CN105087767A - Method for detecting mitochondrial genomes and primer - Google Patents
Method for detecting mitochondrial genomes and primer Download PDFInfo
- Publication number
- CN105087767A CN105087767A CN201410482243.3A CN201410482243A CN105087767A CN 105087767 A CN105087767 A CN 105087767A CN 201410482243 A CN201410482243 A CN 201410482243A CN 105087767 A CN105087767 A CN 105087767A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- dna
- sample
- hair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a method for detecting mitochondrial genomes and a primer. A primer group for forensically medically identifying examined materials comprises four primer pairs. The four primer pairs respectively include a primer pair 1, a primer pair 2, a primer pair 3 and a primer pair 4, the primer pair 1 comprises an Mit1F primer and an Mit1R primer, the primer pair 2 comprises an Mit2F primer and an Mit2R primer, the primer pair 3 comprises an Mit3F primer and an Mit3R primer, and the primer pair 4 comprises an Mit4F primer and an Mit4R primer. The method and the primer have the advantages that full-length sequences of mitochondrial DNA (deoxyribonucleic acid) of samples with few genomes can be detected by the aid of the method, and accordingly important detection technologies can be provided for detecting trace examined materials in forensic medicine.
Description
Technical field
The present invention relates to biological technical field, particularly relate to Mitochondrial Genome Overview detection method and primer.
Background technology
Along with the fast development of science and technology, the effect of DNA inspection technology in forensic science is more and more important.1985, Britain geneticist professor A.J.Jeffreys applied the rape case criminal that DNA fingerprint inspection helps to have assert somewhere, has tracked down this case, has opened the application of DNA inspection technology at medical law fields, greatly promoted medicolegal development.From then on, DNA inspection technology is widely applied in forensic science, qualification, the identification of corpse source, paternity test, the sex identification of residue evidence as on-the-spot in homicide case, sets up all many-sides such as criminal's genetic fingerprint storehouse.
In order to provide foundation accurately and reliably to case investigation, often need the qualification carrying out tissue material evidence.But when the human body soft tissue left over for scene is seriously damaged, severely degrade occurs core DNA, cannot meet material evidence qualification requirement, this just needs to carry out mitochondrial DNA analysis.Mitochondrial DNA is extensively present in the various tissue of human body, comprises hair, in the keratinized tissues such as nail, has short compared with core DNA fragmentation, the features such as copy number is many, and mutation rate is high, matrilinear inheritance.To the hair that scene is left over, nail, bone, teeth etc. carry out mitochondrial DNA analysis, and for legal medical expert's individual recognition and relationship identification, make in medical jurisprudence outmoded, degraded, the qualification of micro-sample is solved, and can provide more clue and strong scientific basis to cracking of cases.Raping and murder case scene, leaving over more material evidence is exactly bloodstain, hair, nail etc.; At missing unknown corpse for many years, cut to pieces in case and major disaster, corpse is decompose to bony skeleton usually, core DNA extraction difficulty.
Human mtdna (mitochondrialDNA, mtDNA) is uniquely distributed in extranuclear DNA, has self-replacation, the function of transcribing and encoding.1981, the Anderson of Cambridge University etc. disclosed the full length sequence of Mitochondrial Genome Overview, and this sequence is called as Anderson sequence or Cambridge sequence.MtDNA total length is made up of 16596bp, in double-strand closed hoop, is divided into coding region and control region.Control region is made up of 1022bp, wherein D-loop district (displacementloopregionD ring district) comprises three hypervariable regions, the Gao Bian 1 district (hypervariableregion I of 16024-16365bp respectively, HV I), the Gao Bian 2 district (hypervariableregion II of 73-340bp, HV II) and Gao Bian 3 district (hypervariableregion III, HV III) of 438-574bp.The polymorphism of these three variable regions shows the difference of altitude opposite sex between individuality, has great importance to medical jurisprudence individual recognition and relationship qualification.
The sensing range of the Mitochondrial DNA of current jus gentium medical circle mainly concentrates on hypervariable region, and Alves-SilvaJ etc. and YaoYG etc. report the sequence variations in HV I and HV II region.But because plastosome has heterogeneity, obviously there is bulk information, have a very important role to individual identity identification in large 15 times of relation control district, coding region.The DNA detection technology of forensic qualification has a lot, as DNA fingerprint technology, restriction fragment length polymorphism (RFLR), single strand conformation polymorphism (SingleStrandConformationalPolymorphism, SSCP), hybridization technique etc., but all there is shortcomings, some poor specificity, sensitivity is low, and some accuracy are low, and what have is high to the requirement of sample.Permitted to pass superfine, apply substance assistant laser desorpted ionized ionization time of flight (matrixassistedlasterdesorptionionizationtimeofflightmass spectrometry, MALDI-TOFMS) examination is carried out to HVI region gene mutation frequency, this method can not obtain the sequence information of Mitochondrial DNA.Zhang Mao's thunder etc. discloses the Mitochondrial DNA detection method of mouth desquamated cells, the sample containing core DNA of detection, and in forensic identification, hair, this kind of keratinized tissue of nail sample is more common, and core DNA is few even degradable, may not be suitable for the detection of this kind of sample by this method.。
Current medical law fields does not also have can the method for detection line plastochondria full length sequence of widespread use, therefore, how detecting the Mitochondrial DNA full length sequence of this kind of micro-sample special sample in forensic identification, make it be applied to forensic science fast, is a problem demanding prompt solution.
Summary of the invention
The present invention's object is to provide a kind of primer sets for the Mitochondrial Genome Overview that increases.
Primer sets for the Mitochondrial Genome Overview that increases provided by the invention, comprises 4 primer pairs;
The primer pair 4 that described 4 primer pairs are respectively the primer pair 1 be made up of Mit1F primer and Mit1R primer, the primer pair 2 be made up of Mit2F primer and Mit2R primer, the primer pair 3 be made up of Mit3F primer and Mit3R primer and are made up of Mit4F primer and Mit4R primer;
The nucleotides sequence of described Mit1F primer is classified as sequence 1 in sequence table;
The nucleotides sequence of described Mit1R primer is classified as sequence 2 in sequence table;
The nucleotides sequence of described Mit2F primer is classified as sequence 3 in sequence table;
The nucleotides sequence of described Mit2R primer is classified as sequence 4 in sequence table;
The nucleotides sequence of described Mit3F primer is classified as sequence 5 in sequence table;
The nucleotides sequence of described Mit3R primer is classified as sequence 6 in sequence table;
The nucleotides sequence of described Mit4F primer is classified as sequence 7 in sequence table;
The nucleotides sequence of described Mit4R primer is classified as sequence 8 in sequence table.
In above-mentioned primer sets, be made up of above-mentioned 4 primer pairs.
Wherein, pcr amplification is carried out respectively with every pair of primers.
Another object of the present invention is to provide a kind of PCR reagent for the Mitochondrial Genome Overview that increases.
PCR reagent provided by the invention, comprises the PCR reagent 1 containing above-mentioned primer pair 1, the PCR reagent 2 containing above-mentioned primer pair 2, the PCR reagent 3 containing above-mentioned primer pair 3 and the PCR reagent 4 containing above-mentioned primer pair 4.
Above-mentioned PCR reagent, is made up of the PCR reagent 1 containing above-mentioned primer pair 1, the PCR reagent 2 containing above-mentioned primer pair 2, the PCR reagent 3 containing above-mentioned primer pair 3 and the PCR reagent 4 containing above-mentioned primer pair 4.
In above-mentioned PCR reagent, the working fluid concentration of every bar primer in the PCR reagent of its correspondence in primer pair is 10 μMs.
Each PCR reagent comprises 10 × LAPCRbuffer II, dNTPMixture, corresponding primer pair, LATaq and water.
Also be the scope of protection of the invention containing above-mentioned primer or containing the test kit of above-mentioned PCR reagent.
Above-mentioned primer, the application of above-mentioned PCR reagent in the product for the preparation of forensic identification sample are also the scope of protection of the invention;
Or above-mentioned primer, above-mentioned PCR reagent are also being the scope of protection of the invention for the preparation of the application in the Mitochondrial Genome Overview sequencing products of forensic identification sample;
Or above-mentioned primer, the application of above-mentioned PCR reagent in the product checked order for the preparation of Mitochondrial Genome Overview are also the scope of protection of the invention;
Or above-mentioned primer, above-mentioned PCR reagent Mitochondrial Genome Overview amplification in application be also the scope of protection of the invention;
Or above-mentioned primer, above-mentioned PCR reagent Mitochondrial Genome Overview order-checking in application be also the scope of protection of the invention;
Or above-mentioned primer, above-mentioned PCR reagent are also being the scope of protection of the invention for the preparation of the application in forensic identification individual identity identification product.
In above-mentioned application, described sample is keratinized tissue or bone or tooth or blood cake or mouth desquamated cells.
In above-mentioned application, described keratinized tissue is without hair follicle hair or nail.
In above-mentioned application, the sample size of described sample is as follows:
The described quantity without hair follicle hair is no less than 1, total length is not less than 5cm; The quantity be specially without hair follicle hair is 1, length is 5-10cm;
Or the surface-area of described nail is not less than 0.2cm
2; The surface-area being specially nail is 0.2-0.5cm
2;
Or the diameter of described blood cake is not less than 1cm, the diameter being specially blood cake is 1-5cm.
In above-mentioned application, described product is test kit.
3rd object of the present invention is to provide the amplification method of a kind of Mitochondrial Genome Overview DNA, carries out pcr amplification with above-mentioned 4 primer pairs to Mitochondrial Genome Overview DNA.
4th object of the present invention is to provide a kind of Mitochondrial Genome Overview DNA sequencing method.
Method provided by the invention, comprises the steps:
1) with above-mentioned 4 primer pairs, pcr amplification is carried out to Mitochondrial Genome Overview DNA respectively, obtain 4 kinds of pcr amplification products;
2) with described 4 kinds of pcr amplification products build wait check order Mitochondrial DNA library;
3) wait Mitochondrial DNA library of checking order described in order-checking, obtain Mitochondrial Genome Overview DNA sequence dna.
In aforesaid method, described sample is keratinized tissue or bone or blood cake or mouth desquamated cells or tooth.
In aforesaid method, described keratinized tissue is without hair follicle hair or nail.
In aforesaid method, the sample size of described sample is as follows:
The described quantity without hair follicle hair is no less than 1, total length is not less than 5cm; The quantity be specially without hair follicle hair is 1, length is 5-10cm;
Or the surface-area of described nail is not less than 0.2cm
2; The surface-area being specially nail is 0.2-0.5cm
2;
Or the diameter of described blood cake is not less than 1cm, the diameter being specially blood cake is 1-5cm.
Step 2) in, described structure comprises the steps:
A, mix described 4 kinds of pcr amplification products, obtain hybrid dna fragment;
B, interrupt described hybrid dna, DNA fragmentation after obtaining rupturing;
C, by DNA fragmentation after described fracture successively through end reparation, jointing, Piece Selection, choose 460-480bpDNA fragment form wait check order Mitochondrial DNA library.
In step B, after described fracture, DNA fragmentation is 200-500bp.
In aforesaid method, step 3) order-checking is as the criterion with 2100 detected results, application IonPGM sequenator is treated order-checking Mitochondrial DNA library according to PGMindexSE400 program and is checked order, and obtains plastosome full length sequence.
Experiment of the present invention proves, the present invention by designing 4 pairs of primers for Mitochondrial Genome Overview, and increases, builds storehouse, order-checking, finally obtains the plastosome full length sequence of sample, obtains mtDNA sequence information more accurately; In addition, the present invention adopts advanced s-generation high throughput sequencing technologies to detect, and once can detect nearly thousands of samples; The more important thing is that the present invention detects sample is the sample that forensic science common extraction genome amount is few: hair, nail etc., sample size is trace, as 1 is about 5cm band hair follicle or the hair not with hair follicle, one is about 1cm, the nail of wide about 0.2cm, the blood cake of 1 piece of diameter 1cm size, adopts method of the present invention can detect the full length sequence of the Mitochondrial DNA of trace sample, for the detection of sample micro-in medical jurisprudence provides important detection technique.
Accompanying drawing explanation
Fig. 1 is 4 pairs of primers with 1 μ LDNA for the electrophoresis detection result of template amplification not with hair follicle hair (hair shaft) and nail Mitochondrial DNA
Fig. 2 is 4 pairs of primers with 2 μ LDNA for the electrophoresis detection result of template amplification not with hair follicle hair (hair shaft) and nail Mitochondrial DNA
Fig. 3 is 4 pairs of primers with 3 μ LDNA for the electrophoresis detection result of template amplification not with hair follicle hair (hair shaft) and nail Mitochondrial DNA
Fig. 4 is 4 pairs of primers with 4 μ LDNA for the electrophoresis detection result of template amplification not with hair follicle hair (hair shaft) and nail Mitochondrial DNA
Fig. 5 is the 2100 detected peaks figure not with hair follicle hair line mitochondrial DNA
Fig. 6 is 2100 detected peaks figure of nail Mitochondrial DNA
Fig. 7 is 2 pairs of primer amplification Mitochondrial DNA electrophoresis detection results
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Embodiment 1, based on two generations order-checking detect be not with hair follicle hair Mitochondrial Genome Overview
One, extracting genome DNA
The hair (being only keratinized tissue, i.e. hair shaft) not with hair follicle being about 5cm with 1 is for example.
Configuration dithiothreitol (DTT) (DTT) extracting solution: 1gDTT is dissolved in 6.66mL ultrapure water.Packing after abundant dissolving ,-20 DEG C save backup.With
dNAInvestigator test kit and dithiothreitol (DTT) (DTT) extracting solution extract the genomic dna in hair sample, and details are as follows:
The digestion of hair sample: add 300 μ LBufferATL, 20 μ L Proteinase Ks and 20 μ LDTT, vortex oscillation mixes 10 seconds, is then placed in constant-temperature mixer, and 56 DEG C with 900rpm jolting 1 hour.
Final dissolving 30 μ LDNA sample, carry out concentration determination with Qubit2.0, hair sample concentration is 4.34ng/ μ L, and-20 DEG C save backup.
Prepared by the sample that two, checks order
1, the primer of design amplification Mitochondrial Genome Overview DNA
According to Anderson sequence (Genebankaccession:M63933), upgrade on August 25th, 2006 and submit to
According to mentioned above principle, design four pairs of primers for plastosome total length, primer sequence is as follows:
The primer pair in amplification Mitochondrial DNA 15572-2838bp region:
Mit1F:TTCGCCTACACAATTCTCCG (sequence 1)
Mit1R:TAGCATGTACTGCTCGGAGGT (sequence 2)
The primer pair in amplification Mitochondrial DNA 2797-7649bp region:
Mit2F:GTCCTAAACTACCAAACCTGC (sequence 3)
Mit2R:ATGAGGGCGTGATCATGAAAGGT (sequence 4)
The primer pair in amplification Mitochondrial DNA 7259-12111bp region:
Mit3F:GCATACACCACATGAAACATC (sequence 5)
Mit3R:AAACCCGGTAATGATGTCGG (sequence 6)
The primer pair in amplification Mitochondrial DNA 11711-82bp region:
Mit4F:GCCCACGGGCTTACATC (sequence 7)
Mit4R:TCCAGCGTCTCGCAATGCTAT (sequence 8)
2, increase Mitochondrial Genome Overview DNA
The genomic dna prepared with above-mentioned steps one, for template, is as the criterion with the concentration that Qubit detects, and carries out pcr amplification respectively, obtain 4 sections of pcr amplified fragments Mit1, Mit2, Mit3 and Mit4 with 4 pairs of primers of above-mentioned 1 synthesis.
When template DNA is 1 μ L, the reaction system that above-mentioned pcr amplification adopts is as shown in table 1:
Table 1 is pcr amplification reaction system
The concentration of each component in above-mentioned table is working fluid concentration.
When template DNA is 2 μ L, the reaction system that above-mentioned pcr amplification adopts is as shown in table 2:
Table 2 is pcr amplification reaction system
| PCR reagent | V/ reacts |
| H 2O (HPLC level) | 32.6μL |
| 10×LA PCR bufferⅡ | 5μL |
| dNTP Mixture(2.5μM) | 8μL |
| PCR primer F (10 μMs) | 1μL |
| PCR primer R (10 μMs) | 1μL |
| LA Taq(5U/μL) | 0.4μL |
| Masterplate DNA (5ng/ μ L) | 2μL |
| Cumulative volume | 50μL |
When template DNA is 3 μ L, the reaction system that above-mentioned pcr amplification adopts is as shown in table 3:
Table 3 is pcr amplification reaction system
| PCR reagent | V/ reacts |
| H 2O (HPLC level) | 31.6μL |
| 10×LA PCR bufferⅡ | 5μL |
| dNTP Mixture(2.5μM) | 8μL |
| PCR primer F (10 μMs) | 1μL |
| PCR primer R (10 μMs) | 1μL |
| LA Taq(5U/μL) | 0.4μL |
| Masterplate DNA (5ng/ μ L) | 3μL |
| Cumulative volume | 50μL |
When template DNA is 4 μ L, the reaction system that above-mentioned pcr amplification adopts is as shown in table 4:
Table 4 is pcr amplification reaction system
| PCR reagent | V/ reacts |
| H 2O (HPLC level) | 30.6μL |
| 10×LA PCR bufferⅡ | 5μL |
| dNTP Mixture(2.5μM) | 8μL |
| PCR primer F (10 μMs) | 1μL |
| PCR primer R (10 μMs) | 1μL |
| LA Taq(5U/μL) | 0.4μL |
| Masterplate DNA (5ng/ μ L) | 4μL |
| Cumulative volume | 50μL |
The response procedures of above-mentioned pcr amplification is as follows:
The above-mentioned pcr amplification product of electrophoresis detection, as Figure 1-4, Marker fragment is followed successively by result from top to bottom: 1000bp, 1500bp, 2000bp, 3000bp, 4000bp, 5000bp, 6000bp, 8000bp, 10000bp,
Fig. 1 is 1 μ L template amplification result, and the size of Mit2PCR amplified production is that 4852bp, Mit1, Mit3, Mit4 are without obvious object band.
Fig. 2 is 2 μ L template amplification results, and the size of Mit1, Mit2, Mit3, Mit4 is respectively: 3855bp, 4852bp, 4852bp and 4961bp.
Fig. 3 is 3 μ L template amplification results, and the size of Mit1, Mit2, Mit3, Mit4 is respectively: 3855bp, 4852bp, 4852bp and 4961bp.
Fig. 4 is 4 μ L template amplification results, and the size of Mit1, Mit2, Mit3, Mit4 is respectively: 3855bp, 4852bp, 4852bp and 4961bp.
As can be seen from the figure, when template is 1 μ L, all there is not obvious object band in 4 sections of products, when template is respectively 2 μ L, 3 μ L, during 4 μ L, 4 sections of products can amplify obvious object band, and the amount of product progressively increases, therefore 2 μ L templates just can obtain the object fragment minimum amount of needs, and meet subsequent experimental needs.
Above-mentioned 4 primer pairs and the PCR reagent containing each primer pair can as the components of test kit.
3, Mitochondrial DNA library construction
1) sample interrupts
1. by 4 PCR primer Mit1, Mit2, Mit3, Mit4 QIAGEN Purification Kit, detect production concentration with Qubit2.0, each sample gets the mass mixings such as 250ng in an EP pipe, obtain mixing PCR primer,, add TEbuffer, make final volume be 80 μ L;
2. be that the DNA sample of 80 μ L proceeds to and to interrupt in pipe in (PartNumber:520052) by final volume, be placed on the specific position interrupting pipe support (rack), pin instrument the green button (DOOR) to open the door, interrupting pipe support or flat board is placed on frame, note in the right direction! Click " Configure ", according to the form below 5 parameters.
Table 5 is for interrupting parameter
Interrupt the fragment for 200-500bp.
3. by the slow sucking-off of sample after interrupting, proceed to 1.5mL and do not carry out purifying with AmpureBeadsXP magnetic bead in collophore, after purifying terminates, if do not carry out subsequent experimental, sample is stored in-20 DEG C for subsequent use, obtain interrupting rear Mitochondrial DNA.
2) library construction
Interrupt rear Mitochondrial DNA successively through end reparation, jointing, Piece Selection by above-mentioned, obtain Mitochondrial DNA library, specific as follows:
1. 5 ' end reparation: repair reaction system by system as shown in table 6 below preparation end, fully centrifugal after mixing.
Table 6 is end reparation system
| Reagent | Volume (μ L) |
| DNA interrupts product | 80 |
| Seedless sour water | 78 |
| 5 × end repairs reaction buffer | 40 |
| End repairs reaction enzymes | 2 |
| Cumulative volume | 200 |
Incubated at room 20min.By the AmpureBeadsXP magnetic beads for purifying reaction product of 1.8 times, 25 μ LTE back dissolvings.
2. jointing: by system as shown in table 7 below preparation ligation system, fully centrifugal after mixing.
Table 7 is ligation system
| Reagent | Volume (μ L) |
| DNA end repairs product | 25 |
| 10 × ligation damping fluid | 10 |
| dNTP | 2 |
| Seedless sour water | 31 |
| P-joint | 10 |
| A-joint-sequence label | 10 |
| DNA ligase | 4 |
| Breach repair polymerase | 8 |
| Cumulative volume | 100 |
Be placed in PCR instrument and hatch by following program, 25 DEG C of 15min, 72 DEG C of 5min, 12 DEG C of forever.
Fech connection product, by the AmpureBeadsXP magnetic beads for purifying reaction product of 1.8 times, 25 μ LTE back dissolving products.
3. Piece Selection: the sepharose preparing 2% carries out electrophoresis detection, 100V, electrophoresis 2h, cuts glue and reclaims 460-480bp fragment, uses QIAquickGelExtractionKit to carry out purifying, finally uses 50ulTE back dissolving, obtains waiting Mitochondrial DNA library of checking order.After purifying completes, do not carry out subsequent experimental, product is stored in-20 DEG C of preservations.
Treat order-checking Mitochondrial DNA library application 2100Expert_HighSensitivityDNAAssay quality inspection by above-mentioned, as shown in Figure 5, result is as shown in table 8 for detected peaks figure:
Table 8 is for treating order-checking Mitochondrial DNA library fragments result
The above results meets the requirement of machine Library Quality, and all the other library Quality Controls require the requirement that need reach with machine library on PGM.
4, upper machine order-checking
Be as the criterion with 2100 detected results, application IonPGM sequenator checks order according to PGMindexSE400 program, and obtain plastosome full length sequence, concrete operations flow process refers to IonPGM specification sheets.
5, data analysis
With Anderson standard sequence as Mitochondrial Genome Overview reference sequences, sequencing result and reference sequences are compared, and obtaining comparison rate is 99.57%, and coverage is 100%, proves to record plastosome full length sequence.
Carry out plastosome full length sequence polymorphism analysis, make a concrete analysis of the results detailed in following table 9.
Table 9 is plastosome full length sequence polymorphism analysis
Can find out, with method of the present invention can based on two generations sequencing technologies detect micro-example, as the Mitochondrial Genome Overview DNA of the hair not with hair follicle.
Embodiment 2, based on two generations sequencing technologies detect the Mitochondrial Genome Overview of nail
One, extracting genome DNA: the method adopting embodiment 1, extracts 1 and is about 1cm, the genomic dna of the nail of wide about 0.2cm;
Configuration dithiothreitol (DTT) (DTT) extracting solution: 1gDTT is dissolved in 6.66mL ultrapure water.Packing after abundant dissolving ,-20 DEG C save backup.With
dNAInvestigator test kit and dithiothreitol (DTT) (DTT) extracting solution extract the genomic dna in nail samples, and details are as follows:
The digestion of nail samples: add 300 μ LBufferATL, 20 μ L Proteinase Ks and 20 μ LDTT, vortex oscillation mixes 10 seconds, is then placed in constant-temperature mixer, and 56 DEG C with 900rpm jolting 2.5 hours.
Nail samples concentration is 8.16ng/ μ L, and-20 DEG C save backup.
Prepared by the sample that two, checks order
1, the primer of design amplification Mitochondrial Genome Overview DNA: identical with embodiment 1;
2, increase Mitochondrial Genome Overview DNA:
Adopt the method for twos' of embodiment 12, respectively with the genomic dna of 1 μ L, 2 μ L, 3 μ L and 4 μ L nails for template, increase with Mit1, Mit2, Mit3, Mit4 primer pair respectively.
Result as Figure 1-4, Fig. 1-4 is respectively 1 μ L, 2 μ L, 3 μ L and the product of 4 μ L templates under 4 pairs of primer amplifications, and Marker fragment is followed successively by from top to bottom: 1000bp, 1500bp, 2000bp, 3000bp, 4000bp, 5000bp, 6000bp, 8000bp, 10000bp, the size of 4 couples of primer extension products Mit1, Mit2, Mit3, Mit4 is respectively: 3855bp, 4852bp, 4852bp and 4961bp.As can be seen from the figure, in Fig. 1 when template is 1 μ L, although object band all appears in 4 sections of products, band is very weak, particularly Mit2 product can not meet subsequent experimental requirement, when template is respectively 2 μ L, 3 μ L, during 4 μ L, 4 sections of products can amplify obvious object band, and the amount of product progressively increases, therefore 2 μ L templates just can obtain the object fragment of needs, and meet subsequent experimental needs.
3, Mitochondrial DNA library construction: identical with embodiment 1;
Application 2100Expert_HighSensitivityDNAAssay treats sequencing library and carries out quality inspection, and as shown in Figure 6, result is as shown in table 10 for detected peaks figure:
Table 10 is for treating order-checking Mitochondrial DNA library fragments result
| Fragment length (bp) | Mass concentration (pg/ μ L) | Volumetric molar concentration (pM) |
| 476 | 2307.41 | 7351.6 |
The above results meets the requirement of machine Library Quality, and all the other library Quality Controls require the requirement that need reach with machine library on PGM.
4, upper machine order-checking: identical with embodiment 1;
5, data analysis
With Anderson as Mitochondrial Genome Overview reference sequences, sequencing result and reference sequences are compared, and obtaining comparison rate is 99.14%, and coverage is 100%, proves to record plastosome full length sequence.
Carry out plastosome full length sequence polymorphism analysis, make a concrete analysis of the results detailed in following table 11.
Table 11 is plastosome full length sequence polymorphism analysis
Can find out, with method of the present invention can based on two generations sequencing technologies detect micro-example, as the Mitochondrial Genome Overview DNA of nail.
Therefore infer, method of the present invention may be used for the few sample of genome quantity, comprises without hair follicle hair, nail, bone, blood cake, mouth desquamated cells etc.
Comparative example 1, by the Mitochondrial Genome Overview that checks order after 2 pairs of primer amplifications
One, extracting genome DNA
1 of embodiment 11 of being about in the genomic dna not with hair follicle hair of 5cm and embodiment 2 is adopted to be about the genomic dna of nail of 1cm, wide about 0.2cm;
Being about 5cm with 1 is with hair follicle hair for contrast, adopts the method for embodiment 1 to extract its genomic dna.
Prepared by the sample that two, checks order
1, the primer of design amplification Mitochondrial Genome Overview DNA
Synthesize two pairs of primers for the primer sequence in plastosome total length application reference document, primer sequence is as follows:
Mit5F:TCTATCACCCTATTAACCACTCACGGGAGCT (sequence 9)
Mit5R:GATACAGTTCACTTTAGCTACCCCCAAGTGTT (sequence 10)
Mit6F:TGAGGCCAAATATCATTCTGAGGGGC (sequence 11)
Mit6R:TTTCATCATGCGGAGATGTTGGATGG (sequence 12)
2, increase Mitochondrial Genome Overview DNA:
Be not with hair follicle hair genomic dna for template with 2ul, be that primer carries out pcr amplification with above-mentioned Mit5F/Mit5R and Mit6F/Mit6R respectively, be not with hair follicle hair line mitochondrial DNA PCR primer Mit5 and Mit6;
With 2ul nail genomic dna for template, be that primer carries out pcr amplification with above-mentioned Mit5F/Mit5R and Mit6F/Mit6R respectively, obtain nail Mitochondrial DNA PCR primer Mit5 and Mit6.
Be with hair follicle hair genomic dna for template with 2ul, be that primer carries out pcr amplification with above-mentioned Mit5F/Mit5R and Mit6F/Mit6R respectively, obtain band hair follicle hair line mitochondrial DNA PCR primer Mit5 and Mit6.
Above-mentioned PCR primer electrophoresis, as shown in Figure 7, Marker fragment is followed successively by result from top to bottom: 310bp, 603bp, 872bp, 1078bp, 1353bp, 2027bp, 2322bp, 4361bp, 6557bp, 9416bp, 23130bp, the size of the PCR primer Mit5 of hair follicle hair is 16000bp, and the PCR primer Mit6 size of hair follicle hair is 16000bp; And be not with hair follicle hair and nail all without object fragment amplification.
Illustrate that hair not with hair follicle and nail two pairs of primer amplifications cannot obtain plastosome full length sequence, more uselessly say to have checked order in the storehouse of building in later stage.
Claims (10)
1., for a primer sets for the Mitochondrial Genome Overview that increases, comprise 4 primer pairs;
The primer pair 4 that described 4 primer pairs are respectively the primer pair 1 be made up of Mit1F primer and Mit1R primer, the primer pair 2 be made up of Mit2F primer and Mit2R primer, the primer pair 3 be made up of Mit3F primer and Mit3R primer and are made up of Mit4F primer and Mit4R primer;
The nucleotides sequence of described Mit1F primer is classified as sequence 1 in sequence table;
The nucleotides sequence of described Mit1R primer is classified as sequence 2 in sequence table;
The nucleotides sequence of described Mit2F primer is classified as sequence 3 in sequence table;
The nucleotides sequence of described Mit2R primer is classified as sequence 4 in sequence table;
The nucleotides sequence of described Mit3F primer is classified as sequence 5 in sequence table;
The nucleotides sequence of described Mit3R primer is classified as sequence 6 in sequence table;
The nucleotides sequence of described Mit4F primer is classified as sequence 7 in sequence table;
The nucleotides sequence of described Mit4R primer is classified as sequence 8 in sequence table.
2., for a PCR reagent for the Mitochondrial Genome Overview that increases, comprise the PCR reagent 1 containing the described primer pair 1 in claim 1, the PCR reagent 2 containing the described primer pair 2 in claim 1, the PCR reagent 3 containing the described primer pair 3 in claim 1 and the PCR reagent 4 containing the described primer pair 4 in claim 1.
3. containing primer described in claim 1 or the test kit containing PCR reagent described in claim 2.
4. the application of PCR reagent described in primer, claim 2 in the product for the preparation of forensic identification sample described in claim 1;
Or PCR reagent described in primer, claim 2 described in claim 1 is for the preparation of the application in the Mitochondrial Genome Overview sequencing products of forensic identification sample;
Or the application of PCR reagent described in primer, claim 2 in the product checked order for the preparation of Mitochondrial Genome Overview described in claim 1;
Or the application of PCR reagent described in primer, claim 2 described in claim 1 in Mitochondrial Genome Overview amplification;
Or the application of PCR reagent described in primer, claim 2 described in claim 1 in Mitochondrial Genome Overview order-checking;
Or PCR reagent described in primer, claim 2 described in claim 1 is for the preparation of the application in forensic identification individual identity identification product.
5. application according to claim 4, is characterized in that: described sample is for without hair follicle hair or nail or bone or tooth or blood cake or mouth desquamated cells.
6. the application according to claim 4 or 5, is characterized in that: the sample size of described sample is as follows:
The described quantity without hair follicle hair is no less than 1, total length is not less than 5cm; The described quantity without hair follicle hair is specially 1, length is 5-10cm;
Or the surface-area of described nail is not less than 0.2cm
2; The surface-area of described nail is specially 0.2-0.5cm
2;
Or the diameter of described blood cake is not less than 1cm; The diameter of described blood cake is specially 1-5cm.
7. a sample to be tested Mitochondrial Genome Overview DNA cloning method, carries out pcr amplification with described 4 primer pairs in claim 1 to Mitochondrial Genome Overview DNA respectively.
8. a sample to be tested Mitochondrial Genome Overview DNA sequencing method, comprises the steps:
1) with described 4 primer pairs in claim 1, pcr amplification is carried out to Mitochondrial Genome Overview DNA respectively, obtain 4 kinds of pcr amplification products;
2) with described 4 kinds of pcr amplification products build wait check order Mitochondrial DNA library;
3) wait Mitochondrial DNA library of checking order described in order-checking, obtain Mitochondrial Genome Overview DNA sequence dna.
9. the method according to claim 7 or 8, is characterized in that: described sample to be tested is for without hair follicle hair or nail or bone or blood cake or mouth desquamated cells or tooth.
10. the method according to claim 7 or 8 or 9, is characterized in that:
The sample size of described sample to be tested is as follows:
The described quantity without hair follicle hair is no less than 1, total length is not less than 5cm; The described quantity without hair follicle hair is specially 1, length is 5-10cm;
Or the surface-area of described nail is not less than 0.2cm
2; The surface-area of described nail is specially 0.2-0.5cm
2;
Or the diameter of described blood cake is not less than 1cm, the diameter of described blood cake is specially 1-5cm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410482243.3A CN105087767A (en) | 2014-09-19 | 2014-09-19 | Method for detecting mitochondrial genomes and primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410482243.3A CN105087767A (en) | 2014-09-19 | 2014-09-19 | Method for detecting mitochondrial genomes and primer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105087767A true CN105087767A (en) | 2015-11-25 |
Family
ID=54569095
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410482243.3A Pending CN105087767A (en) | 2014-09-19 | 2014-09-19 | Method for detecting mitochondrial genomes and primer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105087767A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017165982A1 (en) | 2016-04-01 | 2017-10-05 | Uti Limited Partnership | Plasma derived cell-free mitochondrial deoxyribonucleic acid |
| WO2017193832A1 (en) * | 2016-05-10 | 2017-11-16 | 广州嘉检医学检测有限公司 | Mitochondrial genomic library based on high-throughput sequencing and method for constructing the library |
| CN107663549A (en) * | 2017-10-18 | 2018-02-06 | 中国科学院昆明植物研究所 | A kind of method of the cytoplasmic male sterile gene prediction based on plant mitochondria genome signature |
| CN108315399A (en) * | 2018-01-19 | 2018-07-24 | 成都新基因格生物科技有限公司 | Chondriogen detection kit and application method |
| CN111172260A (en) * | 2020-03-17 | 2020-05-19 | 安吉康尔（深圳）科技有限公司 | Method and kit for detecting mitochondrial genome in human urine or blood sample |
| CN111621552A (en) * | 2019-06-13 | 2020-09-04 | 中国科学院广州生物医药与健康研究院 | Method and system for detecting mtDNA mutation |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101270390A (en) * | 2008-04-15 | 2008-09-24 | 西安交通大学 | 26-pair PCR primer for mitochondrion sequencing and parting method based on the primer |
| CN103173441A (en) * | 2013-02-05 | 2013-06-26 | 深圳华大基因研究院 | Amplification method, primer, sequencing method and mutation detection method of mitochondria whole genome DNA (Deoxyribonucleic Acid) |
-
2014
- 2014-09-19 CN CN201410482243.3A patent/CN105087767A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101270390A (en) * | 2008-04-15 | 2008-09-24 | 西安交通大学 | 26-pair PCR primer for mitochondrion sequencing and parting method based on the primer |
| CN103173441A (en) * | 2013-02-05 | 2013-06-26 | 深圳华大基因研究院 | Amplification method, primer, sequencing method and mutation detection method of mitochondria whole genome DNA (Deoxyribonucleic Acid) |
Non-Patent Citations (4)
| Title |
|---|
| MARTIN MIKKELSEN,ET AL: "Massively parallel pyrosequencing of the mitochondrial genome with the 454 methodology in forensic genetics", 《FORENSIC SCIENCE INTERNATIONAL: GENETICS》 * |
| RICHARD M. ANDREWS，ET AL: "Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA", 《NATURE GENETICS》 * |
| S.ANDERSON,ET AL: "Sequence and organization of the human mitochondrial genome", 《NATURE》 * |
| 姚永刚等: "人类线粒体DNA变异的检测方法和思路", 《动物学研究》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017165982A1 (en) | 2016-04-01 | 2017-10-05 | Uti Limited Partnership | Plasma derived cell-free mitochondrial deoxyribonucleic acid |
| EP3436606A4 (en) * | 2016-04-01 | 2020-01-15 | UTI Limited Partnership | Plasma derived cell-free mitochondrial deoxyribonucleic acid |
| US11104954B2 (en) | 2016-04-01 | 2021-08-31 | M.A.G.I.C. Clinic Ltd. | Plasma derived cell-free mitochondrial deoxyribonucleic acid |
| WO2017193832A1 (en) * | 2016-05-10 | 2017-11-16 | 广州嘉检医学检测有限公司 | Mitochondrial genomic library based on high-throughput sequencing and method for constructing the library |
| CN107663549A (en) * | 2017-10-18 | 2018-02-06 | 中国科学院昆明植物研究所 | A kind of method of the cytoplasmic male sterile gene prediction based on plant mitochondria genome signature |
| CN108315399A (en) * | 2018-01-19 | 2018-07-24 | 成都新基因格生物科技有限公司 | Chondriogen detection kit and application method |
| CN111621552A (en) * | 2019-06-13 | 2020-09-04 | 中国科学院广州生物医药与健康研究院 | Method and system for detecting mtDNA mutation |
| CN111621552B (en) * | 2019-06-13 | 2022-05-06 | 中国科学院广州生物医药与健康研究院 | Method and system for detecting mtDNA mutation |
| CN111172260A (en) * | 2020-03-17 | 2020-05-19 | 安吉康尔（深圳）科技有限公司 | Method and kit for detecting mitochondrial genome in human urine or blood sample |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105087767A (en) | Method for detecting mitochondrial genomes and primer | |
| US20230181173A1 (en) | Methods, compositions, kits and devices for rapid analysis of biological markers | |
| CN104131008B (en) | DNA labels, PCR primer and its application | |
| Lo | Noninvasive prenatal detection of fetal chromosomal aneuploidies by maternal plasma nucleic acid analysis: a review of the current state of the art | |
| WO2017076299A1 (en) | Multiplex pcr primer, and application | |
| Cumbo et al. | Genomic BCR-ABL1 breakpoint characterization by a multi-strategy approach for “personalized monitoring” of residual disease in chronic myeloid leukemia patients | |
| CN108624700B (en) | Kit for synchronously detecting 124 micro-haplotype loci based on next-generation sequencing technology and special primer pair combination thereof | |
| Pisapia et al. | Next generation sequencing in cytopathology: focus on non-small cell lung cancer | |
| CN104024426B (en) | The method for tracing of testing sample and detection kit in the secondary sequencing technologies of DNA | |
| WO2023284768A1 (en) | Fusion primer direct amplification method-based human mitochondrial whole genome high-throughput sequencing kit | |
| Berger et al. | Evaluating sequence-derived mtDNA length heteroplasmy by amplicon size analysis | |
| CN111676318A (en) | Amplification primer and method for novel coronavirus whole genome | |
| Ulz et al. | Detection of circulating tumor DNA in the blood of cancer patients: an important tool in cancer chemoprevention | |
| CN111893216A (en) | Product for detecting DNA/RNA by nucleic acid mass spectrum and detection method | |
| CN111424119A (en) | High-flux detection primer and kit for SARS-CoV-2 virus | |
| Xu et al. | Population data of mitochondrial DNA HVS-I and HVS-II sequences for 208 Henan Han Chinese | |
| CN109207600A (en) | The method and system of affiliation between identification biological sample | |
| AU2015282387A1 (en) | Compositions for quantitative and/or semi-quantitative mutation detection methods | |
| CN109593836A (en) | A method of methylation capture sequencing is carried out using mirror image probe | |
| CN102978205B (en) | High-throughput sequencing junction applied to marker development and application method thereof | |
| US20210110885A1 (en) | Method of correcting amplification bias in amplicon sequencing | |
| CN116769924A (en) | Detection kit comprising 90 short fragment micro-haplotype sites and application thereof | |
| EP3099812B1 (en) | Method and kit with internal amplification control | |
| US20180245131A1 (en) | Optimized clinical sample sequencing | |
| CN112680794A (en) | Ultramicro nucleic acid sample library building method applied to NGS platform |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151125 |