Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/557—Eicosanoids, e.g. leukotrienes or prostaglandins
  • A61K31/5575—Eicosanoids, e.g. leukotrienes or prostaglandins having a cyclopentane, e.g. prostaglandin E2, prostaglandin F2-alpha
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
  • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/02—Peptides of undefined number of amino acids; Derivatives thereof
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
  • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P13/00—Drugs for disorders of the urinary system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P13/00—Drugs for disorders of the urinary system
  • A61P13/02—Drugs for disorders of the urinary system of urine or of the urinary tract, e.g. urine acidifiers
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
  • A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
  • A61P21/06—Anabolic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
  • A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
  • C12N5/06—Animal cells or tissues; Human cells or tissues
  • C12N5/0602—Vertebrate cells
  • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
  • C12N5/0657—Cardiomyocytes; Heart cells
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
  • C12N5/06—Animal cells or tissues; Human cells or tissues
  • C12N5/0602—Vertebrate cells
  • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
  • C12N5/0658—Skeletal muscle cells, e.g. myocytes, myotubes, myoblasts
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
  • C12N5/06—Animal cells or tissues; Human cells or tissues
  • C12N5/0602—Vertebrate cells
  • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
  • C12N5/0658—Skeletal muscle cells, e.g. myocytes, myotubes, myoblasts
  • C12N5/0659—Satellite cells
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
  • C12N5/06—Animal cells or tissues; Human cells or tissues
  • C12N5/0602—Vertebrate cells
  • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
  • C12N5/0661—Smooth muscle cells
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
  • A61K35/34—Muscles; Smooth muscle cells; Heart; Cardiac stem cells; Myoblasts; Myocytes; Cardiomyocytes
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
  • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
  • C12N2501/02—Compounds of the arachidonic acid pathway, e.g. prostaglandins, leukotrienes

Definitions

• Resident MuSCs are rare but essential to the maintenance and repair of muscle, e.g., skeletal muscle, smooth muscle and cardiac muscle throughout adulthood. With aging, the number of functional stem cells declines and thus, the need to enhance the numbers and function of MuSCs increases.
• Prostaglandin E2 (PGE2), also known as dinoprostone, has been employed in various clinical settings including to induce labor in women and to augment hematopoietic stem cell transplantation.
• PGE2 can be used as an anticoagulant and antithrombotic agent.
• PGE2's role as a lipid mediator that can resolve inflammation is also well known.
• Nonsteroidal anti -inflammatory drugs (NSAIDs), inhibitors of COX-1 and/or COX-2, suppress inflammation by inhibiting prostanoids, mainly via PGE2 biosynthesis.
• PGE2 is synthesized from arachidonic acid by a cyclooxygenase (COX) and prostaglandin E synthase enzymes. Levels of PGE2 are physiologically regulated by the PGE2 degrading enzyme, 15- hydroxyprostaglandin dehydrogenase (15-PGDH). 15-PGDH catalyzes the inactivating conversion of the PGE2 15-OH to a 15-keto group.
• COX cyclooxygenase
• PGE2 degrading enzyme 15- hydroxyprostaglandin dehydrogenase
• 15-PGDH catalyzes the inactivating conversion of the PGE2 15-OH to a 15-keto group.
• a method for stimulating the proliferation of a population of isolated muscle stem cells includes cuiturmg the population of isolated muscle cells with a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof.
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof.
• composition comprising a population of isolated muscle ceils and a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof.
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof.
• kits comprising the composition comprising a population of isolated muscle cells and a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof, and an instruction manual.
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof
• an instruction manual a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an
• a method for regenerating a population of muscle cells in a subject having a condition or disease associated with muscle damage, injury, or atrophy includes administering to the subject a therapeutically effective amount of a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof, and a pharmaceutically acceptable earner, to increase the population of muscle cells and/or to enhance muscle function in the subject.
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof
• a pharmaceutically acceptable earner to increase the population of muscle cells and/or to enhance muscle function in
• a method for preventing or treating a condition or disease associated with muscle damage, injury or atrophy in a subject in need thereof includes administering to the subject (i) a therapeutically effective amount of a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof, and a pharmaceutically acceptable carrier, and (ii) a population of isolated muscle cells, to prevent or treat the condition or disease associated with muscle damage, injury, or atrophy.
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof
• a pharmaceutically acceptable carrier and a population
• FIGS. 1A-1H show that transient PGE2 treatment promotes young MuSC proliferation in vitro.
• FIGS. 1E-1G Proliferation of EP4 null MuSCs.
• EP4 ' f (null) MuSCs were transduced with a lenti iral vector encoding GFP luciferase and treated with lentiviral vector encoding Cre (+Cre) or without (-Cre; empty vector) to delete EP4 alelles. Subsequently MuSCs were treated with vehicle (-) or PGE2 ( 10 ng/ml) for 24hr and cultured on hydrogels for three days.
• FIG. IE Scheme depicting EP4-null MuSC analysis.
• FIGS. 2A-2J show an aberrant response of aged MuSCs to PGE2.
• FIG. 2C Scheme showing PGE2 cataboiism via degrading enzyme 15-PGDH to its inactive PGE metabolite, 13, 14-diliydro- 15-keto PGE2 (PGEM).
• FIG. 2H Scheme depicting PGE2 effects on MuSCs.
• PGE2 acts through the EP4 receptor/cAMP (cyclic AMP) signaling pathway to promote proliferation.
• PGT Prostaglandin transporter
• PGE2 cataboiism is mediated by 15-PGDH to the inactive form, PGEM.
• FIG. 21 Trajectories from a clone of aged MuSCs tracked by time-lapse microscopy for 48h in a microwell for control (left) and after acute treatment with PGE2 (right). The trajectory of the original ceil and each of its newborn progeny are represented by a different color.
• FIG. 21 Trajectories from a clone of aged MuSCs tracked by time-lapse microscopy for 48h in a microwell for control (left) and after acute treatment with PGE2 (right). The trajectory of the original ceil and each of its newborn progeny are represented by a different color.
• the proportion of live cells in each generation (G1-G6) at ail timepoints is shown as cell number normalized to a starting population of 100 single MuSCs. The percent increase in live cell count was 4.0% (control) and 5,4% (PGE2-treated) (top panels). Change in aged MuSC dead cell counts (numbers) in clones tracked by time-lapse microscopy for control (left) and after acute treatment with PGE2 (right).
• the proportion of dead cells in each generation (G1-G6) at all timepoints is shown as cell number normalized to a starting population of 100 single MuSCs.
• the percent increase in dead cell count was 1.0% (control) and 0.1% (PGE2-treated) (bottom panels).
• ANOVA test with Bonferroni correction for multiple comparisons FIGS. 2A and 2F
• Mann-Whitney test FIGS. 2B, 2D, 2E, and 2G. Means ⁇ s.e.m. n.s., non-significant.
• FIGS, 3A-3D show that acute PGE2 treatment promotes MuSC engraftment and regeneration in vivo.
• FIG. 3B Engraftment of GFP/luc -labeled EP4 l/f MuSCs (1,000 cells) treated with Cre (+Cre) or without (-Cre; empty vector) in culture to delete EP4 alelies.
• FIGS. 4A-4P show that intramuscular injection of PGE2 alone promotes MuSC expansion, improves regeneration, and increases force.
• FIG. 4A Scheme of experimental procedure (top). Representative
• FIG. 4B Increase in endogenous MuSCs by immunofluorescence of PAX7 expressing satellite cells per 100 fibers in cross-sections of TAs from young mice.
• FIG. 4C Myofiber cross-sectional areas (CSA) in vehicle (-, open white bar) and dmPGE2 treated (filled blue bar) young TAs quantified using the Baxter Algorithms for Myofiber Analysis.
• FIG. 4D Distribution of small ( ⁇ 1,000 ⁇ 2 CSA) and large (> 1,000 ⁇ 2 CSA) myofibers. (FIGS. 4E-4G) Increase in endogenous MuSCs assayed by Pax7-luciferase.
• FIG. 4E Scheme of experimental procedure.
• FIG. 41 Increase in endogenous MuSCs as in FIG. 4B for aged mice.
• FIG. 4J Myofiber cross-sectional area (CSA) as in FIG. 4C for aged TAs.
• FIG. 4 Distribution of CSA as in FIG. 4D for aged TAs. (FIGS, 4L-4P) Increase in strength in aged mice measured in vivo as muscle contractile force after downhill treadmill run.
• FIG. 4L Experimental scheme. Representative twitch force (FIG. 4M) and tetanic force (FIG. 4N). Specific muscle twitch forces (FIG. 40) and specific muscle tetanic force (FIG. 4P) were calculated by normalizing force to physiological cross sectional areas (PCSA). Paired t-test (FIGS.
• FIGS. 5A-5K show that PGE2 promotes MuSC expansion.
• FIG. 5B Representative image of dividing muscle stem cells (MuSCs) labelled with EdU (red) during lhr after treatment with PGE2 (lOng/ml) for 24h (dO to d l) or vehicle (-), and stained for MYOGENIN (green). Bar represents 40 ⁇ .
• FIG. 5B Representative image of dividing muscle stem cells (MuSCs) labelled with EdU
• FIGS. 51-5 J EP4& MuSCs were transduced with a lentiviral vector encoding GFP/luciferase and treated with lentiviral vector encoding Cre (+Cre) or without (-Cre; empty vector) to delete EP4 alelles.
• FIG. 5K Representative image of MuSCs in hydrogel culture after 7 days in myoblast medium containing charcoal stripped fetal bovine supplemented with vehicle (-) or PGE2 (10 ng/'ml) every two days. Bar represents 40 ⁇ . *P ⁇ 0.05, **P ⁇ 0.001 , ***P ⁇ 0.0005. Paired t-test (FIGS. 5A, 5E, 5G, and 5H); Mann-Whitney test (FIG. SC). Means+s.e.m. n.s., nonsignificant. [0018] FIGS.
• FIG. 6A-6C show mass spectrometry analysis of young and aged muscle to detect prostaglandins and PGE2 metabolites.
• FIG. 6A Chemical structures, chemical formula, exact mass and molecular weight of analyzed prostaglandins (PGE2, PGF2a and PGD2) and PGE2 metabolites (15-keto PGE2 and 13, 14 ⁇ dihydro-15-keto PGE2). The interna] standards PGF2a-D9 and PGE2-D9 were added to all composite standards.
• FIG. 6A Chemical structures, chemical formula, exact mass and molecular weight of analyzed prostaglandins (PGE2, PGF2a and PGD2) and PGE2 metabolites (15-keto PGE2 and 13, 14 ⁇ dihydro-15-keto PGE2).
• the interna] standards PGF2a-D9 and PGE2-D9 were added to all composite standards.
• FIG. 6B Calibration lines for liquid chromatogiaphy-electrospray ionizatiott-tandem mass spectrometry (LC-ESI- MS/ ' MS) analysis were prepared by diluting stock solutions to final concentrations of 0.1 ng ml to 500 ng mJ . Standard curve equations and correlation coefficients are shown for each, standard.
• FIG. 6C Representative chromatogram. The separate peaks show excellent chromatographic resolution of the analyzed prostaglandins and their metabolites, cps, counts per second.
• FIGS. 7A-7G show that aged MuSCs increase proliferation and cell survival in response to PGE2 treatment.
• FIG. 7A Prostaglandin transporter (PGT) encoded by the Slcolal gene.
• FIG. 7B PGE2 synthesizing enzymes, Piges and Ptges2.
• FIG. 7C EP1-4 receptors encoded by the genes Ptger 1-4.
• FIG. 7E Single aged MuSC clones tracked by time-lapse microscopy after acute treatment with vehicle (-; top) or PGE2 (bottom). For each clone the resulting number of live (open bar) and dead (black bar) cells after 48h timelapse tracking is shown.
• FIG. 7F Proliferation curve of tracked live aged MuSCs assessed by time-lapse microscopy for vehicle (-) or transient PGE2 treatment during 48h.
• FIGS, 8A-8B show Baxter Algorithms for Myofiber Analysis of muscle cross- sectional area.
• FIG. 8A Representative cross-sectional images of tibialis anterior myofibers of young mice treated in vivo with vehicle (-) or PGE2 48hr post-cardiotoxm (CTX) injury. Images show staining with LAMININ, green and DAPI, blue.
• FIG. 838 The corresponding segmentation images from FIG. 8A analyzed by the Baxter Algorithms for Myofiber Analysis to determine the cross sectional area (CSA) of transverse sections of myofibers (bottom) at day 14 post-injury. Bar represents 40 jim , [0021] FIGS.
• FIG. 9A-9G show that deletion of PGE2 receptor EP4 in MuSCs decreases regeneration and force of skeletal muscle after injury.
• FIG. 9A Experimental scheme.
• FIG. 9A Experimental scheme.
• FIG. 9B Expression of Piger4 (EP4 receptor) in sorted MuSCs ( ⁇ ' " CD34 1" lin " ) from control or EP4 KO mice post-injury.
• FIG. 9D Percentage of eMyHC fibers.
• FIG. 9E Myofiber cross-sectional areas (CSA) in control and Pax7-specific EP4 knockout TAs.
• FIG. 9F Muscle twitch forces and (FIG. 9G) muscle tetanic force at day 14 post- notexin injur ⁇ '. Mann-Whitney test (FIGS.
• FIGS. lOA-lOC show that blockage of endogenous PGE2 signaling in muscle at an early timepoint of regeneration reduces regeneration and force.
• FIG. 10A Experimental scheme.
• the present invention is based, in part, on the discover ⁇ ' that prostaglandin E2 (PGE2) can improve muscle cell proliferation and function, PGE2 alone or in combination with isolated muscle cells can be used to repair muscle damage due to injury, atrophy, or disease. In fact, PGE2 -treated muscle cells exhibit enhanced muscle regeneration and improved muscle function upon administration. As such, provided herein are novel therapeutic methods, compositions, and kits to promote muscle regeneration and rejuvenation of damaged, injured, or atrophied muscle. II.
• nucleic acids sizes are given in either kilobases (kb), base pairs (bp), or nucleotides (nt). Sizes of single-stranded DNA and/or RNA can be given in nucleotides. These are estimates derived from agarose or acrylamide gel electrophoresis, from sequenced nucleic acids, or from published DNA sequences. For proteins, sizes are given in kilodaltons (kDa) or amino acid residue numbers. Protein sizes are estimated from gel electrophoresis, from sequenced proteins, from derived amino acid sequences, or from published protein sequences.
• Oligonucleotides that are not commercially available can be chemically synthesized, e.g. , according to the solid phase phosphoramidite triester method first described by Beaucage and Caruthers, Tetrahedron Lett. 22: 1859-1862 (1981), using an automated synthesizer, as described in Van Devanter et. al. , Nucleic Acids Res. 12:6159-6168 (1984). Purification of oligonucleotides is performed using any art-recognized strategy, e.g., native acrylamide gel electrophoresis or anion-exchange high performance liquid chromatography (HPLC) as described in Pearson and Reanier, J. Chrom. 255: 137-149 (1983).
• HPLC high performance liquid chromatography
• prostaglandin E2 refers to prostaglandin that can be synthesized via arachidonic acid via cyclooxygenase (COX) enzymes and terminal prostaglandin E synthases (PGE5).
• PGE2 plays a role in a number of biological functions including vasodilation, inflammation, and modulation of sleep/wake cycles.
• prostaglandin E2 receptor agonist or "PGE2 receptor agonist” refers to a chemical compound, small molecule, polypeptide, biological product, etc. that can bind to and activate any PGE2 receptor, thereby stimulating the PGE2 signaling pathway
• PGE2 receptor agonist refers to a chemical compound, small molecule, polypeptide, biological product, etc. that can reduce or decrease die breakdown of PGE2.
• compound that neutralizes PGE2 inhibition refers to a chemical compound, small molecule, polypeptide, biological product, etc. that can block or impede an inhibitor of PGE2 synthesis, activity, secretion, function, and the like.
• derivative in the context of a compound, includes but is not limited to, amide, ether, ester, amino, carboxyl, acetyl, and/or alcohol derivatives of a given compound.
• embryonic stem cell-derived muscle cell or "ESC-derived muscle cell” refers to a muscle cell that is derived from or differentiated from an embryonic stem cell.
• ESC-derived muscle cell refers to a muscle cell that is derived from or differentiated from an embryonic stem cell.
• iPSC-derived muscle cell refers to a muscle cell that is derived from or differentiated from an induced pluripotent stem cell.
• the term " 'isolated,' 1 in the context of cells, refers to a single cell of interest or a population of cells of interest, at least partially isolated and/or purified from other cell types or other cellular material with which it naturally occurs in the tissue of origin (e.g. , muscle tissue).
• a population of muscle cells is "isolated” when it is at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% and, in certain cases, at least about 99% free of ceils that are not muscle cells.
• Purit - can be measured by any appropriate method, for example, by fluorescence -activated cell sorting.
• autologous refers to any material (e.g. , a cell) derived from the same individual to whom it is later to be re-introduced into the individual.
• ' allogeneic refers to any material (e.g. , a cell) derived from a different animal of the same species as the individual to whom the material is introduced. Two or more individuals are said to be allogeneic to one another when the genes at one or more loci are not identical . In some aspects, allogeneic material from individuals of the same species may be sufficiently unlike genetically ⁇ interact antigenically.
• Tire term "treating" or “treatment” refers to any one of the following: ameliorating one or more symptoms of disease; preventing the manifestation of such symptoms before they occur; slowing down or completely preventing the progression of the disease (as may be evident by longer periods between reoccurrence episodes, slowing down or prevention of the deterioration of symptoms, etc.) enhancing the onset of a remission period; slowing down the irreversible damage caused in the progressive-chronic stage of the disease (both in the primary and secondary stages); delaying the onset of said progressive stage; or any combination thereof.
• administer refers to the methods that may be used to enable delivery of agents or compositions such as the compounds and cells described herein to a desired site of biological action. These methods include, but are not limited to, parenteral administration (e.g. , intravenous, subcutaneous, intraperitoneal, intramuscular, intra-arterial, intravascular, intracardiac, intrathecal, intranasal, intradermal, intravitreal, and the like), transmucosal injection, oral administration, administration as a suppository, and topical administration.
• parenteral administration e.g. , intravenous, subcutaneous, intraperitoneal, intramuscular, intra-arterial, intravascular, intracardiac, intrathecal, intranasal, intradermal, intravitreal, and the like
• transmucosal injection e.g. , transmucosal injection, oral administration, administration as a suppository, and topical administration.
• parenteral administration e.g. , intrave
• therapeutically effective amount refers to an amount of a compound, therapeutic agent (e.g., cells), and/or pharmaceutical daig that is sufficient to bring about a beneficial or desired clinical effect.
• a therapeutically effective amount or dose may be based on factors individual to each patient, including, but not limited to, the patient's age, size, type or extent of disease, stage of the disease, route of administration of the regenerative cells, the type or extent of supplemental therapy used, ongoing disease process and type of treatment desired (e.g., aggressive vs. conventional treatment).
• Therapeutically effective amounts of a pharmaceutical compound or compositions, as described herein, can be estimated initially from cell culture and animal models. For example, IC 50 values determined in cell culture methods can serve as a starting point in animal models, while IC 50 values determined in animal models can be used to find a therapeutically effective dose in humans.
• pharmaceutically acceptable carrier refers to refers to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
• subject refers to a vertebrate, preferably a mammal, more preferably a human.
• Mammals include, but are not limited to, murines, rats, simians, humans, farm animals, sport animals, and pets.
• acute exposure in the context of administration of a compound, refers to a temporary or brief application of a compound to a subject, e.g. , human subject, or cells.
• an acute exposure includes a single administration of a compound over the course of treatment or over an extended period of time.
• an acute regimen in the context of administration of a compound, refers to a temporary or brief application of a compound to a subject, e.g., human subject, or to a repeated application of a compound to a subject, e.g., human subject, wherein a desired period of time (e.g., 1 day) lapses between applications.
• an acute regimen includes an acute exposure (e.g..
• an acute regimen includes intermittent exposure (e.g., repeated doses) of a compound to a subject in which a desired period of time lapses between each exposure.
• continuous exposure in the context of administration of a compound, refers to a repeated, chronic application of a compound to a subject, e.g., human subject, or cells, over an extended period of time.
• chronic regimen in the context of administration of a compound, refers to a repeated, chronic application of a compound to a subject, e.g., human subject, over an extended period of time such that the amount or level of the compound is substantially constant over a selected time period.
• a chronic regimen includes a continuous exposure of a compound to a subject over an extended period of time.
• a method for stimulating the proliferation, expansion, and/or engraftment of a population of isolated muscle cells by culturing the population of isolated muscle cells with a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof.
• PGE2 prostaglandin E2
• the population of isolated muscle cells is substantially purified or purified (e.g., separated from non-muscle cells or other cells that are not of interest).
• the population of isolated muscle cells comprises skeletal muscle cells, smooth muscle cells, cardiac muscle cells, embryonic stem cell-derived muscle cells, induced pluripotent stem cell-derived muscle cells, dedifferentiated muscle cells, or a combination thereof.
• the population of isolated muscle cells comprises muscle stem cells, satellite cells, myocytes, myoblasts, myotubes, myofibers, or a combination thereof.
• the population of isolated muscle cells can be obtained from a subject.
• the isolated muscles cells are from a cell line, e.g. , a primary cell line.
• the subject has a condition or disease associated with muscle damage, injury, or atrophy.
• the condition or disease associated with muscle damage, injury, or atrophy can be selected from, the group consisting of acute muscle injury, tear, or trauma, soft tissue hand injury, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, limb girdle muscular dystrophy, amyotrophic lateral sclerosis (ALS), distal muscular dystrophy (DO), inherited myopathies, myotonic muscular dystrophy (MDD), mitochondrial myopathies, myotubular myopathy (MM), myasthenia gravis (MG), congestive heart failure, periodic paralysis, polymyositis, rhabdomyolysis, dermatomyositis, cancer cachexia, AIDS cachexia, cardiac cachexia, stress induced urinary incontinence, and sarcopenia.
• DMD Duchenne muscular dystrophy
• ALS amyotrophic lateral sclerosis
• DO distal muscular dystrophy
• inherited myopathies myotonic muscular dystrophy
• MMDD myot
• the PGE2 derivative comprises 16, 16-dimethyl prostaglandin E2.
• the compound that attenuates PGE2 cataboiism comprises a compound, neutralizing peptide, or neutralizing antibody that inactivates or blocks 15- hydroxyprostaglandin dehydrogenase (15-PGDH) or inactivates or blocks a prostaglandin transporter (PTG or SLC02A1), which transports PGE2 inside the cells for cataboiism by 15- PGDH.
• the step of culturing the population of isolated muscle cells with the compound comprises acute, intermittent, or continuous exposure of the population of isolated muscle cells to the compound.
• the compound may be exposed to the isolated cells once in an acute manner.
• the compound may be exposed to the isolated cells at more than one time point such that time elapses between exposures.
• the compound may be exposed to the isolated cells continuously such that the level of compound in direct contact with the cells does not fall below a pre-selected amount.
• a method for promoting muscle cell engraftment in a subject includes culturing or contacting a population of isolated muscle cells with an effective amount of a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 cataboiism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof, to promote engraftment of the muscle cells in the subject; and administering the cultured or contacted muscle cells to the subject.
• PGE2 prostaglandin E2
• composition comprising a population of isolated muscle ceils and a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof.
• PGE2 prostaglandin E2
• the population of isolated muscle cells comprises skeletal muscle cells, smooth muscle cells, cardiac muscle cells, embryonic stem cell-derived muscle cells, induced pluripotent stem cell-derived muscle cells, dedifferentiated muscle cells, or a combination thereof.
• the population of isolated muscle cells comprises muscle stem, cells, satellite cells, myocytes, myoblasts, myotubes, myofibers, or a combination thereof.
• the composition can also include a pharmaceutically acceptable carrier.
• a kit comprising any of the compositions disclosed herein, and an instruction manual.
• a method for regenerating a population of muscle cells in a subject having a condition or disease associated with muscle damage, injury, or atrophy includes administering to the subject a therapeutically effective amount of a compound selected from, the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof, and a pharmaceutically acceptable carrier, to increase the population of muscle cells in the subject and/or to enhance muscle function in the subject.
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof
• a pharmaceutically acceptable carrier to increase the population of muscle cells in the subject and/or
• a method for stimulating the proliferation and/or expansion of a population of muscle cells in a subject having a condition or disease associated with muscle damage, injury, or atrophy includes administering to the subject a therapeutically effective amount of a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof, and a pharmaceutically acceptable carrier, to increase the population of muscle cells in the subject and/or to enhance muscle function in the subject.
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof
• a pharmaceutically acceptable carrier to increase the population of muscle cells in the
• the population of muscle cells comprises an endogenous population of muscle cells.
• the population of muscle cell s compri ses a population of isolated muscle cells that has been administered (e.g., injected or transplanted) to the subject.
• the population of muscle ceils comprises both an endogenous population of muscle cells and a population of isolated muscle cells that has been administered to the subject.
• the condition or disease associated with muscle damage, injur -, or atrophy is selected from the group consisting of acute muscle injur - or trauma, soft tissue hand injury, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, limb girdle muscular dystrophy, amyotrophic lateral sclerosis (ALS), distal muscular dystrophy (DD), inherited myopathies, myotonic muscular dystrophy (MDD), mitochondrial myopathies, myotubular myopathy (MM), myasthenia gravis (MG), congestive heart failure, periodic paralysis, polymyositis, rhabdomyolysis, dermatomyositis, cancer cachexia, AIDS cachexia, cardiac cachexia, stress induced urinary incontinence, and sarcopenia.
• DMD Duchenne muscular dystrophy
• ALS amyotrophic lateral sclerosis
• DD distal muscular dystrophy
• MDD inherited myopathies
• the population of muscle cells comprises skeletal muscle cells, smooth muscle cells, cardiac muscle cells, embryonic stem cell-derived muscle cells, induced pluripotent stem cell-derived muscle cells, dedifferentiated muscle cells, or a combination thereof.
• the population of muscle ceils comprises muscle stem cells, satellite cells, myocytes, myoblasts, myotubes, myofibers, or a combination thereof.
• the PGE2 derivative comprises 16, 16-dimethyl prostaglandin E2.
• the compound that attenuates PGE2 catabolism comprises a compound, neutralizing peptide, or neutralizing antibody that inactivates or blocks 15- hydroxyprostaglandin dehydrogenase (15-PGDH) or inactivates or blocks a prostaglandin transporter (PTG or SLC02A 1).
• the step of administering the compound comprises oral, intraperitoneal, intramuscular, intra-arterial, intradermal, subcutaneous, intravenous, or intracardiac administration.
• the compound is administered in accordance with an acute regimen.
• the acute regimen comprises acute exposure (e.g., a single dose) of the compound to the subject.
• the acute regimen comprises intermittent exposure (e.g., repeated doses) of the compound to the subject.
• an acute PGE2 regimen can comprise a series of intermittent (e.g., daily) doses of PGE2 over a desired period of time (e.g., over the course of 2, 3, 4, 5, 6, or 7 days).
• the step of administering further comprises administering a population of isolated muscle cells to the subject.
• the population of isolated muscle cells can be autologous to the subject.
• the population of isolated muscle cells can be allogeneic to the subject.
• the population of isolated muscle cells is substantially purified or purified.
• the population of isolated muscle cells is cultured with the compound prior to being administered to the subject.
• the step of culturing the population of isolated muscle cells with the compound can include acute, intermittent, or continuous exposure of the population of isolated muscle cells to the compound.
• Administering the population of isolated muscle cells can comprise injecting or transplanting the cells into the subject.
• the population of isolated muscle cells and the compound can be administered to the subject concomitantly. Alternatively, the population of isolated muscle cells and the compound can be administered to the subject sequentially.
• a method for preventing or treating a condition or disease associated with muscle damage, injury or atrophy in a subject in need thereof includes administering to the subject (i) a therapeutically effective amount of a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof, and a pharmaceutically acceptable carrier, and (ii) a population of isolated muscle cells, to prevent or treat the condition or disease associated with muscle damage, injury, or atrophy.
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof
• a pharmaceutically acceptable carrier and a population
• a method for stimulating the proliferation and/or expansion of a population of muscle cells in a subject having a condition or disease associated with muscle damage, injury, or atrophy by administering to the subject (i) a therapeutically effective amount of a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof, and a pharmaceutically acceptable carrier, and (ii) a population of isolated muscle cells.
• the population of muscle cells comprises an endogenous population of muscle cells.
• the population of muscle cells comprises the population of isolated muscle cells that has been administered (e.g., injected or transplanted) to the subject.
• the population of muscle cells comprises both an endogenous population of muscle cells and the population of isolated muscle cells that has been administered to the subject.
• the therapeutically effective amount of the compound comprises an amount that is sufficient to increase the population of endogenous muscle cells in the subject and/or to increase the population of isolated muscle cells that has been administered to the subject and/or to enhance muscle function in the subject.
• the PGE2 derivative comprises 16, 16-dimethyl prostaglandin E2.
• the compound that attenuates PGE2 cataboiism comprises a compound, neutralizing peptide, or neutralizing antibody that inactivates or blocks 15- hydroxyprostaglandin dehydrogenase ( 15-PGDH) or inactivates or blocks a prostaglandin transporter (PTG or SLC02A1).
• the population of muscle cells comprises skeletal muscle cells, smooth muscle cells, cardiac muscle ceils, embryonic stem cell-derived muscle cells, induced pluripotent stem cell-derived muscle cells, dedifferentiated muscle cells, or a combination thereof.
• the population of muscle cells comprises muscle stem cells, satellite cells, myocytes, myoblasts, rnyotubes, myofibers, or a combination thereof.
• the population of isolated muscle cells can be substantially purified or purified.
• the population of isolated muscle cells is cultured with the compound prior to being administered to the subject. In some cases, culturmg the population of isolated muscle cells with the compound comprises acute, intermittent, or continuous exposure of the population of isolated muscle cells to the compound.
• the population of isolated muscle cells is autologous to the subject. In other embodiments, the population of isolated muscle cells is allogeneic to the subject.
• Administration of the compound can be oral, intraperitoneal, intramuscular, intraarterial, intradermal, subcutaneous, intravenous, or intracardiac administration.
• the compound is administered in accordance with an acute regimen.
• the acute regimen comprises acute exposure (e.g., a single dose) of the compound to the subject.
• the acute regimen comprises intermittent exposure (e.g., repeated doses) of the compound to the subject.
• an acute PGE2 regimen can comprise a series of intermittent (e.g., daily) doses of PGE2 over a desired period of time (e.g., over the course of 2, 3, 4, 5, 6, or 7 days).
• Administration of the population of isolated muscle cells can include injecting or transplanting the cells into the subject.
• the compound and the population of isolated muscle cells can be administered to die subject concomitantly.
• the compound and the population of isolated muscle cells can be administered to the subject sequentially.
• the subject is suspected of having or at risk for developing the condition or disease associated with muscle damage, injury, or atrophy.
• the condition or disease associated with muscle damage, injury or atrophy is selected from the group consisting of acute muscle injury or trauma, soft, tissue hand injury, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, limb girdle muscular dystrophy, amyotrophic lateral sclerosis (ALS), distal muscular dystrophy (DD), inherited myopathies, myotonic muscular dystrophy (MOD), mitochondrial myopathies, myotubular myopathy (MM), myasthenia gravis (MG), congestive heart failure, periodic paralysis, polymyositis, rhabdomyolysis, dermatomyositis, cancer cachexia, AIDS cachexia, cardiac cachexia, stress induced urinary incontinence, and sarcopenia.
• DMD Duchenne muscular dystrophy
• ALS amyotrophic lateral sclerosis
• DD distal muscular dyst
• the methods include culturing or contacting a population of isolated muscle cells with prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, or a combination tliereof.
• PGE2 prostaglandin E2
• Hie compound can be added to any culture media used to maintain or propagate the cells.
• the compound can be any small molecule, prodrug, biological product, and the like that can mimic, activate, or stimulate PGE2 signaling.
• the compound is PGE2 (i.e. , dinoprostone), a synthetic PGE2 derivative (e.g. , 16, 16-dimethyl prostaglandin E2; dmPGE2), a synthetic PGE2 analog, a synthetic PGE2 variant, or a muscle-specific PGE2 variant.
• the compound is a PGE2 prodrug such as a prodrug of PGE2 that can be metabolized into a pharmacologically active PGE2 drug when exposed to muscle cells or in close proximity to muscle cells.
• the compound can be an agonist of anyone of the PGE2 receptors including PGE2 receptor 1, PGE2 receptor 2, PGE2 receptor 3, and PGE2 receptor 4.
• the agonist can specifically bind to or activate one or more PGE2 receptors.
• the compound can be a compound that attenuates, impedes, inhibits or decreases PGE2 catabolism such as a compound or neutralizing (blocking) antibody that inactivates or blocks an enzyme that degrades or metabolizes PGE2, e.g. , 15- hydrox -prostaglandin dehydrogenase ( 15-PGDH).
• the compound blocks, hinders or opposes inhibition of PGE2 and/or PGE2 synthesis, activity, and/or secretion.
• the compounds described herein can trigger proliferation of muscle cells including quiescent muscle cells.
• the population of isolated muscle cells can be a pure or substantially pure population of muscle cells such that at least about 90% of the muscle cells are a single type of muscle cell , in other embodiments, the population is a mixture of muscle cells wherein less than about 90% of the cells are of one type of cell.
• the muscle cells include skeletal muscle cells, smooth muscle cells, and/or cardiac muscle cells harvested from a subject.
• the muscle cells are generated or differentiated from embryonic stem cells, e.g. , human embryonic stem cells or induced pluripotent stem cells, e.g. , human induced pluripotent stem ceils.
• the muscle cells are dedifferentiated muscle cells.
• the population of isolated muscle cells comprises muscle stem cells, satellite cells, myocytes, myoblasts, myotubes, myofibers, or a combination thereof.
• the isolated muscle cells can be a pure or substantially pure population of muscle stem cells.
• the isolated muscle cells can be a pure or substantially pure population of satellite cells.
• the isolated muscle cells can a heterogeneous mixture of muscle stem cells, satellite cells, myocytes, myoblasts, myotubes, myofibers, or any combination thereof. As such, the mixture can include muscle stem cells and satellite cells, and optionally, myocytes.
• the muscle cells or the induced pluripotent stem cells are derived from a subject with a condition or disease associated with muscle damage, injury, or atrophy.
• the condition or disease associated with muscle damage, injury, or atrophy is acute muscle injury, tear or trauma, soft tissue hand injury, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, limb girdle muscular dystrophy, amyotrophic lateral sclerosis (ALS), distal muscular dystrophy (DD), inherited myopathies, myotonic muscular dystrophy (MDD), mitochondrial myopathies, myotubular myopathy (MM), myasthenia gravis (MG), congestive heart failure, periodic paralysis, polymyositis, rhabdomyolysis, dermatomyositis, cancer cachexia, AIDS cachexia, cardiac cachexia, stress induced urinary incontinence, sarcopenia or any combination thereof.
• DMD Duchenne muscular dystrophy
• ALS amyotrophic lateral sclerosis
• ex vivo methods for promoting muscle cell engraftment in a subject include culturing or contacting a population of isolated muscle cells with an effective amount of a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof, to promote engraftment of the muscle cells in the subject.
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof
• the methods also include administering the cultured or contacted muscle cells to the subject.
• the population of isolated muscle cells is autologous to the subject.
• the population of isolated muscle cells is allogeneic to the subject.
• the subject is a human.
• the subject has a condition or disease associated with muscle damage, injur ⁇ ', or atrophy.
• the methods further include administering to the subject a therapeutically effective amount of a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog tliereof, and a combination thereof, and a pharmaceutically acceptable carrier.
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog tliereof, and a combination thereof
• a pharmaceutically acceptable carrier a pharmaceutically acceptable carrier.
• the subject can be administered the compound before, simultaneously with, and/or after the cultured or contacted muscle cells are administered to the subject.
• the population of isolated muscle cells is cultured or contacted with the same compound that is administered to the subject.
• the population of isolated muscle cells is cultured or contacted with a compound that is different from the compound administered to the subject.
• the muscle cells can be obtained from any muscle of the body including, but not limited to, musculi pectoralis complex, latissimus dorsi, teres major and subscapularis, brachioradialis, biceps, brachiaiis, pronator quadratus, pronator teres, flexor carpi radialis, flexor carpi ulnaris, flexor digitorum superficial is., flexor digitorum profundus, flexor poilicis brevis, opponens poilicis, adductor poilicis, flexor poilicis brevis, iliopsoas, psoas, rectus abdominis, rectus femoris, gluteus maximus, gluteus minims, gluteus minims, gluteus minims, gluteus minims, gluteus minims, gluteus minims, gluteus minims, gluteus maxim
• the muscle cells are obtained from a particular muscle, expanded according to the method disclosed herein, and then transplanted back to the same muscle, or alternatively, transplanted to a different muscle.
• the source of the muscle cells and the transplantation site is the same muscle of a subject.
• the source of the muscle cells and the transplantation site are different muscles of a subject.
• the source of the muscle cells and the transplantation site is the same type of muscle from different subjects.
• the source of the muscle cells and the transplantation site are different types of muscle from different subjects.
• the compounds disclosed herein can be cultured with isolated muscle cells acutely, intermittently or continuously.
• the compound is exposed to the ceils in a single dose for a duration of time.
• the compound is exposed to the cells in at least two or more doses such that a period of time, e.g., a day, two days, a week or more, passes between closings.
• the compound is chronically or continuously exposed to the cells, e.g., without a change in the compound concentration or in the effect on the cells, over a duration of time.
• the methods provided herein can be used to regenerate or rejuvenate muscle in a subject, such as a human subject.
• Regeneration of muscle includes forming new muscle fibers from muscle stem cells, satellite cells, muscle progenitor cells, and any combination thereof.
• the methods are also useful for enhancing or augment muscle repair and/or maintenance.
• the PGE2 compounds of the present invention can be administered to a subject experiencing muscle degeneration or atrophy. Muscle atrophy can include loss of muscle mass and/or strength. It can affect any muscle of a subject.
• the subject in need of the compositions, methods, and kits provided herein is exhibiting or experiencing muscle loss due to, e.g. , age, inactivity, injury, disease, and any combmation thereof.
• compounds can activate muscle cell proliferation, differentiation, and/or fusion of muscle cells.
• the muscle tissue is regenerated.
• muscle function e.g., muscle mass, muscle strength, and/or muscle contraction
• muscle weakness and atrophy are ameliorated.
• the damaged muscle can be any muscle of the body, including but not limited to, mii scul i pectoralis complex, latissimus dorsi, teres major and subscapularis, brachioradialis, biceps, brachialis, pronator quadratus, pronator teres, flexor carpi radialis, flexor carpi ulnans, flexor digitorum superficialis, flexor digitorum profundus, flexor poilicis brevis, opponens poilicis, adductor poilicis, flexor poilicis brevis, iliopsoas, psoas, rectus abdominis, rectus femoris, gluteus maximus, gluteus minims, medial hamstrings, gastrocnemius, lateral hamstring, quadriceps mechanism, adductor longus, adductor brevis, add
• Subjects in need of muscle regeneration may have musculoskeletal injuries [e.g. , fractures, strains, sprains, acute injuries, overuse injuries, and the like), post-trauma damages to limbs or face, athletic injuries, post-fractures in the aged, soft tissue hand injuries, muscle atrophy (e.g., loss of muscle mass), Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, Fukuyama congenital muscular dystrophy (FCMD), limb-girdle muscular dystrophy (LGMD), congenital muscular dystrophy, facioscapulohumeral muscular dystrophy (FHMD), myotonic muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy, Emery-Dreifuss muscular dystrophy, myotonia congenita, myotonic dystrophy, other muscular dystrophies, muscle wasting disease, such as cachexia due to cancer, end stage renal disease (ESRD), acquired immune defici
• Non-limiting examples of neuromuscular diseases include, but are not limited to, acid maltase deficiency, amyotrophic lateral sclerosis, Andersen-Tawil syndrome, Becker muscular dystrophy, Becker myotonia congenita, Bethlem myopathy, bulbospinal muscular atrophy, carnitine deficiency, carnitine palmityl transferase deficiency, central core disease, centronuclear myopathy, Charcot-Marie-Tooth disease, congenital muscular dystrophy, congenital myasthenic syndromes, congenital myotonic dystrophy, Cori disease, Debrancher enzyme deficiency, Dejerine-Sottas disease, dermatomyositis, distal muscular dystrophy, Duchenne muscular dyst
• Muscle atrophy e.g. , muscle wasting
• normal aging e.g. , sarcopenia
• genetic abnormalities e.g. , mutations or single nucleotide polymorphisms
• poor nourishment e.g. , poor circulation
• loss of hormonal support e.g. , bedrest, immobilization of a limb in a cast, etc.
• aging damage to the nerve innervating the muscle, poliomyelitis, amyotrophic lateral sclerosis (ALS or Lou Gehrig's disease), heart failure, liver disease, diabetes, obesity, metabolic syndrome, demyelinating diseases (e.g.
• multiple sclerosis Charcot-Marie -Tooth disease, Pelizaeus-Merzbacher disease, encephalomyelitis, neuromyelitis optica, adrenoleukodystrophy, and Guillian-Barre syndrome
• denervation fatigue, exercise-induced muscle fatigue, frailty, neuromuscular disease, weakness, chronic pain, and the like.
• kits for regenerating muscle in a subject in need thereof by administering to the subject a therapeutically effective amount of a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof, and a pharmaceutically acceptable carrier, to increase the population of muscle cells and/or to enhance muscle function in the subject.
• PGE2 prostaglandin E2
• the population of muscle cells in the subject can include skeletal muscle cells, smooth muscle cells, cardiac muscle cells, embryonic stem cell-derived muscle cells, induced pluripotent stem cell-derived muscle cells, dedifferentiated muscle cells, or any combinations thereof. Additionally, the muscle cells in the subject can be muscle stem cells, satellite cells, myocytes, myoblasts, myotubes, myofibers, or any combination thereof.
• the compound can be administered to the subject by oral, intraperitoneal, intramuscular, intra-arterial, intradermal, subcutaneous, intravenous, or intracardiac administration. In some cases, the compound is administered directly to the dysfunctional, injured, damaged and/or atrophied muscle.
• the compound can be administered in accordance with an acute regimen (e.g., single or intermittent dosing) or a chronic regimen (e.g., continuous dosing).
• the subject is also administered a population of isolated (or isolated and purified) muscle cells that are either autologous or allogeneic to the subject.
• the cells can be isolated and/or purified by any method known to those of skill in the art.
• the cells can be a homogenous or heterogeneous population of muscle cells.
• the cells are stimulated to proliferate by culturing the cells with the PGE2 compound prior to administering them to the subject.
• the cells can be acutely, intermittently or continuously exposed to the compound during in vitro culturing.
• the population of muscle cells increases by at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 200%, at least about 500%, at least about 1000%, or more after culturing with the PGE2 compound.
• the compound of the present invention and the isolated muscle cells are administered to the subject concomitantly.
• the compound and the cultured muscle cells are administered to the subject concomitantly.
• the compound and the isolated muscle cells are administered to the subject sequentially.
• the compound and the cultured muscle cells are administered to the subject sequentially.
• the methods described herein can be used to increase the number of muscle fibers by at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 200%, at least about 500%, at least about 1000%, or more.
• the methods can increase the growth of a damaged, injured, atrophied, or degenerated muscle.
• the methods provided herein can be used to prevent or treat a condition or disease associated with muscle damage, injury, or atrophy in a subject in need thereof.
• the method can provide prophylactic treatment to a subject who is likely to experience muscle damage, injurs or atrophy.
• the subject can have a condition or disease with possible secondar ' symptoms that affect muscle.
• the subject has undergone a surgical or therapeutic intervention to treat the muscle condition or disease, and the method disclosed here is used to prevent or inhibit recurrence or relapse.
• the subject has any one of the conditions or diseases described herein that affects muscle.
• treatment encompasses administration of compounds and/or cells in an appropriate form prior to the onset of disease symptoms and/or after clinical manifestations, or other manifestations of the condition or disease to reduce disease severity, halt disease progression, or eliminate the disease.
• prevention of or “preventing” a disease includes prolonging or delaying the onset of symptoms of the condition or disease, preferably in a subject with increased susceptibility to the condition or disease.
• the method includes administering to the subject (i) a therapeutically effective amount of a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof, and a pharmaceutically acceptable carrier, and (ii) a population of isolated muscle cells, to prevent or treat the condition or disease associated with muscle damage, injury, or atrophy.
• PGE2 prostaglandin E2
• PGE2 prodrug e.g., a PGE2 prodrug
• PGE2 receptor agonist e.g., a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof
• a pharmaceutically acceptable carrier e.g., a pharmaceutically acceptable carrier
• the compound can be administered orally, intraperitoneal! ⁇ ', intramuscularly, intraarterial! ⁇ ', intradermal! ⁇ -, subcutaneous! ⁇ ', intravenously, or by intracardiac injection.
• the compound can be administered in accordance with an acute regimen (e.g., single or intermittent dosing) or a chronic regimen (e.g., continuous dosing).
• the isolated muscle cells can be administered by injection or transplantation.
• the compound and the cells are administered together or concomitantly.
• the compound and the cells are administered sequentially.
• the compound is administered before the cells.
• the cells are administered before the compound.
• the isolated muscle cells can be substantially purified or purified prior to injection or transplantation into the subject.
• the cells can also be expanded or stimulated to proliferate in culture prior to administration.
• isolated muscle cells including skeletal muscle cells, smooth muscle cells, cardiac muscle cells, embryonic stem cell-derived muscle cells, induced pluripotent stem cell-derived muscle cells, dedifferentiated muscle cells, muscle stem cells, satellite cells, myoblasts, myocytes, myotubes, myofibers, and any combination thereof can be cultured with the compounds of the present invention.
• myoblasts myocytes, myotubes, myofibers, and any combination thereof
• the expanded cells can be transplanted into a subject experiencing muscle damage, injury or atrophy.
• the compound of the present invention is selected from the group consisting of PGE2, a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof.
• a compound that attenuates PGE2 catabolism can be a compound, a neutralizing peptide, or a neutralizing antibody that inactivates or blocks 15-hydroxyprostaglandin dehydrogenase (15-PGDH) or inactivates or blocks a prostaglandin transporter, which transports PGE2 inside cells for catabolism by 15-PGDH.
• the prostaglandin transporter is also known as 2310021C19Rik, MATRl, Matrin F/Q, OATP2A1 , PGT, PHOAR2, SLC21A2, solute carrier organic anion transporter family member 2A1, and SLC02A 1.
• the PGE2 receptor agonist can be a small molecule compound, an activating antibody that specifically binds to a PGE2 receptor, and the like.
• the compound is a PGE2 derivative or analog.
• the compound is a PGE2 prodrug.
• a prodrug of PGE2 can be metabolized into a pharmacologically active PGE2 drug, for example, ai the site of administration or muscle regeneration, or when the prodrug is exposed to muscle cells.
• the compound is a PGE2 derivative or analog that contains one or more modifications to PGE2 that increase its stability, activity, resistance to degradation, transport into muscle cells (e.g., promote cellular uptake), and/or retention in muscle cells (e.g., reduce secretion from muscle cells after uptake).
• examples of PGE2 derivatives and analogs include 2,2-difluoro- 16-phenoxy-PGE2 compounds, 2-decarboxy ⁇ 2-hydroxymethyl-16-fiuoro ⁇ PGE2 compounds, 2-decarboxy-2-hydroxymethyl-l l -deoxy-PGE2 compounds, 19(R)-hydroxy PGE2, 16, 16- dimethyl PGE2, 16,16-dimethyl PGE2 p-(p-acetamidobenzamido) phenyl ester, 11-deoxy- 16, 16-dimethyl PGE2, 9-deoxy-9-methylene- 16,16-dimethyl PGE2, 9-deoxy-9-methylene PGE2, butaprost, sulprostone, enprostil, PGE2 serinol amide, PGE2 methyl ester, 16-phenyl tetranor PGE2, 5-trans-PGE2, 15(S)-15-methyl PGE2, and 15 (R)- 15 -methyl PGE2.
• PGE2 derivatives and analogs are set forth, e.g., in U.S. Patent No. 5,409,911.
• Additional non-limiting examples of PGE2 derivatives and analogs include hydantoin derivatives of PGE2, the more stable PGE2 analogs described in Zhao et al (Bioorganic & Medicinal Chemistry Letters, 17:6572-5 (2007)) in which the hydroxy cyclopentanone ring is replaced by heterocyclic rings and the unsaturated alpha-alkenyl chain is substituted with a phenethyl chain, the PGE2 analogs described in Ungrin et al. (Mol. Pharmacol.
• the compound is an agonist of a PGE2 receptor, e.g. , EP1 receptor, EP2 receptor, EP3 receptor, and EP4 receptor.
• PGE2 receptor agonists include QNG-Dl-004, QNG-AE1-259, ONO-AE-248, ONO-AE1-329, ONO-4819CD (Ono Pliarmaceiitical Co., Japan), L-902688 (Cayman Chemical), CAY 10598 (Cayman Chemical), and CP-533536 (Pfizer). Additional PGE2 receptor agonists are described, e.g., m U.S. Patent Nos. 6,410,591; 6,610,719; 6,747,037; 7,696,235; 7,662,839; 7,652,063; 7622,475; and 7,608,637.
• Muscle (myogenic) cells of the present invention include, but are not limited to, muscle stem cells, skeletal muscle stem cells, smooth muscle stem cells, cardiac muscle stem cells, muscle satellite cells, myogenic precursor cells, myogenic cells, myocytes, myoblasts, myotubes, postmitotic myotubes, multinucleated myofibers, and postmitotic muscle fibers.
• the isolated muscle cells encompass muscle stem cells.
• the isolated muscle cells include muscle satellite cells.
• the muscle cells can be derived from a stem cell such as a bone marrow-derived stem ceil, or a pluripotent stem cell such as an embryonic stem cell or an induced pluripotent stem cell .
• the isolated muscle cells include dedifferentiated muscle cells.
• the muscle cells have been genetically modified to, in some cases, correct disease-associated gene mutations.
• Satellite cells are small mononuclear progenitor cells that can reside within muscle tissue. These cells can be induced to proliferate and differentiate into muscle cells, and in some instances, fuse to muscle fibers. During muscle damage or injury, quiescent satellite cells ⁇ e.g., satellite cells that are not differentiating or undergoing cell division at present) and muscle stem cells can be activated to proliferate, and/or migrate out of the muscle stem cell niche. The satellite cells and muscle stem cells can also differentiate into myocytes, myoblasts, or other muscle cell types.
• muscle cells are obtained by biopsy from a muscle such as a mature or adult muscle, e.g.
• the muscle can be a skeletal muscle, smooth muscle, or cardiac muscle.
• Detailed descriptions of methods of isolating smooth muscle stem cells can be found, e.g. , in U.S. 8,747,838, and U.S. Patent App. Publ. No. 20070224167.
• Methods of isolating muscle cells of interest such as muscle stem, cells or satellite cells from, muscle tissue are described in detail, for example, in Blanco-Bose et al, Exp. Cell Res., 2001, 26592:212-220.
• Methods for purifying a population of muscle cells of interest include selecting, isolating or enriching for a cell having a specific cell surface marker or a specific polypeptide that is expressed on the cell surface of the muscle cell of interest.
• Useful cell surface markers are described in, e.g., Fukada et al., Front. Physiol, 2013, 4:317.
• Cell sorting methods such as flow cytometry, e.g., fluorescence-activated cell sorting (FACS); magnetic bead cell separation, e.g.
• the isolated population of muscle cells of interest can be expanded or multiplied using conventional culture-based methods. Methods for culture muscle cells are found in, e.g. , U.S. Patent No. 5,324,656. In some cases, the cells are cultured on a scaffold or gel such as a hydrogel.
• the compounds of the present invention can be administered locally at or near a site of injury in the subject or systemically .
• the compounds can be administered, for example, intraperitoneally, intramuscularly, intra-arteriaily, orally, intravenously, intracranially, intrathecal! ⁇ ', intraspinal! ⁇ -, intralesionally, intranasal! ⁇ ', subcutaneously, intracerebroventricu!arly, topically, and/or by inhalation.
• the compound may be administered simultaneously or sequentialiy with the muscle cells of interest. When the compound is administered simultaneous! ⁇ ' with the cells, both the compound and cells can be administered in the same composition. When administered separately, the compound can be provided in a pharmaceutically acceptable carrier.
• the compound is administered before or after the administration of the cells.
• the compound is administered in accordance with an acute regimen. In certain instances, the compound is administered to the subject once. In other instances, the compound is administered at one time point, and administered again at a second time point. In yet other instances, the compound is administered to the subject repeatedly (e.g.. once or twice daily) as intermittent doses over a short period of time (e.g., 2 days, 3 days, 4 days, 5 days, 6 days, a week, 2 weeks, 3 weeks, 4 weeks, a month, or more).
• the time between compound administrations is about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, a week, 2 weeks, 3 weeks, 4 weeks, a month, or more.
• the compound is administered continuously or chronically in accordance with a chronic regimen over a desired period of time.
• the compound can be administered such that the amount or level of the compound is substantially constant over a selected time period.
• Administration of the isolated muscle cells into a subject can be accomplished by methods generally used in the art. In some embodiments, administration is by transplantation or injection such as intramuscular injection.
• the number of cells introduced will take into consideration factors such as sex, age, weight, the types of disease or disorder, stage of the disorder, the percentage of the desired cells in the cell population (e.g. , purity of cell population), and the cell number needed to produce the desired result.
• the cells are given at a pharmacologically effective dose.
• pharmaceutically effective amount or “pharmacologically effective dose” is an amount sufficient to produce the desired physiological effect or amount capable of achieving the desired result, particularly for treating the condition or disease, including reducing or eliminating one or more symptoms or manifestations of the condition or disease.
• Pharmacologically effective doses will also apply to therapeutic compounds used in combination with the cells, as described herein.
• Cells can be administered in one injection, or through successive injections over a defined time period sufficient to generate a therapeutic effect. Different populations of muscle cells may be injected when treatment involves successive injections.
• a pharmaceutically acceptable carrier as further described below, may be used for injection of the cells into the subject. These will typically comprise, for example, buffered saline ⁇ e.g. , phosphate buffered saline) or unsuppieme ted basal cell culture medium, or medium as known in the art.
• any number of muscles of the body may be directly injected with the compound and/or cells of the present invention, such as, for example, the biceps muscle; the triceps muscle; the brachioradialus muscle; the brachialis muscle (brachiaiis amicus); the superficial compartment wrist flexors; the deltoid muscle; the biceps femoris, the gracilis, the semitendinosus and the semimembranosus muscles of the hamstrings; the rectus femoris, vastus lateralis, vastus medialis and vastus intermedins muscles of the quadriceps; the gastrocnemius (lateral and medial), tibialis anteri or, and the soleus muscles of the calves; the pectoralis major and the pectoralis minor muscles of the chest; the latissimus dorsi muscle of die upper back; die rhomboids (major and minor); the trapezius muscles that span die
• compositions of the compounds and cells of the present invention may comprise a pharmaceutically acceptable carrier.
• pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions of the present invention (see, e.g., REMINGTON ' S PHARMACEUTICAL SCIENCES, 18TH ED., Mack Publishing Co., Eastern, PA (1990)).
• pharmaceutically acceptable carrier comprises any of standard pharmaceutically accepted carriers known to those of ordinary skill in the art in formulating pharmaceutical compositions.
• the cells or compounds, by themselves, such as being present as pharmaceutically acceptable salts, or as conjugates may be prepared as formulations in pharmace tically acceptable diluents; for example, saline, phosphate buffer saline (PBS), aqueous ethanol, or solutions of glucose, mannitol, dextran, propylene glycol, oils (e.g.
• microcrystalline cellulose carboxymethyl cellulose, hydroxylpropyl methyl cellulose, magnesium stearate, calcium phosphate, gelatin, polysorbate 80 or die like, or as solid formulations in appropriate excipients.
• compositions will often further comprise one or more buffers (e.g. , neutral buffered saline or phosphate buffered saline), carbohydrates (e.g. , glucose, mannose, sucrose or dextrans), mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants (e.g.
• buffers e.g. , neutral buffered saline or phosphate buffered saline
• carbohydrates e.g. , glucose, mannose, sucrose or dextrans
• mannitol e.g., proteins, polypeptides or amino acids such as glycine
• antioxidants e.g.
• compositions of the invention are administered in a manner compatible with tl e dosage formulation, and in such amount as will be therapeutically effective.
• the quantity to be administered depends on a variety of factors including, e.g., the age, body weight, physical activity, and diet of the individual, the condition or disease to be treated, and the stage or severity of the condition or disease.
• the size of the dose may also be determined by the existence, nature, and extent of any adverse side effects that accompany the administration of a therapeutic agent(s) in a particular individual.
• the dose of the com pound may take the form of solid, semisolid, lyophilized powder, or liquid dosage forms, such as, for example, tablets, pills, pellets, capsules, powders, solutions, suspensions, emulsions, suppositories, retention enemas, creams, ointments, lotions, gels, aerosols, foams, or the like, preferably in unit dosage forms suitable for simple administration of precise dosages.
• unit dosage form refers to physically discrete units suitable as unitary dosages for humans and other mammals, each unit containing a predetermined quantity of a therapeutic agent calculated to produce the desired onset, tolerability, and/or therapeutic effects, in association with a suitable pharmaceutical excipient (e.g., an ampoule).
• a suitable pharmaceutical excipient e.g., an ampoule
• more concentrated dosage forms may be prepared, from which the more dilute unit dosage forms may then be produced.
• the more concentrated dosage forms thus will contain substantially more than, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times the amount of the therapeutic compound.
• the dosage forms typically include a conventional pharmaceutical carrier or excipient and may additionally include other medicinal agents, carriers, adjuvants, diluents, tissue permeation enhancers, solubilizers, and the like.
• Appropriate excipients can be tailored to the particular dosage form and route of administration by methods well known in the art (see, e.g., REMINGTON ' S PHARMACEUTICAL SCIENCES, supra).
• excipients include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, saline, syrup, methylceiiidose, ethylcellulose, hydroxypropyimethylceliulose, and poly-acrylic acids such as Carbopols, e.g., Carbopol 941, Carbopol 980, Carbopol 981, etc.
• Carbopols e.g., Carbopol 941, Carbopol 980, Carbopol 981, etc.
• the dosage forms can additionally include lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying agents; suspending agents; preserving agents such as methyl-, ethyl-, and propyl-hydroxy-benzoates (i.e., the parabens); pH adjusting agents such as inorganic and organic acids and bases; sweetening agents; and flavoring agents.
• the dosage forms may also comprise biodegradable polymer beads, dextran, and cyclodextrin inclusion complexes.
• the therapeutically effective dose can be in the form of tablets, capsules, emulsions, suspensions, solutions, syrups, sprays, lozenges, powders, and sustained-release formulations.
• Suitable excipients for oral administration include pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, gelatin, sucrose, magnesium carbonate, and the like.
• the therapeutically effective dose can also be provided in a lyophilized form.
• dosage forms may include a buffer, e.g., bicarbonate, for reconstitution prior to administration, or the buffer may be included in the lyophilized dosage form for reconstitution with, e.g., water.
• the lyophilized dosage form may further comprise a suitable vasoconstrictor, e.g., epinephrine.
• the lyophilized dosage fonn can be provided in a syringe, optionally packaged in combination with the buffer for reconstitution, such that the reconstituted dosage form can be immediately administered to an individual.
• kits comprising a population of isolated muscle cells and a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism (e.g., 15-hydroxyprostaglandin dehydrogenase (15-PGDH) inhibitor or prostaglandin transporter (PTG or SLC02A1 ) inhibitor), a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof.
• PGE2 prostaglandin E2
• PGE2 prodrug e.g., a PGE2 prodrug
• PGE2 receptor agonist e.g., a compound that attenuates PGE2 catabolism
• a compound that attenuates PGE2 catabolism e.g., 15-hydroxyprostaglandin dehydrogenase (15-PGDH) inhibitor or prostaglandin transporter (PTG or SLC02
• the kit typically contains containers which may be formed from a variety of materials such as glass or plastic, and can include for example, bottles, vials, syringes, and test tubes.
• a label typically accompanies the kit, and includes any writing or recorded material, which may be electronic or computer readable form providing instructions or other information for use of the kit contents.
• Example 1 Acute Prostaglandin E2 delivery augments skeletal muscle regeneration and strength in aged mice.
• PGE2 receptor is essential for MuSC proliferation in vitro and engraftment in vivo in mice.
• the PGE2 pathway is dysregulated due to a cell intrinsic molecular defect, elevated prostaglandin degrading enzyme (15-PGDH) that renders PGE2 inactive.
• This defect is overcome by transient acute exposure of MuSCs to a stable degradation-resistant PGE2, 16,16-dimethyl PGE2 (dmPGE2), concomitant with MuSC transplantation into injured muscles.
• dmPGE2 16,16-dimethyl PGE2
• a single intramuscular injection of dmPGE2 alone suffices to accelerate regeneration, evident by an early increase in endogenous MuSC numbers and myofiber sizes following injury.
• aged mouse muscle force generating capacity was increased in response to exercise-induced regeneration and an acute dmPGE2 treatment regimen.
• Our findings reveal a novel therapeutic indication for PGE2 as a potent inducer of muscle regeneration and strength.
• MuSCs also known as satellite cells
• a stem cell population dedicated to muscle regeneration 3"8 . Since a transient inflammatory and fibroadipogenic response plays a crucial role in muscle regeneration 14"1 ', we sought to identify inflammatory modulators induced by injury that could overcome the age-related decline in MuSC function.
• An analysis of our transcriptome database revealed that the Ptger4 receptor for PGE2, a natural and potent lipid mediator during acute inflammation 18 , was expressed at high levels on freshly isolated MuSCs.
• PGE2 is known to signal through four G-protein coupled receptors (Ptgerl-4; EP1- 4) 18 ' 20 , but the expression of these receptors in MuSCs has not previously been described.
• An analysis of the transcript levels of the different receptors (Ptgerl-4) revealed that the only receptors upregulated after PGE2 treatment of MuSCs are Ptgerl and Ptger4 (FIG. SE).
• PGE2 stimulated MuSCs had elevated intracellular cAMP l8,2 ° confirming that PGE2 signals through EP4 to promote proliferation and a stem cell transcriptional state (FIGS. 5F-5H).
• ONO-AE3-208 proliferation induced by PGE2 was blunted (FIG. ID).
• dmPGE2 we observed significantly enhanced engraftment of young and aged MuSCs relative to controls that was further increased in response to notexin injury, a well-accepted stringent test of stem cell function (FIGS. 3C-3D). Thus, the delivery of dmPGE2 together with MuSC cell populations suffices to augment regeneration.
• mice in the treatment group ran for 5 days in succession and were injected daily with dmPGE2 after exercise.
• aged mice in the treatment group ran for 5 consecutive days but received no additional treatment (FIG. 4L).
• the specific twitch and tetanic force were compared for dmPGE2 treated and untreated gastrocnemius mouse muscles (GA) and both were significantly increased (FIGS. 4M-4P).
• GA gastrocnemius mouse muscles
• FIGS. 4M-4P gastrocnemius mouse muscles
• Tierney, M. T. et al. STAT3 signaling controls satellite cell expansion and skeletal muscle repair. Nature medicine 20, 1 182-1186, doi: 10.1038/nm.3656 (2014), Arnold, L. et al. Inflammatory monocytes recruited after skeletal muscle injury switch into antiinflammatory macrophages to support myogenesis. The Journal of experimental medicine 204, 1057-1069, doi: 10.1084/jeni.20070075 (2007).
• mice expressing a firefly luciferase (luc) transgene under the regulation of the ubiquitous Actb promoter were maintained in the FVB strain.
• mice expressing a green fluorescent protein (GFP) transgene under the regulation of the ubiquitous UBC promoter were maintained in the C57BL/6 strain.
• Cultured cells were treated as indicated (vehicle or PGE2 treated lOng/ml) and collected from hydrogel cultures by incubation with 0.5% tiypsin in PBS for 2 min at 37 °C and counted using a hemocytometer.
• For fresh MuSCs transplantation we coinjected sorted cells with 3 nmol of 16,16-Dimethyl Prostaglandin E2 (dmPGE2) (Tocris, catalog # 4027) or vehicle control (PBS).
• 10 ⁇ of notexin (10 ⁇ g ml " '; Latoxan, France) to injure recipient muscles and to activate MuSCs in vivo.
• mice were treated with five consecutive daily intraperitoneal injections of tamoxifen to activate luciferase expression under the control of the Pax7 promoter.
• a week after the last tamoxifen injection mice were subjected to intramuscular injection of 10 ⁇ of cardiotoxin (10 ⁇ ; Latoxan), which we designated as day 0 of the assay.
• 10 ⁇ of cardiotoxin 10 ⁇ ; Latoxan
• 3 days later either 13 nmol dmPGE2 (13 nmol) or vehicle control (PBS) was injected into the TA muscle.
• the contralateral TA was used as an internal control. Bioiuminescence was assayed at days 3, 7, 10 and 14 post-injury.
• MuSC culture assays and transplantations were performed after 1 week of culture unless noted otherwise.
• For aged MuSCs transplant studies we infected MuSCs with lentivirus encoding elongation factor- l a promoter-driven luc-IRES-GFP (GFP/luc virus) for 24h in culture as described previously 5 .
• For EP4' 3 MuSCs studies we isolated MuSCs as described above (Muscle stem ceil isolation), and infected all cells with the GFP/luc virus and a subset of them was cointected with a lentivirus encoding pLM-CMV-R-Cre (mCherry/Cre vims) for 24h in culture.
• pLM-CMV-R-Cre was a gift from Michel Sadelain (Addgene plasmid # 27546) 7 .
• ⁇ 4" : ⁇ MuSCs were plated on hydrogels post-infection and treated for 24 hr with vehicle (DMSO) or 10 ng/ml PGE2, and proliferation was assayed 3 days later.
• the proliferation rates in the two intervals p ?A and p 48 and the corresponding death rates d 24 and d 4S are 5.38% per hour.
• Table 1 shows that the rates of proliferation and death in the two conditions are similar in the first time interval, and that the difference in cell numbers at the end of the experiment is due to differences in both the division rates and the death rates during the second time interval.
• the modeled cell counts in the two time intervals are given by
• RNA from MuSCs using the RNeasy Micro Kit (Qiagen). For muscle samples, we snap froze the tissue in liquid nitrogen, homogenized the tissues using a mortar and pestle, followed by syringe and needie trituration, and then isolated RNA using Trizol (Invitrogen). We re verse -transcribed cDNA from total mRNA from each sample using the SensiFASTTM cDNA Synthesis Kit (Bio!ine). We subjected cDNA to RT-PCR using SYBR Green PC Master Mix (Applied Biosystems) or TaqMan Assays (Applied Biosystems) in an ABI 7900HT Real-Time PCR System (Applied Biosvstems).
• GCTGTCATCACAGGCCAGA-3' reverse 5'-CTCCACATCTGGGTCACTCC-3'
• Ptgesl forward 5 '-CTCCTACAGGAAAGTGCCC A-3 ', reverse 5'- ACCAGGTAGGTCTTGAGGGC -3'
• Ptgerl forward 5' GTGGTGTCGTGCATCTGCT-3', reverse, 5' CCGCTGCAGGGAGTTAGAGT-3'
• Ptger2 forward 5'- ACCTTCGCCATATGCTCCTT-3 ', reverse 5 '-GGACCGGTGGCCTAAGTATG-3'.
• TaqMan Assays were used to quantify Pax7, Myogenin, Slco2al (PGT), Ptger5 ' and Ptger4 in samples according to the manufacturer instructions with the TaqMan Universal PCR Master Mix reagent kit (Applied Biosystems). Transcript levels were expressed relative to Gapdh levels.
• SYBR Green qPCR Gapdh qPCR was used to normalize input cDNA samples.
• FAM multiplex qPCR enabled target signals (FAM) to be normalized individually by their internal Gapdh signals (VIC).
• Muscle was harvested, rinsed in ice-cold PBS containing indomethacin (5.6 jig/ml), and snap frozen in liquid nitrogen. Frozen samples were pulverized in liquid nitrogen. The powder was transferred to an Eppendorf tube with 500 ⁇ of lysate buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 4 mM CaCl, 1.5% Triton X-100, protease inhibitors and mierococcal nuclease), and then homogenized using a tissue homogenizer.
• lysate buffer 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 4 mM CaCl, 1.5% Triton X-100, protease inhibitors and mierococcal nuclease
• the PGE2 level of the supernatant was measured using a PGE2 ELISA Kit (R&D Systems, catalog # KGE004B) and expressed relative to total protein measured by BCA assay (BioRad) and expressed as ng of PGE2. Each sample was assayed in duplicate and in each of two independent experiments. cAMP activity assay
• MuSCs were treated with DMSO (vehicle) or PGE2 ( 10 ng/ml) for lh and cyclic AMP levels measured according to the cAMP-Glo Assay protocol optimized by the manufacturer (Promega). Each sample was assayed in triplicate and in two independent experiments. Flow cytometry
• PGF2a; PGE2; PGD2: 15-keto PGE2; 13,14-dihydro 15-keto PGE2; PGE2-D4; and PGF2a-D9 - were purchased from Cayman Chemical.
• PGE2-D4 internal standard positions 3 and 4 were labeled with a total of four deuterium atoms.
• PGF2a-D9 positions 17, 18, 19 and 20 were labeled with a total of nine deuterium atoms.
• Analyte stock solutions (5 mg/mL) were prepared in DMSO. These stock solutions were serially diluted with acetonitrile/water (1 : 1 v/v) to obtain a series of standard working solutions, which were used to generate the calibration curve. Calibration curves were prepared by spiking 10 uL of each standard working solution into 200 ⁇ of homogenization buffer (acetone/water 1 : 1 v/v: 0.005% BHT to prevent oxidation) followed by addition of 10 uL internal standard solution (3000 ng/mL each PGF2a-D9 and PGE2-D4). A calibration curve was prepared fresh with each set of samples.
• Calibration curve ranges: for PGE2 and 13, 14-dihydro 15-keto PGE2, from 0.05 ng/mL to 500 ng/mL; for PGD2 and PGF2ce, from 0.1 ng/mL to 500 ng/mL; and for 15-keto PGE2, from 0.025 ng/mL to 500 ng/mL.
• SRM Selected reaction monitoring
• mice Aged mice (18 mo.) were subjected to downhill treadmill run for 2 consecutive weeks. During week 1, mice ran daily for 5 days and rested on days 6 and 7. Two hours after each treadmill run during week 1 , each (lateral and medial) gastrocne ius (GA) muscle from both legs of each mouse was injected with a dose of either PBS (vehicle control) or 13nM dmPGE2 (experimental group). During week 2, mice were subjected to 5 days treadmill run only. The treadmill run was performed using the Exer3/6 (Columbus Instruments). Mice ran for 10 minutes on the treadmill at 20 degrees downhill, starting at a speed of 7 meters/mm.
• PBS vehicle control
• 13nM dmPGE2 experimental group
• Tire lower limb was immobilized below the knee by a metal clamp without compromising the blood supply to the leg.
• the mouse was under inhaled anesthetic (2% isofluorane) during the entire force measuring procedure and body- temperature was maintained by a heat lamp.
• the GA muscles were stimulated via the proximal sciatic nerve using a bipolar electrical stimulation cuff delivering a constant current of 2 mA (square pulse width 0.1 ms). GA muscles were stimulated with a single 0.1-ms pulse for twitch force measurements, and a train of 150 Hz for 0.3 s pulses for tetanic force measurements.
• Satellite cells, connective tissue fibroblasts and their interactions are crucial for muscle regeneration. Development 138, 3625-3637, doi: 10.1242/dev.064162 (2011). 4 Safran, M. et al. Mouse reporter strain for noninvasive biolumine scent imaging of cells that have undergone Cre-mediated recombination. Molecular imaging 2, 297-
• Example 2 Increased Muscle Forces After Prostaglandin E2 (PGE2) Injection.
• This example shows an increase in specific twitch force of gastrocnemius muscles in aged mice injected with PGE2.
• the aged mice (18 months old) were subject to treadmill run to exhaustion daily for 10 days.
• the treadmill ran was performed using the Exer3/6 (Columbus Instalments). Mice ran on the treadmill at 20 degrees downhill, starting at a speed of 10 meters/min. After 3 min, the speed was increased 1 meter/min to a final speed of 20 meters/min. Exhaustion was defined as the inability of the animal to remain on the treadmill despite electrical prodding.
• 2 h after each treadmill ran both gastrocnemius muscles of each mouse were injected with either PBS (control group) or 3 nM PGE2 (experimental group).
• the force measurement was performed 4 weeks after the last treadmill run using a 300C-LR force transducer (Aurora Scientific) with a single 0.1 ms pulse at predetermined supramaximal stimulation intensity.
• FIGS. 4M-4N Representative raw muscle force traces of single gastrocnemius muscles are provided in FIGS. 4M-4N.
• the muscle force and synchronization pulses were recorded via a PCI-6251 acquisition card (National Instruments) and analyzed using Matlab.
• FIGS. 40-4P show the specific muscle force values that were calculated by normalizing the force measurements with the muscle physiological cross-sectional area.
• a method for stimulating the proliferation of a population of isolated muscle cells comprising:
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 caiabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof.
• the method of embodiment 1 wherein the population of isolated muscle cells is purified.
• the population of isolated muscle cells comprises skeletal muscle cells, smooth muscle cells, cardiac muscle cells, embryonic stem cell-derived muscle cells, induced pluripotent stem cell-derived muscle cells, dedifferentiated muscle cells, or a combination thereof,
• the condition or disease associated with muscle damage, injur ⁇ ', or atrophy is selected from the group consisting of acute muscle injury or trauma, soft tissue hand injury, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, limb girdle muscular dystrophy, amyotrophic lateral sclerosis (ALS), distal muscular dystrophy (DD), inherited myopathies, myotonic muscular dystrophy (MDD), mitochondria] myopathies, myotubular myopathy (MM), myasthenia gravis (MG), congestive heart failure, periodic paralysis, polymyositis, rhabdomyolysis, dermatomyositis, cancer cachexia, AIDS cachexia, cardiac cachexia, stress induced urinary incontinence, and sarcopenia.
• the PGE2 derivative comprises 16, 16-dimethyl prostaglandin E2.
• the compound that attenuates PGE2 caiabolism comprises a compound, neutralizing peptide, or neutralizing antibody that inactivates or blocks 15-hydroxyprostaglandin dehydrogenase (15-PGDH) or inactivates or blocks a prostaglandin transporter (PTG or SLC02A 1).
• culturmg the population of isolated muscle cells with the compound comprises acute, intermittent, or continuous exposure of the population of isolated muscle cells to the compound.
• a method for promoting muscle cell engraftment in a subject comprising:
• culturmg a population of isolated muscle cells with an effective amount of a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof, to promote engraftment of the muscle cells in the subject; and
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof
• invention 13 The method of embodiment 1 1 or 12, wherein the population of isolated muscle cells comprises skeletal muscle cells, smooth muscle cells, cardiac muscle cells, embryonic stem cell-derived muscle cells, induced piuripotent stem cell-derived muscle cells, dedifferentiated muscle cells, or a combination thereof.
• condition or disease associated with muscle damage, injury, or atrophy is selected from the group consisting of acute muscle injury or trauma, soft tissue hand injury, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, limb girdle muscular dystrophy, amyotrophic lateral sclerosis (ALS), distal muscular dystrophy (DD), inherited myopathies, myotonic muscular dystrophy (MDD), mitochondrial myopathies, myotubuiar myopathy (MM), myasthenia gravis (MG), congestive heart failure, periodic paralysis, polymyositis, rhabdomyolysis, dermatomyositis, cancer cachexia, AIDS cachexia, cardiac cachexia, stress induced urinary incontinence, and sarcopenia.
• DMD Duchenne muscular dystrophy
• ALS amyotrophic lateral sclerosis
• DD distal muscular dystrophy
• MDD inherited myopathies
• MM myotubu
• a composition comprising a population of isolated muscle ceils and a compound selected from the group consisting of prostaglandin E2 (PGE2), a PGE2 prodrug, a PGE2 receptor agonist, a compound that attenuates PGE2 catabolism, a compound that neutralizes PGE2 inhibition, a derivative thereof, an analog thereof, and a combination thereof.
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof.
• composition of embodiment 22, wherein the population of isolated muscle cells comprises skeletal muscle cells, smooth muscle ceils, cardiac muscle cells, embryonic stem cell-derived muscle cells, induced pluripotent stem cell-derived muscle cells, dedifferentiated muscle cells, or a combination thereof.
• composition of embodiment 22 or 23, wherein the population of isolated muscle cells comprises muscle stem cells, satellite cells, myocytes, myoblasts, myotubes, myofibers, or a combination thereof.
• a kit comprising the composition of any one of embodiments 22 to 25, and an instruction manual.
• 27. A method for regenerating a population of muscle cells in a subject having a condition or disease associated with muscle damage, injur -, or atrophy, the method comprising:
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof
• a pharmaceutically acceptable carrier to increase the population of muscle cells and/or to enhance muscle function in the subject.
• the condition or disease associated with muscle damage, injury, or atrophy is selected from the group consisting of acute muscle injurs or trauma, soft tissue hand injur ⁇ 7 , Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, limb girdle muscular dystrophy, amyotrophic lateral sclerosis (ALS), distal muscular dystrophy (DD), inherited myopathies, myotonic muscular dystrophy (MDD), mitochondrial myopathies, myotubuiar myopathy (MM), myasthenia gravis (MG), congestive heart failure, periodic paralysis, polymyositis, rhabdomyolysis, dermatomyositis, cancer cachexia, AIDS cachexia, cardiac cachexia, stress induced urinary incontinence, and sarcopenia.
• DMD Duchenne muscular dystrophy
• ALS amyotrophic lateral sclerosis
• DD distal muscular dystrophy
• MDD inherited myopathies
• the method of embodiment 27 or 28, wherein the population of muscle cells comprises skeletal muscle cells, smooth muscle cells, cardiac muscle cells, embryonic stem cell-derived muscle ceils, induced pluripotent stem cell-derived muscle cells, dedifferentiated muscle cells, or a combination thereof.
• administering further comprises administering a population of isolated muscle cells to the subject.
• administering the population of isolated muscle cells comprises injecting or transplanting the cells into the subject.
• PGE2 prostaglandin E2
• PGE2 prodrug a PGE2 prodrug
• PGE2 receptor agonist a compound that attenuates PGE2 catabolism
• a compound that neutralizes PGE2 inhibition a derivative thereof, an analog thereof, and a combination thereof
• a pharmaceutically acceptable carrier and
• the compound that attenuates PGE2 catabolism comprises a compound, neutralizing peptide, or neutralizing antibody that inactivates or blocks 15 -hydroxy-prostaglandin dehydrogenase (15-PGDH) or inactivates or blocks a prostaglandin transporter (PTG or SLC02A1).
• the population of isolated muscle cells comprises skeletal muscle cells, smooth muscle cells, cardiac muscle cells, embryonic stem cell-derived muscle cells, induced pluripotent stem cell-derived muscle cells, dedifferentiated muscle cells, or a combination thereof.
• administering the population of isolated muscle cells comprises injecting or transplanting the cells into the subject.
• condition or disease associated with muscle damage, injury- or atrophy is selected from the group consisting of acute muscle injury or trauma, soft tissue hand injury, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, limb girdle muscular dystrophy, amyotrophic lateral sclerosis (ALS), distal muscular dystrophy (DD), inherited myopathies, myotonic muscular dystrophy (MDD), mitochondrial myopathies, myotubular myopathy (MM), myasthenia gravis (MG), congestive heart failure, periodic paralysis, polymyositis, rhabdomyolysis, dermatornyositis, cancer cachexia, AIDS cachexia, cardiac cachexia, stress induced urinary incontinence, and sarcopenia.
• DMD Duchenne muscular dystrophy
• ALS amyotrophic lateral sclerosis
• DD distal muscular dystrophy
• MDD inherited myopathies
• MM myotubular my

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Medicinal Chemistry (AREA)
• Biomedical Technology (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Zoology (AREA)
• Biotechnology (AREA)
• Cell Biology (AREA)
• Genetics & Genomics (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Wood Science & Technology (AREA)
• Epidemiology (AREA)
• Rheumatology (AREA)
• Cardiology (AREA)
• Developmental Biology & Embryology (AREA)
• Immunology (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• General Engineering & Computer Science (AREA)
• Neurology (AREA)
• Physical Education & Sports Medicine (AREA)
• Orthopedic Medicine & Surgery (AREA)
• Virology (AREA)
• Heart & Thoracic Surgery (AREA)
• Vascular Medicine (AREA)
• Hospice & Palliative Care (AREA)
• Urology & Nephrology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Endocrinology (AREA)
• Hematology (AREA)

Priority Applications (22)

Applications Claiming Priority (4)

Related Child Applications (3)

Publications (1)

Family

ID=59743257

Family Applications (1)

Country Status (10)

Cited By (10)

Families Citing this family (2)

Citations (10)

Family Cites Families (16)

• 2017
  • 2017-03-03 JP JP2018546415A patent/JP2019513010A/ja not_active Withdrawn
  • 2017-03-03 EP EP24220295.0A patent/EP4538365A3/en active Pending
  • 2017-03-03 EP EP17760893.2A patent/EP3423067B1/en active Active
  • 2017-03-03 DK DK17760893.2T patent/DK3423067T3/da active
  • 2017-03-03 KR KR1020187028393A patent/KR102387896B1/ko active Active
  • 2017-03-03 WO PCT/US2017/020650 patent/WO2017152044A1/en not_active Ceased
  • 2017-03-03 KR KR1020227012174A patent/KR102481354B1/ko active Active
  • 2017-03-03 ES ES17760893T patent/ES3039622T3/es active Active
  • 2017-03-03 AU AU2017225999A patent/AU2017225999B2/en active Active
  • 2017-03-03 CN CN201780014836.9A patent/CN109072186B/zh active Active
  • 2017-03-03 CN CN202310631766.9A patent/CN116716241A/zh active Pending
  • 2017-03-03 CA CA3014667A patent/CA3014667A1/en active Pending
• 2022
  • 2022-06-01 JP JP2022089405A patent/JP2022116259A/ja active Pending
  • 2022-11-10 AU AU2022268368A patent/AU2022268368B2/en active Active
• 2024
  • 2024-03-25 US US18/615,080 patent/US20240415849A1/en active Pending
  • 2024-06-19 JP JP2024098418A patent/JP2024116386A/ja active Pending
  • 2024-12-04 US US18/968,148 patent/US20250090549A1/en active Pending
  • 2024-12-18 AU AU2024278535A patent/AU2024278535A1/en active Pending

Patent Citations (11)

Non-Patent Citations (63)

Also Published As

Similar Documents

Legal Events