WO2017176289A1 - Utilisations de lénalidomide et de lymphocytes t car - Google Patents

Utilisations de lénalidomide et de lymphocytes t car Download PDF

Info

Publication number
WO2017176289A1
WO2017176289A1 PCT/US2016/026731 US2016026731W WO2017176289A1 WO 2017176289 A1 WO2017176289 A1 WO 2017176289A1 US 2016026731 W US2016026731 W US 2016026731W WO 2017176289 A1 WO2017176289 A1 WO 2017176289A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
lymphocytes
car
lenalidomide
modified
Prior art date
Application number
PCT/US2016/026731
Other languages
English (en)
Inventor
Atsushi NATSUME
Shunichiro KURAMITSU
Masasuke OHNO
Original Assignee
Celgene Corporation
National University Corporation Nagoya University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Celgene Corporation, National University Corporation Nagoya University filed Critical Celgene Corporation
Priority to PCT/US2016/026731 priority Critical patent/WO2017176289A1/fr
Publication of WO2017176289A1 publication Critical patent/WO2017176289A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/454—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/463—Cellular immunotherapy characterised by recombinant expression
    • A61K39/4631—Chimeric Antigen Receptors [CAR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/463—Cellular immunotherapy characterised by recombinant expression
    • A61K39/4636—Immune checkpoint inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464402—Receptors, cell surface antigens or cell surface determinants
    • A61K39/464403—Receptors for growth factors
    • A61K39/464404—Epidermal growth factor receptors [EGFR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • A61K2239/47—Brain; Nervous system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies

Definitions

  • the disclosure herein relates to the field of immunology therapy, and more specifically, to the use of lenalidomide and modified T lymphocytes for the treatment of diseases and related uses of lenalidomide for modulating T lymphocyte activation and/or proliferation.
  • Glioblastoma multiforme is the most common malignant brain tumor in adults and the median overall survival time is less than 15 months, despite the currently available multimodal therapy (Stupp et al, NEngl J Med 2005; 352: 987-996; and Stupp et al, Lancet Oncol 2009; 10: 459-466).
  • a variety of immunotherapeutic approaches including cancer vaccines and antibody-mediated and cell-based therapies have been tested to treat cancers (Rosenberg, Nature 2001; 411 : 380-384; Johnson et al, Curr Neurol Neurosci Rep 2010; 10: 259-266; and Chung et al, J Immunol Res 2014; 2014: 326545).
  • these therapies have major drawbacks such as major histocompatibility complex restriction, nonspecific killing and technical difficulties for expansion ex vivo (Chung et al, J Immunol Res 2014; 2014: 326545).
  • compositions and methods of treatment that target neoplastic cells, such as cancer cells and tumor cells, including GBM.
  • target neoplastic cells such as cancer cells and tumor cells, including GBM.
  • the disclosure provided herein includes such compositions and methods with related advantages.
  • a subject e.g., a human subject
  • the methods can comprise administering to the subject an effective amount of lenalidomide and modified T lymphocytes expressing a chimeric antigen receptor (CAR) that targets EGFRvIII expressing cells, such as cancer cells or tumor cells.
  • CAR chimeric antigen receptor
  • the administration of lenalidomide improves or enhances the activity of the modified T lymphocytes against the EGFRvIII expressing cells.
  • lymphocytes in some aspects, express a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain.
  • a method of treating a subject having a disease associated with expression of EGFRvIII comprising administering to the subject an effective amount of lenalidomide and modified T lymphocytes expressing a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain.
  • the disease associated with expression of EGFRvIII is a cancer or a tumor.
  • the cancer or tumor can be a metastatic cancer or a metastatic tumor.
  • the cancer or tumor is a primary cancer or a primary tumor.
  • Such a primary cancer or primary tumor can arise from or be located in the brain, the spinal cord, the central nervous system, a lung, a breast, the prostate, an ovary, the colon, the rectum, the bladder, or any combination thereof of the subject.
  • the tumor is a glioma, which can be, but is not limited to, an astrocytoma.
  • the astrocytoma is a glioblastoma multiforme.
  • the disease associated with expression of EGFRvIII is a cancer or tumor selected from anaplastic astrocytoma, giant cell glioblastoma, gliosarcoma, anaplastic oligodendroglioma, anaplastic ependymoma, choroid plexus carcinoma, anaplastic ganglioglioma, pineoblastoma, medulloepithelioma, ependymoblastoma, medulloblastoma, supratentorial primitive neuroectodermal tumor, and atypical teratoid/rhabdoid tumor.
  • the disease associated with expression of EGFRvIII is glioblastoma multiform.
  • the effective amount of lenalidomide administered to the subject is from about 0.01 mg/kg to about 0.50 mg/kg, or from about 0.05 mg/kg to about 0.10 mg/kg, or from about 0.06 mg/kg to about 0.09 mg/kg.
  • the effective amount of lenalidomide is from about 0.10 mg to about 150 mg, or from about 2.5 mg to about 25 mg.
  • the effective amount of lenalidomide is selected from about 2.5 mg, about 5 mg, about 10 mg, about 15 mg, about 20 mg, and about 25 mg.
  • the effective amount of lenalidomide and CAR is an amount sufficient to cause a reduction in the rate of growth of an EGFRvIII-expressing tumor, to cause a cessation in growth of an EGFRvIII-expressing tumor, or to cause a reduction in size of an EGFRvIII-expressing tumor, e.g., over 1, 2, or 3 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 months after said administering.
  • the lenalidomide administered to the subject is administered daily for a predetermined period of time following an initial administration of lenalidomide. Additionally, the lenalidomide and modified T lymphocytes can be administered
  • the modified T lymphocytes are administered before the lenalidomide is administered, following which the lenalidomide is administered 1 day, 2 days, 3 days or more after administration of the modified T
  • lymphocytes are lymphocytes.
  • the likelihood of the subject's relative survival increases by at least 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%.
  • Such methods can comprise contacting the modified T lymphocytes.
  • the modified T lymphocytes used in the disclosed methods express a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain.
  • a method of increasing the release of interferon gamma by modified T lymphocytes comprising contacting the modified T lymphocytes with an effective amount of lenalidomide, wherein the modified T
  • lymphocytes express a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain.
  • the release of interferon gamma is increased by at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% , 20%, 21%, 22%, 23%, 24%, 25%, 30%, 40% or 50%.
  • modified T lymphocytes can comprise contacting the modified T lymphocytes with an effective amount of lenalidomide.
  • the modified T lymphocytes express a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a
  • transmembrane domain and an intracellular signaling domain.
  • a method of enhancing the cytotoxicity of modified T lymphocytes comprising contacting the modified T lymphocytes with an effective amount of lenalidomide, wherein the modified T lymphocytes express a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain.
  • the cytotoxicity of the modified T lymphocytes is increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% (e.g., as determined in a cell killing assay with U87- EGFRvIII cells as targets).
  • the effective amount of lenalidomide is 0.1 ⁇ , 0.2 ⁇ , 0.3 ⁇ , 0.4 ⁇ , 0.5 ⁇ , 0.6 ⁇ , 0.7 ⁇ , 0.8 ⁇ , 0.9 ⁇ , 1.0 ⁇ , 1.1 ⁇ , 1.2 ⁇ , 1.3 ⁇ , 1.4 ⁇ , 1.5 ⁇ , 1.6 ⁇ , 1.7 ⁇ , 1.8 ⁇ , 1.9 ⁇ , 2.0 ⁇ , 2.5 ⁇ , 3.0 ⁇ , 3.5 ⁇ , 4.0 ⁇ , 4.5 ⁇ , or 5.0 ⁇ , lenalidomide if the contacting is in vitro, or 0.01 mg/kg to about 0.50 mg/kg, or about 0.05 mg/kg to about 0.10 mg/kg, or about 0.06 mg/kg to about 0.09 mg/kg if said contacting is in vivo.
  • kits for increasing the proliferation of a population of T lymphocytes can comprise contacting the population of T lymphocytes with an effective amount of lenalidomide.
  • the population of T lymphocytes comprises modified T lymphocytes expressing a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain.
  • proliferation of the T lymphocytes is increased in vitro. In certain other embodiments, proliferation of the T lymphocytes is increased in vivo.
  • a method of increasing the proliferation of a population of T lymphocytes comprising contacting the population of T lymphocytes with an effective amount of lenalidomide, wherein the population of T lymphocytes comprise modified T lymphocytes expressing a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain.
  • modified T lymphocytes are methods of enhancing immune synapse formation of modified T lymphocytes to cancer cells or tumor cells.
  • Such methods can comprise contacting the modified T lymphocytes and the cancer cells or tumor cells with an effective amount of lenalidomide, wherein the cancer cells or tumor cells express EGFRvIII.
  • the modified T lymphocytes express a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain.
  • a method of enhancing immune synapse formation of modified T lymphocytes to cancer cells or tumor cells comprising contacting the modified T lymphocytes and the cancer cells or tumor cells with an effective amount of lenalidomide, wherein the cancer cells or tumor cells express EGFRvIII, and wherein the modified T lymphocytes express a CAR, wherein the CAR comprises an anti- EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain.
  • the cancer cells or tumor cells expressing EGFRvIII are metastatic cancer cells or metastatic tumor cells.
  • the cancer cells or tumor cells are primary cancer cells or primary tumor cells.
  • Such primary cancer cells or primary tumor cells can arise from or can be located in the brain, the spinal cord, the central nervous system, a lung, a breast, the prostate, an ovary, the colon, the rectum, the bladder, or any combination thereof.
  • the tumor cells are glioma brain tumor cells, which can be, but is not limited to, astrocytoma brain tumor cells.
  • the astrocytoma brain tumor cells are glioblastoma multiforme brain tumor cells.
  • the cancer cells or tumor cells expressing EGFRvIII are selected from anaplastic astrocytoma cells, giant cell glioblastoma cells, gliosarcoma cells, anaplastic oligodendroglioma cells, anaplastic ependymoma cells, choroid plexus carcinoma cells, anaplastic ganglioglioma cells, pineoblastoma cells, medulloepithelioma cells, ependymoblastoma cells, medulloblastoma cells, supratentorial primitive neuroectodermal tumor cells, and atypical teratoid/rhabdoid tumor cells.
  • the CAR-expressing modified T lymphocytes used in the disclosed methods comprise a CAR having an anti-EGFRvIII binding domain, wherein the anti-EGFRvIII binding domain comprises an antibody or antibody fragment that includes an anti-EGFRvIII binding domain.
  • the antibody fragment is a single- chain variable fragment (scFV).
  • the CAR-expressing modified T lymphocytes used in the disclosed methods comprise a CAR having a transmembrane domain, wherein the
  • transmembrane domain comprises a transmembrane domain selected from alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD 16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 and CD154.
  • the transmembrane domain comprises the transmembrane domain of CD8.
  • the anti-EGFRvIII binding domain is joined to the transmembrane domain by a linker, spacer or hinge polypeptide. Such a linker, spacer or hinge polypeptide, in some embodiments, is the hinge region of CD8a chain.
  • the CAR-expressing modified T lymphocytes used in the disclosed methods comprise a CAR having an intracellular domain, wherein the intracellular domain is an intracellular domain of a protein that is expressed on the surface of T
  • the intracellular signaling domain comprises the signaling domain of one or more T lymphocyte costimulatory protein and/or the signaling domain of T-cell receptor zeta chain (CO3Q.
  • T lymphocyte costimulatory protein can be selected from OX40, CD2, CD27, CD28, CD5, CD30, CD40, ICAM-1, LFA-1, ICOS and 4-1BB.
  • the intracellular signaling domain comprises the signaling domain of CD28, 4- 1BB and CD3C.
  • the CAR-expressing modified T lymphocytes used in the disclosed methods comprise a CAR having an anti-EGFRvIII binding domain, a
  • transmembrane domain and an intracellular domain, wherein the anti-EGFRvIII binding domain comprises an scFV, wherein the transmembrane domain comprises the
  • transmembrane domain of CD8 wherein the anti-EGFRvIII binding domain is joined to the transmembrane domain by the hinge region of CD8a chain, and wherein the intracellular domain comprises the signaling domain of CD28, 4-1BB and CD3 ⁇ .
  • FIG. 1A and IB show the results from transduction of lentivirus-mediated 3C10- CAR and an intracellular IFN- ⁇ assay.
  • CAR PBMCs or mock PBMCs (1 ⁇ 10 5 cells) were incubated with 0.5 ⁇ 106 U87-EGFRvIII cells or U87MGs.
  • PBMCs pretreated with lenalidomide and non-treated PBMCs were used.
  • the approximate transduction efficiency of 3C10-CAR was 30-40%.
  • FIG. 1A shows the results for the first experiment
  • FIG. IB shows the results for the second experiment.
  • FIG. 2 shows the results of a calcein assay.
  • PBMCs transduced with 3C10-CAR lysed -50% of the U87-EGFRvIII cells at an E:T ratio of 25: 1 and lysis occurred in an E:T ratio-dependent manner. Mock PBMCs did not demonstrate this killing effect.
  • PBMCs transduced with 3C10-CAR and mock PBMCs were pretreated with 1 ⁇ lenalidomide for 48 h.
  • CD3+ cells were selectively separated from PBMCs using CD3 microbeads to exclude the influence of natural killer (NK) cell activation.
  • the selected CD3+ cells were transduced with viral supernatant to express 3C10-CAR (CD3-selected 3C10-CAR), and then a calcein assay was performed.
  • 3C10-CAR CD3 T cells exerted a similar cytotoxicity to 3C10-CAR PBMCs. Additionally, lenalidomide enhanced the cytotoxicity of the 3C10-CAR CD3 T cells (center).
  • lenalidomide-pretreated 3C10- CAR PBMCs exhibited no killing effect, similar to the results for the other effector cells (i.e., original 3C10-CAR cells and mock PBMCs with or without lenalidomide treatment) (right). *P ⁇ 0.05. Error bars, s.e.m.
  • FIG. 3 shows the schema for the intracranial glioma xenograph mice experiments.
  • FIG. 4 shows exemplary bioluminescence imaging of intracranial glioma xenograph mice. Tumors began to be eradicated from days 7 to 14 in the 3C10-CAR+lenalidomide group, and from days 14 to 21 in the 3C10-CAR group. *Significant difference (P ⁇ 0.05) between the 3C10-CAR+lenalidomide group and the other three groups. Error bars, s.e.m.
  • FIG. 5 shows the survival curve of treated intracranial glioma xenograph mice. Although 50% of the mice treated with 3C10-CAR PBMCs died near day 20, all mice treated with 3C10-CAR+lenalidomide were eventually tumor-free. (**) Represents a significant difference (P ⁇ 0.05) between the 3C10-CAR + and 3C10-CAR " lenalidomide groups, whereas (*) represents a significant difference (P ⁇ 0.05) between the 3C10-CAR " lenalidomide group and the two mock-treated groups.
  • FIG. 6 shows 3C10-CAR T cells migrated to intracranial EGFRvIII-expressing glioblastoma. Seven days after the inoculation of tumor cells, 3C10-CAR PBMCs or mock PBMCs were infused. Simultaneously, lenalidomide or PBS was given for 20 consecutive days. The brain sections were stained with anti -human CD3 antibody. A number of human CD3+ cells were observed in the tumors of 3C 10-CAR-treated mice, but none were seen the tumors of mock-CAR-treated mice. The number of CD3+ cells and DAPI+ cells in three fields was counted. Lenalidomide treatment significantly increased the numbers of migrated CD3+ T cells from those in the tumors without lenalidomide treatment. Scale bars, 200 ⁇ . Error bars, s.e.m.
  • FIG. 7 shows the results of a WST-1 assay.
  • Lenalidomide increased the growth of both types of PBMCs, regardless of CAR transduction, in a dose-dependent manner.
  • FIG. 8 shows immunofluorescence of CD1 la and F-actin in the junction of CAR T cells and tumor cells.
  • FIG. 9 shows F-actin polymerization quantified using a relative recruitment index (RRI).
  • the thickness of the F-actin polymers was significantly higher in the lenalidomide (+) group compared with that in the lenalidomide (-) group. Arrows indicate immune synapses. *P ⁇ 0.05, Error bars, s.e.m.
  • FIG. 10 shows PD1 and CTLA-4 expression analysis by quantitative real-time reverse transcriptase polymerase chain reaction (RT-PCR). Error bars, S.E.M. ns, Not significant.
  • the methods and compositions provided herein are based, in part, on the discovery that lenalidomide can be used in conjunction with modified T lymphocytes that target EGFRvIII expressing cancers or tumors (e.g., GBM) to improve or enhance the activity of the modified T lymphocytes against the EGFRvIII expressing cancers or tumors.
  • the methods provided herein include treating a subject (e.g., a human subject) having a disease associated with expression of EGFRvIII that includes administering lenalidomide and modified T lymphocytes that target EGFRvIII expressing cells.
  • the methods provided herein are further based, in part, on the discovery that lenalidomide can be used to: (i) increase the release of interferon gamma by modified T lymphocytes; (ii) enhance the cytotoxicity of modified T lymphocytes; (iii) increase the proliferation of a population of T lymphocytes; and/or (iv) enhance immune synapse formation of modified T lymphocytes to cancer cells or tumor cells.
  • “approximately” means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the term “about” or “approximately” means within 50%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.05% of a given value or range.
  • administering refers to the act of injecting or otherwise physically delivering a substance as it exists outside the body into a patient, such as by mucosal, intradermal, intravenous, intramuscular delivery and/or any other method of physical delivery described herein or known in the art.
  • administration of the substance typically occurs after the onset of disease or symptoms thereof.
  • an antibody refers to immunoglobulin polypeptide(s) capable of binding to an antigen.
  • An antibody can be a full- length antibody or less than full-length. If an antibody is less than full length (e.g., an antibody fragment), it includes at least one binding site. In some such embodiments, the binding site comprises at least one, and preferably at least two sequences with structure of antibody variable regions.
  • the term "antibody” encompasses any protein having a binding domain that is homologous or largely homologous to an
  • the term "antibody” encompasses polypeptides having a binding domain that shows at least 99% identity with an immunoglobulin-binding domain.
  • the antibody is any protein having a binding domain that shows at least 70%, at least 80%, at least 85%, at least 90% or at least 95% identity with an immunoglobulin-binding domain.
  • Antibody polypeptides in accordance with the present invention may be prepared by any available means, including, for example, isolation from a natural source or antibody library, recombinant production in or with a host system, chemical synthesis, etc., or combinations thereof.
  • an antibody is monoclonal or polyclonal.
  • an antibody may be a member of any immunoglobulin class, including any of the human classes IgG, IgM, IgA, IgD and IgE. In certain embodiments, an antibody is a member of the IgG immunoglobulin class.
  • the term "antibody” refers to any derivative of an antibody that possesses the ability to bind to an antigen of interest. In some embodiments, an antibody is multispecific (e.g., an antibody that binds to at least two different epitopes, antigens or cells). In some embodiments, an antibody is monospecific (e.g., an antibody that binds to one epitope, antigen or cell).
  • an antibody fragment comprises multiple chains that are linked together, for example, by disulfide linkages.
  • an antibody is a human antibody.
  • an antibody is a humanized antibody.
  • humanized antibodies include chimeric immunoglobulins, immunoglobulin chains or antibody fragments that contain minimal sequence from non-human
  • humanized antibodies are human immunoglobulin (recipient antibody) in which residues from a complementary-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • donor antibody a non-human species
  • antibodies for use in the present disclosure bind to EGFRvIII.
  • an "antibody fragment” refers to a portion of a full-length antibody, for example, the antigen binding or variable region of the intact antibody.
  • antibody fragments include, but are not limited to, Fab, Fab', F(ab') 2 , and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules (e.g., single-chain Fv); and multispecific antibodies formed from antibody fragments.
  • Papain digestion of antibodies produces two identical antigen-binding fragments, called "Fab” fragments, each with a single antigen- binding site, and a residual "Fc” fragment, a designation reflecting the ability to crystallize readily.
  • Pepsin treatment yields an F(ab') 2 fragment that has two antigen combining sites and is still capable of cross-linking antigen.
  • An "antigen" is a predetermined target to which an antibody or antibody fragment can selectively bind.
  • An antigen can be a polypeptide, carbohydrate, nucleic acid, lipid, hapten or other naturally occurring or synthetic compound.
  • the target antigen is a polypeptide, including, for example, an EGFRvIII.
  • binding refers to an interaction between molecules to form a complex. Interactions can be, for example, non-covalent interactions including hydrogen bonds, ionic bonds, hydrophobic interactions, and/or van der Waals interactions. A complex can also include the binding of two or more molecules held together by covalent or non-covalent bonds, interactions or forces.
  • the strength of the total non- covalent interactions between a single antigen-binding site on an antibody and a single epitope of a target molecule, such as EGFRvIII, is the affinity of the antibody or functional fragment for that epitope.
  • the ratio of association ⁇ kl) to dissociation ⁇ k-l) of an antibody to a monovalent antigen ⁇ kllk-1) is the association constant ⁇ , which is a measure of affinity.
  • the value of K varies for different complexes of antibody and antigen and depends on both kl and k-l.
  • the association constant K for an antibody provided herein can be determined using any method provided herein or any other method well known to those skilled in the art.
  • the affinity at one binding site does not always reflect the true strength of the interaction between an antibody and an antigen.
  • the avidity of an antibody can be a better measure of its binding capacity than is the affinity of its individual binding sites. For example, high avidity can compensate for low affinity as is sometimes found for pentameric IgM antibodies, which can have a lower affinity than IgG, but the high avidity of IgM, resulting from its multivalence, enables it to bind antigen effectively.
  • cancer refers to any malignant neoplasm characterized by the proliferation of cells that can invade surrounding tissue and/or metastasize to new body sites.
  • Cancer includes, but is not limited to, blood born tumors and solid tumors. Blood born tumors include lymphomas, leukemias and myelomas. Lymphomas and leukemias are malignancies arising among white blood cells.
  • tumor refers to both benign and malignant tumors, which can be classified according to the type of tissue in which they are found. For example, fibromas are neoplasms of fibrous connective tissue, and melanomas are abnormal growths of pigment (melanin) cells.
  • Malignant tumors originating from epithelial tissue e.g., in skin, bronchi, and stomach, are termed carcinomas.
  • Malignancies of epithelial glandular tissue such as are found in the breast, prostate, and colon, are known as adenocarcinomas.
  • Malignant growths of connective tissue e.g., muscle, cartilage, lymph tissue, and bone, are called sarcomas.
  • the CAR comprises: (i) an extracellular domain that binds to an antigen, i.e. an antigen binding domain, such as an antigen on a cell: (ii) a transmembrane domain, and (iii) an intracellular (cytoplasmic) signaling domain that transmits a primary activation signal to an immune cell.
  • the intracellular signaling domain transmits a signal to the T lymphocyte to activate and/or proliferate, and, if the antigen is present on a cell surface, to kill the cell expressing the antigen.
  • T lymphocytes require two signals, a primary activation signal and a costimulatory signal, in order to activate, CARs can also comprise a costimulatory domain such that binding of the antigen to the extracellular domain results in transmission of both a primary activation signal and a costimulatory signal.
  • the intracellular signaling domain further includes one or more signaling domains from at least one
  • the CAR can include an antigen binding domain, a transmembrane domain and an intracellular signaling domain that is from at least one (one, two, three or more) costimulatory proteins and a signaling domain from a protein that is expressed on the surface of T lymphocytes and triggers activation and/or proliferation.
  • the CAR can further include a leader sequence at the N-terminus of the extracellular antigen binding domain, wherein the leader sequence is optionally cleaved from the antigen binding domain (e.g., scFv) during cellular processing and localization of the CAR to the cellular membrane.
  • a "cytotoxic cell” includes CD8 + T cells, natural-killer (NK) cells, and neutrophils, which cells are capable of mediating cytotoxicity responses.
  • cytotoxicity refers to the quality of being toxic to cells. Accordingly, “enhancing cytotoxicity” refers to increasing the quality of being toxic to cells in comparison to control. In the context of the present disclosure, enhancing the cytotoxicity of T
  • lymphocytes can include increasing the ability of the T lymphocytes to recognize and/or kill cells that express EGFRvIII, such as cancer cells or tumor cells.
  • disease disorders
  • condition refers to an abnormal condition of an organism that impairs bodily functions, associated with specific symptoms and signs.
  • the disease may be "associated with expression of EGFRvIII.” Examples include, but are not limited to, a cancer or a tumor. Such a cancer or tumor can be metastatic or primary.
  • a subject amenable to treatment includes a subject presently exhibiting symptoms or diagnosed with the disease, disorder or condition.
  • a "disease associated with EGFRvIII” or an "EGFRvIII-mediated disease” means any disease, disorder or condition in which EGFRvIII, or a mutant thereof, is known or suspected to play a role. This includes, but is not limited to, a disease, disorder or condition associated with cells that express EGFRvIII including, tumor cells (e.g., glioblastoma multiforme or another EGFRvIII-expressing cancer). Accordingly, another embodiment of the present disclosure relates to preventing, treating, stabilizing or lessening the severity or progression of one or more diseases in which EGFRvIII, or a mutant thereof, is known or suspected to play a role.
  • the present disclosure relates to a method of treating a subject having disease associated with EGFRvIII, such as a cancer or a tumor, wherein the method includes administering to a subject lenalidomide in combination with modified T lymphocytes that recognize and kill EGFRvIII expressing cells.
  • an "effective amount” is an amount sufficient to affect a beneficial or desired result.
  • the effective amount e.g., lenalidomide and EGFRvIII- targeted CAR
  • EGFRvIII-expressing tumor to cause a cessation in growth of an EGFRvIII-expressing tumor, or to cause a reduction in size of an EGFRvIII-expressing tumor over a period of time (e.g., 1, 2, or 3 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 months) after administration.
  • An effective amount can be administered in one or more administrations, applications or dosages. Such delivery is dependent on a number of variables including the time period for which the individual dosage unit is to be used, the
  • lenalidomide and modified T lymphocytes for any particular subject depends upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, and diet of the subject, the time of administration, the rate of excretion, the drug combination, and the severity of the particular disease, disorder or condition being treated and form of administration.
  • Treatment dosages generally may be titrated to optimize safety and efficacy. Dosage-effect relationships from in vitro and/or in vivo tests initially can provide useful guidance on the proper doses for administration.
  • the effective amount of lenalidomide, modified T lymphocytes, or compositions thereof is an amount sufficient to: (i) increase the likelihood of a subject's relative survival by at least 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%; (ii) increase the release of interferon gamma by modified T lymphocytes by at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% , 20%, 21%, 22%, 23%, 24%, 25%, 30%, 40% or 50%; and/or (iii) increase the cytotoxicity of modified T lymphocytes by at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, as compared to control.
  • an effective amount of lenalidomide is an amount that, when
  • cytotoxic activity of a T lymphocyte expressing a CAR increases the level of cytotoxic activity of a T lymphocyte expressing a CAR by least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, as compared to the cytotoxic activity of the T lymphocyte in the absence of lenalidomide. Determination of these parameters is well within the skill of the art. These considerations, as well as effective formulations and administration procedures are well known in the art and are described in standard textbooks.
  • EGFRvIII binding domain refers to a polypeptide(s) (e.g., an antibody or antibody fragment) that recognizes and specifically binds to EGFRvIII.
  • polypeptide(s) e.g., an antibody or antibody fragment
  • the EGFRvIII binding domain is a single-chain Fv (scFv).
  • scFv single-chain Fv
  • EGFRvIII refers to a deletion mutant of the epidermal growth factor receptor (EGFR), also known as AEGFR, A801EGFR and de2-7 EGFR, which is described in U.S. Pat. Nos. 6,455,498, 6,127, 126, 5,981,725, 5,814,317, 5,710,010, 5,401,828, and 5,212,290.
  • the EGFRvIII deletion mutant has a deletion of exons 2 to 7 of the EGFR gene, which can be the result of an apparent splice joining of exon 1 to exon 8 or a chromosomal deletion.
  • EGFRvIII is a common truncated receptor found in human tumors, including, but not limited to, non-small-cell lung cancer (NSCLC), high and low grade gliomas, pediatric gliomas, medullablastomas, breast cancer, ovarian cancer and prostate cancer, but is rarely observed in normal tissue.
  • NSCLC non-small-cell lung cancer
  • expression refers to the process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins. If the polynucleotide is from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
  • Glioma is a type of tumor that occurs in the brain and spinal cord. Gliomas begin in the gluey supportive cells (glial cells) that surround nerve cells and help them function. Three types of glial cells can produce tumors, from which gliomas are classified.
  • gliomas include: (i) astrocytomas, including astrocytoma, anaplastic astrocytoma and glioblastoma multiform (GBM); (ii) ependymomas, including anaplastic ependymoma, myxopapillary ependymoma and subependymoma; (iii) oligodendrogliomas, including oligodendroglioma, anaplastic oligodendroglioma and anaplastic oligoastrocytoma. Gliomas are one of the most common types of primary brain tumors.
  • an "immune synapse” or “immunological synapse” refers to any stable, flattened interface between a T lymphocyte or natural killer cell and a target cell that the T lymphocyte or natural killer cell is in the process of recognizing.
  • at the synapse are molecular clusters of T-cell receptors and peptide-loaded major histocompatibility complex molecules on the surface of allophycocyanins that are enriched in F-actin (see, e.g., Dustin, M.L. and Depoil, D., Nat Rev Immunol 2011; 11 : 672).
  • a mature immune synapse forms a specific pattern of receptor segregation, with a central cluster of T- cell receptors surrounded by a ring of integrin family adhesion molecules such as lymphocyte function-associated antigen-1 (see, e.g., Grakoui, A. et al., Science 1999; 285: 221-227).
  • enhancing immune synapse formation refers to increasing the total number synapses formed by a population of T lymphocytes, increasing the number of molecular clusters at a given synapse, or increasing the binding of the molecules present at the synapse.
  • Intracellular signaling domain refers to a polypeptide that transmits a signal to the host cell (e.g., T lymphocyte).
  • Intracellular signaling domains suitable for use in a CAR of the present disclosure includes any desired signaling domain that provides a distinct and detectable signal (e.g., increased production of one or more cytokines by the cell; change in transcription of a target gene; change in activity of a protein; change in cell behavior; cellular proliferation; cellular differentiation; cell survival; or modulation of cellular signaling responses) in response to activation of the CAR (e.g., activated by binding to EGFRvIII).
  • a distinct and detectable signal e.g., increased production of one or more cytokines by the cell; change in transcription of a target gene; change in activity of a protein; change in cell behavior; cellular proliferation; cellular differentiation; cell survival; or modulation of cellular signaling responses
  • the intracellular signaling domain includes at least one (e.g., one, two, three, or more) intracellular domain of a protein that is expressed on the surface of T lymphocytes and triggers activation and/or proliferation of T lymphocytes.
  • the intracellular signaling domain further includes at least one (one, two, three or more) signaling domains from at least one costimulatory protein.
  • chimeric CD28 or 4- IBB can be used with CD3 ⁇ to transmit a signal, or all three can be used together.
  • the term "lenalidomide,” also known in the art as REVLIMTD, refers to 3-(4-amino-l-oxo l,3-dihydro-2H-isoindol-2-yl) piperidine-2,6-dione.
  • Lenalidomide has the following chemical structure:
  • Lenalidomide is an off-white to pale-yellow solid powder. It is soluble in organic solvent/water mixtures, and buffered aqueous solvents. Lenalidomide is more soluble in organic solvents and low pH solutions. Solubility was significantly lower in less acidic buffers, ranging from about 0.4 to 0.5 mg/ml. Lenalidomide has an asymmetric carbon atom and can exist as the optically active forms S(-) and R(+), and is produced as a racemic mixture with a net optical rotation of zero.
  • Lenalidomide is commercially available as REVLIMID in 2.5 mg, 5 mg, 10 mg, 15 mg, 20 mg and 25 mg capsules for oral administration. Each capsule contains lenalidomide as the active ingredient and the following inactive ingredients: lactose anhydrous,
  • microcrystalline cellulose microcrystalline cellulose, croscarmellose sodium, and magnesium stearate.
  • a "linker,” “spacer,” or “hinge” refers to polypeptide that provides structural flexibility and spacing to flanking polypeptide regions.
  • such a polypeptide links an antigen binding domain to a transmembrane domain of a CAR.
  • the linker, spacer or hinge is flexible enough to allow the EGFRvIII binding domain to orient in different directions and to facilitate recognition of EGFRvIII.
  • the linker, spacer or hinge may be of natural occurrence or non-natural occurrence, including, but not limited to, an altered hinge region as described in U.S. Pat. No.
  • a "modified T lymphocyte” refers to a T lymphocyte that has been genetically altered to have a nucleic acid sequence introduced, deleted or mutated in comparison to a naturally occurring T lymphocyte.
  • a nucleic acid sequence encoding a CAR for example, can be introduced to a T lymphocyte.
  • the source of a modified T lymphocyte can be the subject himself/herself or another subject, preferably from a subject from who is immune compatible with the subject who will be receiving the modified T lymphocytes.
  • the term "pharmaceutically acceptable carrier” encompasses any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents.
  • the compositions also can include stabilizers and preservatives.
  • stabilizers and adjuvants see Martin (1975) Remington's Pharm. ScL, 15th Ed. (Mack Publ. Co., Easton).
  • proliferation refers to an increase in number.
  • Relative survival refers to the ratio of the proportion of observed survivors in a cohort of cancer patients to the proportion of expected survivors in a comparable set of cancer free individuals. The formulation is based on the assumption of independent competing causes of death. The relative survival of a disease is calculated by dividing the overall survival after diagnosis by the survival as observed in a similar population that was not diagnosed with that disease. A similar population is composed of individuals with at least age and gender similar to those diagnosed with the disease.
  • responsiveness refers to the degree of effectiveness of the treatment in lessening or decreasing the symptoms of a disease, disorder, or condition being treated.
  • the increase in the effectiveness is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, or at least about 50%.
  • Single-chain Fv or “scFv” antibody fragments comprise the Y H and Y L domains of an antibody, wherein these domains are present in a single polypeptide chain.
  • the Fv polypeptide further comprises a polypeptide linker between the Y H and Y L domains, which enables the scFv to form the desired structure for antigen binding.
  • the terms "subject,” “individual” or “patient” are used interchangeably herein, and refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, rats, rabbits, simians, bovines, ovines, porcines, canines, felines, farm animals, sport animals, pets, equines, and primates, particularly humans.
  • the subject is a female.
  • the subject is a male.
  • the patient is a child.
  • the patient is a patient in need of treating a disease associated with EGFRvIII expression.
  • a subject is a human having a cancer or a tumor.
  • a "T lymphocyte” or “T cell” includes all types of immune cells expressing CD3 including T-helper cells (CD4 + cells), cytotoxic T-cells (CD8 + cells), T-regulatory cells (Treg) and gamma-delta T cells.
  • a "transmembrane domain” refers to a hydrophobic alpha helix polypeptide that spans the cell membrane of the T lymphocyte. The transmembrane domain of the CAR can be interposed between the antigen binding domain and the intracellular signaling domain.
  • the transmembrane domain is interposed between the linker, spacer or hinge polypeptide and the intracellular domain, such that the CAR comprises, in order from the amino terminus (N-terminus) to the carboxyl terminus (C-terminus): an antigen binding domain; a linker, spacer or hinge polypeptide; a transmembrane domain; and an intracellular domain.
  • Any transmembrane domain that provides for insertion of a polypeptide into the cell membrane of a eukaryotic (e.g., mammalian) cell is suitable for use.
  • the transmembrane domain from the most membrane proximal component of the intracellular signaling domain is used.
  • treat contemplate an action that occurs while a subject is suffering from the specified disease, disorder or condition, which reduces the severity or symptoms of the disease, disorder or condition, or retards or slows the progression or symptoms of the disease, disorder or condition.
  • CARs are engineered receptors that graft an arbitrary specificity onto an immune effector cell. These receptors can be used to graft the specificity of a monoclonal antibody onto a T lymphocyte using retroviral vector expression techniques.
  • the most common form of these molecules is fusions of scFv from monoclonal antibodies, fused to CD3-zeta transmembrane and an intracellular signaling domain. Such molecules result in the
  • First- generation CARs can have the intracellular domain from the CD3 ⁇ chain, which is the primary transmitter of signals from endogenous TCRs.
  • Second-generation CARs add intracellular signaling domains from various costimulatory protein receptors (e.g., CD28, 4- 1BB, ICOS) to the cytoplasmic tail of the CAR to provide additional signals to the T lymphocyte. More recent, “third-generation” CARs combine multiple signaling domains, such as CD3C-CD28-4-lBB or CD3C-CD28-OX40, to further augment potency (see, e.g., Zhao, et al, J.
  • a CAR expressed by a modified T lymphocyte which results in the modified T lymphocyte targeting EGFRvIII expressing cells, such as cancer cells or tumor cells.
  • a CAR includes, at a minimum, an antigen binding domain (e.g., anti -EGFRvIII scFv), a transmembrane domain (e.g., transmembrane domain of CD8), and an intracellular signaling domain that provides a primary activation signal to the T lymphocyte (e.g., signaling domain of CD3 ⁇ ).
  • a CAR useful in the disclosed methods can further comprise a costimulatory domain (e.g., signaling domain of CD28 or 4- IBB) such that binding of the antigen to the extracellular domain results in transmission of both a primary activation signal and a costimulatory signal.
  • a costimulatory domain e.g., signaling domain of CD28 or 4- IBB
  • the intracellular signaling domain of the CAR includes a signaling domain from a costimulatory protein in addition to a primary signaling domain.
  • the CAR can include an antigen binding domain, a transmembrane domain and an intracellular signaling domain comprising at least one costimulatory signaling domain and a signaling domain from a protein that is expressed on the surface of T lymphocytes and triggers activation and/or proliferation.
  • the CAR includes an antigen binding domain, a transmembrane domain and an intracellular signaling domain comprising at least two costimulatory signaling domains and a signaling domain from a protein that is expressed on the surface of T lymphocytes and triggers activation and/or proliferation.
  • the CAR includes an antigen binding domain, a transmembrane domain and an intracellular signaling domain comprising at least three costimulatory signaling domains and a signaling domain from a protein that is expressed on the surface of T lymphocytes and triggers activation and/or proliferation.
  • the intracellular signaling domain comprises more than one signaling domain (e.g., a primary signaling domain and two costimulatory signaling domains)
  • the order of the domains from the amino terminus (N- terminus) to the carboxyl terminus (C-terminus) can be in any order.
  • Exemplary orders of the costimulatory and primary signaling domains include from N-terminus to C-terminus: (i) two costimularory domains and the primary signaling domain; (ii) the primary signaling domain and two costimulatory domains; or (iii) one costimulatory domain, one primary signaling domain and one costimulatory domain. It is recognized that additional variations of the signaling domains of a CAR will depend upon the number and/or types of domains present in the intracellular signaling domain, and can be readily determined by a skilled artisan.
  • the CAR includes a linker, spacer or hinge polypeptide (e.g., CD8a chain) that is inserted between the transmembrane domain and the antigen binding domain.
  • a linker, spacer or hinge polypeptide e.g., CD8a chain
  • Such CAR comprises, in order from N-terminus to C-terminus: an antigen binding domain; a linker, spacer or hinge polypeptide; a transmembrane domain; and an intracellular domain.
  • the CAR can further include a leader sequence at the N- terminus of the extracellular antigen binding domain, wherein the leader sequence is optionally cleaved from the antigen binding domain (e.g., scFv) during cellular processing and localization of the CAR to the cellular membrane. Inclusion of such a leader sequence can increase cellular processing of the CAR and localization of the CAR to the cellular membrane of the T lymphocyte.
  • a leader sequence at the N- terminus of the extracellular antigen binding domain, wherein the leader sequence is optionally cleaved from the antigen binding domain (e.g., scFv) during cellular processing and localization of the CAR to the cellular membrane.
  • the CAR-expressing modified T lymphocytes used in the disclosed methods comprise a CAR having an anti-EGFRvIII binding domain, a
  • transmembrane domain and an intracellular domain, wherein the anti-EGFRvIII binding domain comprises an scFV, wherein the transmembrane domain comprises the
  • transmembrane domain of CD8 wherein the anti-EGFRvIII binding domain is joined to the transmembrane domain by the hinge region of CD8a chain, and wherein the intracellular domain comprises the signaling domain of CD28, 4-1BB and CD3 ⁇ .
  • the extracellular domain of the CAR described herein binds to an antigen of interest.
  • the extracellular domain comprises a receptor, or a portion of a receptor, that binds to the antigen (e.g., EGFRvIII).
  • the extracellular domain may be, e.g., a receptor, or a portion of a receptor, that binds to the antigen (e.g., EGFRvIII).
  • the extracellular domain comprises, or is, an antibody or an antibody fragment.
  • the extracellular domain comprises, or is, an scFV.
  • the scFV can comprise, for example, a Y L linked to Y H by a flexible linker, wherein said Y ⁇ and Y H are from an antibody that binds the antigen (e.g., EGFRvIII).
  • a CAR comprising an extracellular domain that recognizes and binds EGFRvIII when expressed by a target cell, such as a cancer or tumor cell.
  • a target cell such as a cancer or tumor cell.
  • an extracellular domain in some embodiments, is an anti-EGFRvIII binding domain that comprises an antibody or antibody fragment, as described herein.
  • the antibody fragment is an scFv.
  • the antibody fragment is an scFv derived from the antibody 3C10 (see, e.g., Takasu et al, J.
  • the antigen to which the extracellular domain of the CAR binds can be EGFRvIII expressed by a cancer cell or tumor cell.
  • the cell may be, e.g., a cell in a solid tumor, or a cell of a blood cancer.
  • the EGFRvIII is expressed on a cancer cell or tumor cell that arises from or is located in the brain, the spinal cord, the central nervous system, a lung, a breast, the prostate, an ovary, the colon, the rectum, the bladder, or any combination thereof.
  • the tumor cells are glioma brain tumor cells.
  • the tumor cell is an astrocytoma brain tumor cell.
  • the tumor cell is a glioblastoma multiforme brain tumor cell.
  • EGFRvIII are anaplastic astrocytoma cells, giant cell glioblastoma cells, gliosarcoma cells, anaplastic oligodendroglioma cells, anaplastic ependymoma cells, choroid plexus carcinoma cells, anaplastic ganglioglioma cells, pineoblastoma cells, medulloepithelioma cells, ependymoblastoma cells, medulloblastoma cells, supratentorial primitive neuroectodermal tumor cells, or atypical teratoid/rhabdoid tumor cells.
  • the cancer cells or tumor cells are anaplastic astrocytoma cells.
  • the cancer cells or tumor cells are giant cell glioblastoma cells. In some embodiments, the cancer cells or tumor cells are gliosarcoma cells. In some embodiments, the cancer cells or tumor cells are anaplastic oligodendroglioma cells. In some embodiments, the cancer cells or tumor cells are anaplastic ependymoma cells. In some embodiments, the cancer cells or tumor cells are choroid plexus carcinoma cells. In some embodiments, the cancer cells or tumor cells are anaplastic ganglioglioma cells. In some embodiments, the cancer cells or tumor cells are pineoblastoma cells. In some embodiments, the cancer cells or tumor cells are
  • the cancer cells or tumor cells are ependymoblastoma cells. In some embodiments, the cancer cells or tumor cells are medulloblastoma cells. In some embodiments, the cancer cells or tumor cells are
  • the cancer cells or tumor cells are atypical teratoid/rhabdoid tumor cells.
  • the cancer cells or tumor cells expressing EGFRvIII are metastatic cancer cells or metastatic tumor cells.
  • the cancer cells or tumor cells are primary cancer cells or primary tumor cells.
  • a CAR comprising a transmembrane domain that is thermodynamically stable in a cell membrane.
  • the transmembrane region can be any transmembrane region that can be incorporated into a functional CAR.
  • the transmembrane domain of the CAR is from an immune system protein that normally transmits a signal (inhibitory signal or activation signal) to the immune cell ⁇ e.g., T lymphocyte).
  • the transmembrane domain is selected from alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 and CD154. Accordingly, in a specific embodiment, the transmembrane domain comprises the transmembrane domain of alpha chain of the T-cell receptor (TCR-a). In a specific embodiment, the transmembrane domain comprises the transmembrane domain of beta chain of the T-cell receptor (TCR- ⁇ ).
  • the transmembrane domain comprises the transmembrane domain of zeta chain of the T-cell receptor ⁇ D3Q. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD28. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD3 epsilon. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD45. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD4. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD5.
  • the transmembrane domain comprises the transmembrane domain of CD8. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD9. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD 16. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD22. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD33. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD37. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD64. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD80. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD86. In a specific embodiment, the
  • transmembrane domain comprises the transmembrane domain of CD 134. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD137. In a specific embodiment, the transmembrane domain comprises the transmembrane domain of CD 154.
  • the transmembrane domain of the polypeptide is from alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 or CD154
  • the transmembrane domain is from a mammalian source, e.g., human, primate, or rodent, e.g., murine.
  • the transmembrane domain does not comprise amino acids from the intracellular domain, extracellular domain, or either intracellular or extracellular domain described herein.
  • the antigen binding domain (e.g., anti-EGFRvIII binding domain) is joined to the transmembrane domain by a linker, spacer or hinge polypeptide.
  • the linker, spacer or hinge may be of natural occurrence or non-natural occurrence, including, but not limited to, an altered hinge region as described in U.S. Pat. No. 5,677,425, a complete hinge region from an antibody of a different class or subclass from that of the CHI domain, or regions from CD8 (e.g., CD8a chain), CD28 or another receptor that provides a similar function in providing flexibility and spacing to flanking regions.
  • a linker, spacer or hinge polypeptide in some embodiments, is the hinge region of CD8a chain.
  • human sequences may be combined with non-human sequences.
  • a CAR comprising human extracellular and intracellular domain amino acid sequences may comprise a transmembrane domain from a non-human species; e.g., may comprise a murine
  • amino acid sequences that constitute the transmembrane domain, linker, spacer or hinge of any of the above proteins, including the nucleic acid sequences that encode the amino acid sequences, are well known in the art. Exemplary amino acid and/or nucleic acid sequences for such a domain and/or nucleic acid sequences that can be used to generate such a domain, which is useful for generating a CAR described herein, can be found in U.S. Patent Application Publication Nos.
  • a CAR comprising an intracellular domain that can direct a T lymphocyte to an antigen, and stimulate the T lymphocyte to kill a cell displaying the antigen.
  • the intracellular signaling domain that transmits a primary activation signal to the T lymphocyte.
  • Such an intracellular signaling domain transmits a signal to the T lymphocyte to activate and/or proliferate, and, if the antigen is present on a cell surface, to kill the cell expressing the antigen.
  • a CAR comprising an intracellular domain of a protein that is expressed on the surface of T lymphocytes and triggers activation or proliferation of T lymphocytes.
  • the intracellular signaling domain comprises the signaling domain of O3 .
  • the intracellular signaling domain comprises a signaling domain from CD2, CD5, CD28, TCR ⁇ chain, FcsRly or ⁇ chains, MB1 (Iga) chain, B29 (3 ⁇ 4 ⁇ ) chain, a CD3 polypeptide ( ⁇ , ⁇ , ⁇ ), a syk family tyrosine kinase (e.g., Syk, ZAP70), or a src family tyrosine kinase (Lck, Fyn, Lyn).
  • the intracellular signaling domain comprises the signaling domain of one or more T lymphocyte costimulatory proteins and/or the signaling domain of O3 .
  • T lymphocyte costimulatory protein can be selected from the costimulatory domains of CD134 (OX40), CD2, CD27, CD28, CD5, CD30, CD40, ICAM-1, LFA-1, ICOS and CD137 (4-1BB), and combinations thereof.
  • the intracellular signaling domain comprises the signaling domain of CD2.
  • the intracellular signaling domain comprises the signaling domain of CD27.
  • the intracellular signaling domain comprises the signaling domain of OX40. In some embodiments, the intracellular signaling domain comprises the signaling domain of CD28. In some embodiments, the intracellular signaling domain comprises the signaling domain of CD5. In some embodiments, the intracellular signaling domain comprises the signaling domain of CD30. In some embodiments, the intracellular signaling domain comprises the signaling domain of CD40. In some embodiments, the intracellular signaling domain comprises the signaling domain of ICAM-1. In some embodiments, the intracellular signaling domain comprises the signaling domain of LFA-1. In some embodiments, the intracellular signaling domain comprises the signaling domain of ICOS. In some embodiments, OX40. In some embodiments, the intracellular signaling domain comprises the signaling domain of CD28. In some embodiments, the intracellular signaling domain comprises the signaling domain of CD5. In some embodiments, the intracellular signaling domain comprises the signaling domain of CD30. In some embodiments, the intracellular signaling domain comprises the signaling domain of CD40. In some embodiments, the intracellular
  • the intracellular signaling domain comprises the signaling domain of 4- IBB.
  • the intracellular signaling domain comprises two signaling domains selected from OX40, CD2, CD27, CD28, CD5, CD30, CD40, ICAM-1, LFA-1, ICOS and 4- IBB.
  • Exemplary combinations of signaling domains include, but are not limited to: CD28 and 4-lBB; OX40 and CD27; ICOS and 4-lBB; CD 5 and CD2; and ICAM-1 and LFA-1.
  • the intracellular signaling domain comprises three signaling domains, which can include any combination of signaling domain that transmits a primary activation signal to the T lymphocyte and signaling domain of one or more T lymphocyte costimulatory protein.
  • Exemplary combinations of signaling domains include, but are not limited to: CD28, 4-lBB and CD3C; OX40, CD27 and CD3C; ICOS, 4-lBB and CD3C; CD5, CD2 and CD3C; and ICAM-1, LFA-1 and ⁇ 3 ⁇ .
  • amino acid sequences that constitute an intracellular signaling domain that transmits a primary activation signal to the T lymphocyte and/or an intracellular signaling domain of a T lymphocyte costimulatory protein as described above, including the nucleic acid sequences that encode the amino acid sequences, are well known in the art. Exemplary amino acid and/or nucleic acid sequences for such a domain and/or nucleic acid sequences that can be used to generate such a domain, which is useful for generating a CAR described herein, can be found in U.S. Patent Application Publication Nos. 2016-0030479, published February 4, 2016, 2015-0152181, published June 4, 2015, 2015-0368342, published
  • T lymphocytes e.g., human T lymphocytes
  • CAR a CAR described herein.
  • a cell e.g., a T lymphocyte, expressing a CAR, wherein the CAR comprises an antigen binding domain ⁇ e.g., anti -EGFRvIII binding domain) as described herein, a transmembrane domain as described herein, and an intracellular signaling domain as described herein.
  • the T lymphocytes may be CD4 + T lymphocytes or CD8+ T lymphocytes. In some of the embodiments herein, wherein the modified cells are T lymphocytes, the T lymphocytes may be CD4 + T lymphocytes or CD8+ T lymphocytes. In some of the embodiments herein, wherein the modified cells are T lymphocytes, the T lymphocytes may be CD4 + T lymphocytes or CD8+ T lymphocytes. In some of the modified cells are T lymphocytes, the T lymphocytes may be CD4 + T lymphocytes or CD8+ T lymphocytes.
  • the T lymphocytes may be, without genetic modification, and specific for a particular antigen ⁇ e.g., EGFRvIII).
  • the T lymphocytes may be genetically modified to express one or more CAR that targets the T lymphocyte to a specific antigen ⁇ e.g., EGFRvIII).
  • the cells comprising the polypeptides provided herein are T lymphocytes.
  • the T lymphocytes comprising the polypeptides provided herein may be naive T lymphocytes or MHC -restricted T lymphocytes.
  • the T lymphocytes are tumor infiltrating lymphocytes (TILs).
  • TILs tumor infiltrating lymphocytes
  • the T lymphocytes have been isolated from a tumor biopsy, or have been expanded from T lymphocytes isolated from a tumor biopsy.
  • the T lymphocytes have been isolated from, or are expanded from T lymphocytes expanded from, peripheral blood, cord blood, or lymph.
  • the immune cells e.g., T lymphocytes, used in the present methods are preferably autologous to an individual to whom the T lymphocytes are to be administered.
  • the T lymphocytes are allogeneic to an individual to whom the T lymphocytes are to be administered.
  • allogeneic T lymphocytes are used to prepare T lymphocytes, it is preferable to select T lymphocytes that will reduce the possibility of graft- versus-host disease (GVHD) in the individual.
  • GVHD graft- versus-host disease
  • virus-specific T lymphocytes are selected for preparation of T lymphocytes; such lymphocytes will be expected to have a greatly reduced native capacity to bind to, and thus become activated by, any recipient antigens.
  • recipient-mediated rejection of allogeneic T lymphocytes can be reduced by co-administration to the host of one or more immunosuppressive agents, e.g., cyclosporine, tacrolimus, sirolimus, cyclophosphamide, or the like.
  • immunosuppressive agents e.g., cyclosporine, tacrolimus, sirolimus, cyclophosphamide, or the like.
  • T lymphocytes are obtained from an individual, optionally then expanded, and then transformed with a polynucleotide sequence encoding CAR described herein, and optionally then expanded.
  • T lymphocytes are obtained from an individual, optionally then expanded, and then transformed with a polynucleotide encoding a CAR described herein, and optionally then expanded.
  • Cells containing a polynucleotide encoding a CAR described herein may be selected using one or more selectable markers.
  • T lymphocytes, and T lymphocytes comprising a CAR that includes a CD3 ⁇ signaling domain and a costimulatory domain can be expanded using antibodies to CD3 and the corresponding costimulatory protein, e.g., antibodies attached to beads, or to the surface of a cell culture plate; see, e.g., U.S. Patent Nos. 5,948,893; 6,534,055; 6,352,694; 6,692,964; 6,887,466; and 6,905,681.
  • Methods for generating modified T lymphocytes generally involves genetically modifying the cells with an expression vector, or an RNA (e.g., in vitro transcribed RNA), comprising nucleotide sequences encoding a CAR of the present disclosure.
  • the genetic modification can be carried out in vivo, in vitro, or ex vivo. In some embodiments, the genetic modification is carried out ex vivo.
  • the present disclosure also provides a polynucleotide that comprises a nucleotide sequence encoding the CAR of the present disclosure.
  • the polynucleotide will, in some embodiments, be DNA, including, e.g., a recombinant expression vector.
  • the polynucleotide will, in some embodiments, be RNA, e.g., in vitro synthesized RNA.
  • a polynucleotide provides for production of a CAR of the present disclosure in a T lymphocyte.
  • a polynucleotide provides for amplification of the CAR-encoding nucleotide sequence.
  • the nucleotide sequence encoding the CAR of the present disclosure can be operably linked to a transcriptional control element, e.g., a promoter, and enhancer, etc.
  • a transcriptional control element e.g., a promoter, and enhancer, etc.
  • suitable promoter and enhancer elements are known in the art.
  • suitable promoters include, but are not limited to, light and/or heavy chain immunoglobulin gene promoter and enhancer elements;
  • cytomegalovirus immediate early promoter herpes simplex virus thymidine kinase promoter; early and late SV40 promoters; promoter present in long terminal repeats from a retrovirus; mouse metallothionein-I promoter; and various art-known tissue specific promoters.
  • Suitable reversible promoters including reversible inducible promoters are known in the art. Such reversible promoters may be isolated and derived from many organisms, e.g., eukaryotes and prokaryotes. Modification of reversible promoters derived from a first organism for use in a second organism, e.g., a first prokaryote and a second a eukaryote, is well known in the art.
  • Such reversible promoters, and systems based on such reversible promoters but also comprising additional control proteins include, but are not limited to, alcohol regulated promoters (e.g., alcohol dehydrogenase I (alcA) gene promoter, promoters responsive to alcohol transactivator proteins (AlcR), etc.), tetracycline regulated promoters, (e.g., promoter systems including TetActivators, TetON, TetOFF, etc.), steroid regulated promoters (e.g., rat glucocorticoid receptor promoter systems, human estrogen receptor promoter systems, retinoid promoter systems, thyroid promoter systems, ecdysone promoter systems, mifepristone promoter systems, etc.), metal regulated promoters (e.g.,
  • pathogenesis-related regulated promoters e.g., salicylic acid regulated promoters, ethylene regulated promoters, benzothiadiazole regulated promoters, etc.
  • temperature regulated promoters e.g., heat shock inducible promoters (e.g., HSP-70, HSP-90, soybean heat shock promoter, etc.), light regulated promoters, synthetic inducible promoters, and the like.
  • the promoter is a CD8 cell-specific promoter or a CD4 cell-specific promoter.
  • a CD4 gene promoter can be used; see, e.g., Salmon et al. (1993) Proc. Natl. Acad. Sci. USA 90:7739; and Marodon et al. (2003) Blood 101 :3416.
  • a CD8 gene promoter can be used.
  • a nucleotide sequence encoding a CAR of the present disclosure can be present in an expression vector and/or a cloning vector. Where a subject CAR comprises two separate polypeptides, nucleotide sequences encoding the two polypeptides can be cloned in the same or separate vectors.
  • An expression vector can include a selectable marker, an origin of replication, and other features that provide for replication and/or maintenance of the vector. Suitable expression vectors include, e.g., plasmids, viral vectors, and the like.
  • Large numbers of suitable vectors and promoters are known to those of skill in the art; many are commercially available for generating a subject recombinant constructs.
  • the following vectors are provided by way of example: pWLneo, pSV2cat, pOG44, PXR1, pSG (Stratagene) pSVK3, pBPV, pMSG and pSVL (Pharmacia).
  • Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleotide sequences encoding the desired proteins (e.g., CAR).
  • Suitable expression vectors include, but are not limited to, viral vectors (e.g.
  • viral vectors based on vaccinia virus; poliovirus; adenovirus (see, e.g., Li et al, Invest Opthalmol Vis Sci 35:2543 2549, 1994; Borras et al, Gene Ther 6:515 524, 1999; Li and Davidson, PNAS 92:7700 7704, 1995; Sakamoto et al, H Gene Ther 5: 1088 1097, 1999; WO 94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO
  • myeloproliferative sarcoma virus and mammary tumor virus
  • a polynucleotide comprising a nucleotide sequence encoding the CAR of the present disclosure will in some embodiments be RNA, e.g., in vitro synthesized RNA.
  • Methods for in vitro synthesis of RNA are known in the art, and any known method can be used to synthesize RNA comprising a nucleotide sequence encoding the CAR of the present disclosure.
  • Methods for introducing RNA into a host cell are known in the art (see, e.g., Zhao et al Cancer Res. 15:9053 (2010)). Introducing RNA into a host cell can be carried out in vitro, ex vivo or in vivo.
  • a host cell e.g., a T lymphocyte
  • RNA comprising a nucleotide sequence encoding the CAR of the present disclosure.
  • the polynucleotide encoding the CAR of the present disclosure can be introduced into T lymphocytes as naked DNA. Methods of stably transfecting T lymphocytes by electroporation using naked DNA are known in the art (see, e.g., U.S. Pat. No. 6,410,319). Naked DNA generally refers to the DNA encoding a CAR of the present disclosure contained in a plasmid expression vector in proper orientation for expression.
  • the use of naked DNA may reduce the time required to produce T lymphocytes expressing the CAR of the present disclosure.
  • the transfected or transduced T lymphocyte i.e., becomes a modified T lymphocyte
  • the modified T lymphocyte are reintroduced or administered to the subject in combination with lenalidomide to activate the anti-EGFR responses in the subject.
  • the modified T lymphocytes of the present disclosure can be made into a pharmaceutical composition or made implant appropriate for administration in vivo, with appropriate carriers or diluents, which further can be pharmaceutically acceptable.
  • the transduced T lymphocyte can be formulated into a preparation in semisolid or liquid form, such as a capsule, solution, injection, inhalant, or aerosol, in the usual ways for their respective route of administration.
  • a preparation in semisolid or liquid form such as a capsule, solution, injection, inhalant, or aerosol, in the usual ways for their respective route of administration.
  • Means known in the art can be utilized to prevent or minimize release and absorption of the composition until it reaches the target tissue or organ, or to ensure timed-release of the composition.
  • a pharmaceutically acceptable form is employed that does not ineffectuate the lymphocytes expressing the CAR.
  • the transduced T lymphocytes can be made into a pharmaceutical
  • composition containing a balanced salt solution preferably Hanks' balanced salt solution, or normal saline.
  • the modified T lymphocytes disclosed herein may be formulated in any pharmaceutically-acceptable solution, preferably a solution suitable for the delivery of living cells, e.g., saline solution (such as Ringer's solution), gelatins, carbohydrates ⁇ e.g., lactose, amylose, starch, or the like), fatty acid esters, hydroxymethylcellulose, polyvinyl pyrolidine, etc.
  • saline solution such as Ringer's solution
  • Such preparations are preferably sterilized prior to addition of the cells, and may be mixed with auxiliary agents such as lubricants, preservatives, stabilizers, emulsifiers, salts for influencing osmotic pressure, buffers, and coloring.
  • Pharmaceutical carriers suitable for use in formulating the cells are known in the art and are described, for example, in WO 96/05309.
  • kits for treating a subject having a disease associated with expression of EGFRvIII can comprise administering to the subject an effective amount of lenalidomide and modified T lymphocytes expressing a CAR that targets
  • modified T lymphocytes such as cancer cells or tumor cells.
  • the administration of lenalidomide improves or enhances the activity of the modified T lymphocytes against the EGFRvIII expressing cells.
  • modified T lymphocytes express a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain as described herein.
  • a method of treating a subject having a disease associated with expression of EGFRvIII comprising administering to the subject an effective amount of lenalidomide and modified T lymphocytes expressing a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain as described herein.
  • the disease associated with expression of EGFRvIII is a cancer.
  • the disease associated with expression of EGFRvIII is a tumor.
  • the cancer or tumor can be metastatic.
  • the cancer or tumor can be a primary cancer or a primary tumor.
  • Such a primary cancer or primary tumor can arise from or be located in the brain, the spinal cord, the central nervous system, a lung, a breast, the prostate, an ovary, the colon, the rectum, the bladder, or any combination thereof of the subject.
  • the primary cancer or primary tumor arises from or is located in the brain.
  • the primary cancer or primary tumor arises from or is located in the spinal cord.
  • the primary cancer or primary tumor arises from or is located in the central nervous system. In a specific embodiment, the primary cancer or primary tumor arises from or is located in a lung. In a specific embodiment, the primary cancer or primary tumor arises from or is located in a breast. In a specific
  • the primary cancer or primary tumor arises from or is located in the prostate. In a specific embodiment, the primary cancer or primary tumor arises from or is located in an ovary. In a specific embodiment, the primary cancer or primary tumor arises from or is located in the colon. In a specific embodiment, the primary cancer or primary tumor arises from or is located in the rectum. In a specific embodiment, the primary cancer or primary tumor arises from or is located in the bladder. In a specific embodiment, the tumor is a glioma. In a more specific embodiment, the tumor is an astrocytoma. In a still more specific embodiment, the tumor is a glioblastoma multiforme.
  • the disease associated with expression of EGFRvIII is a cancer or tumor selected from glioblastoma multiforme, anaplastic
  • the disease associate with expression of EGFRvIII is glioblastoma multiforme.
  • the disease associated with expression of EGFRvIII is anaplastic astrocytoma. In some embodiments, the disease associated with expression of EGFRvIII is giant cell glioblastoma. In some embodiments, the disease associated with expression of EGFRvIII is gliosarcoma. In some embodiments, the disease associated with expression of EGFRvIII is anaplastic oligodendroglioma. In some embodiments, the disease associated with expression of EGFRvIII is anaplastic ependymoma. In some embodiments, the disease associated with expression of EGFRvIII is choroid plexus carcinoma.
  • the disease associated with expression of EGFRvIII is anaplastic ganglioglioma. In some embodiments, the disease associated with expression of EGFRvIII is pineoblastoma. In some embodiments, the disease associated with expression of EGFRvIII is medulloepithelioma. In some embodiments, the disease associated with expression of EGFRvIII is
  • the disease associated with expression of EGFRvIII is medulloblastoma. In some embodiments, the disease associated with expression of EGFRvIII is supratentorial primitive neuroectodermal tumor. In some embodiments, the disease associated with expression of EGFRvIII is atypical teratoid/rhabdoid tumor.
  • the effective amount of lenalidomide is from about 0.01 mg/kg to about 0.50 mg/kg, or from about 0.05 mg/kg to about 0.10 mg/kg, or from about 0.06 mg/kg to about 0.09 mg/kg. In some embodiments, the effective amount of
  • lenalidomide is from about 0.01 mg/kg to about 0.50 mg/kg. In some embodiments, the effective amount of lenalidomide is from about 0.05 mg/kg to about 0.10 mg/kg. In some embodiments, the effective amount of lenalidomide is from about 0.06 mg/kg to about 0.09 mg/kg.
  • the effective amount of lenalidomide is from about 0.10 mg to about 150 mg. In some embodiments, the effective amount of lenalidomide is from about 2.5 mg to about 25 mg. In some specific embodiments, the effective amount of lenalidomide is selected from about 2.5 mg, about 5 mg, about 10 mg, about 15 mg, about 20 mg, and about 25 mg. Accordingly, in some embodiments, the effective amount of lenalidomide is about 2.5 mg. In some embodiments, the effective amount of lenalidomide is about 5 mg. In some embodiments, the effective amount of lenalidomide is about 10 mg. In some embodiments, the effective amount of lenalidomide is about 15 mg. In some embodiments, the effective amount of lenalidomide is about 20 mg. In some embodiments, the effective amount of lenalidomide is about 25 mg.
  • the lenalidomide administered to the subject is administered daily for a predetermined period of time following an initial administration of lenalidomide.
  • a predetermined period of time can be readily determined by a skilled physician and will depend upon a number of factors including, but not limited to, the amount of
  • lenalidomide employed, the age, body weight, general health, sex, and diet of the subject, the time of administration, the rate of excretion, the combination of modified T lymphocytes and lenalidomide employed, form of administration and the severity of the particular disease associated with EGFRvIII being treated.
  • the lenalidomide and modified T lymphocytes are administered simultaneously. In some embodiments, the lenalidomide and modified T lymphocytes are administered sequentially. In some embodiments, the modified T lymphocytes are administered before the lenalidomide is administered. In some embodiments,
  • the lenalidomide can be administered 1 day, 2 days, 3 days or more after administration of the modified T lymphocytes.
  • the lenalidomide can be administered for a predetermined number of days, weeks, or months.
  • the method of treating provided herein results in the likelihood of the subject's relative survival increasing, including by at least 10%, 20%, 25%,
  • the likelihood of the subject's relative survival increases by at least 10%. In some embodiments, the likelihood of the subject's relative survival increases by at least 20%. In some embodiments, the likelihood of the subject' s relative survival increases by at least 25%. In some
  • the likelihood of the subject' s relative survival increases by at least 30%. In some embodiments, the likelihood of the subject' s relative survival increases by at least 40%. In some embodiments, the likelihood of the subject's relative survival increases by at least 50%. In some embodiments, the likelihood of the subject's relative survival increases by at least 60%). In some embodiments, the likelihood of the subject's relative survival increases by at least 70%. In some embodiments, the likelihood of the subject's relative survival increases by at least 80%. In some embodiments, the likelihood of the subject' s relative survival increases by at least 90%. In some embodiments, the likelihood of the subject' s relative survival increases by at least 100%.
  • the lenalidomide and modified T lymphocytes of the present disclose can be used alone or in combination with other well-established agents useful for treating cancer.
  • the lenalidomide and modified T lymphocytes of the present disclose can be delivered via various routes and to various sites in a subject, particularly human, body to achieve a particular effect.
  • a particular route can provide a more immediate and more effective reaction than another route.
  • intravenous delivery or directed injection into the brain of the modified T lymphocytes and oral administration of Lenalidomide may be advantageously used over inhalation for the treatment of a glioma brain tumor (e.g., GBM).
  • GBM glioma brain tumor
  • administration comprising application or instillation of the formulation into body cavities, inhalation or insufflation of an aerosol, or by parenteral introduction, comprising intratumoral, peritumoral, intramuscular, intratracheal, intracranial, subcutaneous, intradermal, topical application, intravenous, intraarterial, rectal, nasal, oral, and other enteral and parenteral routes of administration.
  • An effective amount lenalidomide and sufficient number of the modified T lymphocytes of the present disclosure in their respective pharmaceutical compositions, which is introduced into the subject can be an amount such that long-term, specific, anti -tumor responses are established to: (i) reduce the size of a tumor; or (ii) eliminate tumor growth or regrowth, that would otherwise result in the absence of such treatment.
  • the amount of modified T lymphocytes and lenalidomide introduced into the subject can cause at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 100% decrease in tumor size when compared to otherwise same conditions wherein the modified T lymphocytes and/or lenalidomide is not present.
  • the concentration of modified T lymphocytes should be sufficient to provide in the subject being treated at least from about lxlO 6 to about lxlO 9 modified T lymphocytes, even more desirably, from about lxlO 7 to about 5xl0 8 modified T lymphocytes, although any suitable amount can be utilized either above (e.g., greater than 5xl0 8 cells), or below (e.g., less than lxlO 7 cells).
  • the modified T lymphocytes are formulated into individual doses, wherein said individual doses comprise at least, at most, or about l x lO 4 , 5x l0 4 , l x lO 5 , 5x l0 5 , l x lO 6 , 5x l0 6 , l x lO 7 , 5x l0 7 , l x lO 8 , 5x l0 8 , l x lO 9 , 5x l0 9 , l x lO 10 , 5x l0 10 , or l x lO 11 T lymphocytes.
  • the dosing schedule can be based on well-established cell-based therapies (see, e.g., Topalian and Rosenberg (1987) Acta Haematol. 78 Suppl 1 :75-6; U.S. Pat. No. 4,690,915) or an alternate continuous infusion strategy can be employed.
  • Administration of the anti-EGFRvIII CAR T cells can be on the same dosing schedule as lenalidomide, or a different dosing schedule.
  • the anti-EGFRvIII CAR T cells can be administered on the same day as the lenalidomide, or on a different day.
  • Such methods can comprise, contacting the modified T
  • the modified T lymphocytes used in the disclosed methods express a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain as described herein.
  • a method of increasing the release of interferon gamma by modified T lymphocytes comprising, contacting the modified T lymphocytes with an effective amount of lenalidomide, wherein the modified T lymphocytes express a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a
  • transmembrane domain and an intracellular signaling domain as described herein.
  • the release of interferon gamma is increased by at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% , 20%, 21%, 22%, 23%, 24%, 25%, 30%, 40% or 50%. Accordingly, in some embodiments, the release of interferon gamma is increased by at least 5%. In some embodiments, the release of interferon gamma is increased by at least 6%.
  • the release of interferon gamma is increased by at least 7% In some embodiments, the release of interferon gamma is increased by at least 8% In some embodiments, the release of interferon gamma is increased by at least 9% In some embodiments, the release of interferon gamma is increased by at least 10°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 11°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 12°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 13°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 14°/ ⁇ .
  • the release of interferon gamma is increased by at least 15°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 16°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 17°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 18°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 19°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 20°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 21°/ ⁇ .
  • the release of interferon gamma is increased by at least 22°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 23°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 24°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 25°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 30°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 40°/ ⁇ . In some embodiments, the release of interferon gamma is increased by at least 50°/ ⁇ .
  • modified T lymphocytes are also provided herein.
  • methods of enhancing the cytotoxicity of modified T lymphocytes can comprise, contacting the modified T lymphocytes with an effective amount of lenalidomide.
  • the modified T lymphocytes express a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a
  • transmembrane domain and an intracellular signaling domain as described herein.
  • a method of enhancing the cytotoxicity of modified T lymphocytes comprising, contacting the modified T lymphocytes with an effective amount of lenalidomide, wherein the modified T lymphocytes express a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain as described herein.
  • the cytotoxicity of the modified T lymphocytes is increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%. Accordingly, in some embodiments, the cytotoxicity of the modified T lymphocytes is increased by at least 5%. In some embodiments, the cytotoxicity of the modified T lymphocytes is increased by at least 10%. In some embodiments, the cytotoxicity of the modified T lymphocytes is increased by at least 15%. In some embodiments, the cytotoxicity of the modified T lymphocytes is increased by at least 20%. In some embodiments, the cytotoxicity of the modified T lymphocytes is increased by at least 25%. In some
  • the cytotoxicity of the modified T lymphocytes is increased by at least 30%. In some embodiments, the cytotoxicity of the modified T lymphocytes is increased by at least 40%. In some embodiments, the cytotoxicity of the modified T lymphocytes is increased by at least 50%. In some embodiments, the cytotoxicity of the modified T lymphocytes is increased by at least 60%. In some embodiments, the cytotoxicity of the modified T lymphocytes is increased by at least 70%. In some embodiments, the cytotoxicity of the modified T lymphocytes is increased by at least 80%. In some embodiments, the cytotoxicity of the modified T lymphocytes is increased by at least 90%. In some embodiments, the cytotoxicity of the modified T lymphocytes is increased by at least 100%.
  • kits for increasing the proliferation of a population of T lymphocytes can comprise, contacting the population of T lymphocytes with an effective amount of lenalidomide.
  • the population of T lymphocytes comprises modified T lymphocytes expressing a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain as described herein.
  • a method of increasing the proliferation of a population of T lymphocytes comprising, contacting the population of T lymphocytes with an effective amount of lenalidomide, wherein the population of T lymphocytes comprise modified T lymphocytes expressing a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain as described herein.
  • the population of T lymphocytes comprises modified T lymphocytes expressing a CAR, wherein the CAR comprises an anti- EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain.
  • cytokine production e.g., interferon gamma
  • cytotoxicity e.g., cytotoxicity
  • proliferation of T lymphocytes are described herein in Examples 4, 5 and 8, respectively. Additional methods of assessing these parameters are well known in the art. For example, methods of assessing cell proliferation and cytokine production have been previously described by Milone et al, Molecular Therapy 17(8): 1453-1464 (2009). Briefly, assessment of proliferation is performed in microtiter plates by mixing washed T cells with target cells, such as U87MG, BHK or CHO cells expressing EGFRvIII or EGFR wildtype (wt) or CD32 and CD137 (KT32-BBL) for a final T-cell:target cell ratio of 1 : 1.
  • target cells such as U87MG, BHK or CHO cells expressing EGFRvIII or EGFR wildtype (wt) or CD32 and CD137 (KT32-BBL)
  • Anti-CD3 and anti-CD28 monoclonal antibodies are added to cultures with KT32-BBL cells to serve as a positive control for stimulating T-cell proliferation since these signals support long-term CD8+ T cell expansion ex vivo.
  • T cells can be enumerated in cultures using COUNTBRIGHT fluorescent beads (Invitrogen, Carlsbad, Calif.) and flow cytometry as described by the manufacturer.
  • CAR + T cells can be detected with biotinylated recombinant EGFRvIII protein and a secondary avidin-PE conjugate.
  • CD4+ and CD8+ expression on T cells can also be simultaneously detected with specific monoclonal antibodies (BD Biosciences).
  • Cytokine measurements can be performed on supernatants collected 24 hours following re-stimulation using the human TH1/TH2 cytokine cytometric bead array kit (BD Biosciences, San Diego, Calif.) according the manufacturer's instructions. Fluorescence can be assessed using a FACScalibur flow cytometer, and data is analyzed according to the manufacturer's instructions.
  • cytotoxicity can be assessed by a standard 51Cr-release assay. See, e.g., Milone et al, Molecular Therapy 17(8): 1453-1464 (2009). Briefly, target cells (U87MG, BHK or CHO cells expressing EGFRvIII or EGFR wildtype (wt) can be loaded with 51Cr (as NaCr04, New England Nuclear, Boston, Mass.) at 37 °C for 2 hours with frequent agitation, washed twice in complete RPMI and plated into microtiter plates. T cells are mixed with target cells in the wells in complete RPMI at varying ratios of effector cell:target cell (E:T).
  • 51Cr as NaCr04, New England Nuclear, Boston, Mass.
  • cytotoxicity assays may also be used, such as flow based cytotoxicity assays, as described in Example 8.
  • Such methods can comprise, contacting the modified T lymphocytes and the cancer cells or tumor cells with an effective amount of lenalidomide, wherein the cancer cells or tumor cells express EGFRvIII.
  • the modified T lymphocytes express a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain.
  • a method of enhancing immune synapse formation of modified T lymphocytes to cancer cells or tumor cells comprising, contacting the modified T lymphocytes and the cancer cells or tumor cells with an effective amount of lenalidomide, wherein the cancer cells or tumor cells express EGFRvIII, and wherein the modified T lymphocytes express a CAR, wherein the CAR comprises an anti-EGFRvIII binding domain, a transmembrane domain, and an intracellular signaling domain.
  • the cancer cells or tumor cells expressing EGFRvIII are metastatic cancer cells or metastatic tumor cells.
  • the cancer cells or tumor cells are primary cancer cells or primary tumor cells.
  • Such primary cancer cells or primary tumor cells can arise from or can be located in the brain, the spinal cord, the central nervous system, a lung, a breast, the prostate, an ovary, the colon, the rectum, the bladder, or any combination thereof.
  • the primary cancer cells or primary tumor cells can arise from or can be located in the brain.
  • the primary cancer cells or primary tumor cells can arise from or can be located in the spinal cord.
  • the primary cancer cells or primary tumor cells can arise from or can be located in the central nervous system.
  • the primary cancer cells or primary tumor cells can arise from or can be located in the a lung. In some embodiments, the primary cancer cells or primary tumor cells can arise from or can be located in the a breast. In some embodiments, the primary cancer cells or primary tumor cells can arise from or can be located in the prostate. In some embodiments, the primary cancer cells or primary tumor cells can arise from or can be located in an ovary. In some embodiments, the primary cancer cells or primary tumor cells can arise from or can be located in the colon. In some embodiments, the primary cancer cells or primary tumor cells can arise from or can be located in the rectum. In some embodiments, the primary cancer cells or primary tumor cells can arise from or can be located in the bladder. In a specific embodiment, the tumor cells are glioma brain tumor cells. In as more specific embodiment, the tumor cells are astrocytoma brain tumor cells. In another specific embodiment, the tumor cells are glioblastoma multiforme brain tumor cells.
  • the cancer cells or tumor cells expressing EGFRvIII are selected from anaplastic astrocytoma cells, giant cell glioblastoma cells, gliosarcoma cells, anaplastic oligodendroglioma cells, anaplastic ependymoma cells, choroid plexus carcinoma cells, anaplastic ganglioglioma cells, pineoblastoma cells, medulloepithelioma cells, ependymoblastoma cells, medulloblastoma cells, supratentorial primitive neuroectodermal tumor cells, and atypical teratoid/rhabdoid tumor cells
  • the methods described herein can be perfomed in vivo or in vitro.
  • the method for enhancing increasing the release of interferon gamma by modified T lymphocytes the method for enhancing the cytotoxicity of modified T lymphocytes, the method for increasing the proliferation of a population of T lymphocytes, the method for enhancing immune synapse formation of modified T
  • the method for enhancing increasing the release of interferon gamma by modified T lymphocytes includes a method wherein the contacting takes place in vitro.
  • the method for enhancing increasing the release of interferon gamma by modified T lymphocytes includes a method wherein the contacting takes place in vivo.
  • the examples show the efficacy of EGFRvIII-targeting CAR T-cell therapy for cancers and tumors, such as GBM.
  • Example 1 Construction of a Third-generation 3C10-CAR with a Lentiviral Vector
  • the monoclonal antibody 3C10 was originally established using mice immunized against a synthetic 14-amino-acid peptide named Pep3, which was characteristically created at the EGFRvIII-specific fusion junction between amino-acid residues, including a novel glycine residue. Its corresponding scFv antibody was then produced.
  • 3C10- CAR cDNA was generated by gene synthesis (Genscript, Piscataway, NJ, USA).
  • a mock vector was designed to harbor the scrambled sequence of the scFv portion that has shown no functional activity against glioma, breast cancer, colon cancer and pancreatic cancer cell lines.
  • PBMCs Peripheral blood mononuclear cells
  • PBMCs were cultured in AFM-V medium (Life Technologies) supplemented with 10% human serum in the presence of interleukin-2 (IL-2; SO U ml -1 ; PeproTech, Rocky Hill, NJ, USA) and anti-CD3 monoclonal antibody (catalog no.16-0037-85, 100 ng ml "1 ; eBioscience, San Diego, CA, USA) for 24 h.
  • PBMCs were harvested, washed once and resuspended and cultured at a density of 1.0 ⁇ 10 6 cells per ml for 24 h.
  • For transduction, thawed viral supernatant having the lentiviral vector of Example 1 was replaced to the medium and the cells were cultured for 24 h, and the medium was then refreshed and the cells were cultured for a further 48 h.
  • the human GBM cell line U87-EGFRvIII stably expressing EGFRvIII and its parental U87MG cell lines described throughout the Examples herein were maintained in Dulbecco's modified Eagle's medium (Sigma-Aldrich, St Louis, MO, USA) supplemented with 10% fetal bovine serum (Life Technologies, Grand Island, NY, USA) and
  • U87-EGFRvIII cells expressing luciferase U87-EGFRvIII-LUC stably expressing luciferase described throughout the Examples herein were generated by transduction with a recombinant lentivirus coding for the luciferase of Photinuspyralis. Two days after transduction, the cells were selected in blasticidin for 2 weeks and were cloned by limiting dilution thereafter.
  • IFN- ⁇ staining was performed using the Cytofix/Cytoperm plus GolgiStop Kit (BD Biosciences, Bedford, MA, USA).
  • the effector cells (1 ⁇ 10 5 cells) were incubated with 0.5 ⁇ 10 6 U87-EGFRvIII cells or U87MG cells (Example 3) in 200 ⁇ AIM-V medium along with GolgiStop in a round-bottomed 96-well plate. Following a 4 h incubation period at 37 °C, the cells were incubated with biotin-SP-AffiniPure F(ab) ' 2 fragment-specific goat anti -mouse immunoglobulin G (catalog no.
  • allophycocyanin mouse anti-human IFN- ⁇ (catalog no. 554702; BD Biosciences) and incubated at 4 °C for 30 min. After washing, cells suspended in 1% paraformaldehyde (Wako, Osaka, Japan) were analyzed by FACSCalibur (BD Biosciences). T cells treated with IL-2 were used as a positive control. After the CD8-FITC-positive population was gated, allophycocyanin and PE positivity was analyzed.
  • the transduction efficiency of the lentiviral vector, as described in Example 2, which transduces the 3C10-CAR into CD8 T cells was evaluated by FACS (fluorescence- activated cell sorting) analysis.
  • FACS fluorescence- activated cell sorting
  • Example 5 Lenalidomide Enhances 3C10-CAR T cell Cytolytic Effects on EGFRvIII-expressing Glioma Cells
  • Target (T) cells U87-EGFRvIII, U87MG were suspended at a final concentration of 1.0 10 6 cells per ml and incubated with 10 ⁇ calcein-AM (Dojindo, Kumamoto, Japan) for 30 min at 37 °C, with occasional shaking. After two washes, cells were adjusted to a concentration of 1.0 ⁇ 10 5 cells per ml, and 1.0 ⁇ 10 4 cells (100 ⁇ ) were placed into a round- bottomed 96-well plate. The effector and target cells were then added to each well at various E:T ratios and incubated at 37 °C for 4 h.
  • the plate was centrifuged at low speed (1000 g, 5 min), and 75 ⁇ of supernatant was carefully aspirated and loaded into a lumaplate. The fluorescence was recorded using a 490-nm excitation filter and a 520-nm emission filter. Only target cells in medium with 1.5 ⁇ of 10% sodium dodecyl sulfate were used for maximum release. The percentage of specific lysis was calculated as follows: (experimental release-spontaneous release)/(maximum release-spontaneous release) ⁇ 100 (%).
  • CD3+ cells were selected from the PBMCs using CD3 microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany). Selected CD3+ cells were transduced with viral supernatant to express 3C10-CAR (3C10-CAR-CD3 cells).
  • the effector cells (3C10-CAR-CD3 cells, mock-CD3 cells) were also incubated with or without lenalidomide (1 ⁇ ) for 48 h, and the calcein assay was performed as mentioned above. The assay was repeated three times. 3C10-CAR PBMCs pretreated with lenalidomide lysed -80% of the U87-EGFRvIII cells at an E:T ratio of 25: 1. Mock PBMCs treated with lenalidomide were not effective, similar to the results for those without lenalidomide (FIG. 2, left).
  • CD3+ cells were selectively isolated from PBMCs using CD3 microbeads to exclude the influence of activation of natural killer cells.
  • the selected CD3+ cells were transduced with viral supernatant, as described in Example 2, to express 3C10-CAR (3C10- CAR CD3 T cells).
  • 3C10-CAR CD3 T cells exerted a similar cytotoxicity to that of 3C10- CAR PBMCs. Additionally, lenalidomide enhanced the cytotoxicity of 3C10-CAR CD3 T cells (FIG. 2, center).
  • Lenalidomide-pretreated 3C10-CAR PBMCs exhibited no killing effect on the parental U87MGs with no EGFRvIII expression, similar to the results seen for the other effector cells (i.e., original 3C10-CAR cells and mock PBMCs with or without lenalidomide) (FIG. 2, right). These results show that lenalidomide treatment enhances the 3C10-CAR T cells cytolytic effects on EGFRvIII-expressing glioma cells.
  • NOD/Shi-scid, IL-2Ry-null (NOG) 5- to 6-week-old female mice were used for individual experiments. Animals were handled in the Animal Facility at Nagoya University in accordance with a protocol approved by the Institutional Animal Care and Use Committee. Mice were anesthetized with an intraperitoneal injection of pentobarbital (somnopentyl; 150-160 mg kg -1 body weight; Kyoritsu, Tokyo, Japan).
  • mice were shaved and an incision was made in the scalp, and then a burr hole was made in the skull, 3 -mm lateral to the midline and 4-mm posterior to the bregma, using an 18-gauge needle.
  • the U87-EGFRvIII-LUC cells 5.0 x 10 4 cells
  • PBS phosphate-buffered saline
  • Mice bearing established tumors were randomly assigned to two different experimental groups.
  • mice were injected intraperitoneally with 200 ⁇ of a freshly thawed aqueous solution of d-luciferin potassium salt (15 mg ml -1 ) (Sigma- Aldrich), anesthetized with isoflurane and imaged for bioluminescence using a 1-min exposure time. Optical images were analyzed using the IVIS living image software package (Summit pharmaceuticals International, Tokyo, Japan). Overall survival following tumor inoculation was monitored.
  • d-luciferin potassium salt 15 mg ml -1
  • lenalidomide was administered intraperitoneally for 35 consecutive days. Bioluminescence imaging, as described above, was performed every week, and overall survival time was evaluated.
  • a mature immune synapse forms a specific pattern of receptor segregation, with a central cluster of T-cell receptors surrounded by a ring of integrin family adhesion molecules such as lymphocyte function-associated antigen-1 (Grakoui, A. et al, Science 1999; 285: 221-227).
  • Ramsay et al. Ramsay, A.G. et al, J Clin Invest 2008; 118: 2427-2437; and Ramsay, A.G. et al, Blood 2009; 114: 4713-4720 reported that lenalidomide repaired and enforced immune synapse formation in patients with hematological malignancies.
  • thalidomide previously failed to show sufficient efficacy in the treatment of patients with high-grade gliomas (Giglio P. et al, Cancer 2012; 118: 3599-3606; Alexander BM, et al, J Neurooncol 2013; 111 : 33-39).
  • lenalidomide a thalidomide derivative with theoretically greater efficacy and fewer side effects, is shown to be efficacious when used in combination with CAR T-cell therapy.
  • Example 7 3C10-CAR T cells Migrate to EGFRvIII-expressing Glioblastoma
  • NOG 5- to 6-week-old female mice were stereotactically inoculated with U87- EGFRvIII cells (1.0 x 10 5 cells per 5 ⁇ PBS) as described in Example 6. Seven days after the inoculation, 2.0 ⁇ 10 6 3C10-CAR PBMCs or mock PBMCs were infused into the tail vein. Simultaneously, lenalidomide (5 mg kg -1 ) or PBS was given intraperitoneally for 20 consecutive days, and then the brain tissue was harvested and embedded in optimum cutting temperature compound (Sakura Finetek, Tokyo, Japan). Six-micrometer-thick frozen sections were prepared with a cryostat (CM3050S; Leica, Wetzlar, Germany).
  • the sections were heated in a microwave oven for 3 min and fixed with 4% paraformaldehyde (Wako, Osaka, Japan) for 15 min at room temperature.
  • the sections were then dipped in PBS containing 0.1% Triton X-100 (PBST; Sigma-Aldrich) at room temperature for 20 min.
  • PBST Triton X-100
  • the sections were blocked with PBST containing 1.5% normal goat serum (Vector Laboratories, Burlingame, CA, USA) at room temperature for 1 h and were subsequently incubated with rabbit anti -human CD3 antibody (catalog no. RM9107; Thermo Lab Vision, Fremont, CA, USA) at a 1 : 100 dilution in blocking reagent overnight at 4 °C.
  • lenalidomide was evaluated for its ability to increase the number of effector cells.
  • T-cell proliferation was quantified spectrophotometrically using the metabolic proliferation reagent WST-1 (Roche Applied Science) according to the manufacturer's instructions.
  • WST-1 proliferation assays 2 x 10 4 3C10-CAR T cells and the same number of non-transduced T cells were cultured in 96-well plates for 24 h in 100 ⁇ of AIM- V medium with different concentrations of lenalidomide (10, 1, 0.1 and 0 ⁇ ). Cells were incubated at 37 °C and 5% C02 for 3 days.
  • the glioma cells (1.5 ⁇ 10 5 cells) were collected and cocultured in a round- bottomed 96-well plate for 2 h at 37 °C with an equal number of 3C10-CAR T cells, which had been incubated with lenalidomide (1 ⁇ ) in advance.
  • the cells were gently collected and plated onto poly-l-lysine-coated coverslips (BD Biosciences). To visualize the immune synapse, the F-actin Visualization Biochem Kit (Cytoskeleton, Denver, CO, USA) was used, following the manufacturer's instructions.
  • F(ab) ' 2 fragment-specific goat anti- mouse immunoglobulin G and streptavidin (SA)-FITC, CDl la-FITC were used to stain 3C10-CAR and lymphocyte function-associated antigen-1 (CDl la), respectively.
  • the relative recruitment index was calculated using the following formula: (mean fluorescence intensity (MFI) at synapse-background)/(mean fluorescence intensity at the T- cell regions not in contact with GBM cells-background). Thirty conjugates that had been incubated with or without lenalidomide were analyzed.
  • FIG. 8 shows tumor cells labeled with CellTracker Blue CMAC; 3C10-CAR, F- actin and CDl la were colocalized in the connections between the tumor cells and 3C10-CAR PBMCs, suggesting the formation of immune synapses between CAR T cells and tumor cells.
  • F-actin polymerization was quantified using an relative recruitment index. The thickness of the F- actin polymers was significantly higher in the lenalidomide (+) group compared with that in the lenalidomide (-) group (FIG. 9).
  • Respective expression levels of CTLA-4 and PD-1 were normalized to that of GAPDH in each sample using the ⁇ method, followed by valuing samples without lenalidomide (LEN-) as 1.0.
  • the primers used for the above experiment include:
  • PD1#1-F CGGCCAGGATGGTTCTTAG (SEQ ID NO: 1)
  • PD1#2-F GTGCTGCTAGTCTGGGTCCT (SEQ ID NO: 3)
  • PD1#2-R AATCCAGCTCCCCATAGTCC (SEQ ID NO: 4)
  • CTLA4-F GGGCATAGGCAACGGAACCCA (SEQ ID NO: 5)
  • CTLA4-R GGGGGCATTTTCACATAGACCCCTG (SEQ ID NO: 6)
  • GAPDH RT-F CATGTTCGTCATGGGTGTGAACCA (SEQ ID NO: 7)
  • GAPDH RT-R ATGGCATGGACTGTGGTCATGAGT (SEQ ID NO: 8)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Cell Biology (AREA)
  • Oncology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Dermatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

L'invention concerne des procédés d'utilisation de lénalidomide et de lymphocytes T modifiés pour le traitement de maladies, telles qu'un cancer ou une tumeur exprimant EGFRvIII, et des utilisations associées de lénalidomide pour moduler l'activation et/ou la prolifération des lymphocytes T.
PCT/US2016/026731 2016-04-08 2016-04-08 Utilisations de lénalidomide et de lymphocytes t car WO2017176289A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/US2016/026731 WO2017176289A1 (fr) 2016-04-08 2016-04-08 Utilisations de lénalidomide et de lymphocytes t car

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2016/026731 WO2017176289A1 (fr) 2016-04-08 2016-04-08 Utilisations de lénalidomide et de lymphocytes t car

Publications (1)

Publication Number Publication Date
WO2017176289A1 true WO2017176289A1 (fr) 2017-10-12

Family

ID=60001383

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/026731 WO2017176289A1 (fr) 2016-04-08 2016-04-08 Utilisations de lénalidomide et de lymphocytes t car

Country Status (1)

Country Link
WO (1) WO2017176289A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210379106A1 (en) * 2018-06-14 2021-12-09 Lixte Biotechnology, Inc. Oxabicycloheptanes for enhancing car t cell function

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110319277A1 (en) * 2010-06-18 2011-12-29 Eun Sun Park Prpk-tprkb modulators and uses thereof
US20140322275A1 (en) * 2013-02-20 2014-10-30 Jennifer Brogdon TREATMENT OF CANCER USING HUMANIZED ANTI-EGFRvIII CHIMERIC ANTIGEN RECEPTOR
US20140377221A1 (en) * 2012-01-25 2014-12-25 Board Of Regents, The University Of Texas System Biomarkers and combination therapies using oncolytic virus and immunomodulation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110319277A1 (en) * 2010-06-18 2011-12-29 Eun Sun Park Prpk-tprkb modulators and uses thereof
US20140377221A1 (en) * 2012-01-25 2014-12-25 Board Of Regents, The University Of Texas System Biomarkers and combination therapies using oncolytic virus and immunomodulation
US20140322275A1 (en) * 2013-02-20 2014-10-30 Jennifer Brogdon TREATMENT OF CANCER USING HUMANIZED ANTI-EGFRvIII CHIMERIC ANTIGEN RECEPTOR

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210379106A1 (en) * 2018-06-14 2021-12-09 Lixte Biotechnology, Inc. Oxabicycloheptanes for enhancing car t cell function

Similar Documents

Publication Publication Date Title
US20230357717A1 (en) Cell secreted minibodies and uses thereof
US11980640B2 (en) Bicistronic chimeric antigen receptors and their uses
AU2017366739B2 (en) Synthetic immune receptors and methods of use thereof
US10822419B2 (en) Masking chimeric antigen receptor T cells for tumor-specific activation
WO2017219936A1 (fr) Lymphocyte t exprimant le récepteur car capable d'exprimer avec efficacité et stabilité un anticorps activé, et ses utilisations
BR112020024246A2 (pt) pelo menos um polinucleotídeo recombinante, célula recombinante, receptor de antígeno quimérico, polinucleotídeo que codifica o receptor de antígeno quimérico, vetor, vírus, composição farmacêutica, e, método para tratar câncer
BR112020005938A2 (pt) célula imune ou população de células imunes da mesma, célula efetora imune ou célula-tronco, célula que apresenta antígeno, polinucleotídeo recombinante, vetor, composição que compreende uma célula imune efetora ou uma célula-tronco, métodos para produzir uma célula efetora imune que expressa receptor imune de ocorrência não natural, para gerar uma população de células manipuladas por rna, para fornecer imunidade antidoença em um indivíduo, para tratar ou prevenir uma doença associada à expressão de um antígeno, e, uso
EP3911371A1 (fr) Méthodes et compositions pour améliorer la sécurité et l'efficacité de thérapies cellulaires
JP2021512635A (ja) 腫瘍微小環境を標的とするキメラ抗原受容体
JP2022541349A (ja) Ｍａｇｅ－ａに特異的に結合する抗原結合タンパク質
WO2021233317A1 (fr) Thérapie par cellules immunitaires armées à il-12 et leurs utilisations
BR112020013133A2 (pt) Proteínas monospecíficas e bispecíficas com regulação do ponto de verificação imune para terapia do câncer
CN113896801A (zh) 靶向人Claudin18.2和NKG2DL的嵌合抗原受体细胞及其制备方法和应用
AU2021318297B2 (en) Immune Synapse-Stabilizing Chimeric Antigen Receptor (CAR) T Cell
WO2021092560A1 (fr) Lymphocytes t car dirigés vers epha3 pour le traitement de tumeurs
US20220267420A1 (en) Foxp3 targeting agent compositions and methods of use for adoptive cell therapy
WO2017176289A1 (fr) Utilisations de lénalidomide et de lymphocytes t car
IL303144A (en) Preparations and uses of chimeric antigen receptor adapted cells for PSCA
WO2023273762A1 (fr) Épitope conformationnel spatial induisant une rétention efficace de cd3 dans des cellules et son utilisation
US20240131155A1 (en) T cells for use in therapy
US20220177599A1 (en) Dual chimeric antigen receptor targeting epcam and icam-1
WO2024060140A1 (fr) Récepteur antigénique chimérique anti-egfrviii et son utilisation
WO2024097652A2 (fr) Récepteurs de lymphocytes t anti-kras et cellules modifiées
KR20230077650A (ko) 자연살해세포-특이적 키메릭항원수용체 및 이의 용도
WO2023200873A2 (fr) Compositions de récepteurs antigéniques chimériques et leurs méthodes d'utilisation

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16898126

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 16898126

Country of ref document: EP

Kind code of ref document: A1