WO2017123918A1 - Methods and compositons for the activation of gamma-delta t-cells - Google Patents

Methods and compositons for the activation of gamma-delta t-cells Download PDF

Info

Publication number
WO2017123918A1
WO2017123918A1 PCT/US2017/013399 US2017013399W WO2017123918A1 WO 2017123918 A1 WO2017123918 A1 WO 2017123918A1 US 2017013399 W US2017013399 W US 2017013399W WO 2017123918 A1 WO2017123918 A1 WO 2017123918A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
cell
cells
fdps
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/013399
Other languages
English (en)
French (fr)
Inventor
Charles David Pauza
Li HAISHAN
Tyler LAHUSEN
Mei-Ling Liou
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
American Gene Technologies International Inc
Original Assignee
American Gene Technologies International Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to JP2018536892A priority Critical patent/JP7260898B2/ja
Priority to CN201780017712.6A priority patent/CN108883100B/zh
Priority to IL297238A priority patent/IL297238B2/en
Priority to AU2017207906A priority patent/AU2017207906B2/en
Priority to ES17739028T priority patent/ES2965357T3/es
Priority to EP17739028.3A priority patent/EP3402483B1/en
Priority to CA3011529A priority patent/CA3011529A1/en
Priority to CN202211395043.5A priority patent/CN116064678A/zh
Application filed by American Gene Technologies International Inc filed Critical American Gene Technologies International Inc
Priority to EP23199847.7A priority patent/EP4310500A3/en
Priority to IL279520A priority patent/IL279520B2/en
Priority to IL310925A priority patent/IL310925A/en
Priority to DK17739028.3T priority patent/DK3402483T3/da
Priority to US15/652,080 priority patent/US9914938B2/en
Publication of WO2017123918A1 publication Critical patent/WO2017123918A1/en
Priority to US15/706,481 priority patent/US9834790B1/en
Priority to US15/849,062 priority patent/US10036040B2/en
Priority to US15/850,937 priority patent/US10023880B2/en
Priority to US15/904,131 priority patent/US10137144B2/en
Priority to US16/008,991 priority patent/US10472649B2/en
Priority to IL260594A priority patent/IL260594B/en
Anticipated expiration legal-status Critical
Priority to US16/132,247 priority patent/US10420789B2/en
Priority to US16/182,443 priority patent/US10428350B2/en
Priority to US16/530,908 priority patent/US10772905B2/en
Priority to US16/563,738 priority patent/US11519006B2/en
Priority to US16/988,427 priority patent/US11534450B2/en
Priority to AU2021203836A priority patent/AU2021203836B2/en
Priority to US18/051,821 priority patent/US12410446B2/en
Priority to US18/055,525 priority patent/US12403155B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/66Phosphorus compounds
    • A61K31/675Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5158Antigen-pulsed cells, e.g. T-cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • C12N2310/531Stem-loop; Hairpin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor

Definitions

  • the present disclosure relates generally to the fields of gene therapy and immunotherapy, specifically in relation to increased activation of gamma delta (“GD”) T cells.
  • GD gamma delta
  • Human T ceils are distinguished on the basis of T cell receptor structure.
  • Gamma delta (“GD") T cells make up 3-10% circulating lymphocytes, and V52+ subset makes up 75% of GD T cells in blood.
  • V62+ cells recognize tion-peptide epitopes and do not5 require antigen presentation by major histocompatibility complexes (“MHC”) or human leukocyte antigen (“HLA").
  • MHC major histocompatibility complexes
  • HLA human leukocyte antigen
  • V52+ T ceils also express a Vy9 chain and are stimulated by exposure to 5-carbon pyrophosphate compounds that are intermediates in mevalonate and non-mevalonate sterol/isoprenoid synthesis pathways.
  • 5-carbon pyrophosphate compounds that are intermediates in mevalonate and non-mevalonate sterol/isoprenoid synthesis pathways.
  • the response to isopentenyl pyrophosphate (5-carbon) is universal among healthy human beings.
  • GD T cells have several functions, including killing tumor cells and pathogen-infected cells. Stimulation through their unique T ceil receptor ("TCRs") composed5 of two glycoprotein chains, ⁇ and ⁇ , improves the capacity for cellular cytotoxicity, cytokine secretion and other effector functions.
  • TCRs T ceil receptor
  • the TCRs of GD T cells have unique specificities and the cells themselves occur in high clonal frequencies, thus allowing rapid innate-like responses to tumors and pathogens.
  • Aminobisphosphonate drugs (“ABPs”) and other inhibitors of famesyl diphosphate0 synthase (“FDPS”). which are downstream from isopentenyl pyrophosphate (“1PP”) in the mevalonate pathway (see, for e.g., Figure 1), have been used to treat various diseases, including cancers, specifically those involving bone metastasis.
  • ABPs include trade names such as Zometa® (Novartis) and Fosamax® (Merck).
  • ABPs have also been used to stimulate GD T cells. This may be because when FDPS is inhibited in myeloid cells, IPP begins to accumulate and geranylgeranyl pyrophosphate ("GGPP"), a downstream product of FDPS that suppresses activation of the inflammasome pathway, is reduced.
  • GGPP geranylgeranyl pyrophosphate
  • the reduction in GGPP removes an inhibitor of the caspase-dependent inflammasome pathway and allows secretion of mature cytokines including interleukin-beta and interleukin-18, the latter being especially important for gamma delta T cell activation.
  • V52+ T cells activated by IPP or ABPs will proliferate rapidly, express a number of cytokines and chemokines, and can function to cytotoxically destroy tumor cells or cells infected with pathogenic microorganisms.
  • ABPs are associated with inflammation and osteonecrosis, as well as having poor bioavailability due to their chemistry.
  • IPP has a very short half-life and is difficult to synthesize. Both types of compounds require systemic administration in an individual. Accordingly, both ABPs in general, and IPP specifically, leave a great deal to be desired for therapeutic purposes.
  • a method of activating a GD T cell includes infecting, in the presence of the GD T cell, a target cell with a viral delivery system that encodes at least one genetic element.
  • the at least one genetic element includes a small RNA capable of inhibiting production of an enzyme involved in the mevalonate pathway.
  • the enzyme is FDPS.
  • the target cell when the enzyme is inhibited in the target cell, the target cell subsequently activates the GD T cell.
  • the target cell is a cancer cell or a cell that has been infected with an infectious agent.
  • the activation of the GD T cell results in the GD T cell killing the cancer cell or the cell infected with an infectious agent.
  • the at least one encoded genetic element includes a microRNA or a shRNA.
  • the target cell is also contacted with an aminobisphosphonate drug.
  • the aminobisphosphonate drug is zoledronic acid.
  • a method of treating cancer in a subject includes administering to the subject a therapeutically-effective amount of a viral delivery system that encodes at least one genetic element.
  • the at least one genetic element includes a small RNA capable of inhibiting production of an enzyme involved in the mevalonate pathway.
  • the enzyme when the enzyme is inhibited in a cancer cell in the presence of a GD T cell, the cancer cell activates the GD T cell, to thereby treat the cancer.
  • the enzyme is FDPS.
  • the at least one encoded genetic element includes a microRNA or a shRNA.
  • the target cell is also contacted with an aminobisphosphonate drug.
  • the aminobisphosphonate drug is zoledronic acid.
  • a method of treating an infectious disease in a subject includes administering to the subject a therapeutically-effective amount of a viral delivery system that encodes at least one genetic element.
  • the at least one genetic element includes a small RNA capable of inhibiting production of an enzyme involved in the mevalonate pathway.
  • the enzyme when the enzyme is inhibited in a cell that is infected with an infectious agent in the presence of a GD T cell, the infected cell activates the GD T cell, to thereby treat the infected cell, and the infectious disease.
  • the enzyme is FDPS.
  • the at least one encoded genetic element includes a microRNA or a shRNA.
  • the target cell is also contacted with an aminobisphosphonate drug.
  • the aminobisphosphonate drug is zoledronic acid.
  • the at least one encoded genetic element includes a shRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with
  • the shRNA includes GTCCTGGAGTACAATGCCATTCTCGAG AATGGCATTGTACTCCAGGACTTTTT (SEQ ID NO: 1); GCAGGATTTCGTTCA GCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT (SEQ ID NO: 2); GCCA TGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT (SEQ ID NO: 3); or GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTT CTGCTTTTTTT (SEQ ID NO: 4).
  • the at least one encoded genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAA GCCACAGATGGCAGAAGGAGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCA AGGGGCT (SEQ ID NO: 5); AAGGTATATTGCTGTTGACAGTGAGCGACACT
  • TTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGGCTGAGAAAGTGCT GCCTACTGCCTCGGACTTCAAGGGGCT SEQ ID NO: 6
  • TGCTGTTGACAGTG AGCGACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGAGGCTG AGAAAGTTGCCTACTGCCTCGGA (SEQ ID NO: 7); CCTGGAGGCTTGCTGAAG
  • GCTGTATGCTGACTTTCTCAGCCTCCTTCTGCTTTTGGCCACTGACTGAGCAGAAG GGCTGAGAAAGTCAGGACACAAGGCCTGTTACTAGCACTCA (SEQ ID NO: 8); CATCTCCATGGCTGTACCACCTTGTCGGGACTTTCTCAGCCTCCTTCTGCCTGTTG AATCTCATGGCAGAAGGAGGCGAGAAAGTCTGACATTTTGGTATCTTTCATCTGA CCA (SEQ ID NO: 9); or GGGCCTGGCTCGAGCAGGGGGCGAGGGATACTTTCT
  • the microRNA includes AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCT CCTTCTGCGTGAAGCCACAGATGGCAGAAGGAGGCTGAGAAAGTGCTGCCTACT GCCTCGGACTTCAAGGGGCT (SEQ ID NO: 5); AAGGTATATTGCTGTTGACAGT
  • a viral vector comprising at least one encoded genetic element.
  • the at least one encoded genetic element includes a small RNA capable of inhibiting production of an enzyme involved in the mevalonate pathway.
  • the enzyme involved in the mevalonate pathway is farnesyl diphosphate synthase (FDPS).
  • the at least one encoded genetic element includes a microRNA or a shRNA.
  • the at least one encoded genetic element includes a shRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with v
  • the shRNA includes SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3; or SEQ ID NO: 4.
  • the at least one encoded genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 9; or SEQ ID NO: 10.
  • the microRNA includes SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 9; or SEQ ID NO: 10.
  • the viral vector is comprised of any vector that can effectively transduce the small RNA into a target cell.
  • the viral vector is a lentiviral vector.
  • the viral vector is an adeno-associated virus vector.
  • the viral vector includes a second encoded genetic element.
  • the second genetic element includes at least one cytokine or chemokine.
  • the at least one cytokine is selected from the group consisting of: IL-18, TNF- a, interferon- ⁇ , IL-1, IL-2, IL-15, IL-17, and IL-12.
  • the at least one chemokine is a CC chemokine or a CXC chemokine.
  • the at least one chemokine is RANTES.
  • a lentiviral vector system for expressing a lentiviral particle includes a lentiviral vector, at least one envelope plasmid for expressing an envelope protein optimized for infecting a cell; and at least one helper plasmid for expressing gag, pol, and rev genes.
  • a lentiviral particle is produced by the packaging cell.
  • the lentiviral particle is capable of infecting a targeting cell, and inhibiting an enzyme involved in the mevalonate pathway within the target cell.
  • the enzyme involved in the mevalonate pathway is FDPS.
  • the lentiviral vector system includes a first helper plasmid for expressing the gag and pol genes, and a second helper plasmid for expressing the rev gene.
  • the envelope protein is preferably optimized for infecting a target cell.
  • the target cell is a cancer cell. In other embodiments, the target cell is a cell that is infected with an infectious agent.
  • Figure 1 depicts an overview of the major steps in the mevalonate pathway for biosynthesis of steroids and isoprenoids.
  • Figure 2 depicts an exemplary 3-vector lentiviral vector system in a circularized form.
  • Figure 3 depicts an exemplary 4-vector lentiviral vector system in a circularized form.
  • Figure 4 depicts: (A) a linear map of a lentiviral vector expressing a FDPS shRNA targeting sequence; and (B) a linear map of a lentiviral vector expressing a synthetic microRNA with a FDPS targeting sequence.
  • Figure 5 depicts data demonstrating activation of V52+ T cells THP-1 leukemia cells with a lentivirus expressing FDPS shRNA #4 (SEQ ID NO: 4), as described herein.
  • Figure 6 depicts data demonstrating activation of V52+ T cells by THP-1 leukemia cells with a lentivirus expressing FDPS shRNA #4 (SEQ ID NO: 4), as described herein.
  • Figure 7 depicts data demonstrating activation of V52+ T cells by PC3 prostate carcinoma cells with a lentivirus expressing FDPS shRNA #1 (SEQ ID NO: 1), as described herein.
  • Figure 8 depicts data demonstrating activation of V52+ T cells by PC3 prostate carcinoma cells with a lentivirus expressing FDPS shRNA #4 (SEQ ID NO: 4), as described herein.
  • Figure 9 depicts data demonstrating activation of V52+ T cells by HepG2 carcinoma cells with a lentivirus expressing FDPS shRNA #1 (SEQ ID NO: 1) or FDPS shRNA #4 (SEQ ID NO: 4), as described herein.
  • Figure 10 depicts data demonstrating activation of V52+ T cells by THP-1 leukemia cells with a lentivirus expressing miR30 FDPS #1 (SEQ ID NO: 5), as described herein.
  • Figure 11 depicts data demonstrating the percent of specific lysis versus an E:T ratio for a variety of experimental conditions, as described herein.
  • Figure 12 depicts data demonstrating lentiviral-delivered shRNA-based RNA interference targeting the human FDPS gene.
  • Figure 13 depicts data demonstrating lentiviral-delivered miR-based RNA interference targeting the human FDPS gene.
  • Figure 14 depicts data demonstrating activation of V52+ T cells by HepG2 carcinoma cells with an adeno-associated virus expressing FDPS shRNA #4 (SEQ ID NO: 4), as described herein.
  • Figure 15 depicts immunoblot data demonstrating lack of RAPl prenylation in the cells transduced with LV-shFDPS and treated with zoledronic acid.
  • the present disclosure relates to gene therapy constructs and delivery of the same to cells, resulting in suppression of Famesyl diphosphate synthase ("FDPS"), which is necessary to convert isopentenyl phosphate (IPP) to famesyl diphosphate (FDP), as shown, for example, in Figure 1.
  • FDPS Famesyl diphosphate synthase
  • IPP isopentenyl phosphate
  • FDP famesyl diphosphate
  • one or more viral vectors are provided with microRNAs or short homology RNAs (shRNA) that target FDPS, thereby reducing expression levels of this enzyme.
  • the viral vectors include lentiviral vectors and AAV vectors.
  • a consequence of modulating expression of FDPS is to increase the accumulation of IPP, which is a stimulator of GD T cell proliferation and differentiation.
  • the constructs provided herein are used to activate GD T cells, and are used to treat cancers and infectious diseases.
  • administering should be understood to mean providing an active agent to the subject in need of treatment in a form that can be introduced into that individual's body in a therapeutically useful form and therapeutically effective amount.
  • compositions and methods include the recited elements, but not excluding others.
  • Consisting essentially of when used to define compositions and methods shall mean excluding other elements of any essential significance to the composition or method.
  • Consisting of shall mean excluding more than trace elements of other ingredients for claimed compositions and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this disclosure. Accordingly, it is intended that the methods and compositions can include additional steps and components (comprising) or alternatively including steps and compositions of no significance (consisting essentially of) or alternatively, intending only the stated method steps or compositions (consisting of).
  • expression refers to the process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins. Expression may include splicing of the mRNA in a eukaryotic cell or other forms of post- transcriptional modification or post-translational modification.
  • farnesyl diphosphate synthase may also be referred to herein as FDPS, and may also be referred to herein as farnesyl pyrophosphate synthase or FPPS.
  • gamma delta T cell may also be referred to herein as a ⁇ T cell, or further as a GD T cell.
  • gamma delta T cell activation refers to any measurable biological phenomenon associated with a gamma delta T cell that is representative of such T cell being activated. Non-limiting examples of such a biological phenomenon include an increase of cytokine production, changes in the qualitative or quantitative composition of cell surface proteins, an increase in T cell proliferation, and/or an increase in T cell effector function, such killing or a target cell or assisting another effector cell to kill a target cell.
  • subject refers to any individual mammal subject, e.g. , bovine, canine, feline, equine, or human.
  • microRNA refers to a microRNA, and also may be referred to herein as
  • packing cell line refers to any cell line that can be used to express a lentiviral particle.
  • percent identity in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection.
  • sequence comparison algorithms e.g., BLASTP and BLASTN or other algorithms available to persons of skill
  • the “percent identity” can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.
  • sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
  • test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
  • sequence comparison algorithm calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., infra).
  • BLAST algorithm One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website.
  • the percent identity between two nucleotide sequences can be determined using the
  • GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6.
  • the percent identity between two nucleotide or amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4: 11-17 (1989)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J. Mol. Biol.
  • the nucleic acid and protein sequences of the present disclosure can further be used as a "query sequence" to perform a search against public databases to, for example, identify related sequences.
  • Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.
  • Gapped BLAST can be utilized as described in Altschul et al, (1997) Nucleic Acids Res. 25(17):3389-3402.
  • the default parameters of the respective programs e.g. , XBLAST and NBLAST
  • XBLAST and NBLAST See http://www.ncbi.nlm.nih.gov.
  • pharmaceutically acceptable refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and/or bodily fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit/risk ratio.
  • a "pharmaceutically acceptable carrier” refers to, and includes, any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • the compositions can include a pharmaceutically acceptable salt, e.g., an acid addition salt or a base addition salt (see, e.g., Berge et al. (1977) J Pharm Sci 66: 1-19).
  • sequence ID NO is synonymous with the term “Sequence ID NO”.
  • small RNA refers to non-coding RNA that are generally less than about 200 nucleotides or less in length and possess a silencing or interference function. In other embodiments, the small RNA is about 175 nucleotides or less, about 150 nucleotides or less, about 125 nucleotides or less, about 100 nucleotides or less, or about 75 nucleotides or less in length.
  • RNAs include microRNA (miRNA), small interfering RNA (siRNA), double stranded RNA (dsRNA), and short hairpin RNA (shRNA).
  • miRNA microRNA
  • siRNA small interfering RNA
  • dsRNA double stranded RNA
  • shRNA short hairpin RNA
  • therapeutically effective amount refers to a sufficient quantity of the active agents of the present disclosure, in a suitable composition, and in a suitable dosage form to treat or prevent the symptoms, progression, or onset of the complications seen in patients suffering from a given ailment, injury, disease, or condition.
  • the therapeutically effective amount will vary depending on the state of the patient's condition or its severity, and the age, weight, etc., of the subject to be treated.
  • a therapeutically effective amount can vary, depending on any of a number of factors, including, e.g., the route of administration, the condition of the subject, as well as other factors understood by those in the art.
  • therapeutic vector includes, without limitation, reference to a lenti viral vector or an AAV vector.
  • a treatment is intended to target the disease state and combat it, i.e., ameliorate or prevent the disease state.
  • the particular treatment thus will depend on the disease state to be targeted and the current or future state of medicinal therapies and therapeutic approaches.
  • a treatment may have associated toxicities.
  • treatment or “treating” generally refers to an intervention in an attempt to alter the natural course of the subject being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects include, but are not limited to, preventing occurrence or recurrence of disease, alleviating symptoms, suppressing, diminishing or inhibiting any direct or indirect pathological consequences of the disease, ameliorating or palliating the disease state, and causing remission or improved prognosis.
  • a method of activating a GDT cell includes infecting, in the presence of the GD T cell, a target cell with a viral delivery system encoding at least one genetic element.
  • the at least one encoded genetic element includes a small RNA capable of inhibiting production of an enzyme involved in the mevalonate pathway.
  • the enzyme is FDPS.
  • the target cell when the enzyme is inhibited in the target cell, the target cell activates the GD T cell.
  • the target cell is a cancer cell or a cell that has been infected with an infectious agent.
  • the at least one encoded genetic element includes a microRNA or a shRNA.
  • the at least one encoded genetic element includes a shRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with
  • the shRNA includes GTCCTGGAGTACAATGCCATTCTCGAG AATGGCATTGTACTCCAGGACTTTTT (SEQ ID NO: 1); GCAGGATTTCGTTCA GCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT (SEQ ID NO: 2); GCCA TGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT (SEQ ID NO: 3); or GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTT CTGCTTTTTTT (SEQ ID NO: 4).
  • the at least one encoded genetic element includes a microRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with
  • TTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGGCTGAGAAAGTGCT GCCTACTGCCTCGGACTTCAAGGGGCT SEQ ID NO: 6
  • TGCTGTTGACAGTG AGCGACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGAGGCTG AGAAAGTTGCCTACTGCCTCGGA
  • SEQ ID NO: 8 CCTGGAGGCTTGCTGAAG GCTGTATGCTGACTTTCTCAGCCTCCTTCTGCTTTTGGCCACTGACTGAGCAGAAG GGCTGAGAAAGTCAGGACACAAGGCCTGTTACTAGCACTCA
  • the microRNA includes AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCT CCTTCTGCGTGAAGCCACAGATGGCAGAAGGAGGCTGAGAAAGTGCTGCCTACT GCCTCGGACTTCAAGGGGCT (SEQ ID NO: 5); AAGGTATATTGCTGTTGACAGT GAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGGCTG AGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT (SEQ ID NO: 6); TGCTG
  • the target cell is also contacted with an aminobisphosphonate drug.
  • the aminobisphosphonate drug is zoledronic acid.
  • a method of treating cancer in a subject includes administering to the subject a therapeutically-effective amount of a viral delivery system encoding at least one genetic element.
  • the at least one encoded genetic element includes a small RNA capable of inhibiting production of an enzyme involved in the mevalonate pathway.
  • the enzyme when the enzyme is inhibited in a cancer cell in the presence of a GD T cell, the cancer cell activates the GD T cell, to thereby treat the cancer.
  • the enzyme is FDPS.
  • the at least one encoded genetic element includes a microRNA or a shRNA.
  • a method of treating an infectious disease in a subject includes administering to the subject a therapeutically-effective amount of a viral delivery system encoding at least one genetic element.
  • the at least one encoded genetic element includes a small RNA capable of inhibiting production of an enzyme involved in the mevalonate pathway.
  • the enzyme when the enzyme is inhibited in a cell that is infected with an infectious agent and is in the presence of a GD T cell, the infected cell activates the GD T cell, to thereby treat the infected cell, and the infectious disease.
  • the enzyme is FDPS.
  • the at least one encoded genetic element includes a microRNA or a shRNA.
  • the at least one encoded genetic element includes a shRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with SEQ ID NO: 1 ; SEQ ID NO: 2; SEQ ID NO: 3; or SEQ ID NO: 4.
  • the shRNA includes SEQ ID NO: 1 ; SEQ ID NO: 2; SEQ ID NO: 3; or SEQ ID NO: 4.
  • the at least one encoded genetic element includes a microRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 9; or SEQ ID NO: 10.
  • the microRNA includes SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 9; or SEQ ID NO: 10.
  • a viral vector comprising at least one encoded genetic element.
  • the at least one encoded genetic element includes a small RNA capable of inhibiting production of an enzyme involved in the mevalonate pathway.
  • the enzyme involved in the mevalonate pathway is farnesyl diphosphate synthase (FDPS).
  • the at least one encoded genetic element includes a microRNA or a shRNA.
  • the at least one encoded genetic element includes a shRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3; or SEQ ID NO: 4.
  • the shRNA includes SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3; or SEQ ID NO: 4.
  • the at least one encoded genetic element includes a microRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 9; or SEQ ID NO: 10.
  • the microRNA includes SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 9; or SEQ ID NO: 10.
  • the viral vector includes any vector that can effectively transduce the small RNA.
  • the viral vector is a lentiviral vector.
  • the viral vector is an adeno-associated virus (AAV) vector.
  • the viral vector includes a second encoded genetic element.
  • the second genetic element includes at least one cytokine or chemokine.
  • the at least one cytokine is selected from the group consisting of: IL-18, TNF- a, interferon- ⁇ , IL-1, IL-2, IL-15, IL-17, and IL-12.
  • the at least one chemokine is a CC chemokine, CXC chemokine, c CX3 chemokine or a XC chemokine.
  • the at least one chemokine is the CC chemokine, RANTES.
  • a lentiviral vector system for expressing a lentiviral particle includes a lentiviral vector, at least one envelope plasmid for expressing an envelope protein optimized for infecting a cell; and at least one helper plasmid for expressing gag, pol, and rev genes.
  • a lentiviral particle is produced by the packaging cell.
  • the lentiviral particle is capable of infecting a targeting cell, and inhibiting an enzyme involved in the mevalonate pathway within the target cell.
  • the enzyme involved in the mevalonate pathway is FDPS.
  • the lentiviral vector system includes a first helper plasmid for expressing the gag and pol genes, and a second helper plasmid for expressing the rev gene.
  • the envelope protein is preferably optimized for infecting a target cell.
  • the target cell is a cancer cell. In other embodiments, the target cell is a cell that is infected with an infectious disease. Cancer
  • a cell, tissue, or target may be a cancer cell, a cancerous tissue, harbor cancerous tissue, or be a subject or patient diagnosed or at risk of developing a disease or condition.
  • a cell may be an epithelial, an endothelial, a mesothelial, a glial, a stromal, or a mucosal cell.
  • the cancer cell population can include, but is not limited to a brain, a neuronal, a blood, an endometrial, a meninges, an esophageal, a lung, a cardiovascular, a liver, a lymphoid, a breast, a bone, a connective tissue, a fat, a retinal, a thyroid, a glandular, an adrenal, a pancreatic, a stomach, an intestinal, a kidney, a bladder, a colon, a prostate, a uterine, an ovarian, a cervical, a testicular, a splenic, a skin, a smooth muscle, a cardiac muscle, or a striated muscle cell.
  • cancer includes, but is not limited to astrocytoma, acute myeloid leukemia, anaplastic large cell lymphoma, acute lymphoblastic leukemia, angiosarcoma, B- cell lymphoma, Burkitt's lymphoma, breast carcinoma, bladder carcinoma, carcinoma of the head and neck, cervical carcinoma, chronic lymphoblastic leukemia, chronic myeloid leukemia, colorectal carcinoma, endometrial carcinoma, esophageal squamous cell carcinoma, Ewing's sarcoma, fibrosarcoma, glioma, glioblastoma, gastrinoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Kaposi's sarcoma, Hodgkin lymphoma, laryngeal squamous cell carcinoma, larynx carcinoma, leukemia, leiomyosarcoma, lipoma, liposarcoma, melanom
  • compositions and methods provided herein are also used to treat NSCLC (non- small cell lung cancer), pediatric malignancies, cervical and other tumors caused or promoted by human papilloma virus (HPV), melanoma, Barrett's esophagus (pre-malignant syndrome), adrenal and skin cancers and auto immune, neoplastic cutaneous diseases.
  • NSCLC non- small cell lung cancer
  • HPV human papilloma virus
  • melanoma melanoma
  • Barrett's esophagus pre-malignant syndrome
  • adrenal and skin cancers and auto immune, neoplastic cutaneous diseases.
  • compositions and methods disclosed herein can be used to treat infectious diseases.
  • infectious disease includes any disease that is caused by an infectious agent.
  • infectious agent includes any exogenous pathogen including, without limitation, bacteria, fungi, viruses, mycoplasma, and parasites.
  • Infectious agents that may be treated with compositions provided for in this disclosure include any art-recognized infectious organisms that cause pathogenesis in an animal, including such organisms as bacteria that are gram- negative or gram-positive cocci or bacilli, DNA and RNA viruses, including, but not limited to, DNA viruses such as papilloma viruses, parvoviruses, adenoviruses, herpesviruses and vaccinia viruses, and RNA viruses, such as arenaviruses, coronaviruses, rhinoviruses, respiratory syncytial viruses, influenza viruses, picomaviruses, paramyxoviruses, reoviruses, retroviruses, and rhabdoviruses.
  • DNA viruses such as papilloma viruses, parvoviruses, adenoviruses, herpesviruses and vaccinia viruses
  • RNA viruses such as arenaviruses, coronaviruses, rhinoviruses, respiratory sy
  • Compositions and methods provided for herein may be utilized to treat parasitic infections including, but not limited to, infections caused by somatic tapeworms, blood flukes, tissue roundworms, ameba, and Plasmodium, Trypanosoma, Leishmania, and Toxoplasma species.
  • compositions and methods for activating GD T cells in an individual as well as methods for treating tumors and infectious diseases.
  • the compositions and methods provided herein can be used in methods to treat all known cancers because activated GD T cells comprise a natural mechanism for immune surveillance of tumors (See for e.g.: Pauza et al. 2014 Frontiers in Immunol. 5:687).
  • the compositions and methods provided herein can be used to treat infectious diseases, including but not limited to flavivirus, influenza virus, human retrovirus, mycobacteria, plasmodia and a variety of other viral, fungal and bacterial infections. (See for e.g. : Pauza and Cairo, 2015 Cell Immunol. 296(1).
  • a vector system is administered to an individual to transfect or transduce a target cell population with the disclosed constructs for decreasing expression of FDPS and, in other embodiments, increasing expression of chemokines or cytokines.
  • Administration and transfection/transduction can occur in vivo or ex vivo, with the transfected cells later administered back into the subject in the latter scenario.
  • the disclosed methods can also increase the capacity of NK cells to recognize and destroy tumor cells and/or infected cells.
  • Crosstalk between GD T cells and NK cells is an important aspect of regulating the immune and inflammatory responses.
  • GD T cells are known to trigger dendritic cell maturation, recruit B cells and macrophages, and participate in a variety of cytolytic activities, such as secretion of interferon- ⁇ and TNF-a.
  • compositions and methods provided herein comprise a form of gene therapy for activating GD T cells at the site of tumor or infectious disease pathology.
  • compositions and methods provided herein activate GD T cells and support their proliferation, differentiation, and functional capacities by promoting the production of specific cytokines needed for cytolytic activity capable of killing cancer cells or treating infectious diseases.
  • the gene therapy sequences are carried by therapeutic vectors, including but not limited to viral vectors such as lentiviruses or adeno- associated viruses, although other viral vectors can also be suitable.
  • Gene therapy constructs may also be delivered in the form of DNA or RNA, including but not limited to plasmid forms.
  • the disclosed gene therapy constructs may also be delivered in the form of protein-nucleic acid complexes or lipid nucleic acid complexes and mixtures of these formulations.
  • a protein-nucleic acid complex can comprise nucleic acids of interest in a complex with cationic peptides such as lysine and arginine.
  • Lipid-nucleic acids complexes can comprise lipid emulsions, micelles, liposomes, and/or mixtures of neutral and cationic lipids such as DOTMA, DOSPA, DOTAP, and DMRIE.
  • therapeutic vectors may comprise a single construct or at least two, at least three, at least four, or at least five different constructs. When more than one construct is present in a vector the constructs may be identical, or they may be different. For instance, the constructs may vary in terms of their promoters, the presence or absence of an integrating elements, and/or their sequences. In some embodiments, a therapeutic vector will comprise at least one construct that encodes a small RNA capable of knocking down the expression of FDPS.
  • the therapeutic vector will also encode a specific cytokine(s) and/or chemokine(s), including but not limited to TNF-a, interferon- ⁇ , IL-1, IL-2, IL-15, IL-17, IL- 18 or IL-12.
  • a single construct may encode both small RNAs capable of knocking down the expression of FDPS and specific cytokines or chemokines, including but not limited to TNF-a, interferon- ⁇ , IL-1, IL-2, IL-15, IL-17, IL-18 or IL-12.
  • viral vectors may introduce nucleic acid constructs that become integrated into the host chromosome.
  • transient delivery vectors may be used to prevent chromosomal integration and limit the lifespan of gene therapy constructs.
  • the disclosed constructs and vectors comprise short homology region RNA ("shRNA”), micro RNA (“miRNA”), or siRNA capable of reducing or knocking down expression of FDPS and/or geranyl pyrophosphate synthase (“GPPS”) and/or famesyl transferase (“FT”) genes.
  • shRNA short homology region RNA
  • miRNA micro RNA
  • siRNA capable of reducing or knocking down expression of FDPS and/or geranyl pyrophosphate synthase (“GPPS”) and/or famesyl transferase (“FT”) genes.
  • GPPS geranyl pyrophosphate synthase
  • FT famesyl transferase
  • IPP isopentenyl pyrophosphate
  • Elevation and accumulation of IPP is a known mechanism for increasing GD T cells activation.
  • down regulation of these pyrophosphate synthase genes removes an important negative regulator of inflammasome function that in turn results in increased expression
  • the disclosed constructs are regulated by specific promoters that are capable of producing interleukin-2 and/or interleukin-15 to sustain GD T cell proliferation.
  • the disclosed constructs may be regulated by specific promoters that are capable of producing interleukin-1 beta and/or interleukin-18 and/or interferon-gamma required for GD T cell differentiation and acquisition of all effector cell function.
  • Desirable effector cell functions include the capacity for direct cytotoxic cell killing of tumors and/or infected cells, secretion of beneficial cytokines and/or chemokines, increased expression of NK receptors required to recognize cancerous or infected cells, and increased expression of Fc receptors needed to bind targeting antibodies in order to co-localize GD T cells with cancerous or infected cell targets.
  • the disclosed methods activate GD T cells, resulting in the indirect effect of increasing the capacity for NK cells to attack and destroy cancerous cells, tumors, or infected cells.
  • the activation of NK cells requires GD T cells that are stimulated to proliferate and differentiate, and to express 4-1BBL costimulatory ligand needed to engage the 4-1BB costimulatory receptor on NK cells.
  • This form of crosstalk is known as an important mechanism for activating NK cells and is achieved here through the action of the disclosed methods and compositions.
  • crosstalk between GD T cells and NK cells is an important mechanism for eliminating inflammatory dendritic cells that accumulate in diseased tissues.
  • GD T cells nor NK cells are capable of destroying dendritic cells, but once the aforementioned crosstalk interactions have occurred, NK cells are altered to become cytotoxic against inflammatory dendritic cells. This immuno-regulatory mechanism depends on strong activation and proliferation of GD T cells.
  • the disclosed methods for activation of GD T cells further comprise a step of suppressing pathologic inflammatory responses that may include cellular proliferation leading to atherosclerosis, chronic immune activation that stimulates tumor growth, autoimmune diseases including psoriasis and other presentations in the epidermis, inflammatory diseases of the central nervous system, and arthritis and other diseases of unregulated immune responses.
  • pathologic inflammatory responses may include cellular proliferation leading to atherosclerosis, chronic immune activation that stimulates tumor growth, autoimmune diseases including psoriasis and other presentations in the epidermis, inflammatory diseases of the central nervous system, and arthritis and other diseases of unregulated immune responses.
  • therapeutic vectors are administered concurrently with aminobisphosphonate (ABP) drugs to achieve synergistic activation of gamma delta T cells.
  • ABP aminobisphosphonate
  • the synergism can allow alternate, modified or reduced doses of ABP and may decrease adverse reactions to ABP including acute inflammatory responses and chronic diseases.
  • FDPS Inhibition of FDPS results in IPP accumulation, resulting in activation of V52+ GD T cells and expression of IL-18, which is also important in activating GD T cells. Inhibition of farnesyl transferase results in decreased prenylation of proteins.
  • the disclosed constructs can be transfected or transduced into specific target cells, like tumor cells or infected cells, where they can express RNA sequences (i.e., siRNA, shRNA or microRNA) that will inhibit translation of FDPS as well as encode and express cytotoxic cytokines or chemokines.
  • constructs for decreasing expression of FDPS and/or FT, increasing expression of cytokines, and increasing expression of chemokines including RANTES may encode for interferon- gamma, IL-1, IL-2, IL-15, IL-17, IL-18 or IL-12.
  • cytokines and chemokines will result in localized cytotoxic destruction of tumor cells or cells infected with pathogenic organisms. Accordingly, expression of such constructs by a tumor cell or an infected cell will result in the unwanted cells assisting in its own destruction.
  • GD T cells can kill a broad range of tumors of epithelial origin as well as many leukemias and lymphomas, and are further able to produce high levels of the anti-tumor cytokine, IFNy, recruitment of GD T cells to the site of a tumor can be a particularly effective means of inducing anti -tumor immunity.
  • FDPS Decreased expression of FDPS can be achieved via shRNA, microRNA, siRNA, or other means known in the art.
  • shRNAs according to SEQ ID NOS: 1, 2, 3, or 4, or variants thereof can be used in the disclosed constructs and methods, although this example is not limiting.
  • the coding regions for RNAs to decrease expression of FDPS and FT and the coding regions of cytokine and chemokines may be in the same construct or on different constructs.
  • constructs are based upon chromosomal integration of a transduced expression plasmid (or at least a portion thereof) into the genome of the host cell, short-duration plasmid transfection, or non-integrating viral vectors also with limited half-life.
  • the sites of gene integration are generally random, and the number and ratio of genes integrating at any particular site are often unpredictable; likewise, non-integrating plasmids or viral vectors also generate nuclear DNA but these species usually lack sequences required for DNA replication and continuous maintenance.
  • constructs that rely on chromosomal integration result in permanent maintenance of the recombinant gene that may exceed the therapeutic interval.
  • transient expression constructs An alternative to stable expression constructs for gene expression are transient expression constructs.
  • the expression of the latter gene expression construct is based on non- integrated plasmids, and hence the expression is typically lost as the cell undergoes division or the plasmid vectors are destroyed by endogenous nucleases.
  • the disclosed constructs are preferably episomal constructs that are transiently expressed.
  • Episomal constructs are degraded or diluted over time such that they do not make permanent changes to a subject's genome, nor are they incorporated into the chromosome of a target cell.
  • the process of episomal replication typically incorporates both host cell replication machinery and viral trans-acting factors.
  • the disclosed vectors support active gene and/or small RNA delivery over a period of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, or about 12 weeks. In some embodiments, the disclosed vectors support active gene and/or small RNA delivery over a period of about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or longer. Any combination of these time periods can also be used in the methods of the invention, e.g., 1 month and 1 week, or 3 months and 2 weeks.
  • the constructs comprise integrating elements that depend on a retroviral integrase gene, such that the construct becomes integrated into the subject's chromosome.
  • Retrotransposition and transposition are additional examples of mechanisms whereby mobile genetic elements become integrated or inserted into the chromosome. Plasmids may become integrated into the chromosome by recombination, and gene editing technologies including CRISPR and TALEN utilize guide RNA sequences and alter chromosomal loci by gene conversion mechanisms.
  • Constructs may comprise specific promoters for expressing cytokines involved in the maintenance of GD T cells (i.e. IL-2, IL-7, IL-17, and IL-15).
  • promoters that may be incorporated into the disclosed constructs include but are not limited to TATA-box promoters, CpG-box promoters, CCAAT-box promoters, TTGACA-box promoters, BRE-box promoters, INR-box promoters, AT-based promoters, CG-based promoters, ATCG-compact promoters, ATCG-balanced promoters, ATCG-middle promoters, ATCG-less promoters, AT-less promoters, CG-less promoters, AT-spike promoters, and CG-spike promoters. See Gagniuc and lonescu-Tirgoviste, Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters, BMC GENOMICS 13:512 (2012).
  • the construct can be delivered via known transfection and/or transduction vectors, including but not limited to lentiviral vectors, adeno-associated virus, poxvirus, herpesvirus vectors, protein and/or lipid complexes, liposomes, micelles, and the like.
  • Viral vectors can be preferentially targeted to cell types that are useful for the disclosed methods (i.e., tumor cells or myeloid cells). Viral vectors can be used to transduce genes into target cells owing to specific virus envelope-host cell receptor interactions and viral mechanisms for gene expression. As a result, viral vectors have been used as vehicles for the transfer of genes into many different cell types including whole embryos, fertilized eggs, isolated tissue samples, tissue targets in situ, and cultured cell lines. The ability to introduce and express foreign genes in a cell is useful for the study of gene expression, and the elucidation of cell lineages as well as providing the potential for therapeutic interventions such as gene therapy, somatic cell reprogramming of induced pluripotent stem cells, and various types of immunotherapy.
  • Viral components from viruses like Papovaviridae e.g. bovine papillomavirus or BPV
  • Herpesviridae e.g. Epstein Barr Virus or EBV
  • Hepadnaviridae e.g. Hepatitis B Virus or HBV
  • pox vectors including vaccinia may be used in the disclosed vectors.
  • Lentiviral vectors are a preferred type of vector for the disclosed compositions and methods, although the disclosure is not specifically limited to lentiviral vectors.
  • Lentivirus is a genus of viruses that can deliver a significant amount of viral nucleic acid into a host cell. Lentiviruses are characterized as having a unique ability to infect/transduce non-dividing cells, and following transduction, lentiviruses integrate their nucleic acid into the host cell's chromosomes.
  • Infectious lentiviruses have three main genes coding for the virulence proteins gag, pol, and env, and two regulatory genes including tat and rev. Depending on the specific serotype and virus, there may be additional accessory genes that code for proteins involved in regulation, synthesis, and/or processing viral nucleic acids and other replicative functions.
  • LTR long terminal repeat
  • lentiviruses contain long terminal repeat (LTR) regions, which may be approximately 600 nt long. LTRs may be segmented into U3, R, and U5 regions. LTRs can mediate integration of retroviral DNA into the host chromosome via the action of integrase. Alternatively, without functioning integrase, the LTRs may be used to circularize the viral nucleic acid.
  • LTR long terminal repeat
  • Reverse transcriptase is the virally encoded, RNA-dependent DNA polymerase.
  • the enzyme uses a viral RNA genome as a template for the synthesis of a complementary DNA copy.
  • Reverse transcriptase also has RNaseH activity for destruction of the RNA-template.
  • Integrase binds both the viral cDNA generated by reverse transcriptase and the host DNA. Integrase processes the LTR before inserting the viral genome into the host DNA.
  • Tat acts as a trans-activator during transcription to enhance initiation and elongation.
  • the rev responsive element acts post-transcriptionally, regulating mRNA splicing and transport to the cytoplasm.
  • Viral vectors in general, comprise glycoproteins and the various glycoproteins may provide specific affinities.
  • VSVG peptides can increase transfection into myeloid cells.
  • viral vectors can also have targeting moieties, such as antibodies, attached to their shell peptides. Targeting antibodies can be specific for antigens that are overexpressed on a tumor, for instance, like HER-2, PSA, CEA, M2-PK, and CA19- 9.
  • viral vector specificities are also known in the art and can be used to target particular populations of cells.
  • poxvirus vectors target to macrophages and dendritic cells.
  • Lesitiviral Vector System is also known in the art and can be used to target particular populations of cells.
  • a lentiviral virion is expressed by a vector system encoding the necessary viral proteins to produce a virion (viral particle).
  • a vector system encoding the necessary viral proteins to produce a virion (viral particle).
  • the pol proteins are expressed by multiple vectors.
  • this gag nucleic acid sequence is on a separate vector than at least some of the pol nucleic acid sequence.
  • the gag nucleic acid is on a separate vector from all the pol nucleic acid sequences that encode pol proteins.
  • vectors which are used to create the particles to further minimize the chance of obtaining wild type revertants. These include, but are not limited to deletions of the U3 region of the LTR, tat deletions and matrix (MA) deletions.
  • gag, poi and env vector(s) do not contain nucleotides from the lentiviral genome that package lentiviral RNA, referred to as the lentiviral packaging sequence.
  • the vector(s) forming the particle preferably do not contain a nucleic acid sequence from the lentiviral genome that expresses an envelope protein.
  • a separate vector that contains a nucleic acid sequence encoding an envelope protein operably linked to a promoter is used.
  • This env vector also does not contain a lentiviral packaging sequence.
  • the env nucleic acid sequence encodes a lentiviral envelope protein.
  • the envelope protein is not from the lentivirus, but from a different virus.
  • the resultant particle is referred to as a pseudotyped particle.
  • an env gene that encodes an envelope protein that targets an endocytic compartment such as that of the influenza virus, VSV-G, alpha viruses (Semliki forest virus, Sindbis virus), arenaviruses (lymphocytic choriomeningitis virus), flaviviruses (tick-borne encephalitis virus, Dengue virus, hepatitis C virus, GB virus), rhabdoviruses (vesicular stomatitis virus, rabies virus), paramyxoviruses (mumps or measles) and orthomyxoviruses (influenza virus).
  • envelopes that can preferably be used include those from Moloney Leukemia Virus such as MLV-E, MLV- A and GALV. These latter envelopes are particularly preferred where the host cell is a primary cell .
  • Other envelope proteins can be selected depending upon the desired host cell. For example, targeting specific receptors such as a dopamine receptor can be used for brain deliver '. Another target can be vascular endothelium. These cells can be targeted using a filovirus envelope. For example, the GP of Ebola, which by post- transcriptional modification become the GP, and GP ? . glycoproteins.
  • a pseudotyped envelope for example, FIV or SHIV [U.S. Patent No. 5,654,195]).
  • a SHIV pseudotyped vector can readily be used in animal models such as monkeys.
  • a lentiviral vector system typically includes at least one helper plasmid comprising at least one of a gag, pol, or rev gene.
  • Each of the gag, pol and rev genes may be provided on individual plasmids, or one or more genes may be provided together on the same plasmid.
  • the gag, pol, and rev genes are provided on the same plasmid (e.g., Figure 2).
  • the gag and pol genes are provided on a first plasmid and the rev gene is provided on a second plasmid (e.g., Figure 3). Accordingly, both 3-vector and 4-vector systems can be used to produce a lentivirus as described in the Examples section and elsewhere herein.
  • the therapeutic vector, the envelope plasmid and at least one helper plasmid are transfected into a packaging cell line.
  • a non-limiting example of a packaging cell line is the 293T/17 HEK cell line.
  • a lentiviral vector system for expressing a lentiviral particle includes a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infecting a cell; and at least one helper plasmid for expressing gag, pol, and rev genes, wherein when the lentiviral vector, the envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell line, a lentiviral particle is produced by the packaging cell line, wherein the lentiviral particle is capable of inhibiting production of chemokine receptor CCR5 or targeting an HIV RNA sequence.
  • the lentiviral vector which is also referred to herein as a therapeutic vector, can include the following elements: hybrid 5' long terminal repeat (RSV/5' LTR) (SEQ ID NOS: 11-12), Psi sequence (RNA packaging site) (SEQ ID NO: 13), RRE (Rev-response element) (SEQ ID NO: 14), cPPT (polypurine tract) (SEQ ID NO: 15), HI promoter (SEQ ID NO: 16), FDPS shRNA (SEQ ID NOS: 1, 2, 3, 4), Woodchuck Post-Transcriptional Regulatory Element (WPRE) (SEQ ID NO: 17), and 3' Delta LTR (SEQ ID NO: 18).
  • sequence variation by way of substitution, deletion, addition, or mutation can be used to modify the sequences references herein.
  • helper plasmid has been designed to include the following elements: CAG promoter (SEQ ID NO: 19); HIV component gag (SEQ ID NO: 20); HIV component pol (SEQ ID NO: 21); HIV Int (SEQ ID NO: 22); HIV RRE (SEQ ID NO: 23); and HIV Rev (SEQ ID NO: 24).
  • the helper plasmid may be modified to include a first helper plasmid for expressing the gag and pol genes, and a second and separate plasmid for expressing the rev gene.
  • sequence variation by way of substitution, deletion, addition, or mutation can be used to modify the sequences references herein.
  • an envelope plasmid has been designed to include the following elements being from left to right: RNA polymerase II promoter (CMV) (SEQ ID NO: 25) and vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 26).
  • CMV RNA polymerase II promoter
  • VSV-G vesicular stomatitis virus G glycoprotein
  • sequence variation by way of substitution, deletion, addition, or mutation can be used to modify the sequences references herein.
  • the plasmids used for lentiviral packaging can be modified with similar elements and the intron sequences could potentially be removed without loss of vector function.
  • the following elements can replace similar elements in the plasmids that comprise the packaging system: Elongation Factor-1 (EF-1), phosphoglycerate kinase (PGK), and ubiquitin C (UbC) promoters can replace the CMV or CAG promoter.
  • EF-1 Elongation Factor-1
  • PGK phosphoglycerate kinase
  • UbC ubiquitin C
  • SV40 poly A and bGH poly A can replace the rabbit beta globin poly A.
  • the HIV sequences in the helper plasmid can be constructed from different HIV strains or clades.
  • the VSV-G glycoprotein can be substituted with membrane glycoproteins from feline endogenous virus (RD114), gibbon ape leukemia virus (GALV), Rabies (FUG), lymphocytic choriomeningitis virus (LCMV), influenza A fowl plague virus (FPV), Ross River alphavirus (RRV), murine leukemia virus 10A1 (MLV), or Ebola virus (EboV).
  • RD114 feline endogenous virus
  • GALV gibbon ape leukemia virus
  • FUG Rabies
  • LCMV lymphocytic choriomeningitis virus
  • influenza A fowl plague virus FV
  • RRV Ross River alphavirus
  • MMV murine leukemia virus 10A1
  • Ebola virus Ebola virus
  • lentiviral packaging systems can be acquired commercially (e.g., Lenti-vpak packaging kit from OriGene Technologies, Inc., Rockville, MD), and can also be designed as described herein. Moreover, it is within the skill of a person skilled in the art to substitute or modify aspects of a lentiviral packaging system to improve any number of relevant factors, including the production efficiency of a lentiviral particle. Doses and Dosage Forms
  • the disclosed vectors allow for short, medium, or long-term expression of genes or sequences of interest and episomal maintenance of the disclosed vectors. Accordingly, dosing regimens may vary based upon the condition being treated and the method of administration.
  • transduction vectors may be administered to a subject in need in varying doses. Specifically, a subject may be administered about > 10 6 infectious doses (where 1 dose is needed on average to transduce 1 target cell). More specifically, a subject may be administered about > 10 7 , about > 10 s , about > 10 9 , or about > 10 10 infectious doses, or any number of doses in-between these values. Upper limits of transduction vector dosing will be determined for each disease indication and will depend on toxi city/safety profiles for each individual product or product lot.
  • a vector of the present disclosure may be administered periodically, such as once or twice a day, or any other suitable time period.
  • vectors may be administered to a subject in need once a week, once every other week, once every three weeks, once a month, every other month, every three months, every six months, every nine months, once a year, every eighteen months, every two years, every thirty months, or every three years.
  • the disclosed vectors are administered as a pharmaceutical composition.
  • the pharmaceutical composition comprising the disclosed vectors can be formulated in a wide variety of dosage forms, including but not limited to nasal, pulmonary, oral, topical, or parenteral dosage forms for clinical application.
  • Each of the dosage forms can comprise various solubilizing agents, disintegrating agents, surfactants, fillers, thickeners, binders, diluents such as wetting agents or other pharmaceutically acceptable excipients.
  • the pharmaceutical composition comprising a vector can also be formulated for injection, insufflation, infusion, or intradermal exposure.
  • an injectable formulation may comprise the disclosed vectors in an aqueous or nonaqueous solution at a suitable pH and tonicity.
  • the disclosed vectors may be administered to a subject via direct injection into a tumor site or at a site of infection.
  • the vectors can be administered systemically.
  • the vectors can be administered via guided cannulation to tissues immediately surrounding the sites of tumor or infection.
  • the disclosed vector compositions can be administered using any pharmaceutically acceptable method, such as intranasal, buccal, sublingual, oral, rectal, ocular, parenteral (intravenously, intradermally, intramuscularly, subcutaneously, intraperitoneally), pulmonary, intravaginal, locally administered, topically administered, topically administered after scarification, mucosally administered, via an aerosol, in semi-solid media such as agarose or gelatin, or via a buccal or nasal spray formulation.
  • any pharmaceutically acceptable method such as intranasal, buccal, sublingual, oral, rectal, ocular, parenteral (intravenously, intradermally, intramuscularly, subcutaneously, intraperitoneally), pulmonary, intravaginal, locally administered, topically administered, topically administered after scarification, mucosally administered, via an aerosol, in semi-solid media such as agarose or gelatin, or via a buccal or nasal spray formulation.
  • compositions can be formulated into any pharmaceutically acceptable dosage form, such as a solid dosage form, tablet, pill, lozenge, capsule, liquid dispersion, gel, aerosol, pulmonary aerosol, nasal aerosol, ointment, cream, semi-solid dosage form, a solution, an emulsion, and a suspension.
  • the composition may be a controlled release formulation, sustained release formulation, immediate release formulation, or any combination thereof.
  • the composition may be a transdermal delivery system.
  • the pharmaceutical composition comprising a vector can be formulated in a solid dosage form for oral administration, and the solid dosage form can be powders, granules, capsules, tablets or pills.
  • the solid dosage form can include one or more excipients such as calcium carbonate, starch, sucrose, lactose, microcrystalline cellulose or gelatin.
  • the solid dosage form can include, in addition to the excipients, a lubricant such as talc or magnesium stearate.
  • the oral dosage form can be immediate release, or a modified release form. Modified release dosage forms include controlled or extended release, enteric release, and the like. The excipients used in the modified release dosage forms are commonly known to a person of ordinary skill in the art.
  • the pharmaceutical composition comprising a vector can be formulated as a sublingual or buccal dosage form.
  • dosage forms comprise sublingual tablets or solution compositions that are administered under the tongue and buccal tablets that are placed between the cheek and gum.
  • the pharmaceutical composition comprising a vector can be formulated as a nasal dosage form.
  • Such dosage forms of the present invention comprise solution, suspension, and gel compositions for nasal delivery.
  • the pharmaceutical composition comprising a vector can be formulated in a liquid dosage form for oral administration, such as suspensions, emulsions or syrups.
  • the liquid dosage form can include, in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as humectants, sweeteners, aromatics or preservatives.
  • the composition comprising vectors can be formulated to be suitable for administration to a pediatric patient.
  • the pharmaceutical composition can be formulated in a dosage form for parenteral administration, such as sterile aqueous solutions, suspensions, emulsions, non-aqueous solutions or suppositories.
  • the solutions or suspensions can include propyleneglycol, poly ethylenegly col, vegetable oils such as olive oil or injectable esters such as ethyl oleate.
  • the dosage of the pharmaceutical composition can vary depending on the patient's weight, age, gender, administration time and mode, excretion rate, and the severity of disease.
  • the treatment of cancer is accomplished by guided direct injection of the disclosed vector constructs into tumors, using needle, or intravascular cannulation.
  • the disclosed vectors are administered into the cerebrospinal fluid, blood or lymphatic circulation by venous or arterial cannulation or injection, intradermal delivery, intramuscular delivery or injection into a draining organ near the site of disease.
  • Lentiviral particles were produced in 293T/17 HEK cells (purchased from American Type Culture Collection, Manassas, VA) following transfection with the therapeutic vector, the envelope plasmid, and the helper plasmid.
  • PEI Poly(ethylenimine)
  • the plasmids and DNA were initially added separately in culture medium without serum in a ratio of 3: 1 (mass ratio of PEI to DNA).
  • lentiviral particles were purified by high-speed centrifugation and/or filtration followed by ani on-exchange chromatography.
  • concentration of lentiviral particles can be expressed in terms of transducing units/ml (TU/ml).
  • the determination of TU was accomplished by measuring HIV p24 levels in culture fluids (p24 protein is incorporated into lentiviral particles), measuring the number of viral DNA copies per cell by quantitative PCR, or by infecting cells and using light (if the vectors encode luciferase or fluorescent protein markers).
  • a 3-vector system i.e., a 2-vector lentiviral packaging system
  • a 3-vector system was designed for the production of lentiviral particles.
  • a schematic of the 3-vector system is shown in Figure 2.
  • the top-most vector is a helper plasmid, which, in this case, includes Rev.
  • the vector appearing in the middle of Figure 2 is the envelope plasmid.
  • the bottom-most vector is the therapeutic vector, as described herein.
  • the Helper plus Rev plasmid includes a CAG enhancer (SEQ ID NO: 27); a CAG promoter (SEQ ID NO: 19); a chicken beta actin intron (SEQ ID NO: 28); a HIV gag (SEQ ID NO: 20); a HIV Pol (SEQ ID NO: 21); a HIV Int (SEQ ID NO: 22); a HIV RRE (SEQ ID NO: 23); a HIV Rev (SEQ ID NO: 24); and a rabbit beta globin poly A (SEQ ID NO: 29).
  • the Envelope plasmid includes a CMV promoter (SEQ ID NO: 25); a beta globin intron (SEQ ID NO: 30); a VSV-G (SEQ ID NO: 28); and a rabbit beta globin poly A (SEQ ID NO: 31).
  • helper plasmid was constructed by initial PCR amplification of a DNA fragment from the pNL4-3 HIV plasmid (NIH Aids Reagent Program) containing Gag, Pol, and Integrase genes. Primers were designed to amplify the fragment with EcoRI and Notl restriction sites which could be used to insert at the same sites in the pCDNA3 plasmid (Invitrogen).
  • the forward primer was (5 ' -TAAGC AGAATTC ATGAATTTGCC AGGAAGAT-3 ') (SEQ ID NO: 32) and reverse primer was (5'- CCATACAATGAATGGACACTAGGCGGCCGCACGAAT-3') (SEQ ID NO: 33).
  • the CMV promoter of pCDNA3.1 was replaced with the CAG enhancer/promoter plus a chicken beta actin intron sequence.
  • a DNA fragment containing the CAG enhancer/promoter/intron sequence with Mlul and EcoRI flanking restriction sites was synthesized by MWG Operon. The DNA fragment was then inserted into the plasmid at the Mlul and EcoRI restriction sites.
  • the DNA sequence was as follows:
  • VSV-G vesicular stomatitis Indiana virus glycoprotein
  • a 4-vector system (i.e., a 3-vector lentiviral packaging system) has also been designed and produced using the methods and materials described herein.
  • a schematic of the 4-vector system is shown in Figure 3. Briefly, and with reference to Figure 3, the top-most vector is a helper plasmid, which, in this case, does not include Rev.
  • the vector second from the top is a separate Rev plasmid.
  • the vector second from the bottom is the envelope plasmid.
  • the bottom-most vector is the previously described therapeutic vector.
  • the Helper plasmid includes a CAG enhancer (SEQ ID NO: 1
  • SEQ ID NO: 27 a CAG promoter (SEQ ID NO: 19); a chicken beta actin intron (SEQ ID NO: 28); a HIV gag (SEQ ID NO: 20); a HIV Pol (SEQ ID NO: 21); a HIV Int (SEQ ID NO: 22); a HIV RRE (SEQ ID NO: 23); and a rabbit beta globin poly A (SEQ ID NO: 29).
  • the Rev plasmid includes a RSV promoter (SEQ ID NO: 38); a HIV Rev (SEQ ID NO: 39); and a rabbit beta globin poly A (SEQ ID NO: 29).
  • the Envelope plasmid includes a CMV promoter (SEQ ID NO: 25); a beta globin intron (SEQ ID NO: 30); a VSV-G (SEQ ID NO: 28); and a rabbit beta globin poly A (SEQ ID NO: 29).
  • the Helper plasmid without Rev was constructed by inserting a DNA fragment containing the RRE and rabbit beta globin poly A sequence. This sequence was synthesized by MWG Operon with flanking Xbal and Xmal restriction sites. The RRE/rabbit poly A beta globin sequence was then inserted into the Helper plasmid at the Xbal and Xmal restriction sites.
  • the DNA sequence is as follows:
  • the RSV promoter and HIV Rev sequence was synthesized as a single DNA fragment by MWG Operon with flanking Mfel and Xbal restriction sites. The DNA fragment was then inserted into the pCDNA3.1 plasmid (Invitrogen) at the Mfel and Xbal restriction sites in which the CMV promoter is replaced with the RSV promoter.
  • the DNA sequence was as follows:
  • the plasmids for the 2-vector and 3-vector packaging systems could be modified with similar elements and the intron sequences could potentially be removed without loss of vector function.
  • the following elements could replace similar elements in the 2-vector and 3-vector packaging system:
  • Elongation Factor-1 (EF-1) (SEQ ID NO: 41), phosphoglycerate kinase
  • PGK SEQ ID NO: 42
  • UbC ubiquitin C
  • SEQ ID NO: 43 can replace the CMV (SEQ ID NO: 25) or CAG promoter (SEQ ID NO: 19).
  • HIV Gag, Pol, and Integrase sequences The HIV sequences in the Helper plasmid can be constructed from different HIV strains or clades. For example, HIV Gag (SEQ ID NO: 20); HIV Pol (SEQ ID NO: 21); and HIV Int (SEQ ID NO: 22) from the Bal strain can be interchanged with the gag, pol, and int sequences contained in the helper/helper plus Rev plasmids as outlined herein. These sequences can also be further varied by addition, substitution, deletion or mutation.
  • VSV-G glycoprotein can be substituted with membrane glycoproteins from feline endogenous virus (RD114) (SEQ ID NO: 46), gibbon ape leukemia virus (GALV) (SEQ ID NO: 47), Rabies (FUG) (SEQ ID NO: 48), lymphocytic choriomeningitis virus (LCMV) (SEQ ID NO: 49), influenza A fowl plague virus (FPV) (SEQ ID NO: 50), Ross River alphavirus (RRV) (SEQ ID NO: 51), murine leukemia virus 10A1 (MLV) (SEQ ID NO: 52), or Ebola virus (EboV) (SEQ ID NO: 53). Sequences for these envelopes are identified in the sequence portion herein. Further, these sequences can also be further varied by addition, substitution, deletion or mutation.
  • the 3-vector versus 4-vector systems can be compared and contrasted, in part, as follows.
  • the 3-vector lentiviral vector system contains: 1. Helper plasmid: HIV Gag, Pol, Integrase, and Rev/Tat; 2. Envelope plasmid: VSV-G/FUG envelope; and 3. Therapeutic vector: RSV 5'LTR, Psi Packaging Signal, Gag fragment, RRE, Env fragment, cPPT, WPRE, and 3' ⁇ LTR.
  • the 4-vector lentiviral vector system contains: 1. Helper plasmid: HIV Gag, Pol, and Integrase; 2. Rev plasmid: Rev; 3. Envelope plasmid: VSV- G/FUG envelope; and 4.
  • Therapeutic vector RSV 5'LTR, Psi Packaging Signal, Gag fragment, RRE, Env fragment, cPPT, WPRE, and 3 'delta LTR. Sequences corresponding with the above elements are identified in the sequence listings portion herein.
  • the purpose of this Example was to develop an FDPS lentivirus vector.
  • RNA interference sequences were chosen from candidates selected by siRNA or shRNA design programs such as from GPP Web Portal hosted by the Broad Institute (http://portals.broadinstitute.org/gpp/public/) or the BLOCK-iT RNAi Designer from Thermo Scientific (https://rnaidesigner.thermofisher.com/rnaiexpress/).
  • RNA polymerase III promoter such as HI (SEQ ID NO: 16), U6 (SEQ ID NO: 54), or 7SK (SEQ ID NO: 55) to regulate shRNA expression.
  • HI SEQ ID NO: 16
  • U6 SEQ ID NO: 54
  • 7SK SEQ ID NO: 55
  • oligonucleotide sequences containing BamHI and EcoRI restriction sites were synthesized by Eurofins MWG Operon. Overlapping sense and antisense oligonucleotide sequences were mixed and annealed during cooling from 70 degrees Celsius to room temperature.
  • the lentiviral vector was digested with the restriction enzymes BamHI and EcoRI for one hour at 37 degrees Celsius.
  • the digested lentiviral vector was purified by agarose gel electrophoresis and extracted from the gel using a DNA gel extraction kit from Thermo Scientific. The DNA concentrations were determined and vector to oligo (3: 1 ratio) were mixed, allowed to anneal, and ligated.
  • the ligation reaction was performed with T4 DNA ligase for 30 minutes at room temperature. 2.5 microliters of the ligation mix were added to 25 microliters of STBL3 competent bacterial cells. Transformation was achieved after heat-shock at 42 degrees Celsius. Bacterial cells were spread on agar plates containing ampicillin and drug-resistant colonies (indicating the presence of ampicillin-resistance plasmids) were recovered and expanded in LB broth. To check for insertion of the oligo sequences, plasmid DNA was extracted from harvested bacteria cultures with the Thermo Scientific DNA mini prep kit. Insertion of shRNA sequences in the lentiviral vector was verified by DNA sequencing using a specific primer for the promoter used to regulate shRNA expression. Using the following target sequences, exemplary shRNA sequences were determined to knock-down FDPS:
  • GTCCTGGAGTACAATGCCATT (FDPS target sequence #1; SEQ ID NO: 56);
  • GCAGGATTTCGTTCAGCACTT (FDPS target sequence #2; SEQ ID NO: 57);
  • GCCATGTACATGGCAGGAATT (FDPS target sequence #3; SEQ ID NO: 58);
  • GCAGAAGGAGGCTGAGAAAGT (FDPS target sequence #4; SEQ ID NO: 59); and GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT
  • shRNA sequences were then assembled into a synthetic microRNA (miR) under control of the EF-1 alpha promoter. Briefly, a miR hairpin sequences, such as miR30, miR21, or miR185 as detailed below, was obtained from mirbase.org. The 19-22mer shRNA target sequence was used to construct the synthetic miR sequence. The miR sequence was arranged as an anti-sense-target-sequence-hairpin loop sequence (specific for each microRNA)-sense target sequence.
  • This Example illustrates that knock-down of FDPS in THP1 monocytic leukemia cells by lentiviral (LV)-expressing FDPS shRNA #4 stimulates TNF-a expression in gamma delta T cells, as shown in Figure 5.
  • lentiviral (LV)-expressing FDPS shRNA #4 stimulates TNF-a expression in gamma delta T cells, as shown in Figure 5.
  • THP1 cells (lxlO 5 cells) were transduced with LV-control or LV-FDPS shRNA #4 for 3 days. Two days after transduction, cells were treated with or without ⁇ zoledronic acid. After 24 hours, the transduced THP-1 cells were co-cultured with 5x10 5 PBMC cells and IL- 2 in a round bottom 96 well plate for 4 hours. The PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vy9V ⁇ 2 T cells. After staining for Vy9V52 and TNF-a using fluorophore-conjugated anti TCR-V52 and anti-TNF-a antibody, cells were analyzed via flow cytometry.
  • THP1 cells (lxlO 5 cells) were transduced with LV-control or LV-FDPS shRNA #4 for
  • the activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of flow cytograms. Without zoledronic acid, LV-control stimulated 0.9% of TNF-a expressing Vy9V52 T cells and LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 15.9%. With zoledronic acid treatment, LV-control stimulated 4.7% of TNF-a expressing Vy9V52 T cells and LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 76.2%.
  • PC3 cells were transduced with LV-control or LV-FDPS shRNA #1 (SEQ ID NO: 1) for 3 days. Two days after transduction, cells were treated with or without luM zoledronic acid. After 24 hours, the transduced PC3 cells were co-cultured with 5xl0 5 PBMC cells and IL-2 in a round bottom 96 well plate for 4 hours. The PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vy9V52 T cells. After staining for Vy9V52 and TNF-a using fluorophore-conjugated anti TCR-V52 and anti-TNF-a antibody, cells were analyzed via flow cytometry.
  • PC3 cells were transduced with LV-control or LV-FDPS shRNA #4 (SEQ ID NO: 4) for 3 days. Two days after transduction, cells were treated with or without luM zoledronic acid. After 24 hours, the transduced PC3 cells were co-cultured with 5xl0 5 PBMC cells and IL-2 in a round bottom 96 well plate for 4 hours. The PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vy9V52 T cells. After staining for Vy9V52 and TNF-a using fluorophore-conjugated anti TCR-V52 and anti-TNF-a antibody, cells were analyzed via flow cytometry.
  • Vy9V52 T cells Live cells were gated, and V52+ and TNF-a+ cells were selected on a dot blot. The activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of flow cytograms. Without zoledronic acid, LV-control stimulated 0.5% of TNF-a expressing Vy9V52 T cells and LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 1.9%. With zoledronic acid treatment, LV-control stimulated 2.1% of TNF-a expressing Vy9V52 T cells and LV-FDPS shRNA #4 stimulated 28.7%.
  • HepG2 cells were transduced with LV-control, LV-FDPS shRNA #1 (SEQ ID NO: 1), or LV-FDPS shRNA #4 (SEQ ID NO: 4) for 3 days. Two days after transduction, cells were treated with or without luM zoledronic acid. After 24 hours, the transduced HepG2 cells were co-cultured with 5xl0 5 PBMC cells and IL-2 in a round bottom 96 well plate for 4 hours. The PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vy9V52 T cells.
  • Vy9V52 and TNF-a After staining for Vy9V52 and TNF-a using fluorophore-conjugated anti TCR-V52 and anti-TNF-a antibody, cells were analyzed via flow cytometry. Live cells were gated, and V52+ and TNF-a+ cells were selected on a dot blot. The activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of flow cytograms.
  • LV-control stimulated 0.4% of TNF-a expressing Vy9V52 T cells and LV-FDPS shRNA #1 (SEQ ID NO: 1) and #4 (SEQ ID NO: 4) stimulated 0.7% and 0.9%, respectively.
  • LV-control stimulated 6.9% of TNF-a expressing Vy9V52 T cells and LV-FDPS shRNA #1 and #4 stimulated 7.6% and 21.1%, respectively.
  • Example 8 Knock-down of FDPS for 3 days in THP1 leukemia by microRNA-30
  • THP1 cells (lxlO 5 cells) were transduced with LV-control or LV-miR30 FDPS #1 (SEQ ID NO: 5) for 3 days. Two days after transduction, cells were treated with or without luM zoledronic acid. After 24 hours, the transduced THP-1 cells were co-cultured with 5xl0 5 PBMC cells and IL-2 in a round bottom 96 well plate for 4 hours. The PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vy9V52 T cells.
  • Vy9V52 and TNF-a After staining for Vy9V52 and TNF-a using fluorophore-conjugated anti TCR-V52 and anti- TNF-a antibody, cells were analyzed via flow cytometry. Live cells were gated, and V52+ and TNF-a+ cells were selected on a dot blot. The activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of flow cytograms.
  • LV-control stimulated 0.2% of TNF-a expressing Vy9V52 T cells and LV-miR30 FDPS stimulated 8.1%.
  • LV-control stimulated 5.3% of TNF-a expressing Vy9V52 T cells and LV-miR30 FDPS #1 (SEQ ID NO: 5) stimulated 67.3%.
  • Example 9 E:T ratios resulting from mixture of THP-1 cells, cultured human GD T cells, and/or Zometa (Zol)
  • This Example demonstrates results from mixing treated THP-1 monocytoid tumor cells with cultured human GD T cells, as shown in Figure 11.
  • the monocytoid cell line THP-1 was treated with control lenti virus vector (LV), LV suppressing farnesyl diphosphate synthase gene expression (LV-FDPS), zoledronic acid (Zol) or combinations.
  • Human GD T cells were cultured from an anonymous donor and added to treated THP-1 cells in 4: 1. 2: 1 or 1 : 1 ratios (GD T:THP-1) for 4 hours. Cell killing was measured by a fluorescence assay.
  • THP-1 cells were treated with a combination of LV-FDPS and Zol, cytotoxic T cell killing by GD T cells was increased greatly compared to either treatment alone.
  • LV-FDPS treatment alone was compared to Zol treatment alone, the LV-FDPS lead to greater killing but was >3-fold below tumor cell killing after combination treatment.
  • the combined LV-FDPS plus Zol treatment caused nearly 70% tumor cell killing with 4: 1 ratio; this was more than 3-fold higher than the second best treatment (LV-FDPS alone).
  • Example 10 - Lentiviral-delivered shRNA-based RNA interference targeting the human Farnesyl diphosphate synthase (FDPS) gene
  • HepG2 human hepatocellular carcinoma cells were infected with lentiviral vectors containing the HI promoter and either a non-targeting or four different FDPS shRNA sequences, as shown in Figure 12. After 48 hours, RNA was extracted from the cells and converted to cDNA. Expression of FDPS cDNA was determined by quantitative PCR using SYBR Green and FDPS primers. FDPS expression was normalized to actin levels for each sample.
  • HepG2 human hepatocellular carcinoma cells were then infected with lentiviral vectors to determine the efficacy of FDPS knock-down. After 48 hours, RNA was extracted from the cells using the RNeasy RNA isolation kit (Qiagen) and converted to cDNA with the Superscript VILO cDNA synthesis kit (Thermo Scientific).
  • FDPS cDNA was determined by quantitative PCR on an Applied Biosystems StepOne qPCR machine using a SYBR Green PCR mix (Thermo Scientific) and FDPS primers (Forward primer: 5'- AGGAATTGATGGCGAGAAGG-3 ' (SEQ ID NO: 61) and Reverse primer: 5'- CCCAAAGAGGTC AAGGTAATCA-3 ' (SEQ ID NO: 62)).
  • FDPS expression was normalized to actin levels for each sample using the actin primers (Forward primer: 5'- AGCGCGGCTAC AGCTTC A-3 ' (SEQ ID NO: 63) and Reverse primer: 5'- GGCGACGTAGCACAGCTTCT-3') (SEQ ID NO: 64).
  • the relative FDPS RNA expression of the shCon sample is set at 100%. There was an 85% (FDPS sequence #1), 89% (FDPS sequence #2), 46% (FDPS sequence #3), and 98% (FDPS sequence #4) decrease in FDPS expression.
  • Example 11 Lentiviral-delivered miR-based RNA interference targeting the human farnesyl diphosphate synthase (FDPS) gene
  • HepG2 human hepatocellular carcinoma cells were infected with lentiviral vectors containing either the HI promoter (SEQ ID NO: 16) the FDPS shRNA #4 (SEQ ID NO: 4) sequence or the EF-la promoter (SEQ ID NO: 41) and miR30-based FDPS sequences. After 48 hours, cells were lysed and an immunoblot was performed using an anti-FDPS (Thermo Scientific) and an anti-actin (Sigma) antibody as a protein loading control.
  • HepG2 human hepatocellular carcinoma cells were infected with lentiviral vectors containing either the HI promoter (SEQ ID NO: 16) and the FDPS shRNA sequence
  • FDPS shRNA sequence #4 SEQ ID NO: 4
  • EF-lalpha promoter SEQ ID NO: 41
  • LV control with the EF-1 promoter was set at 100%. There was a 68% (LV-shFDPS #4), 43% (LV-miR FDPS #1), and 38% (LV-miR FDPS #3) reduction of FDPS protein expression.
  • LV-shFDPS #4 43%
  • LV-miR FDPS #1 43%
  • LV-miR FDPS #3 38%
  • This Example illustrates that knock-down of FDPS for 3 days in HepG2 liver carcinoma cells by adeno-associated virus (AAV)-expressing FDPS shRNA #4 (SEQ ID NO: 4) stimulates TNF-a expression in GD T cells ( Figure 14, Panel B).
  • AAV adeno-associated virus
  • HepG2 cells were transduced with control or AAV-FDPS shRNA #4 (SEQ ID NO: 8) for 3 days. Two days after transduction, cells were treated with or without luM zoledronic acid. After 24 hours, the transduced HepG2 cells were co-cultured with 5X10 5 PBMC cells and IL-2 in a round bottom 96 well plate for 4 hours. The PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vy9V52 T cells. After staining for Vy9V52 and TNF-a using fluorophore-conjugated anti TCR-V52 and anti-TNF-a antibody, cells were analyzed via flow cytometry. Live cells were gated, and V52+ and TNF-a+ cells were selected on a dot blot. The activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of flow cytograms ( Figure 14, Panel B).
  • FDPS shRNA sequence #4 (SEQ ID NO: 4) was inserted into the pAAV plasmid (Cell Biolabs).
  • FDPS oligonucleotide sequences containing BamHI and EcoRI restriction sites were synthesized by Eurofins MWG Operon. Overlapping sense and antisense oligonucleotide sequences were mixed and annealed during cooling from 70 degrees Celsius to room temperature.
  • the pAAV was digested with the restriction enzymes BamHI and EcoRI for one hour at 37 degrees Celsius.
  • the digested pAAV plasmid was purified by agarose gel electrophoresis and extracted from the gel using a DNA gel extraction kit from Thermo Scientific.
  • the DNA concentrations were determined and vector to oligo (3: 1 ratio) were mixed, allowed to anneal, and ligated.
  • the ligation reaction was performed with T4 DNA ligase for 30 minutes at room temperature. 2.5 microliters of the ligation mix were added to 25 microliters of STBL3 competent bacterial cells. Transformation was achieved after heat-shock at 42 degrees Celsius. Bacterial cells were spread on agar plates containing ampicillin and drug-resistant colonies (indicating the presence of ampicillin- resistance plasmids) were recovered and expanded in LB broth. To check for insertion of the oligo sequences, plasmid DNA was extracted from harvested bacteria cultures with the Thermo Scientific DNA mini prep kit.
  • the AAV-FDPS shRNA plasmid was combined with the plasmids pAAV-RC2 (Cell Biolabs) and pHelper (Cell Biolabs).
  • the pAAV-RC2 plasmid contains the Rep and AAV2 capsid genes and pHelper contains the adenovirus E2A, E4, and VA genes.
  • these plasmids were transfected in the ratio 1 : 1 : 1 (pAAV-shFDPS: pAAV-RC2: pHelper) into 293T cells. For transfection of cells in 150 mm dishes (BD Falcon), 10 micrograms of each plasmid were added together in 1 ml of DMEM.
  • This Example illustrates that lentiviral-delivered shRNA targeting the human farnesyl diphosphate synthase (FDPS) gene and zoledronic acid synergize to inhibit farnesyl diphosphate production.
  • FDPS human farnesyl diphosphate synthase
  • FDPS is an enzyme in the isoprenoid synthesis pathway that catalyzes the production of farnesyl diphosphate. Inhibiting the enzyme activity of FDPS by zoledronic acid or reduced protein expression by shRNA-mediated knock-down will result in reduced farnesyl diphosphate levels.
  • Famesylation of cellular proteins requires farnesyl diphosphate.
  • RAPIA is a protein that is modified by famesylation, which can be used as a biomarker for levels of cellular farnesyl diphosphate.
  • An antibody that specifically recognizes reduced RAPIA famesylation was used to measure FDPS activity after transduction with LV-shFDPS alone or in combination with zoledronic acid.
  • HepG2 human hepatocellular carcinoma cells were infected with lentiviral vectors containing FDPS shRNA sequence #4.
  • zoledronic acid (Sigma) was added for the last 24 hours. After 48 hours, cells were lysed with NP-40 lysis buffer and protein was quantified with the Bio-Rad protein assay reagent. Protein samples at 50 micrograms were electrophoresed on 4-12% Bis-Tris gels (Thermo Scientific and transferred to PVDF membranes (EMD Millipore). An immunoblot was performed using an anti-FDPS (Thermo Scientific), anti-RAPlA (Santa Cruz), and an anti-actin (Sigma) antibody as a protein loading control.
  • Antibodies were bound with HRP-conjugated secondary antibodies and detected with a Licor c-DiGit Blot scanner using the Immobilon Western ECL reagent (EMD Millipore).
  • An increase in the RAPIA band intensity correlates with reduced famesylation.
  • RAPIA defamesylation occurred only in the cells transduced with LV-shFDPS and treated with zoledronic acid.
  • LV-FDPS is a genetic medicine delivered by a lentivirus vector via local administration to the site of late stage, non-resectable hepatocellular carcinoma
  • HCC hepatocellular carcinoma
  • LV-FDPS is a genetic therapy designed to reduce expression in tumor cells of the enzyme farnesyl diphosphate synthase. Experimental studies show that tumor cells modified by LV-FDPS induce the anti-tumor activity of human gamma delta T cells, including the capacity for tumor killing by cellular cytotoxicity.
  • the dose is number of transducing units of LV-FDPS as described in the product release criteria, delivered via intrahepatic cannulation in a single bolus with volume not to exceed 25 mL.
  • the minimum dose is lxlO 9 transducing units and escalation is 10-fold to a next dose of lxlO 10 transducing units, the next dose is lxlO 11 transducing units, and a maximum dose of lxlO 12 transducing units based on reported experience with recombinant adenovirus therapy for HCC (Sangro et al, A phase I clinic trial of thymidine kinase-based gene therapy in advanced hepatocellular carcinoma, 2010, Cancer Gene Ther. 17:837-43). Subjects are enrolled, treated and evaluated for 3 months. All safety evaluations are completed for each group prior to enrolling and treating subjects at the next higher dose level. Enrollment and dose escalation continue until a maximum tolerable dose is achieved or the study is terminated.
  • Cannulation is via the left subclavian artery until tip of catheter is at the proper hepatic artery junction. Cannulation is guided by ultrasonography as described (Lin et al, Clinical effects of intra-arterial infusion chemotherapy with cisplatin, mitomycin C, leucovor and 5-Fluorouracil for unresectable advanced hepatocellular carcinoma, 2004, J. Chin. Med. Assoc. 67:602-10).
  • ORR Objective response rate
  • Treating physician determines that the lesion is amenable to locoregional targeted delivery.
  • Target lesion must represent measurable disease with a unidimensional longest diameter of > 1.0 cm by computed tomography; the maximum longest diameter is ⁇ 5.0 cm.
  • Hematopoietic function WBC > 2,500/mm 3 ; ANC > 1000/mm 3 ; Hemoglobin > 8 g/dL; Platelet count > 50,000/mm 3 ; Coagulation INR ⁇ 1.3.
  • Thyroid function Total T3 or free T3, total T4 or free T4 and THC ⁇ CTCAE Grade 2 abnormality.
  • LV-FDPS is a genetic medicine delivered by a lentivirus vector via local administration to the site of late stage, non-resectable hepatocellular carcinoma - adjunct administration of aminobisphosphonate
  • HCC hepatocellular carcinoma
  • LV-FDPS is a genetic therapy designed to reduce expression in tumor cells of the enzyme farnesyl diphosphate synthase.
  • Experimental studies show that tumor cells modified by LV-FDPS induce the anti-tumor activity of human gamma delta T cells, including the capacity for tumor killing by cellular cytotoxicity.
  • Prior experimental studies also showed the potential for positive interactions of LV-FDPS and specific aminobisphosphonate drugs that may be prescribed in primary or metastatic diseases.
  • subjects will receive dose escalating amounts of LV-FDPS with continuous standard of care dosing with Aredia® (pamidronate), Zometa® (zoledronic acid) or Actonel® (risedronate) according to physician advice and subject preference.
  • the LV-FDPS dose is a number of transducing units of LV-FDPS as described in the product release criteria, delivered via intrahepatic cannulation in a single bolus with volume not to exceed 25 mL.
  • the minimum dose is lxlO 9 transducing units and escalation is 10-fold to a next dose of lxlO 10 transducing units, the next dose is lxlO 11 transducing units, and a maximum dose of lxl 0 12 transducing units based on reported experience with recombinant adenovirus therapy for HCC (Sangro, et al, A phase I clinic trial of thymidine kinase-based gene therapy in advanced hepatocellular carcinoma, 2010, Cancer Gene Ther.
  • Subjects are enrolled, treated and evaluated for 3 months. All safety evaluations are completed for each group prior to enrolling and treating subjects at the next higher dose level. Enrollment and dose escalation continue until a maximum tolerable dose is achieved or the study is terminated.
  • Cannulation is via the left subclavian artery until tip of catheter is at the proper hepatic artery junction. Cannulation is guided by ultrasonography as described (Lin et al., Clinical effects of intra-arterial infusion chemotherapy with cisplatin, mitomycin C, leucovor and 5-Fluorouracil for unresectable advanced hepatocellular carcinoma, 2004, J. Chin. Med. Assoc. 67:602-10).
  • ORR Objective response rate
  • Treating physician determines that the lesion is amenable to locoregional targeted delivery.
  • Target lesion must represent measurable disease with a unidimensional longest
  • Hematopoietic function WBC > 2,500/mm 3 ; ANC > 1000/mm 3 ; Hemoglobin > 8 g/dL; Platelet count > 50,000/mm 3 ; Coagulation INR ⁇ 1.3.
  • Thyroid function Total T3 or free T3, total T4 or free T4 and THC ⁇ CTCAE Grade 2 abnormality.
  • Example 15 Treatment of a Subject with Chronic Viral Disease(s) of the Liver
  • LV-FDPS is a genetic medicine delivered by a lentivirus vector via local administration to liver for the treatment of hepatitis B virus, hepatitis C virus, HIV or other viral infection of the liver
  • a Phase I clinical trial will test safety and feasibility of delivering LV-FDPS to virally infected liver using ultrasound guided cannulation. It is rationally predicted that this study will result in the successful treatment of infections of the liver.
  • the study is an open label, 4x3 dose escalation (4 dose ranges, up to 3 subjects per dose) to identify the maximum tolerable dose of LV-FDPS in patients 18 years or older with chronic viral disease of the liver that is resistant to chemotherapy.
  • LV-FDPS is a genetic therapy designed to reduce expression in tumor cells of the enzyme farnesyl diphosphate synthase. Experimental studies show that tumor cells modified by LV-FDPS induce human gamma delta T cells, including a capacity for cellular cytotoxicity against virally -infected cells.
  • Subjects with confirmed viral infection of the liver including hepatitis B virus, hepatitis C virus, HIV or other viruses are enrolled into the next available LV-FDPS dosing category. A maximum of 3 subjects are recruited for each dosage group.
  • the LV-FDPS dose is a number of transducing units of LV-FDPS as described in the product release criteria, delivered via intrahepatic cannulation in a single bolus with volume not to exceed 25 mL.
  • the minimum dose is lxl 0 9 transducing units and escalation is 10-fold to a next dose of lxlO 10 transducing units, the next dose is lxlO 11 transducing units, and a maximum dose of lxlO 12 transducing units based on reported experience with recombinant adenovirus therapy for HCC (Sangro, et al., A phase I clinic trial of thymidine kinase-based gene therapy in advanced hepatocellular carcinoma, 2010, Cancer Gene Ther. 17: 837-43). Subjects are enrolled, treated and evaluated for 3 months. All safety evaluations are completed for each group prior to enrolling and treating subjects at the next higher dose level. Enrollment and dose escalation continue until a maximum tolerable dose is achieved or the study is terminated.
  • Cannulation is via the left subclavian artery until tip of catheter is at the proper hepatic artery junction. Cannulation is guided by ultrasonography as described (Lin et al, Clinical effects of intra-arterial infusion chemotherapy with cisplatin, mitomycin C, leucovor and 5-Fluorouracil for unresectable advanced hepatocellular carcinoma, 2004, J. Chin. Med. Assoc. 67:602-10).
  • ORR Objective response rate measured as a Sustained Viral Response (SVR) within the organ or systemically during 3 months after treatment.
  • Treating physician determines that the lesion is amenable to locoregional targeted delivery.
  • Hematopoietic function WBC > 2,500/mm 3 ; ANC > 1000/mm 3 ; Hemoglobin > 8 g/dL; Platelet count > 50,000/mm 3 ; Coagulation INR ⁇ 1.3.
  • Thyroid function Total T3 or free T3, total T4 or free T4 and THC ⁇ CTCAE Grade 2 abnormality.
  • LV-FDPS is a genetic medicine delivered by a lentivirus vector via local administration to liver for the treatment of hepatitis B virus, hepatitis C virus, HIV or other viral infection of the liver - concomitant adjunct aminobisphosphonate therapy
  • a Phase I clinical trial will test safety and feasibility of delivering LV-FDPS to virally infected liver using ultrasound guided cannulation. It is rationally predicted that this study will result in the successful treatment of infections of the liver.
  • the study is an open label, 4x3 dose escalation (4 dose ranges, up to 3 subjects per dose) to identify the maximum tolerable dose of LV-FDPS in patients 18 years or older with chronic viral disease of the liver that is resistant to chemotherapy.
  • LV-FDPS is a genetic therapy designed to reduce expression in tumor cells of the enzyme farnesyl diphosphate synthase.
  • Experimental studies show that tumor cells modified by LV-FDPS induce human gamma delta T cells, including a capacity for cellular cytotoxicity against virally -infected cells.
  • Prior experimental studies also showed the potential for positive interactions of LV-FDPS and specific aminobisphosphonate drugs that may be prescribed during infectious disease.
  • subjects will receive dose escalating amounts of LV-FDPS with continuous standard of care dosing with Aredia® (pamidronate), Zometa® (zoledronic acid) or Actonel® (risedronate) according to physician advice and subject preference.
  • Subjects with confirmed viral infection of the liver including hepatitis B virus, hepatitis C virus, HIV or other viruses will initiate aminobisphosphonate therapy for 45 days before re-screening to meet enrollment criteria for LV-FDPS treatment of infectious disease.
  • Eligible subjects are enrolled into the next available LV-FDPS dosing category.
  • a maximum of 3 subjects are recruited for each dosage group.
  • the LV-FDPS dose is a number of transducing units of LV-FDPS as described in the product release criteria, delivered via intrahepatic cannulation in a single bolus with volume not to exceed 25 mL.
  • the minimum dose is lxl 0 9 transducing units and escalation is 10-fold to a next dose of lxl 0 10 transducing units, the next dose is lxlO 11 transducing units, and a maximum dose of lxlO 12 transducing units based on reported experience with recombinant adenovirus therapy for HCC (Sangro, et al., A phase I clinic trial of thymidine kinase-based gene therapy in advanced hepatocellular carcinoma, 2010, Cancer Gene Ther. 17:837-43). Subjects are enrolled, treated and evaluated for 3 months. All safety evaluations are completed for each group prior to enrolling and treating subjects at the next higher dose level. Enrollment and dose escalation continue until a maximum tolerable dose is achieved or the study is terminated.
  • Cannulation is via the left subclavian artery until tip of catheter is at the proper hepatic artery junction. Cannulation is guided by ultrasonography as described (Lin et al, Clinical effects of intra-arterial infusion chemotherapy with cisplatin, mitomycin C, leucovor and 5-Fluorouracil for unresectable advanced hepatocellular carcinoma, 2004, J. Chin. Med. Assoc. 67:602-10).
  • Objective response rate measured as a Sustained Viral Response (SVR) within the organ or systemically during 3 months after treatment.
  • Hematopoietic function WBC > 2,500/mm 3 ; ANC > 1000/mm 3 ; Hemoglobin > 8 g/dL; Platelet count > 50,000/mm 3 ; Coagulation INR ⁇ 1.3.
  • Thyroid function Total T3 or free T3, total T4 or free T4 and THC ⁇ CTCAE Grade 2 abnormality.
  • miR21 FDPS C ATCTCC ATGGCTGT AC C AC CTTGTC GGGACTTTCTC sequence #1 AGCCTCCTTCTGCCTGTTGAATCTCATGGCAGAAGG
  • G G; Glycoprotein GGGTGAATTGCAAGTTCACCATAGTTTTTCCACACA envelope-cell ACCAAAAAGGAAACTGGAAAAATGTTCCTTCTAATT entry ACCATTATTGCCCGTCAAGCTCAGATTTAAATTGGC
  • RSV promoter CAATTGCGATGTACGGGCCAGATATACGCGTATCTG and HIV Rev AGGGGACTAGGGTGTGTTTAGGCGAAAAGCGGGGC

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2017/013399 2016-01-15 2017-01-13 Methods and compositons for the activation of gamma-delta t-cells Ceased WO2017123918A1 (en)

Priority Applications (27)

Application Number Priority Date Filing Date Title
CA3011529A CA3011529A1 (en) 2016-01-15 2017-01-13 Methods and compositions for the activation of gamma-delta t-cells
IL297238A IL297238B2 (en) 2016-01-15 2017-01-13 Methods and preparations for gamma-delta T-cell activation
AU2017207906A AU2017207906B2 (en) 2016-01-15 2017-01-13 Methods and compositions for the activation of gamma-delta T-cells
ES17739028T ES2965357T3 (es) 2016-01-15 2017-01-13 Métodos y composiciones para la activación de linfocitos T gamma-delta
EP17739028.3A EP3402483B1 (en) 2016-01-15 2017-01-13 Methods and compositons for the activation of gamma-delta t-cells
JP2018536892A JP7260898B2 (ja) 2016-01-15 2017-01-13 ガンマデルタt細胞の活性化のための方法および組成物
IL279520A IL279520B2 (en) 2016-01-15 2017-01-13 Methods and preparations for the activation of gamma-delta t cells
CN202211395043.5A CN116064678A (zh) 2016-01-15 2017-01-13 用于活化γ-δT细胞的方法和组合物
EP23199847.7A EP4310500A3 (en) 2016-01-15 2017-01-13 Methods and compositons for the activation of gamma-delta t-cells
CN201780017712.6A CN108883100B (zh) 2016-01-15 2017-01-13 用于活化γ-δT细胞的方法和组合物
IL310925A IL310925A (en) 2016-01-15 2017-01-13 Methods and compositons for the activation of gamma-delta t-cells
DK17739028.3T DK3402483T3 (da) 2016-01-15 2017-01-13 Fremgangsmåder og sammensætninger til aktivering af gamma-delta-T-celler
US15/652,080 US9914938B2 (en) 2016-01-15 2017-07-17 Methods and compositions for the activation of gamma-delta T-cells
US15/706,481 US9834790B1 (en) 2016-01-15 2017-09-15 Methods and compositions for the activation of gamma-delta T-cells
US15/849,062 US10036040B2 (en) 2016-01-15 2017-12-20 Methods and compositions for the activation of gamma-delta T-cells
US15/850,937 US10023880B2 (en) 2016-01-15 2017-12-21 Methods and compositions for the activation of gamma-delta T-cells
US15/904,131 US10137144B2 (en) 2016-01-15 2018-02-23 Methods and compositions for the activation of gamma-delta T-cells
US16/008,991 US10472649B2 (en) 2016-01-15 2018-06-14 Methods and compositions for the activation of gamma-delta T-cells
IL260594A IL260594B (en) 2016-01-15 2018-07-15 Methods and preparations for gamma-delta T-cell activation
US16/132,247 US10420789B2 (en) 2016-01-15 2018-09-14 Methods and compositions for the activation of gamma-delta T-cells
US16/182,443 US10428350B2 (en) 2016-01-15 2018-11-06 Methods and compositions for the activation of gamma-delta T-cells
US16/530,908 US10772905B2 (en) 2016-01-15 2019-08-02 Methods and compositions for the activation of gamma-delta T-cells
US16/563,738 US11519006B2 (en) 2016-01-15 2019-09-06 Methods and compositions for the activation of gamma-delta T-cells
US16/988,427 US11534450B2 (en) 2016-01-15 2020-08-07 Methods and compositions for the activation of gamma-delta T-cells
AU2021203836A AU2021203836B2 (en) 2016-01-15 2021-06-10 Methods and compositions for the activation of gamma-delta T-cells
US18/051,821 US12410446B2 (en) 2016-01-15 2022-11-01 Methods and compositions for the activation of gamma-delta T-cells
US18/055,525 US12403155B2 (en) 2016-01-15 2022-11-15 Methods and compositions for the activation of gamma-delta T-cells

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662279474P 2016-01-15 2016-01-15
US62/279,474 2016-01-15

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/652,080 Continuation US9914938B2 (en) 2016-01-15 2017-07-17 Methods and compositions for the activation of gamma-delta T-cells

Publications (1)

Publication Number Publication Date
WO2017123918A1 true WO2017123918A1 (en) 2017-07-20

Family

ID=59311597

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/013399 Ceased WO2017123918A1 (en) 2016-01-15 2017-01-13 Methods and compositons for the activation of gamma-delta t-cells

Country Status (10)

Country Link
US (8) US9914938B2 (https=)
EP (2) EP3402483B1 (https=)
JP (4) JP7260898B2 (https=)
CN (3) CN116064678A (https=)
AU (2) AU2017207906B2 (https=)
CA (1) CA3011529A1 (https=)
DK (1) DK3402483T3 (https=)
ES (1) ES2965357T3 (https=)
IL (4) IL297238B2 (https=)
WO (1) WO2017123918A1 (https=)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10023880B2 (en) 2016-01-15 2018-07-17 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10036038B2 (en) 2016-07-08 2018-07-31 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US10137144B2 (en) 2016-01-15 2018-11-27 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
CN109363955A (zh) * 2018-11-14 2019-02-22 广州玮弘祺生物科技有限公司 一种发用固体定型喷雾及其制备方法
WO2019051255A1 (en) * 2017-09-08 2019-03-14 Generation Bio Co. CLOSED-ENDED DNA (CEDNA) MODIFIED
EP3426777A4 (en) * 2016-03-09 2019-09-11 American Gene Technologies International Inc COMBINATION VECTORS AND METHOD FOR THE TREATMENT OF CANCER
US10548914B2 (en) 2008-10-17 2020-02-04 American Gene Technologies International Inc. Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules
US10888613B2 (en) 2016-02-08 2021-01-12 American Gene Technologies International Inc. Method of producing cells resistant to HIV infection
EP3638779A4 (en) * 2017-06-16 2021-03-10 American Gene Technologies International Inc. METHODS AND COMPOSITIONS FOR ACTIVATING TUMOR CYTOXICITY VIA HUMAN GAMMA DELTA T CELLS
US11352646B2 (en) 2018-11-05 2022-06-07 American Gene Technologies International Inc. Vector system for expressing regulatory RNA
US11583562B2 (en) 2016-07-21 2023-02-21 American Gene Technologies International Inc. Viral vectors for treating Parkinson's disease
US11820999B2 (en) 2017-04-03 2023-11-21 American Gene Technologies International Inc. Compositions and methods for treating phenylketonuria
US11976292B2 (en) 2016-06-08 2024-05-07 American Gene Technologies International Inc. Non-integrating viral delivery system and methods related thereto
US11980663B2 (en) 2015-07-08 2024-05-14 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210254103A1 (en) * 2018-07-02 2021-08-19 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis and disorders associated with the spinal cord
US12331320B2 (en) 2018-10-10 2025-06-17 The Research Foundation For The State University Of New York Genome edited cancer cell vaccines
CN109456993A (zh) * 2018-11-28 2019-03-12 上海安民生物技术有限公司 含cag启动子的白蛋白表达载体
SG11202112347RA (en) * 2019-05-23 2021-12-30 Spacecraft Seven Llc Gene therapy vectors for infantile malignant osteopetrosis
AU2024349505A1 (en) * 2023-09-27 2026-02-19 Legend Biotech Ireland Limited Methods of culturing gamma delta t cells

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5654195A (en) 1992-05-22 1997-08-05 Dana-Farber Cancer Institute Vectors expressing hybrid viruses, methods of use and novel assays
US20060246520A1 (en) * 2003-05-23 2006-11-02 Institut National De La Sante Et De La Recherche Medicale Gamma delta t cell-mediated therapy
US20080199961A1 (en) * 2006-08-25 2008-08-21 Avi Biopharma, Inc. ANTISENSE COMPOSITION AND METHOD FOR INHIBITION OF miRNA BIOGENESIS
US20090148936A1 (en) * 2000-12-19 2009-06-11 Research Development Foundation Lentiviral vector-mediated gene transfer and uses thereof
US20110008803A1 (en) * 2006-06-19 2011-01-13 Trustees Of Columbia University In The City Of New York Assays for non-apoptotic cell death and uses thereof
US20120027725A1 (en) * 2009-11-30 2012-02-02 Galvin Jeffrey A Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules to treat liver cancer
US20130090371A1 (en) * 2010-04-20 2013-04-11 President And Fellows Of Harvard College Methods and compositions for inhibition of beta2-adrenergic receptor degradation
US20150126580A1 (en) * 2011-12-20 2015-05-07 Dana-Farber Cancer Institute, Inc. Methods for diagnosing and treating oncogenic kras-associated cancer

Family Cites Families (146)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5668255A (en) 1984-06-07 1997-09-16 Seragen, Inc. Hybrid molecules having translocation region and cell-binding region
US5674703A (en) 1992-12-02 1997-10-07 Woo; Savio L. C. Episomal vector systems and related methods
SK282843B6 (sk) 1993-07-13 2002-12-03 Rhone-Poulenc Rorer S. A. Defektný rekombinantný adenovírus a farmaceutický prostriedok s jeho obsahom
WO1998011244A2 (en) 1996-09-11 1998-03-19 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Aav4 vector and uses thereof
EP1012236A1 (en) 1997-08-15 2000-06-28 Rubicon Laboratory Inc. Retrovirus and viral vectors
US6399383B1 (en) 1997-10-28 2002-06-04 Maxygen, Inc. Human papilloma virus vectors
EP1064393B1 (en) 1998-03-20 2004-12-29 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
EP2386646B1 (en) 1998-10-01 2016-12-21 University Of Southern California Gene delivery system and methods of use
US6156514A (en) 1998-12-03 2000-12-05 Sunol Molecular Corporation Methods for making recombinant cells
US6410013B1 (en) 1999-01-25 2002-06-25 Musc Foundation For Research Development Viral vectors for use in monitoring HIV drug resistance
WO2000072886A1 (en) 1999-05-26 2000-12-07 Dana-Farber Cancer Institute, Inc. Episomally replicating lentiviral vectors
AU2001257611A1 (en) 2000-04-28 2001-11-12 Avigen, Inc. Polynucleotides for use in recombinant adeno-associated virus virion production
CA2408830A1 (en) 2000-05-12 2001-11-22 The Regents Of The University Of California Treatment of human papillomavirus (hpv)-infected cells
US20060057553A1 (en) * 2000-05-30 2006-03-16 Estuardo Aguilar-Cordova Chimeric viral vectors for gene therapy
NO314588B1 (no) 2000-09-04 2003-04-14 Bionor Immuno As HIV-peptider, antigener, vaksinesammensetning, immunoassay- testsett og en fremgangsmåte for å påvise antistoffer indusert av HIV
US20030119770A1 (en) 2001-08-02 2003-06-26 Zhennan Lai Intercellular delivery of a herpes simplex virus VP22 fusion protein from cells infected with lentiviral vectors
AU2002323270A1 (en) 2001-08-18 2003-03-03 Myriad Genetics, Inc Composition and method for treating hiv infection
US7737124B2 (en) 2001-09-13 2010-06-15 California Institute Of Technology Method for expression of small antiviral RNA molecules with reduced cytotoxicity within a cell
WO2003040311A2 (en) 2001-10-25 2003-05-15 The Government Of The United States Of America As Represented By The Secretary Of Health And Human Services Efficient inhibition of hiv-1 viral entry through a novel fusion protein including of cd4
US20070203333A1 (en) 2001-11-30 2007-08-30 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
AU2003224725A1 (en) 2002-03-20 2003-10-08 Brigham And Women's Hospital, Inc. Hiv therapeutic
US20040142416A1 (en) 2002-04-30 2004-07-22 Laipis Philip J. Treatment for phenylketonuria
AU2003301556A1 (en) 2002-05-07 2004-05-13 Chiron Corporation Hiv envelope-cd4 complexes and hybrids
US7199107B2 (en) 2002-05-23 2007-04-03 Isis Pharmaceuticals, Inc. Antisense modulation of kinesin-like 1 expression
US20040161412A1 (en) 2002-08-22 2004-08-19 The Cleveland Clinic Foundation Cell-based VEGF delivery
US8034334B2 (en) 2002-09-06 2011-10-11 The United States Of America As Represented By The Secretary, Department Of Health And Human Services Immunotherapy with in vitro-selected antigen-specific lymphocytes after non-myeloablative lymphodepleting chemotherapy
AU2003290586B2 (en) 2002-11-04 2009-07-02 University Of Massachusetts Allele-specific RNA interference
AU2003283174A1 (en) 2002-12-11 2004-06-30 Cytos Biotechnology Ag Method for protein production
EP1644508A1 (en) 2003-07-11 2006-04-12 Cytos Biotechnology AG Gene expression system
US20050019927A1 (en) 2003-07-13 2005-01-27 Markus Hildinger DECREASING GENE EXPRESSION IN A MAMMALIAN SUBJECT IN VIVO VIA AAV-MEDIATED RNAi EXPRESSION CASSETTE TRANSFER
US20050138677A1 (en) 2003-09-16 2005-06-23 Pfister Herbert J. Transgenic animal model for the treatment of skin tumors
WO2005028634A2 (en) 2003-09-18 2005-03-31 Emory University Improved mva vaccines
WO2005033282A2 (en) 2003-10-01 2005-04-14 Pharmacia & Upjohn Company Llc Polyamide compositions and therapeutic methods for treatment of human papilloma virus
US20080039413A1 (en) 2003-10-21 2008-02-14 Morris David W Novel compositions and methods in cancer
WO2005081911A2 (en) 2004-02-25 2005-09-09 Dana-Farber Cancer Institute, Inc. METHODS AND COMPOSITIONS FOR THE TREATMENT AND PREVENTION OF HIV INFECTION USING TRIM5α
US20060058255A1 (en) 2004-03-01 2006-03-16 Jianzhu Chen RNAi-based therapeutics for allergic rhinitis and asthma
TW201705980A (zh) 2004-04-09 2017-02-16 艾伯維生物技術有限責任公司 用於治療TNFα相關失調症之多重可變劑量療法
US20080227736A1 (en) 2004-06-03 2008-09-18 Regents Of The University Of California, Targeting Pseudotyped Retroviral Vectors
US20080131940A1 (en) 2004-06-25 2008-06-05 Robert Chiu Target Cell-Specific Short Interfering Rna and Methods of Use Thereof
EP1789447B1 (en) 2004-08-16 2012-04-25 Immune Disease Institute, Inc. Method of delivering rna interference and uses thereof
US7358361B2 (en) * 2004-10-08 2008-04-15 The Board Of Trustees Of The University Of Illinois Biophosphonate compounds and methods for bone resorption diseases, cancer, bone pain, immune disorders, and infectious diseases
EP1647595A1 (en) 2004-10-15 2006-04-19 Academisch Medisch Centrum bij de Universiteit van Amsterdam Nucleic acids against viruses, in particular HIV
EP1809753A1 (en) 2004-11-02 2007-07-25 Istituto di Richerche di Biologia Molecolare P. Angeletti S.p.A. Adenoviral amplicon and producer cells for the production of replication-defective adenoviral vectors, methods of preparation and use thereof
US7790446B2 (en) 2005-02-11 2010-09-07 Kosagen Cell Factory Oü Vectors, cell lines and their use in obtaining extended episomal maintenance replication of hybrid plasmids and expression of gene products
MX2007010008A (es) * 2005-02-16 2008-01-18 Lentigen Corp Vectores lentivirales y su uso.
CA2609142C (en) 2005-05-27 2016-02-09 Fondazione Centro San Raffaele Del Monte Tabor Therapeutic gene vectors comprising mirna target sequences
US20070032443A1 (en) * 2005-08-02 2007-02-08 Jaeseob Kim Therapy for Alzheimer's disease
WO2007015122A1 (en) * 2005-08-02 2007-02-08 Genexel, Inc. Therapy for alzheimer’s disease
WO2007056388A2 (en) 2005-11-07 2007-05-18 The General Hospital Corporation Compositions and methods for modulating poly (adp-ribose) polymerase activity
WO2007133674A2 (en) 2006-05-12 2007-11-22 Lentigen Corporation Lentiviral vector compositions, methods and applications
US20080003225A1 (en) 2006-06-29 2008-01-03 Henri Vie Method for enhancing the antibody-dependent cellular cytotoxicity (ADCC) and uses of T cells expressing CD16 receptors
WO2008008719A2 (en) 2006-07-10 2008-01-17 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the myc gene
EP1878440A1 (en) 2006-07-13 2008-01-16 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for increasing the efficiency of therapeutic antibodies using gamma delta cell activator compounds
KR20090034395A (ko) * 2006-07-26 2009-04-07 노파르티스 아게 운데카프레닐 피로포스페이트 합성효소의 억제제
EP2097517B1 (en) * 2006-10-16 2014-06-04 Genelux Corporation Recombinant Lister strain vaccinia virus encoding an anti-VEGF single chain antibody
EP2126137B1 (en) 2007-01-23 2017-06-07 Janssen Pharmaceutica NV Method for designing a drug regime for hiv-infected patients
CN101679466A (zh) * 2007-04-12 2010-03-24 伊利诺伊大学评议会 对包括fpps、ggpps和dpps在内的多靶点效力提高的二膦酸盐化合物及方法
US20080293142A1 (en) 2007-04-19 2008-11-27 The Board Of Regents For Oklahoma State University Multiple shRNA Expression Vectors and Methods of Construction
JP2010530870A (ja) 2007-06-22 2010-09-16 エーテーツェー チューリッヒ 抗ウイルス剤
EP2008656A1 (en) 2007-06-28 2008-12-31 Bergen Teknologioverforing AS Compositions for the treatment of hyperphenylalaninemia
WO2009026328A2 (en) 2007-08-21 2009-02-26 Immune Disease Institute, Inc. Methods of delivery of agents to leukocytes and endothelial cells
NZ599825A (en) 2007-09-28 2014-10-31 Anthrogenesis Corp Tumor suppression using human placental perfusate and human placenta-derived intermediate natural killer cells
EP2090659A1 (en) 2008-02-14 2009-08-19 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Infectious particle, process for its preparation and use thereof
GB0810209D0 (en) 2008-06-04 2008-07-09 Cambridge Entpr Ltd Pluripotency associated epigenetic factor
EP2301105A4 (en) 2008-06-16 2013-06-19 Polyplus Battery Co Inc AQUEOUS LITHIUM / AIR BATTERY CELLS
US8629334B2 (en) 2008-07-16 2014-01-14 University Of Florida Research Foundation, Inc. Viral-based transient-expression vector system for trees
WO2010022195A2 (en) 2008-08-20 2010-02-25 Virxsys Corporation Non-integrating lenti/adeno-associated virus hybrid vector system
WO2010033722A2 (en) 2008-09-17 2010-03-25 Isogenis, Inc. Construction of fully-deleted adenovirus-based gene delivery vectors and uses thereof
US20100183558A1 (en) 2008-10-17 2010-07-22 Zhennan Lai Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules
WO2010051521A1 (en) 2008-10-31 2010-05-06 Lentigen Corporation Cell therapy product for the treatment of hiv infection
WO2010051502A2 (en) 2008-10-31 2010-05-06 Biogen Idec Ma Inc. Light targeting molecules and uses thereof
JP2012508591A (ja) 2008-11-14 2012-04-12 ライフ テクノロジーズ コーポレーション 細胞を操作するための組成物および方法
EP2191834A1 (en) 2008-11-26 2010-06-02 Centre National De La Recherche Scientifique (Cnrs) Compositions and methods for treating retrovirus infections
CA2756670A1 (en) 2009-03-26 2010-09-30 The Regents Of The University Of California Mesenchymal stem cells producing inhibitory rna for disease modification
US20120034197A1 (en) 2009-04-09 2012-02-09 Stemcyte Inc. Hiv-resistant stem cells and uses thereof
RU2539099C2 (ru) 2009-04-13 2015-01-10 Апцет Гмбх Унд Ко.Кг Сконструированные мезенхимальные стволовые клетки и способ их применения для лечения опухолей
WO2010127166A2 (en) 2009-04-30 2010-11-04 The Regents Of The University Of California Combination anti-hiv vectors, targeting vectors, and methods of use
ES2657737T3 (es) 2009-07-15 2018-03-06 Calimmune Inc. Vector dual para la inhibición del virus de la inmunodeficiencia humana
CN101805750B (zh) * 2009-12-29 2011-11-30 浙江大学 法呢基焦磷酸合成酶rna干扰重组慢病毒载体构建及用途
WO2011103417A2 (en) 2010-02-18 2011-08-25 Emory University Of Technology Transfer Vectors expressing hiv antigens and gm-csf and related methods for generating an immune response
WO2011119942A1 (en) 2010-03-25 2011-09-29 Vistagen Therapeutics, Inc. Induction of ips cells using transient episomal vectors
US8993532B2 (en) 2010-04-23 2015-03-31 Cold Spring Harbor Laboratory Structurally designed shRNAs
WO2011148194A1 (en) 2010-05-28 2011-12-01 Oxford Biomedica (Uk) Ltd Delivery of lentiviral vectors to the brain
JP5805089B2 (ja) 2010-08-10 2015-11-04 タカラバイオ株式会社 細胞集団の製造方法
US20130281493A1 (en) 2010-10-07 2013-10-24 The Trustees Of The University Of Columbia In The City Of New York Method for Treating Cancer Harboring a p53 Mutation
WO2012061075A2 (en) 2010-10-25 2012-05-10 The Regents Of The University Of California Hiv resistant and functional hematopoietic stem/progenitor cells and macrophages from induced pluripotent stem cells
WO2012071559A2 (en) 2010-11-23 2012-05-31 Presage Biosciences, Inc. Therapeutic methods and compositions for solid delivery
US8865881B2 (en) 2011-02-22 2014-10-21 California Institute Of Technology Delivery of proteins using adeno-associated virus (AAV) vectors
EP3318635A1 (en) * 2011-04-21 2018-05-09 University of Massachusetts Raav-based compositions and methods for treating alpha-1 anti-trypsin deficiencies
US9358250B2 (en) 2011-10-15 2016-06-07 Genentech, Inc. Methods of using SCD1 antagonists
HK1202434A1 (en) 2011-11-22 2015-10-02 The Children's Hospital Of Philadelphia Virus vectors for highly efficient transgene delivery
JP6188728B2 (ja) 2012-02-07 2017-08-30 グローバル・バイオ・セラピューティクス・インコーポレイテッドGlobal Bio Therapeutics,Inc. 核酸送達の区画化方法ならびにその組成物および使用
WO2013174404A1 (en) 2012-05-23 2013-11-28 Ganymed Pharmaceuticals Ag Combination therapy involving antibodies against claudin 18.2 for treatment of cancer
AU2013273481B2 (en) 2012-06-06 2018-04-05 Bionor Immuno As HIV vaccine
EP2875133B1 (en) 2012-07-17 2018-01-10 Université de Genève Nucleic acids for down-regulation of gene expression
WO2014052855A1 (en) 2012-09-27 2014-04-03 Population Diagnostics, Inc. Methods and compositions for screening and treating developmental disorders
CN105051192B (zh) 2012-11-13 2020-04-17 科迪艾克生物科学公司 治疗剂的递送
US9255250B2 (en) 2012-12-05 2016-02-09 Sangamo Bioscience, Inc. Isolated mouse or human cell having an exogenous transgene in an endogenous albumin gene
US9642921B2 (en) 2012-12-20 2017-05-09 Tocagen Inc. Cancer combination therapy and recombinant vectors
WO2014117050A2 (en) 2013-01-26 2014-07-31 Mirimus, Inc. Modified mirna as a scaffold for shrna
CN103184224A (zh) 2013-04-03 2013-07-03 衡阳师范学院 一种抗艾滋病病毒感染的三联miRNA及构建方法
EP3461909A1 (en) 2013-05-21 2019-04-03 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Isoforms of gata6 and nkx2-1 as markers for diagnosis and therapy of cancer and as targets for anti-cancer therapy
AU2014277092B2 (en) 2013-06-03 2019-04-04 Theravectys Lentiviral vectors containing an MHC class I, MHC class II, or beta-2 microglobulin upstream promoter sequence
EP3027755B1 (en) 2013-08-02 2019-10-09 The Regents of The University of California Engineering antiviral t cell immunity through stem cells and chimeric antigen receptors
WO2015042308A2 (en) 2013-09-18 2015-03-26 City Of Hope Rna-based hiv inhibitors
JP6506749B2 (ja) 2013-10-22 2019-04-24 シャイアー ヒューマン ジェネティック セラピーズ インコーポレイテッド フェニルケトン尿症のためのmRNA療法
CN106459995B (zh) 2013-11-07 2020-02-21 爱迪塔斯医药有限公司 使用统治型gRNA的CRISPR相关方法和组合物
EP2878674A1 (en) 2013-11-28 2015-06-03 Fundación Centro Nacional de Investigaciones Cardiovasculares Carlos III (CNIC) Stable episomes based on non-integrative lentiviral vectors
GB201322091D0 (en) 2013-12-13 2014-01-29 Cambridge Entpr Ltd Modified serpins for the treatment of bleeding disorders
PT3122769T (pt) 2014-03-28 2023-04-24 Univ Minnesota Polipéptidos, células e métodos que envolvem cd16 manipulado
CA2946312A1 (en) 2014-04-23 2015-10-29 Juno Therapeutics, Inc. Methods for isolating, culturing, and genetically engineering immune cell populations for adoptive therapy
CN114395559A (zh) 2014-04-25 2022-04-26 吉尼松公司 高胆红素血症的治疗
PL3134432T3 (pl) * 2014-04-25 2020-10-19 Bluebird Bio, Inc. Promotor mnd chimeryczne receptory antygenowe
US20160060707A1 (en) 2014-08-29 2016-03-03 Immunomedics, Inc. Identification of Cancer Genes by In-Vivo Fusion of Human Cancer Cells and Animal Cells
HRP20211601T1 (hr) 2014-09-22 2022-01-21 Tanea Medical Ab Rekombinantni proteini bez fenilalanina (phe) za liječenje fenilketonurije
EP3204420B1 (en) 2014-10-10 2020-09-02 The United States of America, as represented by The Secretary, Department of Health and Human Services Methods to eliminate cancer stem cells by targeting cd47
CN107405357B (zh) 2014-10-14 2021-12-31 德克萨斯科技大学系统 多重shRNAs及其应用
WO2016069716A1 (en) 2014-10-30 2016-05-06 The Scripps Research Institute Compositions and methods comprising tyrosyl-trna synthetases and resveratrol compounds
GB201509202D0 (en) 2015-05-28 2015-07-15 Ge Healthcare Bio Sciences Ab Semi-static cell culture
WO2016200997A1 (en) 2015-06-10 2016-12-15 America Gene Technologies International, Inc. Non-integrating viral delivery system and methods of use thereof
EP3319631A4 (en) 2015-07-08 2019-01-09 American Gene Technologies International Inc. HIV PREMUNICATION AND IMMUNOTHERAPY
WO2017025061A1 (en) 2015-08-13 2017-02-16 Peking University Induced extended pluripotent stem cells, methods of making and using
CN105112370B (zh) * 2015-08-25 2019-02-05 杭州优善生物科技有限公司 一种体外刺激外周血γδT细胞高效增殖的方法及其应用
WO2017068077A1 (en) 2015-10-20 2017-04-27 Institut National De La Sante Et De La Recherche Medicale (Inserm) Methods and products for genetic engineering
WO2017100551A1 (en) 2015-12-09 2017-06-15 Alexion Pharmaceuticals, Inc. HETEROLOGOUS UTR SEQUENCES FOR ENHANCED mRNA EXPRESSION
CN116064678A (zh) 2016-01-15 2023-05-05 美国基因技术国际有限公司 用于活化γ-δT细胞的方法和组合物
US10137144B2 (en) 2016-01-15 2018-11-27 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
WO2017139065A1 (en) 2016-02-08 2017-08-17 American Gene Technologies International Inc. Hiv vaccination and immunotherapy
WO2017156311A2 (en) 2016-03-09 2017-09-14 American Gene Technologies International Inc. Combination vectors and methods for treating cancer
WO2017165641A1 (en) 2016-03-23 2017-09-28 The Trustees Of Columbia University In The City Of New York CANCER TREATMENT BASED ON DELIVERY OF OLIGOES VIA GAP JUNCTIONS FROM HUMAN MESENCHYMAL STEM CELLS (hMSC)
US20190117799A1 (en) 2016-04-01 2019-04-25 The Brigham And Women's Hospital, Inc. Stimuli-responsive nanoparticles for biomedical applications
EP3468617A4 (en) 2016-06-08 2020-01-22 American Gene Technologies International Inc. SYSTEM FOR THE NON-INTEGRAL VIRAL ISSUE AND PROCEDURE RELATING TO IT
AU2017292582C1 (en) 2016-07-08 2021-11-11 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
EP3487507A4 (en) 2016-07-21 2020-04-08 American Gene Technologies International, Inc. VIRAL VECTORS FOR THE TREATMENT OF PARKINSON'S DISEASE
KR102738752B1 (ko) 2016-12-30 2024-12-06 더 트러스티스 오브 더 유니버시티 오브 펜실베니아 페닐케톤뇨증을 치료하기 위한 유전자 치료
JP7260170B2 (ja) 2017-01-09 2023-04-18 アメリカン ジーン テクノロジーズ インターナショナル インコーポレイテッド 事前の免疫化ステップのないhiv免疫療法
AU2018219292B2 (en) 2017-02-08 2024-09-26 Dana-Farber Cancer Institute, Inc. Tunable endogenous protein degradation with heterobifunctional compounds
PT3589730T (pt) * 2017-02-28 2024-02-28 Univ Pennsylvania Vetor de vírus adenoassociado (aav) de clado f e suas utilizações
US11820999B2 (en) 2017-04-03 2023-11-21 American Gene Technologies International Inc. Compositions and methods for treating phenylketonuria
JP2020524996A (ja) 2017-06-16 2020-08-27 アメリカン ジーン テクノロジーズ インターナショナル インコーポレイテッド ヒトガンマデルタt細胞を介する腫瘍細胞傷害性の活性化のための方法および組成物
CA3077355A1 (en) 2017-10-02 2019-04-11 American Gene Technologies International Inc. Vectors with promoter and enhancer combinations for treating phenylketonuria
DE112019000348B4 (de) 2018-01-05 2021-10-28 Nantbio, Inc. Umprogrammierte t-zellen ähnliche nk-zellen
AU2019302603A1 (en) 2018-07-13 2021-01-14 Nanjing Legend Biotech Co., Ltd. Co-receptor systems for treating infectious diseases
US11352646B2 (en) 2018-11-05 2022-06-07 American Gene Technologies International Inc. Vector system for expressing regulatory RNA
BR112021024124A2 (pt) 2019-05-31 2022-01-11 American Gene Tech Int Inc Expressão otimizada de fenilalanina hidroxilase
WO2021178571A1 (en) 2020-03-03 2021-09-10 American Gene Technologies International Inc. On demand expression of exogenous factors in lymphocytes to treat hiv

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5654195A (en) 1992-05-22 1997-08-05 Dana-Farber Cancer Institute Vectors expressing hybrid viruses, methods of use and novel assays
US20090148936A1 (en) * 2000-12-19 2009-06-11 Research Development Foundation Lentiviral vector-mediated gene transfer and uses thereof
US20060246520A1 (en) * 2003-05-23 2006-11-02 Institut National De La Sante Et De La Recherche Medicale Gamma delta t cell-mediated therapy
US20110008803A1 (en) * 2006-06-19 2011-01-13 Trustees Of Columbia University In The City Of New York Assays for non-apoptotic cell death and uses thereof
US20080199961A1 (en) * 2006-08-25 2008-08-21 Avi Biopharma, Inc. ANTISENSE COMPOSITION AND METHOD FOR INHIBITION OF miRNA BIOGENESIS
US20120027725A1 (en) * 2009-11-30 2012-02-02 Galvin Jeffrey A Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules to treat liver cancer
US20130090371A1 (en) * 2010-04-20 2013-04-11 President And Fellows Of Harvard College Methods and compositions for inhibition of beta2-adrenergic receptor degradation
US20150126580A1 (en) * 2011-12-20 2015-05-07 Dana-Farber Cancer Institute, Inc. Methods for diagnosing and treating oncogenic kras-associated cancer

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, no. 17, 1997, pages 3389 - 3402
AUSUBEL ET AL.: "Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology", 2002, WILEY, JOHN & SONS, INC.
BERGE ET AL., J PHARM SCI, vol. 66, 1977, pages 1 - 19
COLIGAN ET AL.: "Short Protocols in Protein Science", 2003, WILEY, JOHN & SONS, INC.
DIELI ET AL.: "Targeting Human gammadelta T cells with Zoledronate and Interleukin-2 for Immunotherapy of Hormone-Refractory Prostate Cancer", CANCER RESEARCH, vol. 67, 1 August 2007 (2007-08-01), pages 7450 - 7457, XP055199253 *
E. MEYERSW. MILLER, CABIOS, vol. 4, 1989, pages 11 - 17
GAGNIUCIONESCU-TIRGOVISTE: "Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters", BMC GENOMICS, vol. 13, 2012, pages 512, XP021134695, DOI: 10.1186/1471-2164-13-512
GOBER ET AL.: "Human T cell Receptor gammadelta Cells Recognize Endogenous Mevalonate Metabolites in Tumor Cells", JOURNAL OF EXPERIMENTAL MEDICINE, vol. 197, 20 January 2003 (2003-01-20), pages 163 - 8, XP055399647 *
HARLOWLANE: "Using Antibodies: A Laboratory Manual", 1998, COLD SPRING HARBOR LABORATORY PRESS
LIN ET AL.: "Clinical effects of intra-arterial infusion chemotherapy with cisplatin, mitomycin C, leucovor and 5-Fluorouracil for unresectable advanced hepatocellular carcinoma", J. CHIN. MED. ASSOC., vol. 67, 2004, pages 602 - 10
MOSER ET AL.: "gammadelta T Cells: Novel Initiators of Adaptive Immunity", IMMUNOLOGICAL REVIEWS, vol. 215, 1 February 2007 (2007-02-01), pages 89 - 102, XP055399649 *
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 444 - 453
PAUZA ET AL., FRONTIERS IN IMMUNOL., vol. 5, 2014, pages 687
PAUZACAIRO, CELL IMMUNOL., vol. 296, no. 1, 2015
PEARSONLIPMAN, PROC. NAT'L. ACAD. SCI. USA, vol. 85, 1988, pages 2444
SAMBROOK J.RUSSELL D: "Molecular Cloning: A Laboratory Manual", 2000, COLD SPRING HARBOR LABORATORY PRESS
SANGRO ET AL.: "A phase I clinic trial of thymidine kinase-based gene therapy in advanced hepatocellular carcinoma", CANCER GENE THER., vol. 17, 2010, pages 837 - 43
SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482
THOMPSON ET AL.: "Alkylamines Cause Vgamma9Vdelta2 T- cell Activation and Proliferation by Inhibiting the Mevalonate Pathway", BLOOD, vol. 107, 15 January 2006 (2006-01-15), pages 651 - 654, XP055399646 *

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10548914B2 (en) 2008-10-17 2020-02-04 American Gene Technologies International Inc. Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules
US11007209B2 (en) 2008-10-17 2021-05-18 American Gene Technologies International Inc. Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules
US11980663B2 (en) 2015-07-08 2024-05-14 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US10137144B2 (en) 2016-01-15 2018-11-27 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US12403155B2 (en) 2016-01-15 2025-09-02 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10772905B2 (en) 2016-01-15 2020-09-15 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US11519006B2 (en) 2016-01-15 2022-12-06 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10420789B2 (en) 2016-01-15 2019-09-24 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10428350B2 (en) 2016-01-15 2019-10-01 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10472649B2 (en) 2016-01-15 2019-11-12 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10036040B2 (en) 2016-01-15 2018-07-31 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US12410446B2 (en) 2016-01-15 2025-09-09 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10023880B2 (en) 2016-01-15 2018-07-17 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US12090200B2 (en) 2016-02-08 2024-09-17 American Gene Technologies International Inc. Methods of producing cells resistant to HIV infection
US10888613B2 (en) 2016-02-08 2021-01-12 American Gene Technologies International Inc. Method of producing cells resistant to HIV infection
US10975374B2 (en) 2016-03-09 2021-04-13 American Gene Technologies International Inc. Combination vectors and methods for treating cancer
US11242527B1 (en) 2016-03-09 2022-02-08 American Gene Technologies International Inc. Combination vectors and methods for treating cancer
US10767183B2 (en) 2016-03-09 2020-09-08 American Gene Technologies International Inc. Combination vectors and methods for treating cancer
EP3426777A4 (en) * 2016-03-09 2019-09-11 American Gene Technologies International Inc COMBINATION VECTORS AND METHOD FOR THE TREATMENT OF CANCER
US12359203B2 (en) 2016-03-09 2025-07-15 American Gene Technologies International Inc. Combination vectors and methods for treating cancer
EP4036231A1 (en) * 2016-03-09 2022-08-03 American Gene Technologies International Inc. Combination vectors and methods for treating cancer
US11976292B2 (en) 2016-06-08 2024-05-07 American Gene Technologies International Inc. Non-integrating viral delivery system and methods related thereto
US11090379B2 (en) 2016-07-08 2021-08-17 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US12370253B2 (en) 2016-07-08 2025-07-29 American Gene Technologies International Inc. Pre-immunization and immunotherapy
US10036038B2 (en) 2016-07-08 2018-07-31 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US10494647B2 (en) 2016-07-08 2019-12-03 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US11911458B2 (en) 2016-07-08 2024-02-27 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US10233464B2 (en) 2016-07-08 2019-03-19 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US11583562B2 (en) 2016-07-21 2023-02-21 American Gene Technologies International Inc. Viral vectors for treating Parkinson's disease
US11820999B2 (en) 2017-04-03 2023-11-21 American Gene Technologies International Inc. Compositions and methods for treating phenylketonuria
US12559769B2 (en) 2017-06-16 2026-02-24 American Gene Technologies International Inc. Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells
EP3638779A4 (en) * 2017-06-16 2021-03-10 American Gene Technologies International Inc. METHODS AND COMPOSITIONS FOR ACTIVATING TUMOR CYTOXICITY VIA HUMAN GAMMA DELTA T CELLS
WO2019051255A1 (en) * 2017-09-08 2019-03-14 Generation Bio Co. CLOSED-ENDED DNA (CEDNA) MODIFIED
CN111132699A (zh) * 2017-09-08 2020-05-08 世代生物公司 修饰的封闭端dna(cedna)
US11352646B2 (en) 2018-11-05 2022-06-07 American Gene Technologies International Inc. Vector system for expressing regulatory RNA
US12410445B2 (en) 2018-11-05 2025-09-09 American Gene Technologies International Inc. Vector system for expressing regulatory RNA
CN109363955A (zh) * 2018-11-14 2019-02-22 广州玮弘祺生物科技有限公司 一种发用固体定型喷雾及其制备方法
CN109363955B (zh) * 2018-11-14 2021-09-21 广州玮弘祺生物科技有限公司 一种发用固体定型喷雾及其制备方法

Also Published As

Publication number Publication date
CN116064678A (zh) 2023-05-05
US9834790B1 (en) 2017-12-05
IL297238B2 (en) 2024-08-01
EP4310500A3 (en) 2024-04-03
EP4310500A2 (en) 2024-01-24
IL310925A (en) 2024-04-01
IL279520A (en) 2021-01-31
JP7260898B2 (ja) 2023-04-19
CA3011529A1 (en) 2017-07-20
US10428350B2 (en) 2019-10-01
US20180305716A1 (en) 2018-10-25
IL297238B1 (en) 2024-04-01
EP3402483B1 (en) 2023-11-08
US10036040B2 (en) 2018-07-31
JP2021090470A (ja) 2021-06-17
AU2017207906B2 (en) 2021-03-11
US10023880B2 (en) 2018-07-17
US20200063161A1 (en) 2020-02-27
IL279520B2 (en) 2023-03-01
US12410446B2 (en) 2025-09-09
US20180142257A1 (en) 2018-05-24
US9914938B2 (en) 2018-03-13
US20170335344A1 (en) 2017-11-23
CN108883100B (zh) 2022-11-25
ES2965357T3 (es) 2024-04-15
CN111569090A (zh) 2020-08-25
DK3402483T3 (da) 2024-01-02
EP3402483A1 (en) 2018-11-21
JP2023144131A (ja) 2023-10-06
US20230340531A1 (en) 2023-10-26
IL297238A (en) 2022-12-01
US11519006B2 (en) 2022-12-06
IL279520B (en) 2022-11-01
JP2025111628A (ja) 2025-07-30
AU2021203836A1 (en) 2021-07-08
AU2017207906A1 (en) 2018-08-02
US10472649B2 (en) 2019-11-12
US20180142258A1 (en) 2018-05-24
EP3402483A4 (en) 2019-07-10
AU2021203836B2 (en) 2025-02-06
IL260594B (en) 2021-01-31
JP2019501661A (ja) 2019-01-24
US20190062786A1 (en) 2019-02-28
CN108883100A (zh) 2018-11-23

Similar Documents

Publication Publication Date Title
US12410446B2 (en) Methods and compositions for the activation of gamma-delta T-cells
US12403155B2 (en) Methods and compositions for the activation of gamma-delta T-cells
US20200181645A1 (en) Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17739028

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2018536892

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 3011529

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 260594

Country of ref document: IL

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017207906

Country of ref document: AU

Date of ref document: 20170113

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2017739028

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017739028

Country of ref document: EP

Effective date: 20180816

WWW Wipo information: withdrawn in national office

Ref document number: 310925

Country of ref document: IL