WO2017142265A1 - 아디프산을 유효성분으로 함유하는 피부주름개선 및 피부탄력증진용 조성물 - Google Patents

아디프산을 유효성분으로 함유하는 피부주름개선 및 피부탄력증진용 조성물 Download PDF

Info

Publication number
WO2017142265A1
WO2017142265A1 PCT/KR2017/001528 KR2017001528W WO2017142265A1 WO 2017142265 A1 WO2017142265 A1 WO 2017142265A1 KR 2017001528 W KR2017001528 W KR 2017001528W WO 2017142265 A1 WO2017142265 A1 WO 2017142265A1
Authority
WO
WIPO (PCT)
Prior art keywords
skin
composition
adipic acid
elasticity
lotion
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2017/001528
Other languages
English (en)
French (fr)
Inventor
박태선
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of Yonsei University
Original Assignee
Industry Academic Cooperation Foundation of Yonsei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Academic Cooperation Foundation of Yonsei University filed Critical Industry Academic Cooperation Foundation of Yonsei University
Publication of WO2017142265A1 publication Critical patent/WO2017142265A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/194Carboxylic acids, e.g. valproic acid having two or more carboxyl groups, e.g. succinic, maleic or phthalic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/36Carboxylic acids; Salts or anhydrides thereof
    • A61K8/362Polycarboxylic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64Proteins; Peptides; Derivatives or degradation products thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/67Vitamins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/08Anti-ageing preparations

Definitions

  • the present invention relates to a composition for improving skin wrinkles and elasticity containing adipic acid as an active ingredient, and more particularly, to a cosmetic composition for improving wrinkles or enhancing elasticity containing adipic acid as an active ingredient, an external preparation for skin, food
  • the present invention relates to a method for improving skin wrinkles or enhancing skin elasticity using a composition and a composition comprising a pharmaceutical composition and adipic acid as an active ingredient.
  • the skin is composed of three layers: epidermis, dermis and hypodermis.
  • the epidermis especially the stratum corneum, which is the outermost layer of the epidermis, acts as a skin barrier, preventing the loss of moisture and electrolyte from the skin.
  • the dermal layer plays a role in maintaining the elasticity of the skin and supporting the structure through collagen and elastin synthesis.
  • collagen and elastin are major proteins produced in fibroblasts and are involved in skin mechanical firmness, tissue binding strength and elasticity.
  • Collagen forms various isoforms according to the form and structural features, and there are 28 kinds of collagen isotypes in human tissues. Among them, collagen is present in types 1, 3. 4. 6. 7. 13, 14, 17 and the like are known. Collagen types 1 and 3 make up the interstitial components of the dermal layer, and collagen type 7 is the major component of the dermal and epidermal junctions.
  • Type 1 collagen is the largest amount of extracellular matrix protein in skin connective tissue, and other proteins such as elastin, fibronectin, integrin, fibrin, and proteoglycan are present.
  • the newly synthesized procollagen is hydroxylated at the proline and lysine amino acid residues and is secreted into the extracellular space in the form of three strands of twisted helix.
  • procollagen is cut off at both ends by procollagen proteinase to form collagen protein, and the latter form microfibrils of triple helix configuration, and microfibrils are leucine-rich small proteoglycans.
  • the fibrils thus formed form collagen fibers that provide skin binding and elasticity.
  • Skin aging is known to decrease collagen content, a protein that accounts for most of the collagen of skin dermis. Collagen decreases the skin's tension and strength. have. Skin aging is largely divided into endogenous aging due to physiological aging and photoaging caused by continuous ultraviolet radiation (UV) exposure. Repeated ultraviolet exposure results in increased collagen degrading enzymes and causing denaturation and destruction of collagen fibers, reducing the elasticity of the skin and promoting the production of wrinkles.
  • UV continuous ultraviolet radiation
  • the present inventors also conducted research to develop a food or cosmetic material that is effective in improving wrinkles by inhibiting the action of collagen degrading enzymes in natural products with few side effects and promoting collagen synthesis.
  • adipic acid which has been used only for the use of acidity regulators until now, has the effect of enhancing skin elasticity and alleviating skin wrinkles, and completed the present invention.
  • the present inventors have completed the present invention by developing a cosmetic composition, skin external preparation, food and pharmaceutical compositions for improving wrinkles or skin elasticity containing adipic acid as an active ingredient.
  • an object of the present invention is to provide a cosmetic composition, skin external composition, food composition and pharmaceutical composition for improving wrinkles or enhancing skin elasticity containing adipic acid as an active ingredient.
  • Still another object of the present invention is to provide a method for improving skin wrinkles or improving skin elasticity using a composition containing adipic acid as an active ingredient.
  • the present invention provides a cosmetic composition for improving wrinkles containing adipic acid as an active ingredient.
  • adipic acid may be included in 0.0001 to 20% by weight based on the total weight of the cosmetic.
  • the composition of the present invention has at least one effect selected from the group consisting of increased procollagen secretion, promoting collagen biosynthesis, reducing the expression of the MMP-1 gene and inhibiting the formation of skin stratum corneum. It may be to have.
  • the cosmetic of the present invention skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisturizing lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream , Essence, Pack, Mask Pack, Mask Sheet, Soap, Shampoo, Cleansing Foam, Cleansing Lotion, Cleansing Cream, Body Lotion, Body Cleanser, Latex, Press Powder, Loose Powder and Eye Shadow have.
  • composition of the present invention may further comprise a cosmetically acceptable carrier.
  • the composition of the present invention may further comprise a skin wrinkle improvement component or skin elasticity enhancing component.
  • the skin wrinkle improvement component or skin elasticity enhancing component may be specifically selected from the group consisting of vitamin C, retinoic acid, TGF, protein from animal placenta, betulinic acid and chlorella extract.
  • the present invention also provides a skin external composition for improving wrinkles containing adipic acid as an active ingredient.
  • the present invention also provides a food composition for improving wrinkles containing adipic acid as an active ingredient.
  • the food of the present invention may be prepared in any one formulation selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and rings.
  • the present invention also provides a pharmaceutical composition for improving wrinkles containing adipic acid as an active ingredient.
  • the present invention also provides a cosmetic composition for enhancing skin elasticity, a skin external preparation, a food composition and a pharmaceutical composition containing adipic acid as an active ingredient.
  • the present invention also provides a method for improving skin wrinkles or improving skin elasticity using a composition containing adipic acid as an active ingredient.
  • adipic acid may be included in 0.0001 to 20% by weight based on the total weight of the composition.
  • the composition of the present invention has at least one effect selected from the group consisting of increased procollagen secretion, promoting collagen biosynthesis, reducing the expression of the MMP-1 gene and inhibiting the formation of skin stratum corneum. It may be to have.
  • the composition may be the cosmetic composition, the skin external composition, the food composition or the pharmaceutical composition.
  • the present invention provides a cosmetic composition, skin external composition, food composition and pharmaceutical composition for improving wrinkles or improving elasticity containing adipic acid as an active ingredient.
  • the composition containing adipic acid has an effect of increasing the amount of procollagen secretion, promoting collagen biosynthesis, decreasing the expression of the MMP-1 gene and inhibiting skin thickening of the skin epidermis, which is effective in improving skin wrinkles or enhancing skin elasticity.
  • 1 is a graph measuring procollagen secretion in human dermal fibroblasts (-UVB: control group not treated with UVB, + UVB: control group treated with UVB, AA: experimental group treated with adipic acid after irradiation with UVB, VitC: control group treated with vitamin C after UVB irradiation, AA + VitC: experimental group treated with adipic acid and vitamin C after UVB irradiation).
  • Figure 2 is an electrophoresis picture and a graph measuring the amount of procollagen and MMP-1 gene expression in human fibroblasts.
  • Figure 3 is a graph showing the weight gain (A and B) and the dietary intake (C and D) of mice fed the experimental diet.
  • Figure 4 is a graph measuring the water content (A), water evaporation (B), elasticity (C) and erythema index (D) of the mouse skin tissue ingested experimental diet.
  • 5 is a photograph of the back skin tissue of a mouse fed an experimental diet.
  • Figure 6 is a photograph (A) and a graph (B) showing the degree of wrinkle formation of skin tissues, such as mice fed the experimental diet.
  • Figure 7 is a graph (A) and a picture (B) showing the skin thickness of the mouse fed the experimental diet.
  • FIG. 8 is an electrophoretic photograph and graph showing changes in collagen and MMPs gene expression in adipic acid-treated mouse back tissues.
  • FIG. 9 is a graph measuring the elastin gene expression of mouse skin tissues fed an experimental diet containing adipic acid.
  • composition containing adipic acid provided by the present invention has an effect of increasing the amount of procollagen secretion, promoting collagen biosynthesis, decreasing the expression of MMP-1 gene and inhibiting skin thickening of the skin epidermis, thereby improving skin wrinkles or enhancing skin elasticity. .
  • the present invention provides a cosmetic composition for improving wrinkles or enhancing elasticity containing adipic acid as an active ingredient.
  • Adipic acid is a carboxyl compound contained in sugar beet, gambir, and the like; adipic acid, adipic acid, 1,4-butanedicarboxylic acid; 1,6-hexanedioic acid; acifloctin; acinetten; adipinic acid; hexanedioic acid; Also called octafluorohexanedioic acid.
  • Adipic acid of the present invention can be obtained by extraction, separation and purification from various plants including adipic acid.
  • Cas No. 124-04-9 and the adipic acid is a structural formula is C 6 H 10 O 4, and the molecular weight of 146.1 g / mol.
  • the specific structure is shown in the following formula (1).
  • Adipic acid is a combustible material and can be electrostatically charged in dry places by vortexing, air transport, injection and the like. Decomposes to heat to produce corrosive chemical gases and toxic substances containing valeric acid and other substances.
  • Adipic acid is registered as a food additive with the use of "acid regulator" in the Korean Food Code, and is registered as a pH regulator in the Food and Color Additive Database of the US FDA.
  • Adipic acid is added as a yeast acidifier to baking powder and as an acidifier to fruit flavored juices and concentrated powders of bottled drinks. It can also be used to improve the melting properties and texture of processed cheese and cheese spreads.
  • Adipic acid can be added to foam well into products containing egg whites and can be used as a gel generator in jams and jellies.
  • Adipic acid has been added to foods as a buffer and neutralizer, used as a raw material for pharmaceuticals and as a perfume fixative.
  • adipic acid has been reported to be anti-chitogenic and antihypertensive.
  • Adipic acid has been reported to improve ketosis caused by long-chain and short-chain monocarboxylic acids in rats.
  • amlodipine adipate was ingested for eight weeks, resulting in improved blood pressure.
  • adipic acid there is no known effect of adipic acid on improving skin elasticity and reducing skin wrinkles.
  • LD 50 obtained by administration of adipic acid by the method of inhalation, intravenous injection, oral administration, intraperitoneal injection in various kinds of experimental animals is shown in [Table 1] and the weight of 11,000 mg / kg when orally administered to mice Reported as.
  • Adipic Acid Toxicity Report End point Animal species Route of administration Volume Toxic effect Reference TDL0 Rat oral- 140 g / kg / 5 weeks (intermittent) Overexercise, diarrhea, weight loss or weight loss FAO Nutrition Meetings Report Series, 40,1 (1967) LD50 Rat Abdominal cavity 275 mg / kg Drowsiness (overall suppressed activity), other changes, bleeding H.J. Horn et al., Agric. Food Chem, 5: 759-762, 1957. LD50 mouse oral- 1,900 mg / kg Gastrointestinal changes H.J. Horn et al., Agric. Food Chem, 5: 759-762, 1957.
  • adipic acid (2, 20, 200 ⁇ g / ml) and a positive control and negative control compound, there was no obvious abnormality of the chromosome.
  • adipic acid was administered at 3.75, 37.5, and 375 mg / kg / day for 5 consecutive days to evaluate myeloid cell chromosome abnormalities.
  • adipic acid is only partially metabolized after ingestion in the human body and the remainder is excreted in the urine without change. For example, it has been reported that rats receive 0.75 g of adipic acid per day for four weeks and no residues of adipic acid have been detected in tissues sacrificed three days after stopping ingestion. Adipic acid has been reported to be metabolized to succinic acid and acetic acid through beta oxidation, and then to other normal intermediate metabolites. Metabolites detected in urine after ingestion of radioactive adipic acid in fasting rats , Glutamic acid, lactic acid, beta ketoadipic acid and citric acid.
  • adipic acid at low concentrations in particular from 0.001 to 3000 mg / kg, more preferably from 0.001 to 1500 mg / kg, is not very toxic or cosmetic compositions, skin preparations, food compositions or pharmaceutical compositions.
  • adipic acid at low concentrations in particular from 0.001 to 3000 mg / kg, more preferably from 0.001 to 1500 mg / kg, is not very toxic or cosmetic compositions, skin preparations, food compositions or pharmaceutical compositions.
  • the term "improve skin wrinkles or enhance elasticity” means to maintain or enhance the ability to relate to wrinkles and elasticity of the skin.
  • Collagen (collagen) and elastic fiber elastin (collagen) in the dermal layer of the skin is the main protein that plays a role in the skin elasticity, collagen biosynthesis is affected by the internal and external skin.
  • the skin cells are reduced in cell activity due to natural aging, the collagen fibers are reduced, or the active oxygen produced by excessive irradiation of ultraviolet rays or stress as an external factor, the thiol group of the protein (thiol: -SH)
  • the enzyme activity or by increasing the expression of degradation enzymes, such as collagen, elastin, increase the wrinkles of the skin and decrease the elasticity, the skin aging progresses.
  • Adipic acid contained in the cosmetic composition described in the present invention may be included in 0.0001 to 20% by weight relative to the total weight of the cosmetic. Less than 0.0001% by weight of adipic acid in the cosmetics may be a small amount of the effect of improving wrinkles, and more than 20% by weight of adipic acid may exhibit known toxicity.
  • composition of the present invention may have one or more effects selected from the group consisting of increased procollagen secretion, promotion of collagen biosynthesis, decreased expression of MMP-1 gene, and inhibition of stratum corneum formation.
  • the human skin fibroblasts were treated with UV irradiation with drugs to measure the amount of procollagen and procollagen type I C-peptide (PIP) secreted into the extracellular matrix.
  • procollagen secretion was significantly decreased in control cells (+ UVB) irradiated with ultraviolet rays, compared to normal cells (-UVB).
  • the amount of collagen was increased by 18% compared to + UVB).
  • the amount of collagen was significantly increased by 50% compared to the control cells (+ UVB), which was treated with vitamin C (+ 27%) or adipic acid (+ 18%) alone.
  • the values were higher than the amount of collagen observed in one cell (see Figure 1).
  • the expression of collagen type 1 ⁇ 1 and ⁇ 2, and collagen type 3 ⁇ 1 were significantly increased in the adipic acid-intake group compared to the + UVB control group, and MMP-1a and -1b, MMP-3, And MMP-9 gene expression was significantly reduced (see Figure 8), elastin expression was significantly increased (see Figure 9).
  • adipic acid increases collagen protein synthesis in the subcutaneous tissue and inhibits degradation of collagen fibers, thereby alleviating wrinkles caused by UV irradiation.
  • the procollagen and MMP-1 gene expression changes after treatment of the drug in human skin fibroblasts, as shown in Figure 2, adipic acid significantly reduced pro-UV While expression of collagen was significantly increased, MMP-1 gene expression significantly increased by ultraviolet light was significantly decreased.
  • Such gene expression control efficacy of adipic acid was shown to be similar to vitamin C (see Figure 2).
  • the term "cosmetic composition” is a composition comprising the compound, the formulation may be in any form.
  • formulations include cosmetics prepared using the composition, such as nutrition creams, eye creams, massage creams, creams such as cleansing creams, packs, lotions such as nutrient lotions, essences, soft cosmetics, and nutrient cosmetics.
  • powders, foundations, makeup bases, and the like and may be prepared and commercialized in any of these forms to achieve the object of the present invention, and are not limited to the above examples.
  • the cosmetic composition according to the present invention can be formulated by a conventional cosmetic preparation method.
  • the cosmetics of the present invention include skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisturizing lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, essence, pack, mask pack, mask sheet It may be one having a formulation selected from the group consisting of, soap, shampoo, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, emulsion, press powder, loose powder and eye shadow.
  • the cosmetic composition of the present invention may further include a cosmetically acceptable carrier, and it is possible to apply and formulate as needed the usual ingredients to be formulated in general skin cosmetics.
  • the cosmetic composition of the present invention may further include a transdermal penetration enhancer.
  • transdermal penetration enhancer is a composition that allows a desired component to penetrate into the blood vessel cells of the skin at a high absorption rate.
  • phospholipid components, liposome components and the like used in lecithin cosmetics are included, but are not limited to these.
  • oil which can be mainly used as an oil phase component
  • one or more selected from vegetable oil, mineral oil, silicone oil and synthetic oil can be used. More specifically, mineral oil, cyclomethicone, squalane, octyldodecyl myristate, olive oil, Vitis binifera seed oil, macadamia nut oil, glyceryl octanoate, castor oil, ethylhexyl isononanoate, dimethicone Chicon, cyclopentasiloxane, sunflower seed oil and the like can be used.
  • a surfactant may be added to reinforce the emulsifying ability.
  • surfactants may be used conventional surfactants such as nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, phospholipids, and the like, specifically, sorbitan sesquinolate, polysorbate 60 , Glyceryl stearate, lipophilic glyceryl stearate, sorbitan oleate, sorbitan stearate, die-cetyl phosphate, sorbitan stearate / sucrosecoate, glyceryl stearate / polyethylene glycol-100 Stearate, ceteareth-6 oleate, arachidyl alcohol / behenyl alcohol / arachidyl glucoside.
  • Polypropylene glycol-26-butes-26 / polyethylene glycol-40 hydrogenated castor oil and the like can be used.
  • alcohols having 12 to 20 carbon atoms such as cetyl alcohol, stearyl alcohol, octyldodecanol, isostearyl alcohol, etc. may be used alone or in combination of one or more thereof.
  • the aqueous phase component may further add 0.001 to 5% by weight of one or more thickeners such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate and the like to adjust the viscosity or hardness of the aqueous phase.
  • thickeners such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate and the like to adjust the viscosity or hardness of the aqueous phase.
  • the cosmetic composition of the present invention if necessary, active ingredients such as higher fatty acids, vitamins, sunscreens, antioxidants (butylhydroxyanisole, propyl gallic acid, elixolic acid, tocopheryl acetate, butylated hydroxy) Toluene), preservatives (methylparaben, butylparaben, propylparaben, phenoxyethanol, imidazolidinylurea, chlorphenesin, etc.), colorants, pH adjusters (triethanolamine, citric acid, citric acid, sodium citrate, malic acid, Sodium malic acid, fmaric acid, sodium pramate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogen phosphate, etc., moisturizers (glycerine, sorbitol, propylene glycol, butylene glycol, hexylene glycol, diglycerin , Betaine, glycerin-26, methylgluse-20 and the like), lubric acid,
  • the cosmetic composition of the present invention further comprises a substance capable of auxiliaryly providing essential nutrients to the skin, and may preferably contain auxiliary agents including, but not limited to, natural flavors, cosmetic flavors, or herbal medicines. have.
  • the cosmetic composition of the present invention may further comprise a skin wrinkle improvement component or skin elasticity enhancing component.
  • the specific skin wrinkle improving component or skin elasticity enhancing component may be any one or more selected from the group consisting of vitamin C, retinoic acid, TGF, protein from animal placenta, betulinic acid and chlorella extract, most preferably Vitamin C.
  • the present invention provides an external composition for improving wrinkles or enhancing elasticity containing adipic acid as an active ingredient.
  • the external preparation composition of the present invention is used for the purpose of improving the wrinkles of the skin, preventing the formation of wrinkles and delaying them, and is not particularly limited in the formulation thereof.
  • softening water, nourishing cosmetics, massage It may be a cosmetic composition having a formulation of a cream, a nourishing cream, a pack, a mask pack, a mask sheet, a gel or a skin adhesive cosmetic, and may also be a transdermal formulation such as a lotion, an ointment, a gel, a cream, a patch or a spray. have.
  • the present invention provides a food composition for improving wrinkles or enhancing elasticity containing adipic acid as an active ingredient.
  • the food composition of the present invention may be prepared in any one formulation selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and rings.
  • Food composition according to the present invention may be formulated in the form of powder, liquid, tablets, soft capsules, granules, tea bags, instant tea or drink by including adipic acid as an active ingredient.
  • the content of adipic acid as an active ingredient can be suitably determined depending on the purpose of use (prevention or improvement).
  • the amount of adipic acid included in the food composition may be added at 0.1 to 90% by weight of the total food weight. However, in the case of prolonged intake for health and hygiene purposes or health control purposes, the amount may be below the above range.
  • the food composition according to the present invention in addition to adipic acid, other ingredients that can give a synergistic effect to the main effect, preferably within the range of not impairing the main effect of the present invention, such as vitamin C.
  • Wrinkle improvement compounds or natural extracts such as green tea extract, mulberry extract, licorice extract, lettuce extract, betel nut extract, golden extract, wild ginseng extract.
  • the food composition formulated in such a form may be added to the food as it is, or used with other foods or food ingredients, and may be appropriately used according to conventional methods.
  • foods include drinks, meats, sausages, breads, biscuits, rice cakes, chocolate, candy, snacks, confectionery, pizza, ramen, dairy products including other noodles, gums, ice creams, various soups, beverages, alcoholic beverages and vitamin complexes. , Dairy products and dairy products, and all functional foods in the conventional sense.
  • the food composition of the present invention when the food composition of the present invention is a drink, it contains adipic acid as an essential ingredient in the ratio indicated, and there are no particular limitations on other ingredients used for the manufacture of other drinks, and various flavors such as ordinary drinks or Natural carbohydrates and the like may be included as additional components.
  • natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • a natural flavoring agent, a synthetic flavoring agent, etc. can be used as a flavoring agent other than the above-mentioned.
  • the proportion of such natural carbohydrates is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.
  • the food composition of the present invention is a variety of nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, coloring and neutralizing agents (such as cheese, chocolate), pectic acid and salts thereof, alginic acid and its Salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks, and the like.
  • the food composition of the present invention may contain a pulp for producing natural fruit juice and fruit juice beverage and vegetable beverage. These components can be used independently or in combination. The proportion of such additives is not so critical but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of adipic acid of the present invention.
  • the present invention provides a pharmaceutical composition for improving wrinkles or enhancing elasticity containing adipic acid as an active ingredient.
  • the compound of the present invention has a skin aging inhibitory effect by inhibiting the cellular aging and the generation of reactive oxygen species by UV, and by promoting the expression of extracellular matrix protein in the skin cells, it is effective in improving wrinkles of the skin, thereby inhibiting skin aging. Or it may be used as a pharmaceutical composition for improving skin wrinkles.
  • the throughput of the pharmaceutical composition for improving wrinkles or enhancing skin elasticity used in the present invention should be a pharmaceutically effective amount.
  • pharmaceutically effective amount refers to an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level may refer to an individual type and severity, age, sex, It can be determined according to the type of virus infected, the activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of treatment, factors including the drug used concurrently and other factors well known in the medical arts. Effective amounts may vary depending on the route of treatment, the use of excipients, and the possibility of use with other agents, as will be appreciated by those skilled in the art.
  • compositions for improving wrinkles or enhancing skin elasticity of the present invention may be prepared in pharmaceutical formulations using methods well known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal. Can be.
  • the active ingredient is mixed or diluted with the carrier or enclosed in a carrier in the form of a container.
  • the pharmaceutical composition for improving wrinkles or enhancing skin elasticity of the present invention may be in the form of powder, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, oral formulations, external preparations and patches according to conventional methods. It may be formulated and used further and may further comprise suitable carriers, excipients or diluents commonly used in the manufacture of compositions.
  • carriers, excipients and diluents that may be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium Phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used.
  • the pharmaceutical composition of the present invention may be added and used in the manufacture of quasi-drugs for the purpose of inhibiting skin aging or skin wrinkle improvement.
  • the pharmaceutical composition of the present invention is used as an quasi-drug additive, the compound may be added as it is or used with other quasi-drug or quasi-drug components, and may be appropriately used according to a conventional method.
  • the mixed amount of the active ingredient may be suitably determined depending on the purpose of use (prevention, health or therapeutic treatment).
  • the quasi-drug may be a disinfectant cleaner, shower foam, gagreen, wet tissue, detergent soap, hand wash, humidifier filler, mask, ointment, coating agent or filter filler.
  • the present invention also provides a method for improving skin wrinkles or improving skin elasticity using a composition containing adipic acid as an active ingredient.
  • Example One Human skin fibroblasts Wrinkle improvement effect of adipic acid
  • Normal human dermal fibroblasts (neonatal foreskin) were purchased from ATCC (Manassas, VA, USA) and used. The purchased cells were incubated in a 37%, 5% CO 2 incubator using a fibroblast growth medium (Promo Cell, Heidelberg) and used for the experiment.
  • human fibroblasts were dispensed in 12 well-plates at 1.0 ⁇ 10 6 cells / well, and adipic acid and vitamin C were added at a concentration of 100 ⁇ M and incubated in a CO 2 incubator for 24 hours. After removing the medium of each well, washed once with PBS, and again put 1 ml of PBS and irradiated with ultraviolet B (UVB) at 20 mJ / cm 2 conditions. PBS of each well was replaced with medium again and cultured for 24 hours, and then the amount of procollagen secreted into the medium was measured using a procollagen type I C-peptide EIA kit (Takara bio, Japan). The standard solution included in the collagen measurement kit was diluted by concentration, and the absorbance was measured at 450 nm to prepare a standard concentration curve and calculate the amount of collagen produced.
  • UVB ultraviolet B
  • UV / VIS spectrophotometer (Beckman coulter, DU730) was used to measure the concentration of RNA samples extracted at 260 nm and 280 nm wavelength, and agarose gel electrophoresis was performed to determine the integrity of the RNA samples (integrity) Confirmed.
  • RNA samples extracted from human skin fibroblasts were synthesized by oligonucleotide dT primers and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA) to perform global death.
  • PCR was performed using the 5D and 3 'flanking sequences of the gene cDNA to be amplified as a template and the cDNA obtained through reverse transcription.
  • the primer sequences used are shown in [Table 2]. As shown. 1 ⁇ l of the amplified PCR product was electrophoresed on a 1% agarose gel to confirm DNA bands.
  • Primer sequences used for RT-PCR gene primer Sequence (5 ' ⁇ 3') Annealing Temperature (°C) PCR product (bp) SEQ ID NO: Procollagen F TCTTCAAGCCATCCTGTGTG 60 168 One R GCGAGTCTGTGTTTTTGCAG 2 Metalloproteinase 1 (MMP-1) F ATGACATGAGTCCGGAGCAA 60 122 3 R TCATCTCCTGGGTCCCTTTC 4 Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) F GTGATGGCATGGACTGTGGT 55 203 5 R GGAGCCAAAAGGGTCATCAT 6
  • Collagen the main protein constituting the skin, is synthesized in the form of procollagen from fibroblasts present in the dermis and then secreted into the extracellular matrix.
  • Procollagen secreted into the extracellular matrix is cleaved at the C-terminus by the procollagen peptidase present on the cell surface and formed into active collagen, so the activated collagen content can be determined by measuring the C-peptide content.
  • PIP procollagen type I C-peptide
  • Collagen content was 18 compared to control cells (+ UVB) irradiated with UV only in cells treated with adipic acid with UV irradiation. % Increased significantly.
  • the amount of collagen was increased by 50% compared to the control cells (+ UVB), which was treated with vitamin C (+ 27%) or adipic acid (+ 18%) alone. It is higher than the amount of collagen observed in one cell (see Figure 1). Therefore, adipic acid increases the amount of collagen in human skin fibroblasts, and it can be seen that this collagen increase effect is more effective when used with vitamin C.
  • adipic acid significantly increased the expression of procollagen which was significantly reduced by UV light.
  • MMP-1 gene expression significantly increased by UV light decreased significantly.
  • Such gene expression control efficacy of adipic acid was shown to be similar to vitamin C (see Figure 2). Therefore, adipic acid may not only increase procollagen synthesis in UV-irradiated human skin fibroblasts, but also inhibit MMP-1 expression and ultimately contribute to the increase in collagen content closely related to skin wrinkles.
  • mice Five-week-old female albino hairless mice (SKH-1) used in this experiment were purchased from Orient Bio (Gyeonggi-do, Korea) and subjected to a one-week adaptation period with solid feed. Experimental animals were divided into 4 groups and 4 animals were used for each group. All experimental groups were divided into the normal control group (-UVB), the ultraviolet irradiation group (+ UVB), and the intake of adipic acid (AA) or vitamin C (VitC) together with ultraviolet irradiation. Feed and water were freely ingested during the breeding period, and the temperature was maintained at 22 ⁇ 1 ° C and humidity at 60 ⁇ 5%, and the photoperiod and dark cycle were adjusted to 12 hours daily.
  • -UVB normal control group
  • AA adipic acid
  • VitC vitamin C
  • the -UVB and + UVB groups consumed a tablet diet prepared according to the AIN-93 rat diet (Reeves, PG et al., J Nutr, 123: 1939-1951, 1993).
  • the composition of the detailed experimental diet is shown in [Table 3]. The diet was fed with water between 10 am and 11 am daily, and dietary intake was measured daily.
  • UVB Ultraviolet B
  • the UV irradiation dose was 73 mJ / cm 2 for the first week, 146 mJ / cm 2 for the second week, and 219 from 3 to 13 weeks It was investigated at mJ / cm 2 .
  • body weight and skin thickness were measured and back skin photographs were taken every week. Skin thickness was measured by the hip portion of hairless mice using a digital micro caliper (Marathon Watch Company Ltd, Ontario, Canada). The caliper used in the measurement was able to measure up to 0.01 mm, and it was able to measure the thickness of the skin under the same force with the adjustment function to apply a constant force to the thickness.
  • the animals were anesthetized and blood was collected and used for hematological analysis. Some of the dorsal skin tissues were cut and stored in the freezer, and some were used for molecular biological tests. Fixed to and used for immunohistochemical staining.
  • the skin of the hairless mice irradiated with ultraviolet rays for 13 weeks was made with silicone rubber to measure the extent of wrinkle formation.
  • Fabrication temperature of the replica plate was carried out in a constant temperature and humidity condition of 20 ⁇ 23 °C, humidity 45 ⁇ 50%, was used a silicon plate rubber impression material (Epigem, Seoul, Korea) for the production.
  • Analysis of the simulated platen was performed using a computer image analyzer (Visioline VL650, CK electronic GmbH, Germany) for total wrinkle area, maximum wrinkle depth, mean depth and mean wrinkles.
  • Four wrinkle indicator items such as mean length were analyzed.
  • mice The back skin tissue of hairless mice was extracted, fixed in 10% formalin, and stained with hematoxylin and eosin (H & E). Observations were made using a fluorescence microscope (ECLIPSE E600, Nikon, Japan), and photographs were taken using a digital camera (DXM 1200F, Nickon, Japan).
  • the tissue was pulverized by adding 1 ml of Trizol solution per 0.1 g of back skin tissue, and then centrifuged at 4 ° C. and 12,000 ⁇ g for 10 minutes. The supernatant was transferred to a new tube and 200 ⁇ l of chloroform was added and vortexed. This process was repeated twice, after which the supernatant was transferred to a new tube, and isopropanol and supernatant were added in a 1: 1 ratio.
  • UV / VIS spectrophotometer (Beckman coulter, DU730) was used to measure the concentration of RNA samples extracted at 260 nm and 280 nm wavelength, and agarose gel electrophoresis was performed to confirm the integrity of the RNA samples (integrity) It was.
  • CDNA was synthesized by performing reverse transcription using oligo dT primer and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA). PCR was performed using the cDNA obtained through reverse transcription as a template and 5 'and 3' flanking sequences of the gene cDNA to be amplified as primers, and the primer sequences used were shown in [Table 4]. As shown. 1 ⁇ l of the amplified PCR product was electrophoresed on a 1% agarose gel to confirm DNA bands.
  • UV irradiation, adipic acid and vitamin C intake did not have a significant effect on the weight and dietary intake of hairless mice mice (see Figure 3).
  • AA adipic acid-ingested group
  • the skin of the back skin of the hairless mice irradiated with UV light for 13 weeks was prepared by using a silicone rubber to measure the extent of wrinkle formation.
  • the + UVB control group was thicker and deeper than the normal group (-UVB). It was observed that the fine wrinkles were formed, and the adipic acid intake group showed a significant improvement in the thickness and depth of the wrinkles, although the deep wrinkles were almost disappeared compared to the + UVB control group despite the UV irradiation of the same intensity. (See Figure 6).
  • the AA group had a total wrinkle area of 38%, a maximum wrinkle depth of 45%, an average wrinkle depth of 18%, and an average wrinkle in comparison with the + UVB group.
  • the length was significantly decreased by 37%, and the wrinkle improvement effect of adipic acid was similar to the wrinkle improvement effect observed in vitamin C (see FIG. 7B). Therefore, it can be seen that the intake of adipic acid significantly inhibits wrinkle formation by ultraviolet irradiation.
  • the adipic acid-ingested group was found to have a significant 24% reduction in skin thickness compared to the + UVB control group.
  • the + UVB control group showed thickening of the skin epidermal layer compared to the normal group (-UVB) that was not irradiated with ultraviolet rays. It was confirmed that the thickness of the thickened epidermal layer was significantly reduced compared to the control (see Fig. 7B).
  • Collagen types 1 and 3 are proteins that constitute the cytoplasmic components of the dermal layer, and in particular, type 1 collagen is present in the largest amount of extracellular matrix proteins present in skin connective tissue.
  • MMPs that catalyze collagen breakdown in mammals
  • MMP types known to increase by ultraviolet rays are known as Nos. 1, 3, and 9.
  • MMPs enzymes that degrade collagen types 1 and 3.
  • MMP-1 cuts the middle of collagen fibers
  • MMP-3 and MMP-9 are known to play a role in subdividing and cutting the cut collagen fibers.
  • the expression of collagen types 1 ⁇ 1 and ⁇ 2 and collagen type 3 ⁇ 1 in the skin tissues was significantly reduced compared to the normal group (-UVB), which was not irradiated with UV rays, and MMP-1a and -1b, MMP-3, and MMP-9 gene expression was significantly increased.
  • the expression of collagen type 1 ⁇ 1 and ⁇ 2 and collagen type 3 ⁇ 1 were significantly increased compared to the + UVB control group, and the expression of MMP-1a and -1b, MMP-3, and MMP-9 genes was significantly increased. Decreased (see Figure 8). Therefore, adipic acid is thought to mitigate wrinkle formation by UV irradiation by increasing collagen protein synthesis in the subcutaneous tissue and inhibiting collagen fiber degradation.
  • composition of the nutrition cream containing adipic acid was prepared as shown in Table 5 below. At this time, the unit of component content is weight%.
  • components 1 to 8 are first dissolved by heating at a temperature of 70 ° C, and then components 9 to 13 are dissolved and dispersed in component 14 and emulsified in heating to 70 ° C. . Thereafter, the emulsified product was cooled to a temperature of 56 ° C., and then component 15 dissolved in the fractionated component 9 was added thereto, stirred, and cooled to room temperature to prepare.
  • the comparative example for the formulation example, except for the component 15, adipic acid, except for the component composition or the manufacturing method was set to proceed in the same manner.
  • the nutrition cream (test group) of the formulation example was applied to 20 women over 20 years of age.
  • the nutritional cream of the comparative formulation was continuously used once a day for 12 weeks.
  • the anti-wrinkle effect of the nutritional cream of the formulation example was relatively evaluated based on the nutritional cream of the comparative formulation. This phenomenon was evaluated. The evaluation was performed based on the five-point method of very good (5 points), excellent (4 points), moderate (3 points), bad (2 points), very bad (1 point), and the results are shown in Table 6 below. Indicated. In Table 6, the skin irritation indicates the degree of no skin irritation.
  • the skin stimulation evaluation score for the cosmetic composition of the formulation example according to the present invention was evaluated very good as 4.40, confirming that the skin stimulation degree is low, as in Comparative Formula 4, the skin safety is excellent.
  • Table 6 the skin stimulation evaluation score for the cosmetic composition of the formulation example according to the present invention was evaluated very good as 4.40, confirming that the skin stimulation degree is low, as in Comparative Formula 4, the skin safety is excellent.
  • the relative skin wrinkle improvement effect of the cosmetic composition of the formulation example compared to the formulation comparative example was found to be very excellent in the degree of improvement to an evaluation score of 4.55.
  • the dermis is composed of collagen (collagen) and elastin (elastic fiber), of which collagen fibers form skin tension and structural integration, and elastin fibers are involved in skin elasticity. This means that the extracellular matrix is contracted due to the decrease in number and the amount of collagen and elastin.
  • the present inventors confirmed the degree of elastin gene expression in mouse skin tissues according to the method described in Example 2.
  • the primer set for elastin gene amplification the sequence of the following [Table 7] was used.
  • the present invention provides a cosmetic composition containing adipic acid as an active ingredient.
  • the cosmetic composition according to the present invention has no skin side effects, and is very useful for improving wrinkles of the skin because of its excellent anti-wrinkle effect, collagen synthesis effect, and collagenase expression inhibiting effect. It is believed that the composition containing adipic acid of the present invention may be used as a material for functional cosmetics or health functional foods in the future.
  • a flexible lotion containing adipic acid as an active ingredient was prepared according to a conventional method.
  • Adipic Acid 0.1 Glycerine 3.0, Butylene Glycol 2.0, Propylene Glycol 2.0, Carboxyvinyl Polymer 0.1, Ethanol 10.0, Triethanolamine 0.1, Preservative, Trace Color, Tracer, and Trace Residue
  • a nutritious cream containing adipic acid as an active ingredient was prepared according to a conventional method. Component content is described in weight percent.
  • Adipic acid 0.1 beeswax 10.0, polysorbate 60 1.5, sorbitan sesquioleate 0.5, liquid paraffin 10.0, squalane 5.0, caprylic / capric triglyceride 5.0, glycerin 5.0, butylene glycol 3.0, propylene glycol 3.0, Triethanolamine 0.2, preservatives, trace pigments, trace fragrances and trace purified water
  • a mask pack composition containing adipic acid as an active ingredient was prepared according to a conventional method. Component content is described in weight percent.
  • a mask pack product was prepared by impregnating the prepared mask pack composition into a nonwoven fabric (width x length, 10 ⁇ 10 cm).
  • tablets were prepared by tableting according to a conventional method for producing tablets.
  • the capsule was prepared by filling in gelatin capsules according to the conventional method for producing a capsule.
  • Adipic acid 150 mg of the present invention is Adipic acid 150 mg of the present invention
  • the functional food composition containing adipic acid was prepared by the conventional liquid preparation method with the same composition as the respective preparation examples.
  • the final volume is 100 ml in each liquid.
  • This formulation example can be prepared by a conventional production method as well as liquid tablets, powders, granules and the like.
  • Adipic Acid 100 mg, Honey 1500 mg, Vitamin C 50 mg, Vitamin B6 10 mg, Nicotinamide 10 mg, Royal Jelly 80 mg, Preservatives, Fragrance, Microbalance Residue 100 mg

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Birds (AREA)
  • Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Dermatology (AREA)
  • Emergency Medicine (AREA)
  • Cosmetics (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

본 발명은 아디프산을 유효성분으로 함유하는 피부주름개선 및 탄력증진용 조성물에 관한 것으로, 보다 상세하게는 아디프산을 유효성분으로 함유하는 주름 개선용 화장료 조성물, 피부 외용제 및 식품 조성물과 아디프산을 유효성분으로 함유하는 탄력 증진용 화장료 조성물, 피부 외용제 및 식품 조성물에 관한 것이다.

Description

아디프산을 유효성분으로 함유하는 피부주름개선 및 피부탄력증진용 조성물
본 발명은 아디프산을 유효성분으로 함유하는 피부주름개선 및 탄력증진용 조성물에 관한 것으로, 보다 상세하게는 아디프산을 유효성분으로 함유하는 주름 개선 또는 탄력 증진용 화장료 조성물, 피부 외용제, 식품 조성물 및 약학적 조성물과 아디프산을 유효성분으로 함유하는 조성물을 사용한 피부 주름 개선 또는 피부 탄력 증진 방법에 관한 것이다.
피부는 크게 표피(epidermis), 진피(dermis), 피하지방(hypodermis)의 세 층으로 구성되어 있다, 표피, 특히 표피의 가장 외층인 각질층은 피부장벽의 역할을 함으로서 피부로부터 수분과 전해질 손실되는 것을 억제하는 한편, 진피층은 콜라겐과 엘라스틴 합성을 통하여 피부의 탄력을 유지하고 구조를 지지하는 역할을 한다. 즉, 콜라겐과 엘라스틴은 섬유아세포에서 생성되는 주요 단백질로서 피부의 기계적 견고성, 조직의 결합력 및 탄력성 등에 관여한다. 콜라겐은 형태와 구조적 특징에 따라 다양한 isoform을 구성하며, 사람의 조직에서 총 28가지 콜라겐 isotype이 존재하는데, 이중 피부조직에 존재하는 콜라겐은 타입 1, 3. 4. 6. 7. 13, 14, 17 등이 알려져 있다. 콜라겐 타입 1과 3은 진피층의 세포간질 구성성분을 이루고, 콜라겐 타입 7은 표피와 진피를 연결부위(dermal and epidermal junction)의 주요 구성물질이 된다.
피부결합조직에는 세포외기질 단백질 중 타입 1 콜라겐이 가장 많은 양으로 존재하며, 그 밖에 엘라스틴, 피브로넥틴, 인테그린, 피브리린, 프로테로글리칸 등의 단백질들이 존재한다. 새로이 합성된 프로콜라겐은 프롤린 및 라이신 아미노산 잔기에서 hydroxylation이 일어나 세 가닥의 나선이 꼬인 형태로 세포외 공간으로 분비된다. 이곳에서 프로콜라겐은 procollagen proteinase에 의해 양 말단이 잘려나가 비로소 콜라겐 단백질을 형성하게 되고, 후자는 다시 삼중나선구조(triple helix configuration)의 마이크로피브릴을 형성하고, 마이크로 피브릴은 leucine-rich small proteoglycans과 결합하여 피브릴을 형성한다. 결과적으로 이렇게 만들어진 피브릴들이 모여 피부의 결합력과 탄력성을 제공하는 콜라겐 섬유를 형성하게 된다.
피부노화는 피부 진피조직의 교원질 중 대부분을 차지하는 단백질인 콜라겐 함량이 감소하기 때문으로 알려져 있고, 콜라겐은 피부의 장력과 강도를 부여하기 때문에 콜라겐의 감소는 피부노화 및 주름생성과 매우 깊은 관계를 가지고 있다. 피부노화는 크게 생리학적 노화에 의한 내인성 노화, 그리고 지속적인 자외선(ultraviolet radiation, UV) 노출에 의해 일어나는 광노화로 구분된다. 반복적인 자외선 노출은 콜라겐 분해효소를 증가시키고 콜라겐 섬유의 변성 및 파괴를 유발하여 피부의 탄력을 감소시키고 주름의 생성을 촉진하는 결과를 초래한다.
최근 의료기술의 발달로 평균수명이 연장되고 삶의 질 향상과 건강하고 아름다운 삶에 대한 욕구가 증가함에 따라 피부미용 및 건강에 대한 관심이 확대되고 있다. 이에 건강한 피부를 유지하도록 하는 다양한 미용 기능성 화장품이 개발되었으며, 특히 피부 주름형성 예방, 완화와 개선을 위한 연구가 활발히 진행되고 있다. 아울러 최근 화장품의 성분이 피부진피에 도달하여 영양분을 공급하는데 한계가 있고, 식품으로 섭취하여 피부에 영양분 또는 기능성분을 공급하여 피부미용증진 효과를 나타낼 수 있다는 인식의 변화가 일어남에 따라 이너뷰티 식품소재들을 발굴하는 연구 또한 활발히 진행되고 있다.
본 출원인 또한, 부작용이 적은 천연물에서 콜라겐 분해효소의 작용을 억제하고 콜라겐의 합성을 촉진시킴으로써 주름 개선에 효과가 있는 식품 또는 화장품 소재를 개발하는 연구를 진행하였다. 그 결과, 지금까지 산도조절제의 용도로만 사용되던 아디프산이 피부 탄력 증진 및 피부 주름 완화 효과가 있다는 사실을 확인하고 본 발명을 완성하였다.
이에 본 발명자들은 아디프산을 유효성분으로 함유하는 주름 개선용 또는 피부 탄력 증진용 화장료 조성물, 피부 외용제, 식품 및 약학적 조성물을 개발하여 본 발명을 완성하였다.
따라서, 본 발명의 목적은 아디프산을 유효성분으로 함유하는 주름 개선 또는 피부 탄력 증진용 화장료 조성물, 피부 외용제 조성물, 식품 조성물 및 약학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은, 아디프산을 유효성분으로 함유하는 조성물을 사용한 피부 주름 개선 또는 피부 탄력 증진 방법을 제공하는 것이다.
상기의 목적을 달성하기 위해, 본 발명은 아디프산을 유효성분으로 함유하는 주름 개선용 화장료 조성물을 제공한다.
본 발명의 바람직한 다른 일실시예에 따르면, 아디프산은 화장료 전체 중량에 대하여 0.0001 내지 20 중량% 포함되는 것일 수 있다.
본 발명의 바람직한 다른 일실시예에 따르면, 본 발명의 조성물은 프로콜라겐 분비량의 증가, 콜라겐 생합성의 촉진, MMP-1 유전자의 발현 감소 및 피부 각질층 형성 억제로 이루어지는 군에서 선택되는 어느 하나 이상의 효과를 가지는 것 일 수 있다.
본 발명의 바람직한 또 다른 일실시예에 따르면, 본 발명의 화장료는 스킨로션, 스킨 소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스처 로션, 영양로션, 맛사지 크림, 영양크림, 모이스처 크림, 핸드크림, 에센스, 팩, 마스크팩, 마스크시트, 비누, 샴푸, 클렌징 폼, 클렌징로션, 클렌징크림, 바디로션, 바디클렌저, 유액, 프레스파우더, 루스파우더 및 아이섀도로 구성된 그룹에서 선택된 어느 하나의 제형일 수 있다.
본 발명의 바람직한 다른 일실시예에 따르면, 본 발명의 조성물은 화장품학적으로 허용 가능한 담체를 추가로 포함하는 것일 수 있다.
본 발명의 바람직한 다른 일실시예에 따르면, 본 발명의 조성물은 피부 주름개선 성분 또는 피부탄력 증진 성분을 추가로 포함하는 것일 수 있다. 피부 주름개선 성분 또는 피부탄력 증진 성분은 구체적으로 비타민 C, 레티노산, TGF, 동물 태반 유래의 단백질, 베튤린산 및 클로렐라 추출물로 구성되는 군으로부터 선택되는 것일 수 있다.
본 발명은 또한, 아디프산을 유효성분으로 함유하는 주름 개선용 피부 외용제 조성물을 제공한다.
본 발명은 또한, 아디프산을 유효성분으로 함유하는 주름 개선용 식품 조성물을 제공한다.
본 발명의 바람직한 다른 일실시예에 따르면, 본 발명의 식품은 정제, 과립, 분말, 캅셀, 액상의 용액 및 환으로 이루어진 군으로부터 선택된 어느 하나의 제형으로 제조된 것일 수 있다.
본 발명은 또한, 아디프산을 유효성분으로 함유하는 주름 개선용 약학적 조성물을 제공한다.
본 발명은 또한, 아디프산을 유효성분으로 함유하는 피부 탄력 증진용 화장료 조성물, 피부 외용제, 식품 조성물 및 약학적 조성물을 제공한다.
본 발명은 또한, 아디프산을 유효성분으로 함유하는 조성물을 사용한 피부 주름 개선 또는 피부 탄력 증진 방법을 제공한다.
본 발명의 바람직한 일실시예에 따르면, 아디프산은 조성물 전체 중량에 대하여 0.0001 내지 20 중량% 포함되는 것일 수 있다.
본 발명의 바람직한 다른 일실시예에 따르면, 본 발명의 조성물은 프로콜라겐 분비량의 증가, 콜라겐 생합성의 촉진, MMP-1 유전자의 발현 감소 및 피부 각질층 형성 억제로 이루어지는 군에서 선택되는 어느 하나 이상의 효과를 가지는 것 일 수 있다.
본 발명의 바람직한 일실시예에 따르면 조성물은 상기 화장료 조성물, 상기 피부 외용제 조성물, 상기 식품 조성물 또는 상기 약학적 조성물일 수 있다.
본 발명은 아디프산을 유효성분으로 함유하는 주름 개선 또는 탄력 증진용 화장료 조성물, 피부 외용제 조성물, 식품 조성물 및 약학적 조성물을 제공한다. 아디프산을 함유하는 조성물은 프로콜라겐 분비량의 증가, 콜라겐 생합성의 촉진, MMP-1 유전자의 발현 감소 및 피부 표피층 비후 억제효과가 있어, 피부 주름 개선 또는 피부 탄력 증진에 효과적이다.
도 1은 사람 피부섬유아세포에서 프로콜라겐 분비량을 측정한 그래프이다(-UVB: UVB를 처리하지 않은 대조군, +UVB : UVB를 처리한 대조군, AA : UVB를 조사한 후 아디프산을 처리한 실험군, VitC : UVB를 조사한 후 비타민 C를 처리한 대조군, AA+VitC : UVB를 조사한 후 아디프산과 비타민 C를 함께 처리한 실험군).
도 2는 사람 섬유세포에서 프로콜라겐 및 MMP-1 유전자 발현량을 측정한 전기영동 사진과 그래프이다.
도 3은 실험식이를 섭취한 마우스의 체중증가량(A 및 B) 및 식이섭취량(C 및 D)을 나타낸 그래프이다.
도 4는 실험식이를 섭취한 마우스 피부조직의 수분함유량(A), 수분증발량(B), 탄력성(C) 및 홍반지수(D)를 측정한 그래프이다.
도 5는 실험식이를 섭취한 마우스의 등피부조직 사진이다.
도 6은 실험식이를 섭취한 마우스 등 피부조직의 주름 형성 정도를 나타낸 사진(A)과 그래프(B)이다.
도 7은 실험식이를 섭취한 마우스의 피부 두께를 나타낸 그래프(A)와 사진(B)이다.
도 8은 아디프산을 처리한 마우스 등조직에서 콜라겐 및 MMPs 유전자 발현 변화를 나타낸 전기영동 사진과 그래프이다.
도 9는 아디프산을 포함한 실험식이를 섭취한 마우스 피부조직의 엘라스틴 유전자 발현 정도를 측정한 그래프이다.
이하, 본 발명을 보다 상세히 설명한다.
상술한 바와 같이, 아디프산의 산도조절 용도는 공지되어 있었으나, 피부 탄력 증진 및 피부 주름 완화 효과에 대한 연구는 이루어진바 없다.
본 발명에서 제공하는 아디프산을 함유하는 조성물은 프로콜라겐 분비량의 증가, 콜라겐 생합성의 촉진, MMP-1 유전자의 발현 감소 및 피부 표피층 비후 억제효과가 있어, 피부 주름 개선 또는 피부 탄력 증진에 효과적이다.
따라서, 본 발명은 아디프산을 유효성분으로 함유하는 주름 개선용 또는 탄력 증진용 화장료 조성물을 제공한다.
아디프산은 사탕무(sugar beet)와 감비르(gambir) 등에 함유되어 있는 카르복실계 화합물로서 아디핀산, 아디픽산, 1,4-butanedicarboxylic acid; 1,6-hexanedioic acid; acifloctin; acinetten; adipinic acid; hexanedioic acid; octafluorohexanedioic acid으로도 불리 운다. 본 발명의 아디프산은 아디프산을 포함하는 다양한 식물로부터 추출, 분리 및 정제하여 얻을 수 있다.
아디프산의 Cas No.는 124-04-9이고 구조식은 C6H10O4, 그리고 분자량은 146.1 g/mol이다. 그 구체적인 구조는 하기 화학식1과 같다. 아디프산은 가연성 물질이고, 건조한 곳에서는 와류, 공기 수송, 주입 등에 의해 정전기적으로 하전될 수 있다. 열에 분해되어 발레르산 및 기타 물질이 포함된 부식성 화학가스와 독성 물질을 만들어낸다.
[화학식1]
Figure PCTKR2017001528-appb-I000001
아디프산은 국내 식품공전에 "산도조절제"의 용도를 가지는 식품첨가물로 등록되어 있으며, 미국 FDA의 Food and Color Additive Database에도 산도 조절제로 등록되어 있다. 아디프산은 베이킹파우더에 효모 산미제로 첨가되며 과일맛 주스 및 병 음료의 농축분말 등에도 산미제로 첨가된다. 또한 가공 치즈 및 치즈 스프레드의 녹는 특성과 질감을 향상시키기 위해서도 사용될 수 있다. 아디프산은 계란 흰자가 들어가는 제품에 거품이 잘 만들어지도록 첨가될 수 있으며 잼 및 젤리에 젤 생성제로 사용될 수 있다. 아디프산은 식품에 완충제 및 중화제로 첨가되고, 의약품의 원료로 사용되며 향수 고정제로도 사용되어 왔다.
그동안 알려진 아디프산의 생리활성으로는 항-키토제닉 효과와 항-고혈압 효과가 보고되었다. 아디프산은 랫트에서 긴-체인과 짧은-체인 모노카르복시산에 의해 야기된 된 케톤증을 개선하는 효과가 보고되었다. 고혈압 환자를 대상으로 한 임상연구에서 8주 동안 암로디핀 아디페이트염(amlodipine adipate)을 섭취한 결과, 혈압이 개선되었다. 그러나 지금까지 아디프산의 피부 탄력 증진 및 피부 주름 완화 효과에 대해서는 공지된 바 없었다.
여러 실험을 통해, 아디프산의 안전성은 어느 정도 알려져 있다. 다양한 종류의 실험동물에서 흡입, 정맥주사, 경구투여, 복강주사 등의 방법으로 아디프산을 투여하여 얻은 LD50 이 [표 1]에 제시되어 있으며 마우스를 대상으로 경구투여 시 11,000 mg/kg 몸무게로 보고되었다.
아디프산의 독성보고 자료
종말점 동물종 투여경로 용량 독성효과 참고자료
TDL0 랫드 경구 140 g/kg/5주 (간헐적) 과운동성, 설사, 체중 감소 또는 체중 증가율 감소 FAO Nutrition Meetings Report Series, 40,1 (1967)
LD50 랫드 복강 275 mg/kg 졸음(전반적으로 억제된 활동), 기타 변화, 출혈 H.J. Horn et al., Agric. Food Chem, 5:759-762, 1957.
LD50 마우스 경구 1,900 mg/kg 위장관 변화 H.J. Horn et al., Agric. Food Chem, 5:759-762, 1957.
LD50 마우스 정맥내 680 mg/kg 경련 또는 발작 역치에 대한 영향, 출혈 H.J. Horn et al., Agric. Food Chem, 5:759-762, 1957.
LD50 토끼 경구 >11 g/kg 세부적 보고 없음 IuV, Novikov. et al., Gigiena i sanitariia, 9:72-75, 1983.
TDL0 랫드 경구 140 g/kg/5주 (간헐적) 과운동성, 설사, 체중 감소 또는 체중 증가율 감소 FAO Nutrition Meetings Report Series, 40,1 (1967)
(Reference: 독성정보제공시스템(Tox-Info), 식품의약품안전평가원)
교배한 CD-1 알비노 마우스 암컷 20-24마리를 대상으로 임신 후 6일부터 15일까지 아디프산을 매일 투여한 연구에서 배자독성 또는 기형유발 영향은 나타나지 않았다. 또한 암컷 랫드 17-20마리로 구성된 시험군에게 0, 10, 20, 40 mg/kg과 동등한 용량 수준의 아디프산이 포함된 식단을 28일 동안 유지했을 때 성장 유해 반응은 발견되지 않았다. 수컷 랫드 18마리로 구성된 시험군에게 5주 동안 0, 200, 400, 800 mg/일과 동등한 용량 수준의 아디프산이 포함된 식단을 유지했을 때 성장률이 감소한 고용량 그룹을 제외하면 성장률은 정상이었다.
또한, 인간 배자의 폐 배양체(WI - 38)를 아디프산(2, 20, 200 μg/ml)과 양성 대조 및 음성 대조 화합물이 존재하는 조건에서 성장시킨 결과 염색체의 뚜렷한 이상은 없었다. 아급성 연구에서 아디프산을 3.75, 37.5, 375 mg/kg/일 용량으로 5일 연속 투여하여 골수세포 염색체 이상을 평가한 결과, 골수 중기 염색체에 뚜렷한 이상은 나타나지 않았다.
아디프산은 인체에서 섭취 후 부분적으로만 대사되고 나머지는 변화되지 않은 채 그대로 소변으로 배설됨이 보고되었다. 예를 들어, 랫드에게 1일 0.75 g의 아디프산을 4주 동안 섭취시키고 섭취를 중단한 지 사흘 뒤 희생시킨 조직에서 아디프산의 잔재는 검출되지 않았다는 보고가 있다. 아디프산은 베타산화를 통해 숙신산과 아세트산으로 대사되고 이어서 정상적 기타 중간 대사산물로 대사되는 것으로 보고된 바 있으며, 공복상태의 실험용 랫드에게 방사성 아디프산을 섭취시킨 후 소변에서 검출된 대사 산물은 요소, 글루탐산, 젖산, 베타 케토아디프산, 시트르산으로 보고되었다.
따라서, 아디프산은 낮은 농도, 구체적으로 0.001 내지 3000 mg/kg, 더욱 바람직하게는 0.001 내지 1500 mg/kg로 투여하는 것은 독성이 아주 미미하거나 없으므로, 화장료 조성물, 피부 외용제, 식품 조성물 또는 약학적 조성물로 사용될 수 있다.
본 발명에서 사용되는 용어, "피부 주름 개선 또는 탄력 증진"은 피부의 주름 및 탄력과 관련된 능력을 유지 또는 강화시키는 것을 의미한다. 피부 진피층의 교원섬유인 콜라겐(collagen)과 탄력섬유인 엘라스틴(elastin)이 그러한 역할을 하는 주요 단백질로서 피부 탄력을 주관하는데, 콜라겐의 생합성은 피부의 내, 외적 영향을 받게 된다. 구체적으로, 피부세포는 자연 노화로 인하여 세포 활성이 감소되면 콜라겐 섬유의 감소가 일어나거나, 또는 외적요인으로서 자외선의 과량 조사되거나 스트레스 등에 의해 생성된 활성 산소가 단백질의 티올기(thiol: -SH)와 반응하여 효소 활성을 저해하거나, 콜라겐, 엘라스틴 등의 분해 효소의 발현을 증가시켜 피부의 주름을 증가시키고 탄력을 감소시켜 피부 노화가 진행된다.
본 발명에서 기재하는 화장료 조성물에 함유되는 아디프산은 화장료 전체 중량에 대하여 0.0001 내지 20 중량%로 포함되는 것일 수 있다. 화장료 내에 0.0001 중량% 미만의 아디프산은 그 용량이 소량이어서 주름 개선 효과가 없을 수 있으며, 20 중량% 이상의 아디프산은 기존에 알려진 독성을 나타낼 수 있다.
본 발명의 조성물은 프로콜라겐 분비량의 증가, 콜라겐 생합성의 촉진, MMP-1 유전자의 발현 감소 및 피부 각질층 형성 억제로 이루어지는 군에서 선택되는 어느 하나 이상의 효과를 가지는 것일 수 있다.
본 발명의 일실시예에 따르면, 사람피부섬유아세포에 자외선 조사와 함께 약물을 처리하여 세포외 기질로 분비된 프로콜라겐, 프로콜라겐 타입I C-펩타이드(PIP) 양을 측정한 결과, 도 1에 나타난 바와 같이, 자외선을 조사받은 대조세포(+UVB)에서는 정상세포(-UVB)에 비해 프로콜라겐 분비량이 현저히 감소하였고, 자외선 조사와 함께 아디프산을 처리한 세포에서는 자외선만 조사받은 대조세포(+UVB)에 비해 콜라겐 양이 18% 유의하게 증가하였다. 한편 아디프산을 비타민C와 함께 처리한 세포에서는 대조세포(+UVB)에 비해 콜라겐 양이 50% 유의하게 증가하였고 이는 비타민C(+27%) 또는 아디프산(+18%) 단독으로 처리한 세포에서 관찰된 콜라겐 양보다 더 높은 수치를 보였다(도1 참조).
본 발명의 일실시예에 따르면, 아디프산 섭취군의 경우 +UVB 대조군에 비해 콜라겐 타입 1α1과 α2, 그리고 콜라겐 타입 3α1의 발현은 유의하게 증가하였고, MMP-1a 및 -1b, MMP-3, 그리고 MMP-9 유전자 발현은 유의하게 감소하였으며(도8 참조), 엘라스틴 발현이 유의하게 증가하였다(도 9 참조). 따라서 아디프산은 피하조직의 콜라겐 단백질 합성을 증가시키고 콜라겐 섬유의 분해를 저해함으로써 자외선조사에 의한 주름형성을 완화시킬 수 있다.
본 발명의 일실시예에 따르면, 사람피부섬유아세포에 약물을 처리한 후 프로콜라겐과 MMP-1 유전자 발현변화를 측정한 결과, 도 2에 나타난 바와 같이, 아디프산은 자외선에 의해 유의하게 감소한 프로콜라겐의 발현을 유의하게 증가시킨 한편, 자외선에 의해 유의하게 증가한 MMP-1 유전자발현은 유의하게 감소시켰다. 이와 같은 아디프산의 유전자발현 조절 효능은 비타민 C와 유사한 수준으로 나타났다(도2 참조).
본 발명에서 사용되는 용어, "화장료 조성물"은 상기 화합물을 포함하는 조성물로서 그 제형은 어떠한 형태라도 가능하다. 이러한 제형의 예를 들면 상기 조성물을 이용하여 제조된 화장료는 영양크림, 아이크림, 마사지크림, 클렌징크림과 같은 크림류, 팩류, 영양로션과 같은 로션류, 에센스류, 유연화장수, 영양화장수와 같은 화장수류, 파우다류, 파운데이션류 및 메이크업 베이스류 등이고, 본 발명의 목적을 달성하기 위하여 이러한 제형 중 어떠한 형태로도 제조되어 상용화될 수 있으며, 상기 예들에 한정되지 않는다. 또한, 본 발명에 따른 화장료 조성물에는 통상의 화장료 제조 방법으로 제형화할 수 있다.
구체적으로 본 발명의 화장료는 스킨로션, 스킨 소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스처 로션, 영양로션, 맛사지 크림, 영양크림, 모이스처 크림, 핸드크림, 에센스, 팩, 마스크팩, 마스크시트, 비누, 샴푸, 클렌징 폼, 클렌징로션, 클렌징크림, 바디로션, 바디클렌저, 유액, 프레스파우더, 루스파우더 및 아이섀도로 구성된 그룹에서 선택된 어느 하나의 제형을 가지는 것일 수 있다.
본 발명의 화장료 조성물은 화장품학적으로 허용 가능한 담체를 추가로 포함할 수 있으며, 일반 피부 화장료에 배합되는 보통의 성분을 필요한 만큼 적용 배합하는 것이 가능하다.
구체적으로, 본 발명의 화장료 조성물은 경피 침투 강화제를 추가로 포함할 수 있다. 본 발명에서 사용되는 용어, 경피 침투 강화제란 피부의 혈관세포 내로 원하는 성분이 높은 흡수율로 침투할 수 있게 해주는 조성물이다. 바람직하게는 레시틴 화장품에 사용되는 다른 인지질 성분, 리포좀 성분 등이 포함되지만 이에 국한되지는 않는다.
또한, 유상 성분으로서 주로 사용될 수 있는 오일로는 식물성 오일, 광물성 오일, 실리콘유 및 합성유 중에서 선택된 하나 이상을 사용할 수 있다. 보다 구체적으로, 미네랄오일, 사이크로메치콘, 스쿠알란, 옥틸도데실 미리스테이트, 올리브오일, 비티스 비니페라 씨드 오일, 마카다미아너트오일, 글리세릴옥타노에이트, 캐스터오일, 에칠헥실 이소노나노에이트, 디메치콘, 사이크로펜타실록산 및 선플라워씨드 오일 등을 사용할 수 있다.
또한, 유화 능력을 보강하기 위하여 계면활성제, 고급 알콜 등을 0.1 내지 5 중량% 첨가할 수 있다. 이러한 계면 활성제로는 비이온 계면활성제, 음이온성 계면 활성제, 양이온성 계면 활성제, 양성 계면 활성제, 인지질 등과 같은 통상적인 계면활성제를 사용할 수 있으며, 구체적으로, 소르비탄세스퀴놀리에이트, 폴리솔베이트 60, 글리세릴 스테아레이트, 친유형 글리세릴스테아레이트, 소르비탄 올리에이트, 소르비탄 스테아레이트, 디이에이-세틸포스페이트, 소르비탄스테아레이트/슈크로스코코에이트, 글리세릴스테아레이트/폴리에틸렌글라이콜-100 스테아레이트, 세테아레스-6 올리베이트, 아라키딜알코올/베헤닐알코올/아라키딜 글루코사이드. 폴리프로필렌글라이콜-26-부테스-26/폴리에틸렌글라이콜-40 하이드로제네이티드 캐스터오일 등을 사용할 수 있다. 고급 알콜로는 탄소수가 12 내지 20인 알콜, 예컨대 세틸알코올, 스테아릴 알코올, 옥틸도데칸올, 이소스테아릴 알코올 등을 단독으로 또는 1종 이상 혼합하여 사용할 수 있다.
수상 성분은 수상의 점도 또는 경도를 조절하기 위하여 카보머, 잔탄검, 벤토나이트, 마그네슘알루미늄실리케이트, 셀룰로오스검, 덱스트린 팔미테이트 등과 같은 1종 이상의 점증제를 0.001 내지 5 중량% 더 첨가할 수 있다.
또한, 본 발명의 화장료 조성물에는 필요에 따라 고급 지방산, 비타민 등의 약효 성분과 자외선 차단제, 산화 방지제(부틸히드록시아니솔,갈릭산프로필, 엘리소르빈산, 토코페릴아세테이드, 부틸레이티드하이드록시톨루엔 등), 방부제(메칠파라벤, 부틸파라벤, 프로필파라벤, 페녹시에탄올, 이미다졸리디닐우레아, 클로르페네신 등), 착색제, pH 조절제(트리에탄올아민, 씨트릭애씨드, 시트르산, 시트르산나트륨, 말산, 말산나트륨, 프말산, 프말산나트륨, 숙신산, 숙신산나트륨, 수산화나트륨, 인산일수소나트륨 등), 보습제(글리세린, 솔비톨, 프로필렌 글라이콜, 부틸렌 글라이콜, 헥실렌 글라이콜, 디글리세린, 베타인, 글리세레스-26, 메칠글루세스-20 등), 윤활제 등의 성분을 더 첨가할 수 있다.
또한, 본 발명의 화장료 조성물은 피부에 필수 영양소를 보조적으로 제공할 수 있는 물질을 추가로 포함하는데, 바람직하게는 천연향, 화장품향, 또는 한약재가 포함되지만 이들에 국한되지 않는 보조제를 함유할 수 있다.
또한, 본 발명의 화장료 조성물은 피부 주름개선 성분 또는 피부탄력 증진 성분을 추가로 포함할 수 있다. 그 구체적인 피부 주름 개선 성분 또는 피부탄력 증진 성분으로는 비타민 C, 레티노산, TGF, 동물 태반 유래의 단백질, 베튤린산 및 클로렐라 추출물로 구성되는 군으로부터 선택되는 어느 하나 이상인 것일 수 있으며, 가장 바람직하게는 비타민 C일 수 있다.
본 발명의 일실시예에서는 비타민 C와 아디프산을 함께 처리하였을 때 50% 향상된 프로콜라겐 분비량을 보였지만, 비타민 C를 단독으로 처리하였을 때에는 27%, 아디프산을 단독으로 처리하였을 때에는 18%의 프로콜라겐 분비량 향상을 보였다. 이러한 결과를 콜비공식에 대입하여 보면, 아디프산과 비타민 C를 함께 처리할 때 상승효과를 나타낸다는 것을 확인할 수 있다.
본 발명은 아디프산을 유효성분으로 함유하는 주름 개선용 또는 탄력 증진용 피부 외용제 조성물을 제공한다.
본 발명의 외용제 조성물은 피부의 주름을 개선하고, 주름이 생성되는 것을 방지하며, 지연시킬 목적으로 사용되는 것으로, 그 제형에 있어서 특별히 한정되는 바가 없으며, 예를 들면, 유연화장수, 영양화장수, 마사지크림, 영양크림, 팩, 마스크팩, 마스크시트, 젤 또는 피부 점착타입 화장료의 제형을 갖는 화장료 조성물일 수 있으며, 또한, 로션, 연고, 겔, 크림, 패취 또는 분무제와 같은 경피투여형 제형일 수 있다.
또한, 각 제형의 외용제 조성물에 있어서, 상기한 필수 성분 이외의 다른 성분들은 기타 외용제의 제형 또는 사용목적 등에 따라 당업자가 어려움 없이 적의 선정하여 배합할 수 있다.
본 발명은 아디프산을 유효성분으로 함유하는 주름 개선용 또는 탄력 증진용 식품 조성물을 제공한다.
본 발명의 식품 조성물은 정제, 과립, 분말, 캅셀, 액상의 용액 및 환으로 이루어진 군으로부터 선택된 어느 하나의 제형으로 제조된 것일 수 있다. 본 발명에 따른 식품 조성물은 아디프산을 유효성분으로 포함시켜 분말제, 액제, 정제, 연질캅셀제, 과립제, 티백차, 인스턴트 차 또는 드링크제 등의 형태로 제형화될 수 있다. 유효 성분으로서의 아디프산의 함량은 그 사용 목적(예방 또는 개선용)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 조성물 중에 포함되는 아디프산의 양은 전체 식품 중량의 0.1 내지 90 중량%로 가할 수 있다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있다. 또한, 본 발명에 따른 식품 조성물은 아디프산 이외에 본 발명이 목적으로 하는 주효과를 손상시키지 않는 범위 내에서 바람직하게는 주효과에 상승효과를 줄 수 있는 다른 성분 예를 들면, 비타민 C와 같은 주름 개선용 화합물 또는 녹차 추출물, 닥나무 추출물, 감초추출물, 상백피 추출물, 빈랑자 추출물, 황금 추출물, 산삼 추출물 등의 천연물을 함유하는 것도 무방하다.
상기와 같은 형태로 제형화된 식품 조성물은 식품에 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 식품의 예로는 드링크제, 육류, 소시지, 빵, 비스킷, 떡, 초콜릿, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 알코올 음료 및 비타민 복합제, 유제품 및 유가공 제품 등이 있으며, 통상적인 의미에서의 건강기능식품은 모두 포함한다.
본 발명의 식품 조성물이 드링크제인 경우는 지시된 비율로 필수성분으로서 아디프산을 함유하며, 그 밖의 드링크제 제조를 목적으로 사용되는 다른 성분에는 특별한 제한이 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상기한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 상술한 것 이외의 향미제로서 천연 향미제 및 합성 향미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 ㎖당 일반적으로 약 1 내지 20 g, 바람직하게는 약 5 내지 12 g이다.
또한 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에도 본 발명의 본 발명의 식품 조성물은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 아디프산 100 중량부 당 0.1 내지 약 20 중량부의 범위에서 선택되는 것이 일반적이다.
본 발명은 아디프산을 유효성분으로 함유하는 주름 개선용 또는 탄력 증진용 약학적 조성물을 제공한다.
본 발명의 화합물은 UV에 의한 세포 노화 억제 및 활성 산소종의 생성 억제로 피부 노화 억제 효과가 있으며, 피부세포에서 세포외 기질 단백질의 발현을 촉진함으로써 피부의 주름 개선에 효과가 있으므로, 피부 노화 억제 또는 피부 주름 개선용 약학적 조성물로 사용될 수 있다.
본 발명에서 사용되는 주름 개선용 또는 피부 탄력 증진용 약학적 조성물의 처리량은 약학적으로 유효한 양이어야 한다. 본 발명에서 사용되는 용어, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 감염된 바이러스 종류, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 유효량은 당업자에게 인식되어 있듯이 처리의 경로, 부형제의 사용 및 다른 약제와 함께 사용할 수 있는 가능성에 따라 변할 수 있다.
본 발명의 주름 개선용 또는 피부 탄력 증진용 약학적 조성물은 포유동물에 투여된 후 활성 성분의 신속, 지속 또는 지연된 방출을 제공할 수 있도록 당업계에 잘 알려진 방법을 사용하여 약학적 제형으로 제조될 수 있다. 제형의 제조에 있어서, 활성 성분을 담체와 함께 혼합 또는 희석하거나, 용기 형태의 담체 내에 봉입시키는 것이 바람직하다.
따라서, 본 발명의 주름 개선용 또는 피부 탄력 증진용 약학적 조성물은 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제 및 패치의 형태로 제형화하여 사용될 수 있고, 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 또는 희석제를 추가로 포함할 수 있다.
예를 들어, 본 발명의 약학 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
또한, 본 발명의 상기 약학 조성물은 피부 노화 억제 또는 피부 주름개선을 목적으로 의약외품 제조시 첨가되어 사용될 수 있다. 본 발명의 상기 약학 조성물을 의약외품 첨가물로 사용할 경우, 상기 화합물을 그대로 첨가하거나 다른 의약외품 또는 의약외품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효 성분의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 바람직하게는, 상기 의약외품은 소독청결제, 샤워폼, 가그린, 물티슈, 세제비누, 핸드워시, 가습기 충진제, 마스크, 연고제, 코팅제 또는 필터충진제일 수 있다.
또한, 본 발명은 아디프산을 유효성분으로 함유하는 아디프산을 유효성분으로 함유하는 조성물을 사용한 피부 주름 개선 또는 피부 탄력 증진 방법을 제공한다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1. 사람피부섬유아세포를 이용한 아디프산의 주름개선 효능
1-1) 세포배양
사람피부섬유아세포(normal human dermal fibroblasts, neonatal foreskin)를 ATCC사(Manassas, VA, USA)로부터 구매하여 사용하였다. 구입한 세포를 fibroblast growth medium(Promo Cell, Heidelberg)을 이용하여 37℃, 5% CO2 인큐베이터에서 배양하여 실험에 사용하였다.
1-2) 프로콜라겐 타입 I C- 펩타이드 (PIP) 농도 측정
콜라겐 생합성능을 알아보기 위하여 사람섬유아세포를 12 웰-플레이트에 1.0 × 106 cells/well 씩 분주하여 아디프산과 비타민 C를 각각 100 μM의 농도로 첨가하여 24시간 동안 CO2 배양기에서 배양하였다. 각 웰의 배지를 제거한 후 PBS로 1회 세척하고 다시 1 ml의 PBS를 넣은 후 20 mJ/cm2 조건으로 자외선 B(UVB)를 조사하였다. 각 웰의 PBS를 다시 배지로 교체하여 24시간 동안 배양한 후, 프로콜라겐 타입Ⅰ C-펩타이드 EIA 키트(Takara bio, Japan)를 이용하여 배지로 분비된 프로콜라겐 양을 측정하였다. 콜라겐 측정 키트에 포함된 표준용액을 농도별로 희석하고 450 nm에서 흡광도를 측정하여 표준농도 곡선을 작성하고 콜라겐 생성량을 산정하였다.
1-3) 트리졸 방법을 이용한 RNA 분리 및 RT- PCR (reverse transcription-polymerase chain reaction)
사람피부섬유아세포 1 × 107 cells 당 트리졸 용액 334 ㎕을 첨가하여 갈아준 후, 4℃, 12,000×g에서 10분간 원심분리하였다. 상층액을 새 튜브로 옮긴 후 클로로포름 67 ㎕을 첨가하고, 볼텍스(vortex)하였다. 다시 상층액을 새 튜브로 옮기고 상층액과 아이소프로페놀의 비율이 1:1이 되도록 아이소프로판올을 첨가하였다. 10회 세게 흔든 다음 실온에서 15분 동안 방치하고, 12,000×g, 4℃에서 10분간 원심분리 시킨 후 상층액을 제거하고, 남은 침전물에 70% 에탄올 1 ml을 가한 후 7,500×g, 4℃에서 5분 동안 원심분리 하였다. 에탄올을 제거한 후 RNA 침전물이 담긴 튜브를 실온에서 15분 동안 건조시키고, 핵산분해효소가 포함되지 않은 물을 사용하여 RNA 펠렛을 용해시켰다. UV/VIS 분광 광도계(Beckman coulter, DU730)를 이용하여 260 nm 및 280 nm 파장에서 추출된 RNA 시료의 농도를 측정하고, 아가로오스 겔 전기영동을 실시하여 RNA 시료에 이상이 없음(integrity)을 확인하였다.
사람피부섬유아세포에서 추출된 RNA시료를 대상으로 올리고 dT 프라이머와 슈퍼스크립트 역전사효소(GIBCO BRL, Gaithersburg, MD, USA)를 이용하여 전역사를 수행함으로써 cDNA를 합성하였다. 역전사를 통해 얻은 cDNA를 template로 하고 증폭하고자 하는 유전자 cDNA의 5'과 3'측면 염기서열(flanking sequence)을 프라이머로 사용하여 PCR을 수행하였으며, 이때 사용된 프라이머 염기서열은 [표 2]에 제시된 바와 같다. 증폭된 PCR 산물 1 ㎕를 1% 아가로오스 겔에 전기영동하여 DNA band를 확인하였다.
RT-PCR에 사용된 프라이머 염기서열
유전자 프라이머 염기서열(5'→3') 어닐링 온도 (℃) PCR 산물 (bp) 서열번호
Procollagen F TCTTCAAGCCATCCTGTGTG 60 168 1
R GCGAGTCTGTGTTTTTGCAG 2
Metalloproteinase 1 (MMP-1) F ATGACATGAGTCCGGAGCAA 60 122 3
R TCATCTCCTGGGTCCCTTTC 4
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) F GTGATGGCATGGACTGTGGT 55 203 5
R GGAGCCAAAAGGGTCATCAT 6
1-4) 프로콜라겐 분비량 변화 측정 결과
피부를 구성하는 주 단백질인 콜라겐은 피부진피에 존재하는 섬유아세포에서 프로콜라겐의 형태로 합성된 후 세포외 기질로 분비된다. 세포외 기질로 분비된 프로콜라겐은 세포표면에 존재하는 프로콜라겐 펩티다아제에 의해 C-말단이 분해되고 활성형 콜라겐으로 형성되므로 C-펩타이드 함량을 측정하면 활성화된 콜라겐 함량을 측정할 수 있다. 사람피부섬유아세포에 자외선 조사와 함께 약물을 처리하여 세포외 기질로 분비된 프로콜라겐, 프로콜라겐 타입I C-펩타이드(PIP) 양을 측정한 결과, 도 1에 나타난 바와 같이, 자외선을 조사받은 대조세포(+UVB)에서는 정상세포(-UVB)에 비해 프로콜라겐 분비량이 현저히 감소하였고, 자외선 조사와 함께 아디프산을 처리한 세포에서는 자외선만 조사받은 대조세포(+UVB)에 비해 콜라겐 양이 18% 유의하게 증가하였다. 한편 아디프산을 비타민C와 함께 처리한 세포에서는 대조세포(+UVB)에 비해 콜라겐 양이 50% 유의하게 증가하였고 이는 비타민 C(+27%) 또는 아디프산(+18%) 단독으로 처리한 세포에서 관찰된 콜라겐 양보다 더 높은 수치이다(도1 참조). 따라서 아디프산은 사람피부섬유아세포에서 콜라겐 양을 증가시키고 이러한 콜라겐 증가효과는 비타민C와 함께 사용 시 더 효과적으로 나타남을 알 수 있다.
1-5) 프로콜라겐 MMP -1 유전자 발현변화 측정 결과
사람피부섬유아세포에 약물을 처리한 후 프로콜라겐과 MMP-1 유전자 발현변화를 측정한 결과, 도 2에 나타난 바와 같이, 아디프산은 자외선에 의해 유의하게 감소한 프로콜라겐의 발현을 유의하게 증가시킨 한편, 자외선에 의해 유의하게 증가한 MMP-1 유전자발현은 유의하게 감소시켰다. 이와 같은 아디프산의 유전자발현 조절 효능은 비타민 C와 유사한 수준으로 나타났다(도2 참조). 따라서 아디프산은 자외선을 조사받은 사람피부섬유아세포에서 프로콜라겐 합성을 증가시킬 뿐 아니라 MMP-1 발현을 억제함으로서 궁극적으로 피부주름과 밀접한 연관이 있는 콜라겐 함량을 증가시키는데 관여하였을 것으로 사료된다.
실시예 2. 마우스를 이용한 아디프산의 피부주름 개선, 보습 및 탄력증진 효능평가
2-1) 실험식이 제조, 실험동물의 사육 및 자외선 조사
본 실험에 사용한 5주령 암컷 알비노 무모 생쥐(SKH-1)는 오리엔트바이오(Gyeonggi-do, Korea)에서 구입하여 고형사료로 1주일간 적응기간을 거쳤다. 실험동물은 4개 군으로 분류하여 군별로 4 마리씩 배정하여 실험에 사용하였다. 모든 실험군은 자외선을 조사하지 않은 정상 대조군(-UVB), 자외선 조사군(+UVB), 자외선조사와 함께 아디프산(AA) 또는 비타민 C(VitC)을 섭취시킨 군으로 나누었다. 사육 기간 동안 사료와 물을 자유로이 섭취하도록 하였으며, 온도는 22±1℃, 습도는 60±5%로 유지하고 매일 광주기와 암주기가 12시간이 되도록 조절하였다.
-UVB군과 +UVB군은 AIN-93 실험쥐 식이 구성(Reeves, PG et al., J Nutr, 123:1939-1951, 1993)에 준하여 조제된 정제식이를 섭취시켰고, AA군은 AIN-93 정제식이에 0.2% 아디프산(Sigma-Aldrich)을, 그리고 VitC군은 AIN-93 정제식이에 0.2% 비타민 C (Sigma-Aldrich)를 첨가하여 제조된 식이를 13주간 공급하였다. 자세한 실험식이의 조성은 [표 3]과 같다. 식이는 매일 오전 10~11시 사이에 물과 함께 공급하였으며, 식이 섭취량은 매일 측정하였다.
실험사육기간 동안 무모생쥐의 등 부분에 주 3회 자외선 B (UVB)를 조사하였으며 자외선 조사량은 처음 1주간은 73 mJ/cm2, 2주째는 146 mJ/cm2, 3주부터 13주까지는 219 mJ/cm2로 조사하였다. 사육하는 동안 매주 체중 및 피부두께 측정, 등 피부 사진촬영을 실시하였다. 피부두께는 디지털 마이크로 캘리퍼(Marathon Watch Company Ltd, Ontario, Canada)를 이용하여 무모생쥐의 엉덩이 부분을 측정하였다. 측정할 때 사용된 캘리퍼는 0.01 mm 까지 측정가능하며 두께에 일정한 힘을 가할 수 있는 조절기능을 갖추고 있어 같은 힘을 준 상태에서 피부의 두께 측정이 가능하였다.
실험이 종료된 후 실험동물을 마취한 후 혈액을 채취한 후 혈액학적 분석에 사용하였고, 등 쪽 피부조직을 절취하여 일부는 냉동고에 보관한 후 분자생물학적 검사에 사용하였고, 일부는 10% 포르말린 용액에 고정하여 면역조직화학적 염색에 사용하였다.
실험식이 조성표
성분 AIN- 93G식이 (g/kg diet) 아디프산 보충식이(AA) (g/kg diet) 비타민C 보충식이(VitC) (g/kg diet)
카제인 200 200 200
말토덱스트린 132 132 132
옥수수 전분 397.486 395.486 395.486
수크로오스 100 100 100
셀룰로오스 50 50 50
콩기름 70 70 70
비타민 복합물 10 10 10
미네랄 복합물 35 35 35
콜린 비타르트레이트 2.5 2.5 2.5
L-시스틴 3 3 3
Tert-부티하이드로퀴논 0.014 0.014 0.014
Adipic acid - 2 -
Vitamin C - - 2
총합(g) 1,000 1,000 1,000
2-2) 피부 보습, 탄력성 및 홍반지수 측정
실험동물의 피부 수분함유량, 수분증발량, 탄력성 및 홍반지수 측정은 각각 Corneometer®, Tewameter®, Cutometer®, Mexameter®(CK Electronics GmbH)을 이용하여 실험 종료일에 1회 측정하였다. 측정 시 실험동물 등의 일정한 부분을 가볍게 눌러서 나타나는 수치를 기록하였다.
2-3) 등피부조직의 주름 측정
13주 동안 자외선 조사를 실시한 무모 생쥐의 피부를 실리콘 고무로 모사판을 제작하여 주름의 형성 정도를 측정하였다. 무모 생쥐의 등 부분에 지름이 1 cm가 되는 원모양의 구멍이 있는 디스크를 부착하고 모사판 제작용 시약을 혼합하여 무모 생쥐의 등 부분에 얇게 펴 바르고 완전히 말린 다음 디스크를 조심스럽게 떼어내어 모사판을 제작하였다. 모사판의 제작 온도는 20 ~ 23℃, 습도 45 ~ 50%의 항온항습 상태에서 실시하였으며, 모사판 제작용 실리판 고무 인상재(Epigem, Seoul, Korea)를 사용하였다. 제작한 모사판의 분석은 컴퓨터 영상분석기(Visioline VL650, CK electronic GmbH, Germany)을 사용하여 주름의 총면적(total wrinkle area), 최대 주름깊이(max wrinkle depth), 주름 평균깊이(mean depth) 및 평균길이(mean length) 등의 4가지 주름지표 항목을 분석하였다.
2-4) 피부조직의 면역조직화학적 염색
무모생쥐의 등 피부 조직을 적출하고 10% 포르말린에 고정한 다음 헤마톡실린과 에오신(H&E) 염색을 실시하였다. 형광현미경 (ECLIPSE E600, Nikon, Japan)을 이용하여 관찰하였고, 디지털 카메라(DXM 1200F, Nickon, Japan)를 이용하여 사진촬영을 하였다.
2-5) RT- PCR 분석
등 피부조직 0.1 g 당 트리졸 용액 1 ml을 첨가하여 조직을 분쇄한 후, 4℃, 12,000×g에서 10분간 원심분리 하였다. 상층액을 새 튜브로 옮긴 후 클로로포름 200 ㎕을 첨가하고, 볼텍싱하였다. 이 과정을 두 번 반복한 다음, 상층액을 새 튜브로 옮긴 후 아이소프로판올과 상층액을 1:1 비율로 첨가하였다. 10회 세게 흔든 다음 실온에서 15분 동안 방치한 후, 12,000×g, 4℃에서 10분간 원심분리 시킨 후 상층액을 제거하고, 남은 침전물에 70% 에탄올 1 ml을 가한 후 7,500×4℃에서 5분 동안 원심분리 하였다. 에탄올을 제거한 후 RNA 침전물이 담긴 튜브를 실온에서 15분 동안 건조시키고, 핵산분해효소가 없는 물을 사용하여 RNA 펠렛을 용해시켰다. UV/VIS 분광 광도계(Beckman coulter, DU730)를 이용하여 260 nm 및 280 nm 파장에서 추출된 RNA 시료의 농도를 측정하고, 아가로스 겔 전기영동을 실시하여 RNA 시료에 이상이 없음(integrity)을 확인하였다.
등 피부조직에서 추출된 RNA시료를 대상으로 올리고 dT 프라이머와 슈퍼스크립트 역전사효소(GIBCO BRL, Gaithersburg, MD, USA)를 이용하여 역전사를 수행함으로써 cDNA를 합성하였다. 역전사를 통해 얻은 cDNA를 주형으로 하고 증폭하고자 하는 유전자 cDNA의 5'과 3'측면 염기서열(flanking sequence)을 프라이머로 사용하여 PCR을 수행하였으며, 이때 사용된 프라이머 염기서열은 [표 4]에 제시된 바와 같다. 증폭된 PCR 산물 1 ㎕를 1% 아가로스 겔에 전기영동 하여 DNA 밴드를 확인하였다.
RT-PCR에 사용된 프라이머 염기서열
유전자 프라이머 염기서열 (5'→3') 어닐링 온도 (℃) PCR 산물 (bp) 서열번호
Collagen type Ⅰ alpha 1 (Col1α1) F ggcaacagtcgcttcaccta 55 164 7
R agtccgaattcctggtctgg 8
Collagen type Ⅰ alpha 2 (Col1α2) F cggttctgttggtcctgttg 55 103 9
R acccctgtgccctttatcac 10
Collagen type Ⅲ alpha 1 (Col3α1) F taaccaaggctgcaagatgg 55 104 11
R accagtgcttacgtgggaca 12
Matrix metallopeptidase 1a (MMP-1a) F ccctgtgtttcacaacggag 55 133 13
R cctcagcttttcagccatca 14
Matrix metallopeptidase 1b (MMP-1b) F tttgctcatgcttttctgcc 55 146 15
R gaatgggagagtccaaggga 16
Matrix metallopeptidase 3 (MMP-3) F tgctggtatggagcttctgc 55 142 17
R catctccaacccgaggaact 18
Matrix metallopeptidase 9 (MMP-9) F gtggaccatgaggtgaacca 55 102 19
R actgcacggttgaagcaaag 20
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) F ggagattgttgccatcaacg 55 122 21
R tgacaagcttcccattctcg 22
2-6) 무모 생쥐의 체중 및 식이섭취량 측정 결과
도 3에 나타난 바와 같이, 자외선조사, 아디프산 및 비타민C 섭취는 무모 생쥐 마우스의 체중 및 식이섭취량에 유의한 영향을 미치지 않았다(도3 참조).
2-7) 자외선 조사 무모 생쥐 피부조직의 수분량, 탄력성 및 홍반지수 변화 측정 결과
도4에 나타난 바와 같이, 13주 동안 자외선을 조사받은 +UVB 대조군은 자외선을 조사받지 않은 정상군(-UVB)에 비해 피부조직의 수분함유랑 및 탄력성은 유의하게 감소한 한편, 수분증발량 및 홍반지수는 유의하게 증가하였다(도4 참조). 아디프산을 섭취시킨 군(AA)의 경우 같은 세기의 UV가 조사되었음에도 불구하고 +UVB 대조군에 비해 수분함유랑 및 탄력성은 각기 88% 및 83% 유의하게 증가하였고, 수분증발량 및 홍반지수는 각각 56% 및 28% 유의하게 감소하였음을 확인하였다. 이와 같은 아디프산이 피부조직 수분량, 탄력성 및 홍반지수에 미치는 효과는 비타민 C에 의한 효과와 유사하였다(도5 참조).
2-8) 자외선 조사 무모 생쥐의 피부주름 생성변화 측정 결과
아디프산의 섭취가 피부주름의 형성정도에 미치는 영향을 평가하기 위하여 무모 생쥐에 13주 동안 UVB를 조사하면서 아디프산을 섭취시킨 군(AA)의 주름생성 억제효능을 자외선만 조사받은 대조군군(+UVB)의 등피부를 촬영하여 비교하였다. 도6에 나타난 바와 같이, +UVB 대조군은 자외선을 조사받지 않은 정상군(-UVB)에 비해 다수의 굵고 깊게 패인 주름과 함께 잔주름이 형성된 것을 육안상으로 관찰할 수 있었으며, 아디프산 섭취군의 경우 +UVB 대조군에 비해 주름의 굵기와 깊이가 현저히 감소하여 자외선을 조사받지 않은 -UVB군에서 관찰된 피부상태와 유사하게 개선된 것을 확인하였다(도5 참조).
13주 동안 자외선 조사를 실시한 무모 생쥐의 등피부를 실리콘 고무로 모사판을 제작하여 주름의 형성 정도를 측정한 결과, +UVB 대조군은 자외선을 조사받지 않은 정상군(-UVB)에 비해 굵고 깊게 패인 주름과 함께 잔주름이 형성된 것을 관찰할 수 있었으며, 아디프산 섭취군은 같은 세기의 UV가 조사되었음에도 불구하고 +UVB 대조군에 비해 깊은 주름이 거의 사라지는 등, 주름의 굵기와 깊이가 현저히 개선된 것을 확인하였다(도6 참조). 컴퓨터 영상분석기를 이용하여 모사판에서 주름형성 정도를 수치화 한 결과에서도 AA군의 경우 +UVB군에 비해 총주름면적이 38%, 최대 주름깊이가 45%, 평균 주름깊이가 18%, 그리고 평균 주름길이가 37% 유의하게 감소하였고, 이와 같은 아디프산의 주름개선 효능은 비타민 C에서 관찰된 주름개선효능과 유사하였다(도7B 참조). 따라서 아디프산의 섭취는 자외선조사에 의한 주름생성을 현저히 억제하는 효과가 있음을 알 수 있다.
2-9) 자외선 조사 무모 생쥐의 피부두께 변화 측정 결과
자외선 등에 의한 광노화가 진행되면 피부의 진피층 보호를 위해 각질층의 형성이 증가하여 피부의 두께는 두꺼워지고, 자외선 조사에 의해 피부의 두께가 두꺼워졌다는 것은 그만큼 광노화에 의한 피부손상이 크다는 것을 의미한다(Gail J Molecular mechanism of skin ageing Mech Ageing Dev 123: 801-810, 2002)
실험사육 마지막 날 디지털 마이크로 캘리퍼를 이용하여 등피부의 두께를 측정한 결과, 도 7에 나타난 바와 같이, 아디프산을 섭취시킨 군은 +UVB 대조군에 비해 피부두께가 24% 유의하게 감소하였음을 확인하였다(도7A 참조). 피부조직의 H&E 염색을 통해 무모생쥐의 피부 표피층 두께를 관찰한 결과에서도 +UVB 대조군은 자외선을 조사받지 않은 정상군(-UVB)에 비해 피부 표피층의 비후현상이 관찰되었고, AA군의 경우 +UVB 대조군에 비해 비후해진 표피층의 두께가 현저히 감소된 것이 확인되었다(도7B 참조).
2-10) 자외선 조사 무모 생쥐 피부조직의 유전자발현 변화
콜라겐 타입 1과 3은 진피층의 세포간질 구성성분을 이루는 단백질이고, 특히 타입 1 콜라겐은 피부결합조직에 존재하는 세포외기질 단백질 중 가장 많은 양으로 존재한다. 한편, 콜라겐 분해를 촉매하는 MMPs는 포유류에서 23개의 타입이 존재하며 이중 자외선에 의해 증가하는 MMP 타입은 1, 3, 9번으로 알려져 있고 이들 세가지 타입의 MMP는 콜라겐 타입 1과 3을 분해하는 효소로 알려져 있다. MMP-1이 콜라겐섬유의 중간을 절단하는 한편, MMP-3, MMP-9는 절단된 콜라겐섬유를 세분해서 절단하는 역할을 하는 것으로 알려져 있다.
+UVB 대조군은 자외선을 조사받지 않은 정상군(-UVB)에 비해 피부조직의 콜라겐 타입 1α1과 α2, 그리고 콜라겐 타입 3α1의 발현은 유의하게 감소하였고, MMP-1a 및 -1b, MMP-3, 그리고 MMP-9 유전자 발현은 유의하게 증가하였다. 아디프산 섭취군의 경우 +UVB 대조군에 비해 콜라겐 타입 1α1과 α2, 그리고 콜라겐 타입 3α1의 발현은 유의하게 증가하였고, MMP-1a 및 -1b, MMP-3, 그리고 MMP-9 유전자 발현은 유의하게 감소하였다(도8 참조). 따라서 아디프산은 피하조직의 콜라겐 단백질 합성을 증가시키고 콜라겐 섬유의 분해를 저해함으로써 자외선조사에 의한 주름형성을 완화한 것으로 생각된다.
실시예 3. 피부의 주름개선효과 및 피부자극 관능시험
3-1) 제형 실시예 비교예
아디프산을 함유한 영양크림의 성분구성을 하기 표 5와 같이 구성하여 제조하였다. 이때, 성분함량의 단위는 중량%이다.
아디프산을 함유한 영양크림의 성분구성
번호 성분 실시예 비교예
1 세테아릴알코올 1.5 1.5
2 글리세릴스테아레이트 1.0 1.0
3 폴리소르베이트 60 1.2 1.2
4 소르비탄세스퀴올리에이트 0.3 0.3
5 세틸옥타노에이트 6.0 6.0
6 스쿠알란 8.0 8.0
7 아프리코드커넬오일 4.0 4.0
8 디메치콘 1.0 1.0
9 부틸렌글라이콜 5.0 5.0
10 글리세린 4.0 4.0
11 마그네슘알루미늄실리케이트 0.2 0.2
12 산탄검 0.05 0.05
13 방부제 미량 미량
14 정제수 잔량 잔량
15 아디프산 1.0 -
한편, 상기 표5의 각 성분번호로 구별된 성분 중에서, 먼저 성분 1 내지 8을 70℃의 온도에서 가열 용해시킨 다음, 성분 9 내지 13을 성분 14에 용해 분산시켜 70℃로 가열한 것에 유화한다. 이후, 상기 유화한 것을 56℃의 온도로 냉각한 후, 분취된 성분 9에 용해시킨 성분 15를 가하여 교반하고 실온에서 냉각하여 제조하였다.
상기 제형 실시예에 대한 그 비교예는 성분 15인 아디프산을 제외한 나머지 성분구성이나 제조방법은 동일하게 진행하여 제조한 것을 설정하였다.
3-2) 주름개선효과 및 피부자극 관능시험
본 발명에 따른 피부 주름개선용 화장료 조성물의 피부 주름개선효과 및 피부자극을 평가하기 위하여, 상기 제형 실시예와 제형 비교예에서 제조된 영양크림을 이용하여 관능시험을 실시하였다.
구체적으로, 제형 실시예와 제형 비교예의 영양크림을 피부에 각각 도포했을 때 피부의 주름개선효과를 측정하기 위하여 20세 이상의 여성 20명에게 안면 왼쪽 부분에는 제형 실시예의 영양크림(시험군)을, 안면 오른쪽 부분에는 제형 비교예의 영양크림(대조군)을 1일 1회 12주간 지속적으로 사용하게 하였다.
관능시험에서 피부의 주름개선효과 항목에 대하여는 제형 비교예의 영양크림을 기준으로 제형 실시예의 영양크림이 나타내는 주름개선효과를 상대적으로 평가하게 하였고, 피부자극에 대한 관능평가는 피부의 가려움, 따가움 및 홍반 등의 현상을 평가하게 하였다. 평가는 매우 우수(5점), 우수(4점), 보통(3점), 나쁨(2점), 매우 나쁨(1점)의 오점법 기준에 의거하여 수행하였으며, 그 결과를 하기 표 6에 나타내었다. 표 6에서 피부자극은 피부자극이 없는 정도를 나타낸다.
피부자극 및 주름개선효과 평가
번호 피부자극 주름개선효과
실시예 비교예 실시예 비교예
1 4 5 5 4
2 5 5 5 5
3 5 4 5 3
4 3 4 4 3
5 4 4 5 4
6 5 5 5 5
7 4 4 4 4
8 4 4 4 4
9 5 5 5 4
10 4 4 4 4
11 5 5 5 4
12 5 5 5 5
13 3 4 4 3
14 4 4 4 5
15 5 4 4 5
16 4 4 4 4
17 5 5 5 4
18 5 5 5 3
19 5 5 5 5
20 4 4 4 3
평균 4.40 4.45 4.55 4.05
상기 표 6에 나타난 바와 같이, 본 발명에 따른 제형 실시예의 화장료 조성물에 대한 피부자극 평가점수는 4.40점으로 매우 양호하게 평가되어, 제형 비교예4와 마찬가지로 피부자극 정도가 낮아 피부 안전성이 우수함을 확인할 수 있었다.
또한, 제형 비교예 대비 제형 실시예의 화장료 조성물이 가진 상대적인 피부의 주름개선효과는 평가점수 4.55점으로 개선 정도가 매우 우수함을 알 수 있었다.
실시예 4. 피부의 탄력 증진 효과 실험
진피는 교원섬유인 콜라겐과 탄력섬유인 엘라스틴으로 구성되어 있으며, 이중 콜라겐 섬유는 피부 장력 형성과 구조적인 통합을 이루게 하고, 엘라스틴 섬유는 피부 탄력에 관여하는 것으로서, 조직학적으로 피부 노화는 섬유아세포의 수적 감소 및 콜라겐과 엘라스틴 양의 감소로 세포외기질이 위축되는 것을 의미한다.
본 출원인은 아디프산의 피부 탄력 증진 효과를 확인하기 위하여, 상기 실시예 2에 기재된 방법을 따라 마우스 피부조직에서 엘라스틴 유전자 발현 정도를 확인하였다. 엘라스틴 유전자 증폭을 위한 프라이머 세트로 하기 [표 7]의 서열을 사용하였다.
유전자 프라이머 염기서열(5'→3') 어닐링 온도 (℃) PCR 산물 (bp) 서열번호
Elastin F tagggtgcaaagggttgtgt 60 193 23
R ccaaagagcacaccaacaatca 24
Glyceraldehyde 3-phosphate F ggagattgttgccatcaacg 55 122 25
R tgacaagcttcccattctcg 26
그 결과 도 9에 나타낸 바와 같이, 자외선만 조사한 대조군 마우스(+UVB)는 자외선을 조사받지 않은 정상군 마우스(-UVB)에 비해 엘라스틴 발현이 유의하게 감소하였고, 자외선 조사와 함께 아디프산 섭취군(AA)의 경우 대조군(+UVB)에 비해 엘라스틴 발현이 유의하게 증가하였을 뿐만 아니라, 양성 대조군인 비타민 C 섭취군(VitC)보다 뛰어난 효과를 나타내었다. 이로써 본원발명 아디프산은 엘라스틴 발현 촉진을 통해 피부 탄력 증진 효과를 나타내는 것을 확인하였다.
이상에서 설명한 바와 같이, 본 발명은 아디프산을 유효성분으로 함유하는 화장료 조성물을 제공한다. 본 발명에 따른 화장료 조성물은 피부 부작용이 없으며, 피부의 주름개선효과, 콜라겐합성효과 및 콜라겐을 분해하는 효소인 콜라게나아제의 발현 저해효과가 우수하여 피부의 주름을 개선하는데 매우 유용하다. 본 발명의 아디프산을 함유하는 조성물은 향후 기능성화장품 또는 건강기능식품의 소재로 활용될 수 있을 것으로 생각된다.
[제조예 1]
화장료의 제조
1-1) 유연 화장수의 제조
아디프산을 유효성분으로 포함하는 유연 화장수를 통상의 방법에 따라 제조하였다.
성분함량(중량%) 아디프산 0.1, 글리세린3.0, 부틸렌 글리콜 2.0, 프로필렌 글리콜 2.0, 카복시비닐폴리머 0.1, 에탄올 10.0, 트리에탄올아민 0.1, 방부제, 미량색소, 미량향료 및 미량정제수잔량 총계100.0
1-2) 영양 크림의 제조
아디프산을 유효 성분으로 포함하는 영양 크림을 통상의 방법에 따라 제조하였다. 성분함량은 중량%로 기재하였다.
아디프산 0.1, 밀납 10.0, 폴리소르베이트60 1.5, 소르비탄세스퀴올레이트 0.5, 유동파라핀 10.0, 스쿠알란 5.0, 카프릴릭/카프릭 트리글리세라이드 5.0, 글리세린 5.0, 부틸렌 글리콜 3.0, 프로필렌 글리콜 3.0, 트리에탄올아민 0.2, 방부제, 미량색소, 미량향료 및 미량정제수
1-3) 마스크팩용 조성물 및 마스크팩의 제조
아디프산을 유효 성분으로 포함하는 마스크팩용 조성물을 통상의 방법에 따라 제조하였다. 성분함량은 중량%로 기재하였다.
아디프산 0.1, 시토스테롤 13.0, 폴리 글리세릴 2-올레이트 0.2, 세라마이드 0.1, 세테아레스-4 5.0, 콜레스테롤 0.3, 디세틸포스페이트 0.4, 농글리세린 2.0, 마카데미아 오일 10.0, 카르복시비닐폴리머 0.4, 산탄검 0.1, 방부제 0.2, 향료 0.15. 정제수 68.05 총계 100.0
상기 제조된 마스크팩 조성물을 부직포(가로x세로, 10x10cm)에 함침시켜 마스크팩(Mask Pack) 제품을 제조하였다.
[제조예 2]
약학적 제제의 제조
2-1) 산제의 제조
본 발명의 아디프산 2 g
유당 1 g
상기의 성분을 혼합하고 기밀포에 충진하여 산제를 제조하였다.
2-2) 정제의 제조
본 발명의 아디프산 100 ㎎
옥수수전분 100 ㎎
유 당 100 ㎎
스테아린산 마그네슘 2 ㎎
상기의 성분을 혼합한 후, 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조하였다.
2-3) 캡슐제의 제조
본 발명의 아디프산 100 ㎎
옥수수전분 100 ㎎
유 당 100 ㎎
스테아린산 마그네슘 2 ㎎
상기의 성분을 혼합한 후, 통상의 캡슐제의 제조방법에 따라서 젤라틴 캡슐에 충전하여 캡슐제를 제조하였다.
2-4) 환의 제조
본 발명의 아디프산 1 g
유당 1.5 g
글리세린 1 g
자일리톨 0.5 g
상기의 성분을 혼합한 후, 통상의 방법에 따라 1환 당 4 g이 되도록 제조하였다.
2-5) 과립의 제조
본 발명의 아디프산 150 ㎎
대두추출물 50 ㎎
포도당 200 ㎎
전분 600 ㎎
상기의 성분을 혼합한 후, 30% 에탄올 100 ㎎을 첨가하여 섭씨 60 ℃에서 건조하여 과립을 형성한 후 포에 충진하였다.
[제조예 3]
식품의 제조
아디프산을 함유한 기능식품 조성물은 다음 각각의 제제예와 같은 조성으로 통상의 액제 제조방법으로 제조하였다. 최종 부피는 각 액제에 100 ml이다. 본 제제예는 액제 뿐만 아니라 정제, 산제, 과립제 등으로 통상의 제조방법으로 제조가 가능하다.
성분함량 (중량%) 아디프산 100 mg, 벌꿀 1500 mg, 비타민C 50 mg, 비타민B6 10 mg, 니코틴산아미드10 mg, 로얄젤리 80 mg, 방부제, 향, 미량정제수잔량 합계 100 mg

Claims (18)

  1. 아디프산을 유효성분으로 함유하는 피부 주름 개선 또는 탄력 증진용 화장료 조성물.
  2. 제1항에 있어서,
    상기 아디프산은 화장료 전체 중량에 대하여 0.0001 내지 20 중량% 포함되는 것을 특징으로 하는 피부 주름 개선 또는 탄력 증진용 화장료 조성물.
  3. 제1항에 있어서,
    상기 조성물은 프로콜라겐 분비량의 증가, 콜라겐 생합성의 촉진, MMP-1 유전자의 발현 감소 및 피부 표피층 비후 억제로 이루어지는 군에서 선택되는 어느 하나 이상의 효과를 가지는 것을 특징으로 하는 피부 주름 개선 또는 탄력 증진용 화장료 조성물.
  4. 제1항에 있어서,
    상기 화장료는 스킨로션, 스킨 소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스처 로션, 영양로션, 맛사지 크림, 영양크림, 모이스처 크림, 핸드크림, 에센스, 팩, 마스크팩, 마스크시트, 비누, 샴푸, 클렌징 폼, 클렌징로션, 클렌징크림, 바디로션, 바디클렌저, 유액, 프레스파우더, 루스파우더 및 아이섀도로 구성된 그룹에서 선택된 어느 하나의 제형을 가지는 것임을 특징으로 하는 피부 주름 개선 또는 탄력 증진용 화장료 조성물.
  5. 제1항에 있어서,
    상기 조성물은 화장품학적으로 허용 가능한 담체를 추가로 포함하는 것을 특징으로 하는 피부 주름 개선 또는 탄력 증진용 화장료 조성물.
  6. 제1항에 있어서,
    상기 조성물은 피부 주름개선 성분 또는 피부탄력 증진 성분을 추가로 포함하는 것을 특징으로 하는 피부 주름 개선 또는 탄력 증진용 화장료 조성물.
  7. 제6항에 있어서,
    추가의 피부 주름개선 성분은 비타민 C, 레티노산, TGF, 동물 태반 유래의 단백질, 베튤린산 및 클로렐라 추출물로 구성되는 군으로부터 선택되는 어느 하나 이상인 피부 주름 개선 또는 탄력 증진용 화장료 조성물.
  8. 아디프산을 유효성분으로 함유하는 피부 주름 개선 또는 탄력 증진용 피부 외용제 조성물.
  9. 아디프산을 유효성분으로 함유하는 피부 주름 개선 또는 탄력 증진용 식품 조성물
  10. 제9항에 있어서,
    상기 식품은 정제, 과립, 분말, 캅셀, 액상의 용액 및 환으로 이루어진 군으로부터 선택된 어느 하나의 제형으로 제조된 것을 특징으로 하는 피부 주름 개선 또는 탄력 증진용 식품 조성물.
  11. 아디프산을 유효성분으로 함유하는 피부 주름 개선 또는 탄력 증진용 약학적 조성물.
  12. 아디프산을 유효성분으로 함유하는 조성물을 사용한 피부 주름 개선 또는 피부 탄력 증진 방법.
  13. 제12항에 있어서,
    상기 아디프산은 조성물 전체 중량에 대하여 0.0001 내지 20 중량% 포함되는 것을 특징으로 하는 피부 주름 개선 또는 피부 탄력 증진 방법.
  14. 제12항에 있어서,
    상기 조성물은 프로콜라겐 분비량의 증가, 콜라겐 생합성의 촉진, MMP-1 유전자의 발현 감소 및 피부 표피층 비후 억제로 이루어지는 군에서 선택되는 어느 하나 이상의 효과를 가지는 것을 특징으로 하는 피부 주름 개선 또는 피부 탄력 증진 방법.
  15. 제12항에 있어서,
    상기 조성물은 화장료 조성물, 피부 외용제 조성물, 식품 조성물 및 약학적 조성물로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 피부 주름 개선 또는 피부 탄력 증진 방법.
  16. 제15항에 있어서,
    상기 화장료는 스킨로션, 스킨 소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스처 로션, 영양로션, 맛사지 크림, 영양크림, 모이스처 크림, 핸드크림, 에센스, 팩, 마스크팩, 마스크시트, 비누, 샴푸, 클렌징 폼, 클렌징로션, 클렌징크림, 바디로션, 바디클렌저, 유액, 프레스파우더, 루스파우더 및 아이섀도로 구성된 그룹에서 선택된 어느 하나의 제형을 가지는 것을 특징으로 하는 피부 주름 개선 또는 피부 탄력 증진 방법.
  17. 제12항에 있어서,
    상기 조성물은 피부 주름개선 성분 또는 피부탄력 증진 성분을 추가로 포함하는 것을 특징으로 하는 피부 주름 개선 또는 피부 탄력 증진 방법.
  18. 제17항에 있어서,
    상기 추가의 피부 주름개선 성분은 비타민 C, 레티노산, TGF, 동물 태반 유래의 단백질, 베튤린산 및 클로렐라 추출물로 구성되는 군으로부터 선택되는 어느 하나 이상인 피부 주름 개선 또는 피부 탄력 증진 방법.
PCT/KR2017/001528 2016-02-15 2017-02-13 아디프산을 유효성분으로 함유하는 피부주름개선 및 피부탄력증진용 조성물 Ceased WO2017142265A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2016-0017137 2016-02-15
KR1020160017137A KR101721022B1 (ko) 2016-02-15 2016-02-15 아디프산을 유효성분으로 함유하는 피부주름개선 및 피부탄력증진용 조성물

Publications (1)

Publication Number Publication Date
WO2017142265A1 true WO2017142265A1 (ko) 2017-08-24

Family

ID=58497912

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/001528 Ceased WO2017142265A1 (ko) 2016-02-15 2017-02-13 아디프산을 유효성분으로 함유하는 피부주름개선 및 피부탄력증진용 조성물

Country Status (2)

Country Link
KR (1) KR101721022B1 (ko)
WO (1) WO2017142265A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114432284A (zh) * 2022-03-16 2022-05-06 中国农业大学 己二酸在制备抗皮肤光损伤产品中的用途

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102132817B1 (ko) * 2018-12-07 2020-07-10 조선대학교산학협력단 솔잎 유래의 말론산을 유효성분으로 포함하는 자외선에 대한 피부보호용 조성물
KR20230065584A (ko) 2021-11-05 2023-05-12 재단법인대구경북과학기술원 Rgd 함유 엘라스틴 유사 폴리펩타이드 및 줄기세포를 포함하는 상처치유 재생 시 피부 탄력도 개선용 조성물

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101101808B1 (ko) * 2011-06-01 2012-01-05 연세대학교 산학협력단 아디픽산의 신규한 용도
US20130116189A1 (en) * 2010-06-15 2013-05-09 Sunstar Inc. of Osaka, Japan Retinol-modified collagen, method for producing same, and external composition for skin containing same
KR101318084B1 (ko) * 2011-12-26 2013-10-14 한국콜마주식회사 폴리쿼터늄-51 및 아디프산/네오펜틸글리콜 크로스 폴리머 서스펜션 솔루션을 포함하는 수분산 화장료 조성물
US8568751B1 (en) * 2011-02-17 2013-10-29 Beachbody, LLC Anti-aging cosmeceutical composition
JP2014125432A (ja) * 2012-12-25 2014-07-07 Lion Corp 皮膚貼付剤組成物

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104187702A (zh) * 2014-09-30 2014-12-10 青岛金佳慧食品有限公司 一种延缓皮肤衰老的保健食品

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130116189A1 (en) * 2010-06-15 2013-05-09 Sunstar Inc. of Osaka, Japan Retinol-modified collagen, method for producing same, and external composition for skin containing same
US8568751B1 (en) * 2011-02-17 2013-10-29 Beachbody, LLC Anti-aging cosmeceutical composition
KR101101808B1 (ko) * 2011-06-01 2012-01-05 연세대학교 산학협력단 아디픽산의 신규한 용도
KR101318084B1 (ko) * 2011-12-26 2013-10-14 한국콜마주식회사 폴리쿼터늄-51 및 아디프산/네오펜틸글리콜 크로스 폴리머 서스펜션 솔루션을 포함하는 수분산 화장료 조성물
JP2014125432A (ja) * 2012-12-25 2014-07-07 Lion Corp 皮膚貼付剤組成物

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114432284A (zh) * 2022-03-16 2022-05-06 中国农业大学 己二酸在制备抗皮肤光损伤产品中的用途

Also Published As

Publication number Publication date
KR101721022B1 (ko) 2017-03-29

Similar Documents

Publication Publication Date Title
WO2017146414A1 (ko) α-테르피네올을 유효성분으로 함유하는 피부 보습 및 피부 주름 개선용 조성물
WO2017222317A1 (ko) 이오논 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
WO2018004141A1 (ko) 시멘, 베헨산, 2-메톡시나프탈렌, 티몰 및 이들의 염으로 이루어진 군에서 선택된 어느 하나 이상을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
WO2021261975A1 (ko) 식물성 콜라겐 및 식물성 뮤신을 포함하는 식물 추출물 및 이의 제조방법
WO2024049120A1 (ko) 친환경 천연 공융 용매로 추출한 추출물을 포함하는 화장료 조성물
WO2020071630A1 (ko) 천연소재 추출물을 포함하는 피부 개선용 조성물
WO2020246766A1 (ko) 찹쌀떡버섯으로 발효한 홍경천 추출물을 함유하는 피부노화 예방 또는 개선용 조성물
WO2024181725A1 (ko) 홍국균으로 발효시킨 적색 병풀 및 이의 용도
WO2017142265A1 (ko) 아디프산을 유효성분으로 함유하는 피부주름개선 및 피부탄력증진용 조성물
WO2018186640A1 (ko) 오시멘 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2017213346A1 (ko) 디오스민 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
WO2022085858A1 (ko) 황칠 추출물을 포함하는 미백 또는 주름 개선용 조성물
WO2016117762A1 (ko) 구스베리 추출물 또는 글루타티온을 포함하는 조성물
WO2020218890A1 (ko) 개다래 추출물을 포함하는 피부 손상 개선용 또는 피부 보습용 조성물
WO2018186641A1 (ko) 피페로날 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2020218720A1 (ko) 익모초 추출물 또는 레오누린을 함유하는 근육 질환 예방 또는 치료용 또는 근 기능 개선용 조성물
WO2018186644A1 (ko) 자스몬 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2018186643A1 (ko) 신코닌 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2017014597A1 (ko) 오미자 종자 추출물을 포함하는 피부 미백 개선용 화장품 조성물
WO2020256380A1 (ko) 카르본 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물
WO2021040470A1 (ko) 섬나리 추출물을 포함하는 조성물
WO2018186639A1 (ko) 요놀 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2023219300A1 (ko) 신규한 클로렐라 불가리스 균주 및 이의 용도
WO2016003120A1 (ko) 알피나 골무꽃 추출물을 포함하는 미백용 조성물
KR102212343B1 (ko) 마리안 플럼 추출물을 유효성분으로 함유하는 피부 항노화 및 보습용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17753426

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17753426

Country of ref document: EP

Kind code of ref document: A1