WO2017153023A1 - In vitro method for identifying thoracic aortic aneurysms (taa) in a subject - Google Patents
In vitro method for identifying thoracic aortic aneurysms (taa) in a subject Download PDFInfo
- Publication number
- WO2017153023A1 WO2017153023A1 PCT/EP2016/082925 EP2016082925W WO2017153023A1 WO 2017153023 A1 WO2017153023 A1 WO 2017153023A1 EP 2016082925 W EP2016082925 W EP 2016082925W WO 2017153023 A1 WO2017153023 A1 WO 2017153023A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- adamtsl
- mice
- taa
- aortic
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
- C12N9/0073—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen 1.14.13
- C12N9/0075—Nitric-oxide synthase (1.14.13.39)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/14—Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
- C12Y114/13—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen (1.14.13)
- C12Y114/13039—Nitric-oxide synthase (NADPH dependent) (1.14.13.39)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
- G01N2333/948—Hydrolases (3) acting on peptide bonds (3.4)
- G01N2333/95—Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
- G01N2333/964—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
- G01N2333/96402—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from non-mammals
- G01N2333/96405—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from non-mammals in general
- G01N2333/96408—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from non-mammals in general with EC number
- G01N2333/96419—Metalloendopeptidases (3.4.24)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/32—Cardiovascular disorders
- G01N2800/329—Diseases of the aorta or its branches, e.g. aneurysms, aortic dissection
Definitions
- biomarker ADAMTS1 is used in the present invention for identifying human subjects at risk of developing a disease causing thoracic aortic aneurysm (TAA), preferably Marfan syndrome.
- TAA thoracic aortic aneurysm
- Aortic aneurysm is characterized by vascular smooth muscle cell (VSMC) dysfunction and adverse extracellular matrix remodeling that together predispose the vessel wall to dilation, dissection and rupture. AA is often asymptomatic until rupture, causing significant morbidity and mortality. No single gene or locus has been identified as sufficient cause of abdominal AA (AAA), at least in the absence of a more systemic aortopathy. In contrast, thoracic AA (TAA) is strongly associated with familial genetic predisposition and involves gene variants that show high penetrance. Familial TAA and dissections (FTAAD) appear in isolation or together with features of a systemic connective tissue disorder (syndromic FTAAD).
- FTAAD Familial TAA and dissections
- TGFB Marfan syndrome
- aortic medial degeneration a typical histopathologic feature of TAA characterized by an enlarged and weakened medial layer, fibrosis, proteoglycan accumulation, and elastic fiber disorganization and fragmentation.
- TGFB activation is cause or consequence of FTAAD. Since the risk of aortic dissection or rupture escalates with increasing aortic size, the main treatment goals are to limit structural changes to the aortic wall and to slow aneurysm growth.
- TGFB neutralizing anti-TGFB antibodies prevent aortic dilation and inhibit elastic lamellae fragmentation in a mouse model of mild MFS.
- these processes are also inhibited by losartan, an Angiotensin-II (Ang-II) type I receptor (AT1R) antagonist that inhibits TGFB signaling.
- losartan is less effective in a model of severe MFS, and in randomized clinical trials losartan was no more effective at reducing the rate of aortic root enlargement than the beta-blocker atenolol, and dual therapy with atenolol produced no additional benefit.
- Ang-II and AT1R are involved in the development and progression of TAA and AAA in mouse models. Little is known about the mechanisms by which Ang-II promotes aneurysm.
- ADAMTSl A Disintegrin And Metalloproteinase with Thrombospondin Motifs 1).
- ADAMTSl a member of the proteoglycan-degrading ADAMTS metalloproteinase family, is involved in tissue remodeling, ovulation, wound healing and angiogenesis.
- aortic endothelial and vascular smooth muscle cells (VSMCs) during development and in adulthood and in atherosclerotic lesions.
- Adamtsl is also expressed in TAA tissue and is active in normal aortic tissue, where it cleaves versican and aggrecan.
- Adamtsl-/- mice have congenital kidney malformations and high perinatal mortality, but no vascular phenotype has been reported.
- Adamtsl+/- mice and a model of aortic Adamtsl deficiency based on targeted knockdown.
- ADAMTSl is weakly expressed in MFS, which indicates a role for Adamtsl deficiency in the aortic phenotype of MFS.
- Results from the knockdown model shown herein have uncovered a critical role for nitric oxide (NO) in the pathogenesis of aneurysm formation and related to MFS thus providing new treatment methods for TAA and TAA related diseases.
- NO nitric oxide
- the present invention provides a solution for obtaining useful data for the diagnosis of TAA related diseases as Marfan syndrome or FTAAD.
- the present invention refers to an in vitro method for screening for subjects at risk of developing thoracic aortic aneurysm (TAA) or a disease causing TAA, comprising:
- the present invention further refers to a method for the treatment, prevention or inhibition of a thoracic aortic aneurysm (TAA) in a subject in need of such treatment, prevention or inhibition, comprising administering to said subject an iNOS blocker or a pharmaceutically acceptable salt or prodrug thereof.
- TAA thoracic aortic aneurysm
- the present invention refers to screening method for identifying compounds useful for the treatment, prevention or inhibition of a thoracic aortic aneurysm (TAA), comprising the following steps:
- TAA thoracic aortic aneurysm
- Gapdh expression was used as a loading control. End-of-treatment (d) systolic and diastolic BP (mean ⁇ SEM) and maximal aortic diameter (mean ⁇ SEM) in 12 control siCtl, 16 control siAdamtsl, 13 Ang-II siCtl, and 16 Ang-II siAdamtsl mice. One-way ANOVA, ****p ⁇ 0.001 siCtl vs siAdamtsl; #p ⁇ 0.05, ###p ⁇ 0.001, and ####p ⁇ 0.0001, control vs Ang-II.
- Results in D-E are pooled data from two independent experiments, (f Images show Masson's trichrome (Masson T.), elastic van Gieson (EVG) and alcian blue staining. Scale bar, 50 ⁇ .
- (g,h) Quantification of elastin breaks and collagen content in AsAo sections from the mouse cohorts shown in Figures 1 and 2d-2e.
- One-way ANOVA **p ⁇ 0.01, ***p ⁇ 0.001, ****p ⁇ 0.0001 siCtl vs siAdamtsl or Adamtsl+/+ vs Adamtsl+/-; #p ⁇ 0.05, ##p ⁇ 0.01, ####p ⁇ 0.0001 Control vs Ang-II.
- (i) Representative TGFpi, pSMAD2 and total SMAD2/3 immunohistochemistry of AsAo sections from Control or Ang-II-treated Adamtsl+/+ and Adamtsl+/- mice (n 3).
- mice per group were 8 siCtrl, 4 siCtrl losartan, 5 siAdamtsl, 7 siAdamtsl losartan, and 6 siAdamtsl anti-TGFp.
- siCtl results were stable throughout the experimental period, and data are means of readings at 2, 4, 7, 14, 21, and 49 days
- FIG. 4 The aortopathy induced by Adamtsl deficiency is mediated by NO.
- (a) Experimental design. Eight-week-old C57BL/6 mice were given the NOS inhibitor (L-NAME) in the drinking water, starting 3 days before siCtl or siAdamtsl lentivirus inoculation and continuing for next 14 days, (b) Maximal AsAo and AbAo diameter at the indicated times and end-of-experiment quantification of (c) elastin breaks and (d) collagen content in aortic sections (mean ⁇ SEM; n 5 for each group), (e) Quantification of Mmp2 and Mmp9 activity in aortic extracts from siAdamtsl -transduced mice treated with L-NAME.
- L-NAME NOS inhibitor
- IgG staining serves as a negative control. Scale bar, 20 ⁇ .
- (h) Representative medial layer images of ADAMTS1 immunofluorescence (red; n 9) and (i) quantification of ADAMTSl- positive area in immunohistochemistry-stained sections of 5 control donors and 9 MFS patients,
- (j) Representative medial layer images of NOS2 immunofluorescence (red; n 6) and
- (h,j) Elastin autofluorescence (green) and DAPI- stained nuclei (blue) are also shown.
- (i,k) Data are presented as mean+SEM.
- IgG staining serves as a negative control.
- Scale bar 50 ⁇ .
- ( ⁇ ) AdamtsI mRNA levels in aortic samples from mice transduced with siCtl or siAdamtsl treated as indicated for 28 days. Numbers of mice per group were 12 control siCtl, 16 control siAdamtsl, 13 Ang-II siCtl, and 16 Ang-II siAdamtsl .
- mRNA amounts were normalized to Gapdh expression (mean + SEM).
- One-way ANOVA ***p ⁇ 0.001 vs siCtl; ###p ⁇ 0.001 vs control, (e) AdamtsI mRNA levels in aortic samples from the indicated mice and treatments (n>6).
- siCtl results in (b,c) were stable throughout the experimental period, and data are means of readings at 2, 4, 7, 14, 21, and 49 days, (d) Maximal AbAo diameter (mean ⁇ SEM) and (e) systolic BP (mean ⁇ SEM) at the indicated times in 8 siCtl, 4 siCtl losartan, 5 siAdamtsl, 7 siAdamtsl losartan, and 6 siAdamtsl anti-TGFp mice.
- Figure 14 (a) Maximal AbAo diameter (mean ⁇ SEM) at the indicated times in 9 wt, 7 wt L- NAME, 8 FbnlC1039G/+, and 8 FbnlC1039G/+ L-NAME mice. Two-way ANOVA, ****p ⁇ 0.0001 vs FbnlC1039G/+ L-NAME. (b) End-of-experiment quantification of diastolic BP in the same mice. One-way ANOVA, ** ⁇ 0.01 vs untreated wt; ##p ⁇ 0.01 control vs L- NAME.
- ADAMTS1-NOS2 axis is deregulated in aortic samples of human MFS. Representative medial layer images of NOS2 (red) and SMA (white) immunofluorescence, elastin autofluorescence (green), and DAPI-stained nuclei (blue) in sections from 5 control donors and 8 MFS patients. Bar, 25 um.
- Figure 17. Representative images (n 4) of NO production (red) and GFP fluorescence (green) in unfixed VSMCs transduced with siCtl or siAdamtsl and treated with the Nos2 inhibitors as indicated. Bar, 50 ⁇ .
- Figure 18 3D view of the NOS2 structure, ligands and inhibitors binding sites, (a) Human NOS2 structure and native ligands and (b), zoom of the dimer interface and the ligands region, showing the A (green) and B (cyan) chains of the human NOS2 as cartoon and the native ligands (Hemo and H4B in red and L-Arginine in yellow) as sticks. All the inhibitors models bind in the guanidine site of the ligand region (in yellow as sticks). The binding site for L-NAME in (c), 1400w in (d), Aminoguanidine in (e), GW273629 in (f), L-NIL in (g) and Clotrimazole in (h) are shown. In the case of Clotrimazole, as reported previously, inhibits the dimerization of NOS2 modifying the dimer interface.
- nitric oxide synthase and “NOS” as used interchangeably herein refer to any of the isoforms of isoforms of the enzyme nitric oxide synthase, including eNOS, nNOS and iNOS.
- inducible nitric oxide synthase refers to the Ca -independent, inducible isoform of the enzyme nitric oxide synthase.
- nitric oxide synthase inhibitor and “NOS inhibitor” as used interchangeably herein denote a compound that reduces the physiological effect of a nitric oxide synthase enzyme. Such an inhibitor may be select ive for a particular isoform of nitric oxide synthase, or may be substantially non-selective, that is, effective to a large extent on two or more isoforms of nitric oxide synthase.
- selective nitric oxide synthase inhibitor and “selective NOS inhibitor denote a compound capable of reducing the physiological effect of a particular isoform of nitric oxide synthase preferentially over other isoforms of nitric oxide synthase.
- selective inducible nitric oxide synthase inhibitor denotes a compound capable of reducing the physiological effect of the calcium ion independent isoform of nitric oxide synthase preferentially over other isoforms of nitric oxide synthase.
- a selective iNOS inhibitor produces the selective inhibition of iNOS compared to either endothelial NOS or neuronal NOS such that in vivo administration results in efficacy (ED 50 ) of less than 100 mg kg.
- a select ive iNOS inhibitor produces the select ive inhibit ion of iNOS compared to either endothelial NOS or neuronal NOS such that in vivo administration results in efficacy (ED 50 ) of less than 10 mg ' kg in a rodent endotoxin model), in a further embodiment, an iNOS inhibitor exhibits selectivity of about 20-fold with respect to eNOS as measured by elevation in mean arterial blood pressure. In yet another embodiment, an iNOS inhibitor exhibits 100-fold or greater selectivity fold with respect to eNOS as measured by elevation in mean arterial blood pressure.
- an iNOS inhibitor exhibits selectivity of at about 20- fold with respect to nNOS as measured by reductions in gastrointestinal transit or penile erection. In another embodiment, an iNOS inhibitor exhibits about 1 00- fold or greater selectivity with respect to nNOS as measured by reductions in gastrointestinal transit or penile erection.
- screening is understood as the examination or testing of a group of individuals pertaining to the general population, at risk of suffering from a thoracic aortic aneurysm (TAA) as defined below, with the objective of discriminating healthy individuals from those who are suffering from an undiagnosed thoracic aortic aneurysm. (TAA) or who are at high, risk of suffering from said indications.
- TAA thoracic aortic aneurysm
- thoracic aortic aneurysm includes the well-accepted medical definition that defines TAA as a localized pathologic dilatation of the thoracic segment of the aortic wall at least 50% > normal, true aneurysm contains ail. layers of vessel wall.
- the present invention includes diseases that results in a TAA such as Syndromic thoracic aortic aneurysm (TAA) such as Marfan Syndrome, vascular Ehlers Danlos, Loeys Dietz Syndrome (Types 1 and 2), and Familial thoracic aortic aneurysm and dissection (familial TAAD); non-syndromic TAAs; or any other disease associated with an aorthopathy triggered by Adamts l deficiency.
- Non-syndromic thoracic aortic aneurysm includes those diseases not understood as syndromes that result in a thoracic aortic aneurysm (TAA).
- the present invention also comprises diseases that result in TAA such as bicuspid aortic valve, wherein Adamtsl null mice develop biscuspid aortic valve in most cases.
- minimally-invasive biological sample refers to any sample which is taken from the body of the patient without the need of using harmful instruments, other than fine needles used for taking the blood from the pat ient, and consequently without being harmfully for the patient.
- m i n i ma 11 y- i n vas i ve biological sample refers in the present invent ion to: blood, serum, or plasma samples.
- up-regulated or “over-expressed” of any of the bio markers or combinations thereof described in the present invention refers to an increase in their expression level with, respect to a given "threshold value” or “cutoff v alue” by at least 5%, by at least 10%, by at least 15 >, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%>, by at least 65%>, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 100%, by at least 1 10%, by at least 120%, by at least 130%, by at least 140%, by at least 150%, or more.
- up-regulated or “over-expressed” of any of the biomarkers or combinations thereof described in the present invention, also refers to an increased in their expression level with respect to a given "threshold value” or '"cutoff value " by at least about 1 .5 -fold, about 2- fold, about 5-fold, about 10-fold, about 1 5-fold, about 20-fold, about 50- fold, or of about 100- fold.
- Adamtsl refers to the A disintegrin and metal loproteinase with thrombospondin motifs 1 , in particular an enzyme that in humans is encoded by the ADAMTS 1 gene.
- reduced expression of any of the biomarkers or combinations thereof described in the present invention, refers to a reduction in their expression level with respect to a given "threshold value” or “cutoff value” by at least 5%, by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%>, by at least 65%>, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 100%, by at least 1 10%, by at least 120%, by at least 130%, by at least 140%, by at least 150%, or more.
- the term “reduced expression” of any of the biomarkers or combinat ions thereof described in the present invention also refers to a decreased in their expression level with respect to a given "threshold value” or “cutoff value” by at least about 1.5-fold, about 2-fold, about 5- fold, about 10-fold, about 1 5 -fold, about 20-fold, about 50-fold, or of about 100-fold.
- threshold value when referring to the expression levels of Adamts 1 or iNOS described in the present invention, refers to a reference expression level indicative that a subject is likely to suffer from a syndromic or non- syndromic thoracic aortic aneurysm (TAA) with a given sensitivity and specificity if the expression levels of the patient are above or below said threshold or cut-off or reference levels, i n the context of the present invent ion, said '"threshold value " or ' " cutoff v alue” is a reference expression level taken from a healthy subject.
- TAA syndromic or non- syndromic thoracic aortic aneurysm
- threshold or cutoff expression level for a particular biomarker may be selected.
- these threshold or cutoff expression levels can be varied, for example, by moving along the ROC plot for a particular biomarker or combinations thereof, to obtain different values for sensitivity or specificity thereby affecting overall assay performance. For example, i the objective is to hav e a robust diagnostic method from a clinical point of view, we should try to have a high sensitivity. However, if the goal is to have a cost-effective method we should try to get a high specificity.
- the best cutoff refers to the value obtained from the ROC plot for a particular biomarker that produces the best sensitivity and specificity.
- Sensitivity and specificity values are calculated over the range of thresholds (cutoffs).
- the threshold or cutoff values can be selected such that the sensitivity and/or specificity are at least about 70 %, and can be, for example, at least 75 %, at least 80 %, at least 85 %, at least 90 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or at least 100% in at least 60 % of the patient populat ion assayed, or in at least 65 %, 70 %, 75 % or 80 % of the patient population assayed.
- CI -6 alkyi includes methyl and ethyl groups, and straight- chained or branched propyl, butyl, pentyi and hexyl groups. Particular alkyi groups are methyl, ethyl, n-propyl. isopropyi and tert-butyl.
- C2-6alkenyl includes ethenyl and straight-chained or branched propcnyl, butenyl, pcntenyl and hexenyl groups.
- C2-6alkynyl includes ethynyl and propynyl, and straight-chained or branched butynyi, pentynyi and hexynyl groups.
- aryl represents a carbocyclic aromatic ring system such as phenyl, bipheny!. naphthyi, anthracenyl, phenanthrenyl, fluorenyi, indenyl, pentaienyl, azulenyi, biphenylenyi and the like.
- Aryl is also intended to include the partially hydrogenated derivat ives of the carbocyclic aromatic systems enumerated abov e. Non-limit ing examples of such partially hydrogenated deriv at ives are 1 ,2,3,4-tetrahydronaphthyl, 1 ,4-dihydronaphthyl and the like.
- aryloxy represents a group— O-aryi wherein aryl is as defined above.
- heteroaryl (on its own or in any combination, such as “heteroaryloxy”, or “heteroaryl alkyl”)— a 5-10 membered aromatic ring system in which one or more rings contain one or more heteroatoms selected from the group consisting of N, O or S. such as, but not limited, to pyrrole, pyrazoie, furan, thiophene.
- quinoline isoquinoline, quinazolinyi, pyridine, pyrimidinc, oxazole, thiazole, thiadiazole, tetrazole, triazole, imidazole, or benzimidazole.
- heterocyclic or heterocyclyl (on its own or in any combination, such as “heterocyclylalkyl”)— a saturated or partially unsaturated 4- 10 membered ring system in which one o more rings contain one or more heteroatoms selected from the group consist ing of N, O, or S; such as, but not limited to, pyrrolidine, piperidine. piperazine, morpholine, tetrahydro pyran, or imidazol idine.
- CI -6 perfluoroalkyi means that al l of the hydrogen atoms in said alkyl group are replaced with fluorine atoms.
- Illustrative examples include trif!uoromethyl and pentafluoroethyl, and straight-chained or branched heptafluoropropyl, nonafluorobutyl, undeeafluoropentyl and tridecafl uorohexy 1 groups.
- Derived expression, "CI -6 perfluoroalkoxy” is to be construed accordingly.
- C3-8cycloaikyi means cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl .
- C3-8cycloalkylCl-6alkyl means that the C3-8cycioalkyl as defined herein is further attached to Cl-6alkyl as defined herein.
- Representative examples include c y c lo p ro p y 1 m e t h y 1 , 1 -cyclobutylethyl, 2-cyclopentylpropyl, cyclohexylmethyl, 2- cycloheptylethyl and 2-cyclooctylbutyl and the like.
- halogen or halo means chloro, fluoro, bra mo. and iodo.
- Representative examples include, but are not limited to, methylsulfonyl, ethylsulfonyl, n-propylsulfonyl, isopropylsulfbnyl, butylsu i fonyl, iso-butylsulfonyl, sec-butylsulfony , tert-butylsulfonyl, n-pentylsulfonyl, isopentylsulfonyl, neopentylsulfonyl, tert-penty Isu 1 fo ny I , n-hexylsuHbnyl, isohexylsulfonyl and the like.
- patient means a warm blooded animal, such as for example rat, mice, dogs, cats, guinea pigs, and primates such as humans.
- the expression '"pharmaceutically acceptable carrier means a non-toxic solvent, dispersant, excipient, adjuvant, or other material which is mixed with the compound o the present invention in order to permit the formation of a pharmaceutical composition, i.e., a dosage form capable of administration to the patient.
- a pharmaceutical composition i.e., a dosage form capable of administration to the patient.
- a pharmaceutically acceptable oil typically used for parenteral administration.
- salts of the compounds of the present invention can be used in medicinal preparations.
- Other salts may, however, be useful in the preparat ion of the compounds according to the invent ion or of their pharmaceutically acceptable salts.
- Suitable pharmaceutically acceptable salts of the compounds of this invention include acid addition salts which may, for example, be formed by mixing a solution of the compound according to the invention with a solution of a pharmaceutically acceptable acid such as hydrochloric acid, hydrobromic acid, sulfuric acid, methanesulfonic acid, 2-hyd.roxyethanesulfonic acid, p-toiuenesulfonic acid, fu marie acid, maleic acid, hydroxymaieic acid, malic acid, ascorbic acid, succinic acid, glutaric acid, acet ic acid, salicylic acid, cinnamic acid, 2-phenoxybenzoic acid, hydroxybenzoic acid, phenyiacetic acid, benzoic acid, oxal ic acid, citric acid, tartaric acid, glyceric acid, lactic acid, pyruvic acid, ma Ionic acid, carbonic acid or phosphoric acid.
- a pharmaceutically acceptable acid such as hydrochloric acid, hydrobro
- the acid metal salts such as sodium monohydrogen orthophosphate and potassium, hydrogen sulfate can also be formed.
- the salts so formed may present either as mono- or di-acid salts and can exist either as hydrated or can. be substantially anhydrous.
- suitable pharmaceutically acceptable salts thereof may include alkali metal salts, e.g. sodium or potassium salts; alkaline earth, metal salts, e.g. calcium or magnesium, salts; and salts formed with suitable organic ligands, e.g. quaternary ammonium salts.
- Substituted means substituted by 1 to 2 substituents independently selected from the group consisting of CI -6 alky !, CI -6 perfluoroalkyl, hydroxy,— C02H, an ester, a amide, C1-C6 alko y, C1-C6 perf!uoroalkoxy, NH2.
- “Therapeutically effective amount” means an amount of the compound which is effective in treating the named disorder or condition.
- the term “comprising” it is meant including, but not l imited to, whatever follows the word “comprising”. Thus, use of the term, “comprising” indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present.
- kit is not limited to any specific device and includes any device suitable for working the invent ion such as but not limited to microarrays, bioarrays, biochips or biochip arrays.
- the present invention identifies the NO pathway, in particular iNOS, as an essential mediator of aortic disease in mouse models and suggests such pathway as a possible target for intervention in thoracic aortopathies, in particular in human TAAs.
- iNOS vascular wall homeostasis whose expression is decreased in thoracic aortic aneurysms, in particular in syndromic thoracic aortic aneurysms (TAA), more particularly in MFS.
- lentivirus tropism depends on the administration route and that injection into the jugular vein yields stable and efficient transduction of the aortic wall.
- This approach achieves long-term silencing of Adamtsl throughout the aorta, and provides an alternative to the use of genomically modified mice for the analysis of genes expressed in the vascular wall.
- the silencing model results in aortic phenotypic changes and symptoms indistinguishable from those of Adamtsl+/- mice.
- a key experimental benefit of lentiviral silencing is the controlled timing of gene targeting. Achieving this in the aortic wall with a conditional knockout approach would require simultaneous use of specific drivers for the 3 major cell types, and would not be viable.
- a single lentivirus type knocks down gene expression in all vascular wall cells.
- timed knockdown provides a unique model for studying aortic disorders, enabling us to define the pathological sequence leading to disease: siAdamtsl transduction triggered immediate hypotension and elasto lysis, followed rapidly by aortic dilation, whereas the TGFB-Smad pathway was not activated until 1-2 weeks after lentiviral infection.
- TGFB neutralization also failed to inhibit aneurysm progression at the early stages of a progressively severe form of MFS (FbnlmgR/mgR mice), but was protective at later stages.
- Hypertension is considered a risk factor in AA; however, our results show that the hypertensive effects of L-NAME are compatible with reversal of aortic dilation in Adamtsl+/- and MFS mice. Reversal of dilation was remarkably fast, being complete in 1 week. Elastic fiber and collagen deposition in these mice returned to normal levels 3 weeks after NOS inhibition, suggesting activation of mechanisms for collagen clearance from the aortic wall and the induction of elastin synthesis.
- NOS inhibitors in 3-4-month-old mice, and their therapeutic effect in older mice has yet to be determined. Nonetheless, our results clearly indicate that NO is a primary trigger of aortic diseases and is also required to sustain their symptoms.
- Nos2 is not normally expressed in resting cells, once induced, it remains highly active.
- Nos2 protein in 2 mouse models of Adamtsl deficiency, in MFS mice and, more importantly, in aortic sections of MFS patients.
- NOS2-mediated NO production plays an essential role in the pathogenesis of TAA, in particular in the pathogenesis of syndromic thoracic aortic aneurysms (TAA), in particular in MFS and the aorthopathy triggered by Adamtsl deficiency.
- TAA syndromic thoracic aortic aneurysms
- a first aspect of the present invention refers to a composition useful in a method for the treatment, prevention or inhibition of a thoracic aortic aneurysm (TAA) in a subject in need of such treatment, prevention or inhibition, comprising administering to said subject an iNOS blocker/inhibitor or a pharmaceutically acceptable salt or prodrug thereof.
- TAA thoracic aortic aneurysm
- the method of the first aspect of the invention is useful no matter if the subject has been diagnosed with TAA or at risk of developing TAA according to the methodology described later- on in the present invention or if the subject has been diagnosed with TAA or at risk of developing TAA with any other known clinically effective methodology.
- TAAs can be subdivided into syndromic presentations that exhibit prominent features of systemic connective tissue disease (such as Marfan syndrome, ADESAD (Adamtsl -deficiency elicited syndromic aortic disease (ADESAD)) and Loeys-Dietz syndrome (LDS)) and non-syndromic presentations, such as bicuspid aortic valve with TAA and isolated familial TAA.
- systemic connective tissue disease such as Marfan syndrome, ADESAD (Adamtsl -deficiency elicited syndromic aortic disease (ADESAD)) and Loeys-Dietz syndrome (LDS)
- non-syndromic presentations such as bicuspid aortic valve with TAA and isolated familial TAA.
- iNOS inhibitors are useful as a medical therapy directed at preventing, limiting and reverting the progressive TAA expansion in two syndromic presentations, in particular in Marfan and ADESAD.
- syndromic presentations in general present similar attributes in terms of disease development and subsequent progression, in particular they all develop with medial degeneration, which is characterized by elastic fibers fragmentation, among other features; it thus appears more than plausible that a medical treatment that works well in two syndromic presentations reverting common attributes such as medial degeneration would also work in other syndromic presentations such as Loeys-Dietz syndrome (LDS) (see figures 4h, 4i (elastin breaks and fibrosis, respectively, in ADESAD) (please also refer to figure 6o, 6h and 6j).
- LDS Loeys-Dietz syndrome
- non-syndromic presentations such as bicuspid aortic valve with TAA and isolated familial TAA
- the authors of the present invention have created an animal model for non-syndromic presentations of the disease (please refer to figures 2e, 2f, and 2g wherein medial degeneration and aortic dilation is shown in this model).
- figures 4b, 4c, 4d, 5d, 5e and 5f illustrate that treatment with iNOS inhibitors prevents aortic dilation and medial degeneration in such non- syndromic presentation model and that iNOS knock-out mice in said non-syndromic presentation of the disease do not develop media degeneration or aortic dilation.
- the iNOS inhibitor is capable of binding in the guanidine site of the L-arginine ligand region of the human NOS2 structure and inhibiting the human NOS2 isoform in the presence of L-arginine.
- the expression "iNOS inhibitors" by characterizing these by their capacity to bind the guanidine site of the L-arginine ligand region of the human NOS2 structure and inhibiting the human NOS2 isoform in the presence of L-arginine. Please note that from the early days of drug discovery it has been known that molecules of different structural types can elicit the same biological action.
- the iNOS inhibitor comprises the following chemical moiety covalently bounded through R2 to the rest of the chemical compound:
- Rl is a methyl, methyamine or amino group and wherein R2 is an amino group or methylene group.
- the iNOS blocker/blocker is an iNOS selective inhibitor. More preferably, the the iNOS inhibitor is selected from the group consisting of 1400W, L-NAME, BYK191023, GW274150, GW273629, MEG (sodium succinate), Aminoguanidine (AG) hydrocloride, L- Canavanine, S-(2-Aminoethyl)-ITU dihydrobromide, 2-Iminopiperidine hydrochloride, 1- Amino-2-hydroxyguanidine, p-Toluenesulfonate, 1,3-BP-ITU dihydrobromide, 2-Amino-4- methylpyridine, S-Methylisothiourea sulfate, Canavanine sulfate, MEG(sulfate), AMT hydrochloride, L-NIL dihydrochloride, 1,3-PBITU, Dihydrobromide, S-(3-A
- Rl is selected from CI -4 alkyl, C3-4 cycloalkyl, CI -4 hydroxyalkyl, and CI -4 haloalkyl or or a pharmaceutically acceptable salt thereof.
- iNOS inhibitor is selected from the group consisting of:
- the iNOS inhibitor is selected from the group consisting of: a compound having Formula I
- Rl is selected from the group consisting of H, halo and alkyl which may be optionally substituted by one or more halo;
- R2 is selected from the group consisting of H, halo and alkyl which may be optionally substituted by one or more halo;
- R7 is selected from the group consisting of H and hydroxy
- J is selected from the group consisting of hydroxy, alkoxy, and NR3R4 wherein;
- R3 is selected from the group consisting of H, lower alkyl, lower alkylenyl and lower alkynyl;
- R4 is selected from the group consisting of H, and a heterocyclic ring in which at least one member of the ring is carbon and in which 1 to about 4 heteroatoms are independently selected from oxygen, nitrogen and sulfur and said heterocyclic ring may be optionally substituted with heteroarylamino, N-aryl-N-alkylamino, N- heteroarylamino-N-alkylamino, halo alky It hio, alkanoyloxy, alkoxy, heteroaralkoxy, cycloalkoxy, cycloalkenyloxy, hydroxy, amino, thio, nitro, lower alkylamino, alkylthio, alky It hio alkyl, arylamino, aralkylamino, arylthio, alkylsulfmyl, alkylsulfonyl, alkylsulfonamido, alkylamino sulfonyl, amidosulfonyl, monoalkyl amidosul
- R12 is selected from the group consisting of C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C5 alkoxy-Cl alkyl, and C1-C5 alkylthio-Cl alkyl wherein each of these groups is optionally substituted by one or more substituent selected from the group consisting of— OH, alkoxy, and halogen
- R18 is selected from the group consisting of— OR24 and— N(R25)(R26)
- R13 is selected from the group consisting of— H,—OH,— C(O)— R27,— C(O)— O— R28, and— C(O)— S— R29; or R18 is— N(R30)—
- R13 is— C(O)— , wherein R18 and R13 together with the atoms to which they are
- R41 is H or methyl
- R42 is H or methyl
- R43 is selected from the group consisting of hydrogen, halo, C1-C5 alkyl and C1-C5 alkyl substituted by alkoxy or one or more halo;
- R44 is selected from the group consisting of hydrogen, halo, C1-C5 alkyl and C1-C5 alkyl substituted by alkoxy or one or more halo;
- R45 is C1-C5 alkyl or C1-C5 alkyl be substituted by alkoxy or one or more halo; a compound of Formula VI:
- R46 is C1-C5 alkyl, said C1-C5 alkyl optionally substituted by halo or alkoxy, said alkoxy optionally substituted by one or more halo; a compound of Formula VII
- R47 is selected from the group consisting of hydrogen, halo, C1-C5 alkyl and C1-C5 alkyl substituted by alkoxy or one or more halo;
- R48 is selected from the group consisting of hydrogen, halo, C1-C5 alkyl and C1-C5 alkyl substituted by alkoxy or one or more halo;
- R49 is C1-C5 alkyl or C1-C5 alkyl be substituted by alkoxy or one or more halo; a compound of Formula VIII
- R50 is C1-C5 alkyl, said C1-C5 alkyl optionally substituted by halo or alkoxy, said alkoxy optionally substituted by one or more halo; a compound of Formula IX
- R50 is selected from the group consisting of hydrogen, halo, and C1-C5 alkyl, said Cl- C5 alkyl optionally substituted by halo or alkoxy, said alkoxy optionally substituted by one or more halo;
- R51 is selected from the group consisting of hydrogen, halo, and C1-C5 alkyl, said Cl- C5 alkyl optionally substituted by halo or alkoxy, said alkoxy optionally substituted by one or more halo;
- R52 is C1-C5 alkyl, said C1-C5 alkyl optionally substituted by halo or alkoxy, said alkoxy optionally substituted by one or more halo;
- R53 is selected from the group consisting of hydrogen, halo, and C1-C5 alkyl, said Cl- C5 alkyl optionally substituted by halo or alkoxy, said alkoxy optionally substituted by one or more halo; and
- R54 is selected from the group consisting of halo and C1-C5 alkyl, said C1-C5 alkyl optionally substituted by halo or alkoxy, said alkoxy optionally substituted by one or more halo; a compound of Formula X
- R55 is C1-C5 alkyl, said C1-C5 alkyl optionally substituted by halo or alkoxy, said alkoxy optionally substituted by one or more halo.
- each X, Y and Z are independently N or C(R19);
- each U is N or C(R60), provided that U is N only when X is N and Z and Y are CR74; - V is N(R59), S, O or C(R59)H;
- Each W is N or CH;
- n is zero or an integer from 1 to 4;
- - n is zero or an integer from 1 to 3;
- q is zero or one
- r is zero or one, provided that when Q and V are heteroatoms, m, q, and r cannot all be zero; when A is — OR56, N(R56)C(0)R57, — N(R71)C(0)OR57, — N(R56)R76, — N(R71)C(0)N(R56)R71,— S(0)tR56 (where t is zero), or— NHS02R77, n, q, and r cannot all be zero; and when Q is a heteroatom and A is— OR56, N(R56)C(0)R57,— N(R71)C(0)OR57, — N(R56)R76, N(R71)C(0)N(R56)R71,— S(0)tR56 (when t is zero), or— NHS02R77, m and n cannot both be zero; t is zero, one or two;
- each R56 and R57 are independently chosen from the group consisting of hydrogen, optionally substituted C1-C20 alkyl, optionally substituted cycloalkyl,
- R59 is chosen from the group consisting of hydrogen, alkyl, aryl, aralkyl and cycloalkyl;
- R59 cannot be hydrogen, and when V is CH, R59 may additionally be hydroxy;
- R60 is chosen from the group consisting of hydrogen, alkyl, aryl, aralkyl, haloalkyl, optionally substituted aralkyl, optionally substituted aryl,— OR71,— S(0)t— R71, N(R71)R76, N(R71)C(0)N(R56)R71, N(R71)C(0)OR71, N(R71)C(0) R71, — [C0-C8 alkyl]— C(H)[C(0)R71]2 and— [C0-C8 alkyl]- C(0)N(R56)R71;
- R61 is chosen from the group consisting of hydrogen, alkyl, cycloalkyl,— [C1-C8 alkyl]-R63, — [C2-C8]alkyl]-R65,— [C1-C8 alkyl]-R66, acyl,— C(0)R63,
- R73 is hydrogen, N02, or toluenesulfonyl; each R74 is independently hydrogen, alkyl (optionally substituted with hydroxy), cyclopropyl, halo or haloalkyl; each R76 is independently hydrogen, alkyl, cycloalkyl, optionally substituted aryl, optionally substituted aralkyl,— C(0)R77 or— S02R77; or R76 taken together with R56 and the nitrogen to which they are attached is an optionally substituted N-heterocyclyl; or R76 taken together with R71 and the nitrogen to which they are attached is an optionally substituted N-heterocyclyl; each R77 is independently alkyl, cycloalkyl, optionally substituted aryl or optionally substituted aralkyl; and
- R78 is an amino acid residue
- PPA250 or a pharmaceutically acceptable salt or prodrug of any of said inducible nitric oxide synthase inhibitors.
- the iNOS inhibitor is a coumarin. and is selected from the group consisting of a compound of formula ( XVI ):
- n is an integer of from 2-5;
- X is halogen
- - X.s is hydrogen with the prov iso that when n is 2, R
- a syndromic thoracic aortic aneurysm such as Marfan Syndrome, vascular Ehlers Danlos, Loeys Dietz Syndrome (Types 1 and 2), and Familial, thoracic aortic aneurysm, and dissection (familial TAAD); a non- syndromic TAAs; or any other disease associated with an aorthopathy triggered by Adamtsl deficiency.
- administering an iNOS selective inhibitor or pharmaceutically acceptable salt or prodrug thereof comprises administering to the subject orally, by inhalation, enterally or parenterally in at least one dose per day.
- a second aspect of the invention refers to a composition for use in the treatment, prevention or inhibition of TAA, or a bicuspid aortic valve; or a syndromic thoracic aortic aneurysm (TAA) such as Marfan Syndrome, vascular Ehlers Dan!os.
- TAA syndromic thoracic aortic aneurysm
- iNOS selective inhibitor is as defined in the first aspect of the invention or as defined in any of its preferred embodiments.
- said composition is administered to the subject orally, by inhalation, enterally or parenterally in at least one dose per day.
- the subject has or suffers from Marfan syndrome.
- mice or humans has a clear correlation with the thoracic aortic phenotype, particularly the syndromic thoracic aortic aneurysm (TAA), more particularly the syndromic thoracic aortic aneurysm (TAA) of subjects or patients having or suffering from MFS (see examples).
- TAA syndromic thoracic aortic aneurysm
- TAA syndromic thoracic aortic aneurysm
- a third aspect of the invention refers to an in vitro method for screening for subjects at risk of developing TAA comprising: (a) measuring the expression pattern or level of at least A Disintegrin And Metalloproteinase with Thrombospondin Motifs 1 (ADAMTSl) obtained from an isolated biological sample of the subjects to be screened; and (b) comparing said expression pattern or level of at least ADAMTSl of the subjects to be screened with an already established expression pattern or level, wherein reduced expression of at least ADAMTSl is indicative of thoracic aortic aneurysm (TAA).
- ADAMTSl substrates can also be used for the purpose of the third aspect of the invention.
- a fourth aspect of the invention thus refers to an in vitro method for screening subjects at risk of developing TAA comprising:
- ADAMTSl nitric oxide synthase
- ADAMTSl substrates Aggrecan, versican, tissue factor pathway inhibitor-2 (TFPI-2), semaphorin 3C, nidogen-1, nidogen-2, desmocollin-3, dystroglycan, mac-2, Collagen type I, amphiregulin, TGF-a, heparin-binding EGF, Syndecan 4, versican neoepitopes or aggrecan neoepitopes; and b) comparing said expression pattern or level of at least ADAMTSl and/or at least the inducible form of the nitric oxide synthase (iNOS) and/or at least the expression pattern of any of the following ADAMTSl substrates:
- the method of the third or fourth aspects of the invention screens for subjects at risk of developing diseases causing TAA such as bicuspid aortic valve: or a syndromic thoracic aortic aneurysm (TAA ) such as Marfan Syndrome, vascular Ehlers Danlos, Loeys Dietz S ndrome (Types 1 and 2), and Familial thoracic aortic aneurysm and dissection (familial.
- TAA syndromic thoracic aortic aneurysm
- a fifth aspect of the invention refers to an in vitro method for the diagnosis of a subject suspected of suffering from a TAA related disease, comprising the steps a) and b) of any of the third or fourth aspects of the invention, and optionally (c) confirming the presence of the disease by means of a clinical examination.
- a sixth aspect of the invention refers to a method for obtaining useful data for the in vitro diagnosis of a TAA related disease, comprising the steps a) and b) of any of the third o fourth aspects of the invention.
- a seventh aspect of the invention refers to an in vitro method for classifying subjects as healthy subjects or as subjects suffering from a TAA related disease, comprising the steps a) and b) of any of the third or fourth aspects of the invention.
- An eight aspect of the invention refers to an in vitro method for monitoring the response to a therapy o fo monitoring the progression of a TAA related disease, in a subject suffering from a TAA related disease comprising the steps a) and b) of any of the third o fourth aspects of the invention.
- a ninth of the invention refers to a method fo treating subjects suffering from a TAA related disease, comprising the steps a) and b) of any of the third or fourth aspects of the invention, and (c) treating the patient diagnosed with said disease.
- said treatment is with iNOS inhibitors, more preferably with an iNOS inhibitor as defined in the first aspect of the invention or as defined in any of its preferred embodiments.
- the invention refers to a composition comprising an iNOS inhibitor fo use in the treatment of a TAA related disease in a patient diagnosed with said disease by a method comprising the steps a) and ) of any of the third or fourth aspects of the invention.
- the TAA related disease is selected from the group consisting of Marfan Syndrome, vascular Ehlers Danlos, Loeys Dietz Syndrome (Types 1 and 2), aorthopathy triggered by Adamtsl deficiency and Familial thoracic aortic aneurysm and dissection (familial TAAD); preferably, Marfan syndrome.
- the biological sample is selected from the group consisting of a biopsy sample (such as an aortic biopsy) or of a minimally-invasive biological sample of the subjects to be screened such as a plasma sample, blood sample, Cerebrospinal fluid (CSF) sample or a serum sample.
- a biopsy sample such as an aortic biopsy
- a minimally-invasive biological sample of the subjects to be screened such as a plasma sample, blood sample, Cerebrospinal fluid (CSF) sample or a serum sample.
- CSF Cerebrospinal fluid
- a tenth aspect of the invention refers to the in vitro use of a kit comprising biomarker detecting reagents for determining a differential expression level (of proteins, peptides or nucleotides) in an isolated biological sample of at least ADAMTSl and/or at least the inducible form of the nitric oxide synthase (iNOS) and/or at least the expression pattern of any of the following ADAMTSl substrates: Aggrecan, versican, tissue factor pathway inhibitor-2 (TFPI-2), semaphorin 3C, nidogen-1, nidogen-2, desmocollin-3, dystroglycan, mac-2, Collagen type I, amphiregulin, TGF-a, heparin-binding EGF, Syndecan 4, versican neoepitopes and aggrecan neoepitopes, for diagnosing in vitro the risk that a subject suffers or has a TAA related disease. More preferably said
- the tenth aspect of the invention refers to the in vitro use of a kit comprising biomarker detecting reagents for determining a differential expression level in an isolated biological sample of at least ADAMTSl, wherein a reduced expression of at least ADAMTSl is indicative of a TAA related disease, fo diagnosing in vitro the risk that a subject suffers or has a
- the kit comprises at least the following nucleotides for the detection of at least Adamtsl and optionally the nitric oxide synthase 2:
- the above kit is especially suitable and comprises additional reagents for performing qPCR reactions.
- these reactions are performed in triplicate with SYBR-master mix (Applied Biosystems) according to the manufacturer's guidelines.
- the kit comprises the reagents suitable, such as antibodies or fragments thereof, for detecting any of the peptides or proteins as defined in the kits of the tenth aspect of the invention.
- the isolated biological sample is selected from the group consisting of a biopsy sample (such as an aortic biopsy) or of a minimally-invasive biological sample of the subjects to be screened such as a plasma sample, blood sample, Cerebrospinal fluid (CSF) sample or a serum sample.
- a biopsy sample such as an aortic biopsy
- CSF Cerebrospinal fluid
- the present invention further refers to computer implemented processes of any of the methods described in any of aspects third to ninth as well as to the devices used for the implementation of such processes.
- the present invention identifies the NO pathway, in particular iNOS, as an essential mediator of aortic disease in mouse models and suggests such pathway as a possible target for intervention in thoracic aortopathies
- the authors of the present invention have configured a new screening method for identifying compounds useful for the treatment, prevention or inhibition of a thoracic aortic aneurysm (TAA).
- Said screening method for identifying compounds useful for the treatment, prevention or inhibition of a thoracic aortic aneurysm (TAA) comprising the following steps:
- NO can be determined by direct in vivo use of electrochemical probes (though these are subject to many limitations), electron paramagnetic resonance spectroscopy and fluorescence imaging.
- Nitrite can be determined by use of the Griess reaction and its derivatives, chromatography and chemiluminescence.
- S-nitrosothiols can also be quantified by chemiluminescence; determination of their location on proteins requires tagging the sites of S-nitrosation, such as by the Biotin switch technique or a derivative thereof.
- identifying a compound or a group of compounds capable of acting as NOS inhibitors is by determining whether nitric oxide stimulates soluble guanylyl cyclase to increase cellular cGMP levels.
- kinase activitiy can be assayed with 35 ng recombinant PKG1 protein in reactions containing 8 ⁇ g kemptide.
- Reactions are performed for 5 min at 30°C in 40 mM HEPES (pH 7.0), 8 ⁇ g kemptide (Sigma- Aldrich), 10 mM MgC12, 60 ⁇ ATP, 0.6 ⁇ 32P-g-ATP, and variable amounts of cGMP (0 - 3000 nM). Reactions are stopped by spotting on P81 phosphocellulose paper, and activity is measured by liquid scintillation counting. Lastly, computational design of iNOS inhibitors also forms part of the present invention.
- mice GCCATCGGGGTCAGCTTTTCAAATG-3 ' , 5 -GGGCCAGCTCATTCCTCCCACTCAT/ GGTTGTAGTTTCGCGCTGAGTTTTG-3 ' ); Nos2-/- mice (5 *
- mice 5 ' CTC ATC ATT TTT GGC CAG TTG 3 ' , 5 GCA CTT GAT GCA CAT TCA CA 3 ' ). Wild-type littermates were used as controls unless otherwise specified. Mice were treated with Ang-II (Sigma-Aldrich) at 1 ⁇ g/kg/min or losartan (Sigma Aldrich) at lOmg/kg/day using subcutaneous osmotic minipumps (Alzet Corp).
- the monoclonal pan-antibody against TGFpi, 2, 3 clone 1D11 (BioXcell) was injected intraperitoneally 3 times per week at lOmg/kg.
- ⁇ -Nitro-L-arginine methyl ester hydrochloride (L-NAME, Sigma-Aldrich), was given to mice over 21d (and an additional 3d before LVi inoculation in infected mice) at 0,5mg/ml in drinking water.
- BP Arterial blood pressure
- mice were trained for BP measurements every day for one week. After training, BP was measured one day before treatment or before lentiviral infection to determine the baseline BP values in each mouse cohort. Measurements were repeated several times during experiments. BP measurements were recorded in mice located in a tail-cuff restrainer, over a warmed surface (37°C). Fifteen consecutive systolic and diastolic BP measurements were made, and the last ten readings per mouse were recorded and averaged.
- aortic diameter was monitored in isofluorane-anesthetized mice (2% isofluorane) by high-frequency ultrasound with a VEVO 2100 echography device (VisualSonics, Toronto, Canada). Maximal internal diameters of aortic images were measured using VEVO 2100 software, version 1.5.0. All recordings were made by a cardiologist and a technician who were blinded to animal genotype and treatment. Measurements were taken before lentivirus administration or the corresponding treatments to determine the baseline diameters, and measurements were repeated several times during the experiment.
- VSMCs Mouse vascular smooth muscle cells
- MOI multiplicity of infection
- MOI multiplicity of infection
- Lentiviruses expressing GFP and siRNA targeting mouse Adamtsl mRNA were purchased from ABM-GOOD.
- siRNA sequences were as follows: #siRNA27 (GGAAAGAATCCGCAGCTTTAGTCCACTCA); #siRNA57 (ACCGCCAGTGTCAGTTTACATTCGGAGAG); #siRNA69 (CTTCCGAATGTGCAAAGGAAGTGAAGCCA).
- siCtl GGGTGAACTCACGTCAGAA was used as a control.
- Pseudo-typed lentiviral production was obtained by transient calcium phosphate transfection of HEK-293T cells.
- Supernatant containing the lentiviral particles was collected 48h after removal of the calcium phosphate precipitate, and ultracentrifuged for 2h at 26,000rpm (Ultraclear Tubes, SW28 rotor and Optima L-100 XP Ultracentrifuge; Beckman). Viruses were suspended in cold sterile PBS solution and titrated by transduction of Jurkat cells for 48h. Transduction efficiency (GFP-expressing cells) and cell death (propidium iodide staining) were quantified by flow cytometry.
- mice aortas were perfused with saline, isolated, and fixed in 4% paraformaldehyde overnight at 4°C.
- 5-um paraffin cross sections from fixed aortas were stained with Masson's trichrome (Masson), alcian blue or Verhoeff elastic- van Gieson (EVG) or were used for immunohistochemistry or immunofluorescence. Deparaffinized sections were rehydrated, boiled to retrieve antigens (lOmM citrate buffer, pH6) and blocked for 45min with 10% goat serum plus 2% BSA in PBS.
- Images were acquired under a Leica DM2500 microscope with 20x, 40x or 63xHCX PL Fluotar objective lenses and Leica Application Suite V3.5.0 acquisition software.
- secondary antibodies were AlexaFluor546-conjugated goat anti-rabbit and AlexaFluor647- conjugated goat anti-rabbit (BD Phramigen). Sections were mounted in Citifluor AF4 mounting medium (Aname) with DAPI. Images were acquired at 1024x1024 pixels, 8bits, using a Leica SP5 confocal microscope with 20x or 40x oil immersion objectives.
- Mouse aortic samples were isolated, frozen in liquid nitrogen and then homogenized (MagNA lyzer, Roche). Protein extracts were obtained by lysis in ice-cold RIPA buffer (50mM NaCl, 50mM Tris HC1 pH8, 1% NP40, 0.1% SDS, 0.5% sodium deoxycolate) completed with protease, phosphatase, and kinase inhibitors.
- RIPA buffer 50mM NaCl, 50mM Tris HC1 pH8, 1% NP40, 0.1% SDS, 0.5% sodium deoxycolate
- VSMCs cells were infected and then stimulated with Angll, washed with ice-cold PBS, and lysed in RIPA buffer. Proteins were separated under reducing conditions on SDS-polyacrylamide gels and transferred to nitrocellulose membranes.
- Protein detection was performed with the following primary antibodies: anti-Adamtsl (1/1000; Santa Cruz), anti-GFP (1/1000; Invitrogen), anti-pSMAD2 (1/500; Cell Signaling), Anti-alpha Tubulin (1/40,000; Sigma-Aldrich), Anti-GAPDH (1/10,000; Abeam). Bound antibodies were detected with enhanced chemiluminescence (ECL) detection reagent (Millipore). - RT and Quantitative PCR
- RNA samples were extracted after perfusion with 5ml saline solution perfusion, and the adventitia layer was discarded. Frozen tissue was homogenized using a mortar and an automatic bead homogenizer (MagNA Lyzer, Roche). Total RNA was isolated with TRIZOL (Life Technologies). Total RNA (2 ⁇ g) was reverse transcribed at 37°C for 50 min in a 20ul reaction mix containing 200U Moloney murine leukemia virus (MMLV) reverse transcriptase (Life Technologies), lOOng random primers, and 40U RNase Inhibitor (Life Technologies). Real-time quantitative RT-PCR was performed with the following PCR primers: Adamtsl (ACACTGGCGGTTGGCATCGT, GCCAGCCCTGGTCACCTTGC), Tgffil
- NO staining was performed in unfixed fresh aortic sections from mice with DAF-FM Diacetate reagent (Molecular Probes) according to manufacturer's instructions. Samples were incubated with ⁇ /L DAF-FM Diacetate reagent during 1 hour at RT and mounted in 10%glycerol/PBS. Images were acquired in Leica SP5 microscope.
- Aortic extracts were prepared from whole aortas as described for immunoblot assays, but in the absence of DTT. Extracts (15 ⁇ g) were fractionated under nonreducing conditions on SDS- polyacrylamide gels containing 1% gelatin. Gels were washed three times in 2.5% Triton x-100 for 30 min at RT, incubated in 50mM Tris-HCl pH 7.5, lOmM CaC12, and 200mM NaCl overnight at 37°C, and stained with Coomasie Blue. The areas of gelatinolytic or MMP activity were visualized as transparent bands. Images were analyzed with Quantity One software (Bio- Rad).
- Serum Adamtsl was measured in 50 ⁇ 1 mouse serum with an ELISA kit (BioNova). Human Samples
- Graphpad Prism software 6.01 was used for the analysis.
- the aortic diameter data were presented as box and whiskers plots, with 75th and 25th percentiles; bars represent maximal and minimal data.
- Differences were analyzed by one-way or two-way analysis of variance (ANOVA) and Bonferroni's post-hoc test or Newman's post-hoc test (experiments with >3 groups).
- For survival curves differences were analyzed with the Log-rank (Mantel-Cox) test. Statistical significance was assigned at * p ⁇ 0.05, ** p ⁇ 0.01, ***p ⁇ 0.001, and ****p ⁇ 0.0001.
- Example 2 Constitutive Adamtsl deficiency induces a syndromic form of TAA.
- Example 3 Aortic Adamtsl knockdown promotes TAA.
- Example 4 Medial degeneration and activation of the TGFB pathway in the aortic wall of Adamtsl deficient mice.
- Example 5 Aortic dilation induced by Adamtsl deficiency is fast and independent of TGFB
- AsAo and AbAo diameter and BP after intrajugular inoculation of siCtl or siAdamtsl lentiviruses ( Figure 3 A).
- Reduced Adamtsl mRNA and protein levels were detected from as early as 1-2 days post-inoculation ( Figures 3B-3C), coinciding with the first drop in systolic and diastolic BP and the induction of elastolysis ( Figures 3D-3E and 11A-11B).
- Example 6 Nos2-derived nitric oxide mediates the aortopathy induced by Adamtsl deficiency
- NO nitric oxide
- eNOS endothelial
- nNOS neuronal
- iNOS inducible NOS
- L-NAME rapidly decreased AsAo and AbAo diameter to normal levels (Figure 4F), reverted the systolic and diastolic hypotension (Figures 4G and 12C), decreased elastic fiber fragmentation (Figure 4H), and diminished fibrosis (Figure 41).
- vascular NOS3 produces low levels of NO to maintain vascular homeostasis, whereas under pathological conditions NOS2 can be transcriptionally activated and produce 1000-fold more NO than its constitutive counterparts.
- Nos2 levels might be increased in Adamtsl deficient mice and mediate aortic dilation and medial degeneration.
- Nos2-derived NO mediates the aortopathy induced by Adamtsl deficiency
- Nos2-/- and wt mice with siAdamtsl lentivirus (Figure 5C).
- Nos2- deficiency blocked siAdamtsl -induced AsAo and AbAo dilation ( Figures 5D), elastic fiber fragmentation (Figure 5E) and fibrosis (Figure 5F).
- FbnlC1039G/+ mice also exhibited markedly elevated levels of Nos2 and NO production relative to littermate controls, while Nos3 was unaffected (Figure 6E) .
- Figure 6E Immunostaining of FbnlC1039G/+ aortic sections revealed reduced levels of Adamtsl, confirmed by immunoblot analysis of aortic protein extracts ( Figure 6G).
- Figure 14E Posttranscriptional downregulation of Adamtsl expression in Marfan syndrome.
- Example 8 Docking of human NOS2 and interaction with inhibitors Fasta sequences of oxigenase domain of human NOS2 protein (Uniprot Id: P35228, residues 511-1153) and reductase domain (Uniprot Id: P35228, residues 1-535) were submitted to a local implementation of I-Tasser software suite v5.0 (1) for modeling with homology. For each one, the best model with minimal energy and correct folding (best structural alignment to template: PDB ID 4nos and 3hr4 respectively) was selected as final template.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Hematology (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Cardiology (AREA)
- Vascular Medicine (AREA)
- Heart & Thoracic Surgery (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/083,165 US10907135B2 (en) | 2016-03-07 | 2016-12-30 | In vitro method for identifying thoracic aortic aneurysms (TAA) in a subject |
| JP2018566633A JP7057976B2 (ja) | 2016-03-07 | 2016-12-30 | 被験体において胸部大動脈瘤(TAA)を同定するin vitro方法 |
| ES16826369T ES2965961T3 (es) | 2016-03-07 | 2016-12-30 | Uso de inhibidores selectivos de INOS para el tratamiento de aneurismas de la aorta torácica (TAA) en un sujeto |
| CA3017042A CA3017042C (en) | 2016-03-07 | 2016-12-30 | In vitro method for identifying thoracic aortic aneurysms (taa) in a subject |
| AU2016396401A AU2016396401B2 (en) | 2016-03-07 | 2016-12-30 | In vitro method for identifying thoracic aortic aneurysms (TAA) in a subject |
| EP16826369.7A EP3427061B1 (en) | 2016-03-07 | 2016-12-30 | Use of selective inos inhibitors for treating thoracic aortic aneurysm |
| BR112018068045A BR112018068045A2 (pt) | 2016-03-07 | 2016-12-30 | método in vitro para identificar aneurismas da aorta torácica (taa) em um indivíduo |
| US17/122,962 US12163161B2 (en) | 2016-03-07 | 2020-12-15 | In vitro method for identifying thoracic aortic aneurysms (TAA) in a subject |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP16382103 | 2016-03-07 | ||
| EP16382103.6 | 2016-03-07 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/083,165 A-371-Of-International US10907135B2 (en) | 2016-03-07 | 2016-12-30 | In vitro method for identifying thoracic aortic aneurysms (TAA) in a subject |
| US17/122,962 Continuation US12163161B2 (en) | 2016-03-07 | 2020-12-15 | In vitro method for identifying thoracic aortic aneurysms (TAA) in a subject |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017153023A1 true WO2017153023A1 (en) | 2017-09-14 |
Family
ID=55524277
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2016/082925 Ceased WO2017153023A1 (en) | 2016-03-07 | 2016-12-30 | In vitro method for identifying thoracic aortic aneurysms (taa) in a subject |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US10907135B2 (https=) |
| EP (1) | EP3427061B1 (https=) |
| JP (1) | JP7057976B2 (https=) |
| AU (1) | AU2016396401B2 (https=) |
| BR (1) | BR112018068045A2 (https=) |
| CA (1) | CA3017042C (https=) |
| ES (1) | ES2965961T3 (https=) |
| WO (1) | WO2017153023A1 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020023922A1 (en) * | 2018-07-27 | 2020-01-30 | The Regents Of The University Of California | Biomarker for thoracic aortic aneurysm |
| US20210038596A1 (en) * | 2018-02-19 | 2021-02-11 | The General Hospital Corporation | Methods and compositions for the treatment of vascular disease |
| WO2022219196A1 (en) * | 2021-04-16 | 2022-10-20 | Centro Nacional De Investigaciones Cardiovasculares Carlos Iii (F.S.P.) | Method for the diagnosis, prognosis and/or treatment of thoracic aortic aneurysm |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2555790B1 (es) | 2014-06-05 | 2016-10-13 | Consejo Superior De Investigaciones Científicas (Csic) | Método de obtención de un array de micropartículas planares con multiplexado molecular superficial, array obtenido y su uso |
| WO2016123163A2 (en) | 2015-01-27 | 2016-08-04 | Kardiatonos, Inc. | Biomarkers of vascular disease |
| ES2791415T3 (es) | 2015-12-01 | 2020-11-04 | Centro Nac De Investigaciones Cardiovasculares Carlos Iii F S P | Método para diagnosticar miocardiopatías |
| CN111867622A (zh) | 2017-11-24 | 2020-10-30 | 高等科学研究委员会(Csic) | 经修饰的用于治疗布鲁氏菌病的布鲁氏菌疫苗株 |
| US20230031371A1 (en) * | 2020-01-10 | 2023-02-02 | Deutsches Herzzentrum Muenchen | Diagnosis of an aortic dissection by detecting a specific biomarker in a blood sample |
| US20210318336A1 (en) * | 2020-04-09 | 2021-10-14 | The Trustees Of The University Of Pennsylvania | Methods for treating aortic aneurysm disease |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003026668A1 (en) * | 2001-09-24 | 2003-04-03 | Pharmacia Corporation | Ophthalmologic treatment methods using selective inos inhibitors |
| WO2014004889A2 (en) * | 2012-06-27 | 2014-01-03 | Musc Foundation For Research Development | Plasma analytes predict diagnosis and prognosis of thoracic aortic aneurysm |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2555790B1 (es) | 2014-06-05 | 2016-10-13 | Consejo Superior De Investigaciones Científicas (Csic) | Método de obtención de un array de micropartículas planares con multiplexado molecular superficial, array obtenido y su uso |
| ES2612340B1 (es) | 2015-10-27 | 2018-03-09 | Consejo Superior De Investigaciones Científicas (Csic) | Sensor, aparato y procedimiento para la determinación de la concentración de solutos en disoluciones |
| ES2791415T3 (es) | 2015-12-01 | 2020-11-04 | Centro Nac De Investigaciones Cardiovasculares Carlos Iii F S P | Método para diagnosticar miocardiopatías |
| WO2017187000A1 (es) | 2016-04-29 | 2017-11-02 | Universidad Autónoma de Madrid | Formulaciones con sistemas lípidos portadores de compuestos bioactivos para su uso como agente adyuvante o potenciador de la terapia inmunológica en pacientes que sufren de cáncer o de transtornos inmunológicos |
| WO2017198717A1 (en) | 2016-05-18 | 2017-11-23 | Consejo Superior De Investigaciones Científicas | Fusion proteins comprising an aldolase enzyme joined to a maltose binding protein |
| EP3681515A1 (en) | 2017-09-15 | 2020-07-22 | Fundación para la Investigación Biomédica del Hospital Universitario de la Paz (FIBHULP) | Mafg as a potential therapeutic target to restore chemosensitivity in platinum-resistant cancer cells |
| EP3703756B1 (en) | 2017-11-02 | 2022-04-20 | Consejo Superior de Investigaciones Científicas (CSIC) | Use of statins in overcoming resistance to beta-lactam antibiotics in bacterial species synthetizing isoprenoids using the mevalonate synthetic pathway |
| CN111867622A (zh) | 2017-11-24 | 2020-10-30 | 高等科学研究委员会(Csic) | 经修饰的用于治疗布鲁氏菌病的布鲁氏菌疫苗株 |
| WO2019234189A1 (en) | 2018-06-06 | 2019-12-12 | Centro Nacional De Investigaciones Cardiovasculares Carlos Iii (F.S.P.) | Enhanced trained immunity in myeloid cells by ship-1 inhibition |
| JP7260341B2 (ja) | 2019-03-06 | 2023-04-18 | スタンレー電気株式会社 | 車両用灯具の制御装置、車両用灯具の制御方法、車両用灯具システム |
-
2016
- 2016-12-30 ES ES16826369T patent/ES2965961T3/es active Active
- 2016-12-30 CA CA3017042A patent/CA3017042C/en active Active
- 2016-12-30 JP JP2018566633A patent/JP7057976B2/ja not_active Expired - Fee Related
- 2016-12-30 BR BR112018068045A patent/BR112018068045A2/pt not_active Application Discontinuation
- 2016-12-30 US US16/083,165 patent/US10907135B2/en active Active
- 2016-12-30 EP EP16826369.7A patent/EP3427061B1/en active Active
- 2016-12-30 AU AU2016396401A patent/AU2016396401B2/en not_active Ceased
- 2016-12-30 WO PCT/EP2016/082925 patent/WO2017153023A1/en not_active Ceased
-
2020
- 2020-12-15 US US17/122,962 patent/US12163161B2/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003026668A1 (en) * | 2001-09-24 | 2003-04-03 | Pharmacia Corporation | Ophthalmologic treatment methods using selective inos inhibitors |
| WO2014004889A2 (en) * | 2012-06-27 | 2014-01-03 | Musc Foundation For Research Development | Plasma analytes predict diagnosis and prognosis of thoracic aortic aneurysm |
Non-Patent Citations (5)
| Title |
|---|
| "Aneurysm", 29 August 2012, INTECH, ISBN: 978-953-51-0730-9, article MIGUEL ANGEL ET AL: "Marfan Syndrome - Advances in Diagnosis and Management", XP055270833, DOI: 10.5772/48482 * |
| ARMSTRONG P J ET AL: "Suppression of Experimental Aortic Aneurysms: Comparison of Inducible Nitric Oxide Synthase and Cyclooxygenase Inhibitors", ANNALS OF VASCULAR SURGERY, QUALITY MEDICAL PUBLISHING, ST. LOUIS, MO, US, vol. 19, no. 2, 1 March 2005 (2005-03-01), pages 248 - 257, XP027826777, ISSN: 0890-5096, [retrieved on 20050301] * |
| JAN VÍTECEK ET AL: "Arginine-Based Inhibitors of Nitric Oxide Synthase: Therapeutic Potential and Challenges", MEDIATORS OF INFLAMMATION., vol. 2012, 1 January 2012 (2012-01-01), GB, pages 1 - 22, XP055346044, ISSN: 0962-9351, DOI: 10.1155/2012/318087 * |
| JOHANNING ET AL: "Nitric Oxide in Experimental Aneurysm Formation: Early Events and Consequences of Nitric Oxide Inhibition", ANNALS OF VASCULAR SURGERY, QUALITY MEDICAL PUBLISHING, ST. LOUIS, MO, US, vol. 16, no. 1, 1 January 2002 (2002-01-01), pages 65 - 72, XP005942439, ISSN: 0890-5096, DOI: 10.1007/S10016-001-0139-Z * |
| JOHANNING JASON M ET AL: "Inhibition of inducible nitric oxide synthase limits nitric oxide production and experimental aneurysm expansion", JOURNAL OF VASCULAR SURGERY, vol. 33, no. 3, 1 March 2001 (2001-03-01), pages 579 - 586, XP029487719, ISSN: 0741-5214, DOI: 10.1067/MVA.2001.111805 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20210038596A1 (en) * | 2018-02-19 | 2021-02-11 | The General Hospital Corporation | Methods and compositions for the treatment of vascular disease |
| US11938129B2 (en) * | 2018-02-19 | 2024-03-26 | The General Hospital Corporation | Methods and compositions for the treatment of vascular disease |
| WO2020023922A1 (en) * | 2018-07-27 | 2020-01-30 | The Regents Of The University Of California | Biomarker for thoracic aortic aneurysm |
| CN112752851A (zh) * | 2018-07-27 | 2021-05-04 | 加利福尼亚大学董事会 | 胸主动脉瘤的生物标志物 |
| US12313635B2 (en) | 2018-07-27 | 2025-05-27 | The Regents Of The University Of California | Biomarker for thoracic aortic aneurysm |
| CN112752851B (zh) * | 2018-07-27 | 2025-06-17 | 加利福尼亚大学董事会 | 胸主动脉瘤的生物标志物 |
| WO2022219196A1 (en) * | 2021-04-16 | 2022-10-20 | Centro Nacional De Investigaciones Cardiovasculares Carlos Iii (F.S.P.) | Method for the diagnosis, prognosis and/or treatment of thoracic aortic aneurysm |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2016396401A1 (en) | 2018-10-25 |
| US10907135B2 (en) | 2021-02-02 |
| US20190112582A1 (en) | 2019-04-18 |
| JP2019510081A (ja) | 2019-04-11 |
| CA3017042A1 (en) | 2017-09-14 |
| EP3427061C0 (en) | 2023-12-06 |
| BR112018068045A2 (pt) | 2019-01-08 |
| EP3427061A1 (en) | 2019-01-16 |
| AU2016396401B2 (en) | 2023-07-13 |
| ES2965961T3 (es) | 2024-04-17 |
| CA3017042C (en) | 2024-02-20 |
| US12163161B2 (en) | 2024-12-10 |
| JP7057976B2 (ja) | 2022-04-21 |
| US20210363501A1 (en) | 2021-11-25 |
| EP3427061B1 (en) | 2023-12-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12163161B2 (en) | In vitro method for identifying thoracic aortic aneurysms (TAA) in a subject | |
| US11331290B2 (en) | Niclosamide for the treatment of cancer metastasis | |
| JP7840031B2 (ja) | チロシンキナーゼ阻害剤を用いる組成物および方法 | |
| ES2764480T3 (es) | Composiciones de combinación para tratar la enfermedad de Alzheimer y trastornos relacionados con zonisamida y acamprosato | |
| US9730922B2 (en) | Combined therapy for cystic fibrosis | |
| US20110021475A1 (en) | Compositions And Methods for Treatment Of Fibrosis | |
| JP6822412B2 (ja) | 妊娠高血圧腎症のための診断アッセイ及び治療 | |
| BR112019018162A2 (pt) | Composições farmacêuticas para terapia de combinação | |
| Wang et al. | Hyperglycemia inhibition of endothelial miR-140-3p mediates angiogenic dysfunction in diabetes mellitus | |
| Wang et al. | Angiotensin II receptor blocker LCZ696 attenuates cardiac remodeling through the inhibition of the ERK signaling pathway in mice with pregnancy-associated cardiomyopathy | |
| JP2021513993A (ja) | 血管疾患を処置するための方法および組成物 | |
| Zhang et al. | CIRP attenuates acute kidney injury after hypothermic cardiovascular surgery by inhibiting PHD3/HIF-1α-mediated ROS-TGF-β1/p38 MAPK activation and mitochondrial apoptotic pathways | |
| Campuzano et al. | Reduction of NADPH-oxidase activity ameliorates the cardiovascular phenotype in a mouse model of Williams-Beuren Syndrome | |
| JP2022504990A (ja) | 血管型エーラース・ダンロス症候群および関連障害を処置するための組成物および方法 | |
| JP2008222603A (ja) | 神経変性疾患の予防・治療剤 | |
| AU2020375441A1 (en) | Treatment of renal cystic disease | |
| Redondo et al. | In vitro method for identifying thoracic aortic aneurysms (taa) in a subject | |
| JP7525591B2 (ja) | 心機能不全を予測及び処置するための方法 | |
| Campuzano Uceda et al. | Reduction of NADPH-oxidase activity ameliorates the cardiovascular phenotype in a mouse model of Williams-Beuren Syndrome |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| ENP | Entry into the national phase |
Ref document number: 3017042 Country of ref document: CA Ref document number: 2018566633 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2016826369 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112018068045 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2016826369 Country of ref document: EP Effective date: 20181008 |
|
| ENP | Entry into the national phase |
Ref document number: 2016396401 Country of ref document: AU Date of ref document: 20161230 Kind code of ref document: A |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16826369 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 112018068045 Country of ref document: BR Kind code of ref document: A2 Effective date: 20180906 |