WO2017074065A1 - 중쇄 디아민의 생산 방법 - Google Patents

중쇄 디아민의 생산 방법 Download PDF

Info

Publication number
WO2017074065A1
WO2017074065A1 PCT/KR2016/012174 KR2016012174W WO2017074065A1 WO 2017074065 A1 WO2017074065 A1 WO 2017074065A1 KR 2016012174 W KR2016012174 W KR 2016012174W WO 2017074065 A1 WO2017074065 A1 WO 2017074065A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
heavy chain
chain diamine
producing
oxidation
Prior art date
Application number
PCT/KR2016/012174
Other languages
English (en)
French (fr)
Inventor
안정오
이홍원
박규연
이희석
장민정
전우영
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority to EP16860248.0A priority Critical patent/EP3378941B1/en
Priority to US15/771,830 priority patent/US11162121B2/en
Priority claimed from KR1020160141018A external-priority patent/KR101903552B1/ko
Publication of WO2017074065A1 publication Critical patent/WO2017074065A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds

Definitions

  • the present invention relates to a method for the production of heavy chain diamines, and more particularly, the fat aldehyde dehydrogenase gene and the ⁇ -oxidation pathway related genes in the ⁇ -oxidation metabolic pathway are removed, and also the ⁇ -trans
  • the present invention relates to a method for producing a heavy chain diamine from alcohol or alkanes derived from fatty acids by culturing a recombinant microorganism into which a transaminase gene has been introduced.
  • Bioplatform compounds are produced through biological or chemical conversion based on biomass-derived raw materials, and are used for synthesis of polymer monomers and new materials.
  • the medium chain diamine in the bioplatform compound is used as a monomer of polyamide, and the polyamide is classified into aliphatic polyamide, aromatic polyamide, and aliphatic ring polyamide.
  • Representative of aliphatic polyamides include nylon 6 and nylon 66, which are prepared by condensation polymerization of hexamethylenediamine having 6 carbon atoms and adipic acid having 6 carbon atoms.
  • aromatic polyamide is introduced under the aromatic skeleton to further improve heat resistance, and is known under the name aramid.
  • Polyamide has excellent heat resistance, mechanical properties, electrical properties, and chemical resistance, and is attracting attention as an engineering plastic that replaces metals such as polyacetal.
  • Polyamide-based synthetic fibers are polyester-based polyacrylonitrile-based (acrylic fibers). ) Is the mainstream of synthetic fibers.
  • medium chain diamines may be achieved by biological methods through chemical synthesis or microbial fermentation.
  • biological methods through chemical synthesis or microbial fermentation.
  • the use of such biological methods requires the development of new strains using metabolic engineering and optimization of fermentation processes.
  • microorganisms having a ⁇ -oxidative metabolic pathway and an ⁇ -oxidative metabolic pathway may be used as a strain capable of producing heavy chain diamines.
  • microorganisms having a ⁇ -oxidative metabolic pathway and an ⁇ -oxidative metabolic pathway may be used.
  • non-naturally occurring microorganisms derived from Penicillium chrysogenum A method for producing hexamethylenediamine from an organism is known (Korean Patent Publication No. 10-2012-0034640).
  • the heavy chain diamine is prepared by further introducing a process of transferring an amine group to the heavy chain aldehyde corresponding to the intermediate product of the ⁇ -oxidation metabolic pathway, the yield of the medium chain diamine using the microorganism is not high. there was.
  • the present invention provides an alcohol or alkane derived from a fatty acid by culturing a recombinant microorganism in which a fatty aldehyde dehydrogenase gene and a ⁇ -oxidative metabolic pathway related gene in the ⁇ -oxidative metabolic pathway are removed and a ⁇ -transaminase gene is introduced. It is an object to provide a process for the production of heavy chain diamines.
  • the present invention (1) the recombination in which the fat aldehyde dehydrogenase gene and ⁇ -oxidation metabolic pathway related gene in the ⁇ -oxidation metabolic pathway are removed, and the ⁇ -transaminase gene is introduced. Preparing a microorganism; And (2) provides a method for producing a heavy chain diamine comprising the step of culturing the substrate to the recombinant microorganism.
  • the fatty aldehyde dehydrogenase and ⁇ -oxidation metabolic pathway related genes are preferably but not limited to all homologous genes present in the microorganism. According to another embodiment of the present invention, the fatty aldehyde dehydrogenase and ⁇ -oxidation pathway related genes are preferably but not limited to some homologous genes present in the microorganism.
  • the fatty aldehyde dehydrogenase gene may be a gene selected from the group consisting of FALDH1, FALDH2, FALDH3 and FALDH4 gene, but is not limited thereto.
  • the ⁇ -oxidation pathway related gene may be an acyl-CoA oxidase gene, but is not limited thereto.
  • the acyl-CoA oxidase gene may be selected from the group consisting of ACO1, ACO2, ACO3, ACO4, ACO5 and ACO6 genes, but is not limited thereto.
  • the microorganism may be yeast or E. coli, but is not limited thereto.
  • the yeast is composed of Yarrowia sp., Saccharomyces sp., Pichia sp., And Candida sp. Yeast selected from the group may be, but is not limited thereto.
  • the yeast of the genus Yarrowia may be Yarrowia lipolytica, but is not limited thereto.
  • the substrate may be selected from the group consisting of alcohols and alkanes derived from fatty acids, but is not limited thereto.
  • the alcohol, alkane and heavy chain diamine derived from the fatty acid may each have 5 to 30 carbon atoms, preferably 6 to 20 carbon atoms, more preferably 8 to 16 carbon atoms, but is not limited thereto. no.
  • the alkanes may be dodecane, but is not limited thereto.
  • the heavy chain diamine may be 1,12-diaminododecane, but is not limited thereto.
  • the fat aldehyde dehydrogenase gene and ⁇ -oxidation metabolic pathway related genes in the ⁇ -oxidation metabolic pathway is removed, and the ⁇ -transaminase gene is introduced to further oxidize fat aldehyde and
  • the heavy chain diamine can be produced in high yield by preventing ⁇ -oxidation metabolism and introducing an amine group at the terminal.
  • Figure 2 schematically shows the preparation of recombinant microorganisms in which the fat aldehyde dehydrogenase gene and the ⁇ -oxidation metabolic pathway gene related to ⁇ -oxidation have been removed and the ⁇ -transaminase gene has been introduced.
  • Figure 3 schematically shows a vector having a ura3 gene to be used as a selection marker for gene knockout for strain improvement and a pop-out for removing the ura3 gene after the knockout cassette insertion.
  • Figure 4 is a schematic diagram showing the manufacturing process of the knock-out cassette used in the production of the transformed microorganism of the present invention.
  • Figure 5 schematically shows a transformation vector containing the ⁇ -transaminase gene for strain improvement.
  • Figure 6 is a graph showing the types of genes knocked out and transduced in the transformed microorganism of the present invention.
  • Figure 7 is a graph showing the amount of heavy chain diamine produced from the dodecan substrate of the transforming microorganism of the present invention.
  • FIG. 8 is a graph showing the amount of heavy chain diamine produced from dodecane as a substrate when the Y2-36 strain of the present invention is cultured in a flask.
  • ⁇ -oxidation refers to a metabolic process in which a methyl group terminal of a fatty acid is oxidized to form a dicarboxylic acid
  • ⁇ -oxidation means that a ⁇ -site carbon atom is oxidized in a carboxy group. It is a metabolic process that releases acetyl CoA and gradually breaks down into fatty acids with two carbon atoms each time.
  • the concepts of ⁇ -oxidation and ⁇ -oxidation and the enzymes involved in this metabolic process are well known to those skilled in the biochemistry art.
  • ⁇ -hydroxy fatty acid is first produced by the action of cytochrome P450 and NADPH-cytochrome P450 reductase, and the ⁇ -hydroxy fatty acid is ⁇ -aldehyde fatty acid is produced by the action of fatty alcohol dehydrogenase and fatty alcohol oxidase, and the ⁇ -aldehyde fatty acid is produced by the action of fatty aldehyde dehydrogenase.
  • acyl-CoA oxidase produces fatty acids having two carbon atoms (see FIG. 1).
  • Transaminase (TA, EC 2.6.1.X) is an enzyme that exists widely in nature and is involved in the transfer of amine groups in the nitrogen metabolism of organisms. In general, transaminase removes the amino group of one amino acid and transfers it to another ⁇ -keto acid. Transaminase is used for the production of optically pure non-natural amino acids and amine compounds due to its many advantages such as broad substrate specificity, high optical selectivity, fast reaction rate, excellent stability, and the need for coenzyme reproduction. have.
  • Transaminase can be divided into five groups based on the structure and multiple sequence alignments of proteins in the Pfam database, including ⁇ -amino acids: pyruvate transaminase, ornithine transaminase, 4 Transaminases belonging to group III containing aminobutyrate transaminase and the like are called ⁇ -transaminases. Unlike conventional transaminase, ⁇ -transaminase transfers an amine group of an amino acid with an amine group at a non-alpha position or an amine compound without a carboxyl group to an amine receptor such as 2-ketoglutarate or pyruvate. Perform.
  • ⁇ -transaminase can be used as an enzyme which is very useful for the production of optically active amine compounds.
  • ⁇ -transaminase was first used by Celgene Co. of the United States to synthesize chiral amines for the first time in 1990. Recently, studies on asymmetric synthesis of chiral amines and improved kinetic resolution have been made. This is an important part of the study, and 12-oxolauric acid methyl ester was prepared by Evonik, Germany, in 2012 using ⁇ -transaminase of Chromobacterium violaceum DSM30191 strain. Examples of conversion to aminolauric acid methyl ester are also known.
  • the fatty aldehyde dehydrogenase gene is preferably all homologous genes present in the microorganism is removed, but in some cases, the recombinant microorganism from which some of the genes are removed Can be applied.
  • the fatty aldehyde dehydrogenase gene may be selected from the group consisting of FALDH1, FALDH2, FALDH3 and FALDH4 gene, but is not limited thereto.
  • the FALDH1, FALDH2, FALDH3 and FALDH4 genes may include, but are not limited to, nucleotide sequences consisting of SEQ ID NO: 1 and SEQ ID NO: 4, respectively.
  • the ⁇ -oxidation metabolic pathway-related gene is preferably all homologous genes present in the microorganism is removed, but in some cases, the recombinant microorganism from which some of the genes are removed Can be applied.
  • the ⁇ -oxidation pathway related gene is an acyl-CoA oxidase gene, and the acyl-CoA oxidase gene may be selected from the group consisting of ACO1, ACO2, ACO3, ACO4, ACO5 and ACO6 genes, but is not limited thereto. No (see Figure 2).
  • the ACO1, ACO2, ACO3, ACO4, ACO5 and ACO6 gene may include a base sequence consisting of SEQ ID NO: 5 and SEQ ID NO: 10, but is not limited thereto.
  • the ⁇ -transaminase gene may include a nucleotide sequence consisting of SEQ ID NO: 11, but is not limited thereto.
  • recombination in which the fat aldehyde dehydrogenase gene and ⁇ -oxidation metabolic pathway related genes are removed using a conventional gene recombination technique known in the art, and a ⁇ -transaminase gene is introduced.
  • Microorganisms can be produced.
  • the term "removal" is not only a part or all of the gene is physically removed, but also a state in which a protein is not made from mRNA transcribed from the gene and the protein expressed from the gene function The state of not being able to be used is also used in the sense of comprehensive inclusion.
  • introduction is used in the sense that encompasses both when the gene is inserted into the genome of the microorganism, or when the gene is expressed without inserting the gene into the genome of the microorganism.
  • Genetic recombination techniques that can be used include, but are not limited to, methods such as transformation, transduction, transfection, microinjection, electroporation, and the like. .
  • any microorganism that can be used may be used without limitation any microorganism having both ⁇ -oxidation and ⁇ -oxidation metabolic processes, for example, eukaryotes including yeast and prokaryotes including E. coli are used. Can be.
  • the microorganism is preferably using yeast, and yeasts such as Yarrowia genus, Saccharomyces genus, Pichia genus, Candida genus and the like may be used without limitation.
  • Yarrowia Lipolitica Candida tropicalis, Candida infanticola, Saccharomyces cerevisiae, Pichia alcoholophia or Candida mycoderma ( Candida mycoderma) is preferred, and Yarrowia lipolitica is more preferred.
  • cytochrome P450 and NADPH-cytochrome P450 are supplied when alkanes are supplied to the substrate.
  • the alcohol is oxidized to form an aldehyde by the action of fatty alcohol dehydrogenase and fatty alcohol oxidase, but fatty aldehyde di Since the hydrogenase is removed, no further oxidation occurs.
  • the aldehyde formed as described above becomes a substrate so that the other end is oxidized by the action of cytochrome P450, NADPH-cytochrome P450 reductase, fatty alcohol dehydrogenase, and fatty alcohol oxidase to form aldehyde groups at both ends. do.
  • cytochrome P450 NADPH-cytochrome P450 reductase
  • fatty alcohol dehydrogenase fatty alcohol oxidase
  • fatty alcohol oxidase fatty alcohol oxidase
  • the fat aldehyde dehydrogenase gene and ⁇ -oxidation metabolic pathway related genes in the ⁇ -oxidation metabolic pathway are removed, and further addition of the fat aldehyde using a recombinant microorganism into which the ⁇ -transaminase gene has been introduced.
  • the heavy chain diamine can be produced in high yield by preventing oxidation and ⁇ -oxidation metabolism and introducing an amine group at the terminal.
  • the fatty aldehyde dehydrogenase and ⁇ -oxidation pathway related genes are preferably all homologous genes present in the microorganism, but in some cases, the recombinant microorganism from which some of the genes have been removed may also be applied in the present invention. Can be.
  • any microorganism that can be used may be used without limitation any microorganism having both ⁇ -oxidation and ⁇ -oxidation metabolic processes, for example, eukaryotes including yeast and prokaryotes including E. coli are used. Can be.
  • the microorganism is preferably using yeast, and yeasts such as Yarrowia genus, Saccharomyces genus, Pichia genus, Candida genus and the like may be used without limitation.
  • Yarrowia Lipolitica Candida Tropicalis, Candida Infantica, Saccharomyces cerevisiae, Pichia alcoholopia or Candida Mycoderma, and more preferably Yarrowia lipolitica. desirable.
  • recombination in which the fat aldehyde dehydrogenase gene and ⁇ -oxidation metabolic pathway related genes are removed using a conventional gene recombination technique known in the art, and a ⁇ -transaminase gene is introduced.
  • Microorganisms can be produced.
  • the term "removal” is not only a part or all of the gene is physically removed, but also a state in which a protein is not made from mRNA transcribed from the gene and the protein expressed from the gene function The state of not being able to be used is also used in the sense of comprehensive inclusion.
  • introduction is used in the sense that encompasses both when the gene is inserted into the genome of the microorganism, or when the gene is expressed without inserting the gene into the genome of the microorganism.
  • diamine refers to a compound containing two amine groups (-NH 2 groups)
  • mid-chain diamine refers to a diamine compound having 5 to 30, preferably 8 to 16 carbon atoms It is used to mean all.
  • the heavy chain diamine is preferably, but not limited to, 1,12-diaminododecane having 12 carbon atoms.
  • the substrate of step (2) may be selected from the group consisting of alcohols and alkanes derived from fatty acids, but is not limited thereto.
  • the alcohol derived from the fatty acid may be an alcohol having 5 to 30, preferably 8 to 16 carbon atoms, but is not limited thereto.
  • the alkanes may be used alkanes having 5 to 30, preferably 8 to 16, more preferably dodecane having 12 carbon atoms, but is not limited thereto.
  • a vector having a ura3 gene to be used as a selection marker for gene knock-out for strain improvement and a pop-out for removing the ura3 gene after insertion of the knock-out cassette was constructed (FIG. 3).
  • the primers used to PCR the pop-out region and ura3 in two pieces are shown in Table 3.
  • Fat aldehyde dehydrogenase gene and ⁇ -oxidation metabolic pathway in the ⁇ -oxidation metabolism pathway present in wild type Yarrowia strain using the knock-out cassette prepared in Example 1 and the transduction vector prepared in Example 2 A total of eight knock-out strains were constructed in which some or all of the related genes were removed and the ⁇ -transaminase gene was introduced (FIG. 6). Specifically, strains to knock-out or introduce genes were plated on YPD plates and incubated at 30 ° C. for 16-24 hours.
  • the cultured cells were scraped with a loop and vortexed in 100 ⁇ l of one-step buffer (45% PEG4000, 100 mM DTT, 0.1 L LiAc, 25 ⁇ g single-strand carrier DNA), followed by knock-out cassette and transduction vector (1 ng). Above) was added and vortexed again, and incubated at 39 ° C. for 1 hour.
  • the cultured samples were loaded into selection medium (YNB w / o amino acid 6.7g / L, Glucose 20g / L) and incubated at 30 ° C. for 48 hours to select the inserted strain. Then, it was confirmed by PCR using the fries included in the gene deletion of Table 2 to confirm that the cassettes are correctly inserted on the genome of the selected strain.
  • the strain into which the cassette was inserted went through a pop-out process to proceed with the insertion of another cassette.
  • 200 ⁇ l of the culture medium was mixed with 5 ′ FOA medium (YNB w / o amino acid 6.7g / L, Glucose 20g / L, 5 'FOA).
  • 5 ′ FOA medium YNB w / o amino acid 6.7g / L, Glucose 20g / L, 5 'FOA.
  • the strain to be tested was inoculated in 2 ml of YPD medium (Bacto Laboratories, Yeast extract 10g / L, peptone 20g / L, glucose 20g / L) the day before at 30 °C, 200rpm.
  • 2 ml of growth stage medium (pH 6.0) having the composition shown in Table 7 was placed in a 24-well plate, and then inoculated with 1% of the precultured culture, and then incubated at 30 ° C. and 450 rpm for one day in a plate stirrer.
  • the Y1-11 strain that only knocked out the ⁇ -oxidation metabolism related gene could not produce 1,12-diaminododecane from the substrate dodecane, but the fat aldehyde dehydrogenase gene further
  • the Y2-36 strain showed 1,12-diaminododecane synthesis capacity of about 12 mg / L when cultured in a flask (FIG. 8). In the following experiment, a sample analysis experiment using the Y2-36 strain was performed.
  • Example 4 300 ⁇ l of 6N sulfuric acid was added to 1000 ⁇ l of the culture medium of the Y2-36 strain which showed the highest ability to synthesize 1,12-diaminododecane, and vortexed, followed by centrifugation at 12,000 rpm for 2 minutes. It was. Subsequently, 200 ⁇ l of 10N sodium hydroxide and 200 ⁇ l of diethyl ether were added to 600 ⁇ l of the supernatant, followed by vortexing, followed by centrifugation at 12,000 rpm for 2 minutes. It was.

Abstract

본 발명은 중쇄 디아민의 생산 방법에 관한 것으로, 보다 상세하게는 ω-산화 대사 경로 중의 지방 알데히드 디하이드로게나아제 유전자 및 β-산화 대사 경로 관련 유전자가 제거되고, 또한 ω-트랜스아미나아제 유전자가 도입된 재조합 미생물을 배양함으로써, 지방산 유래의 알코올 또는 알칸으로부터 중쇄 디아민을 생산하는 방법에 관한 것이다. 본 발명에서 개시하고 있는 재조합 미생물은 지방 알데히드의 추가적인 산화 및 β-산화 대사를 방지하고, 말단에 아민기를 도입함으로써 중쇄 디아민을 높은 수율로 생산할 수 있다.

Description

중쇄 디아민의 생산 방법
본 발명은 중쇄 디아민의 생산 방법에 관한 것으로, 보다 상세하게는 ω-산화 대사 경로 중의 지방 알데히드 디하이드로게나아제(fatty alcohol dehydrogenase) 유전자 및 β-산화 대사 경로 관련 유전자가 제거되고, 또한 ω-트랜스아미나아제(transaminase) 유전자가 도입된 재조합 미생물을 배양함으로써, 지방산 유래의 알코올 또는 알칸(alkane)으로부터 중쇄 디아민을 생산하는 방법에 관한 것이다.
바이오플랫폼 화합물은 바이오매스 유래 원료를 기반으로 하여 생물학적 또는 화학적 전환을 통해 생산된 것으로, 고분자 모노머, 신소재 등의 합성에 사용되고 있다.
바이오플랫폼 화합물 중 중쇄 디아민은 폴리아마이드(polyamide)의 단량체로 사용되는 물질로서, 상기 폴리아마이드는 지방족 폴리아마이드, 방향족 폴리아마이드, 지방족 고리 폴리아마이드로 분류된다. 지방족 폴리아마이드의 대표적인 것에는 나일론 6 및 나일론 66이 있는데, 탄소수 6개인 헥사메틸렌디아민과 탄소수 6개인 아디프산의 축합중합에 의해 제조된다. 또한, 방향족 폴리아마이드는 내열성을 더욱 향상시키기 위해 방향족 골격을 도입한 것으로, 아라미드(aramid)라는 이름으로 알려져 있다.
폴리아마이드는 내열성과 기계적 성질 및 전기특성·내약품성이 뛰어나, 폴리아세탈과 같이 금속을 대체 하는 엔지니어링·플라스틱으로 주목되고 있고, 폴리아마이드계 합성섬유는 폴리에스테르계·폴리아크릴로니트릴계(아크릴 섬유)와 함께 합성섬유의 주류를 이루고 있다.
중쇄 디아민의 생산은 화학적 합성이나 미생물 발효를 통한 생물학적 방법으로 이루어질 수 있는데, 이러한 생물학적 방법을 이용할 경우에는 대사공학 기술을 이용한 신규 균주 개발 및 발효공정의 최적화가 요구된다.
종래에 중쇄 디아민을 생산할 수 있는 균주로는 β-산화 대사 경로와 ω-산화 대사 경로를 함께 갖고 있는 미생물이 이용될 수 있고, 예컨대 페니실리엄 크리소제넘(Penicillium chrysogenum) 유래의 비-천연 미생물 유기체로부터 헥사메틸렌디아민을 생산하는 방법이 알려져 있다(대한민국 특허공개번호 제10-2012-0034640호). 그러나, 중쇄 디아민은 ω-산화 대사 경로의 중간 생성물에 해당하는 중쇄 알데히드에 아민기를 전달하는 과정을 추가로 도입하여 제조되기 때문에, 상기 미생물을 이용한 중쇄 디아민의 생산에 있어서는 그 수율이 높지 않다는 문제점이 있었다.
본 발명은 ω-산화 대사 경로 중의 지방 알데히드 디하이드로게나아제 유전자 및 β-산화 대사 경로 관련 유전자가 제거되고, 또한 ω-트랜스아미나아제 유전자가 도입된 재조합 미생물을 배양함으로써, 지방산 유래의 알코올 또는 알칸으로부터 중쇄 디아민을 생산하는 방법을 제공하는 것을 목적으로 한다.
상기 기술적 과제를 달성하기 위하여, 본 발명은 (1) ω-산화 대사 경로 중의 지방 알데히드 디하이드로게나아제 유전자 및 β-산화 대사 경로 관련 유전자가 제거되고, 또한 ω-트랜스아미나아제 유전자가 도입된 재조합 미생물을 제조하는 단계; 및 (2) 상기 재조합 미생물에 기질을 처리하여 배양하는 단계를 포함하는 중쇄 디아민의 생산 방법을 제공한다.
본 발명의 한 구현예에 따르면, 상기 지방 알데히드 디하이드로게나아제 및 β-산화 대사 경로 관련 유전자는 미생물 내에 존재하는 모든 상동형 유전자가 제거된 것이 바람직하지만 이에 한정되는 것은 아니다. 본 발명의 다른 구현예에 따르면, 상기 지방 알데히드 디하이드로게나아제 및 β-산화 대사 경로 관련 유전자는 해당 미생물 내에 존재하는 일부 상동형 유전자가 제거된 것이 바람직하지만 이에 한정되는 것은 아니다.
본 발명의 한 구현예에 따르면, 상기 지방 알데히드 디하이드로게나아제 유전자는 FALDH1, FALDH2, FALDH3 및 FALDH4 유전자로 이루어진 군으로부터 선택되는 유전자일 수 있으나 이에 한정되는 것은 아니다.
본 발명의 한 구현예에 따르면, 상기 β-산화 대사 경로 관련 유전자는 아실-CoA 옥시다아제 유전자일 수 있으나 이에 한정되는 것은 아니다. 본 발명의 바람직한 구현예에 따르면, 상기 아실-CoA 옥시다아제 유전자는 ACO1, ACO2, ACO3, ACO4, ACO5 및 ACO6 유전자로 이루어진 군으로부터 선택될 수 있으나 이에 한정되는 것은 아니다.
본 발명의 한 구현예에 따르면, 상기 미생물은 효모 또는 대장균일 수 있으나 이에 한정되는 것은 아니다. 본 발명의 바람직한 구현예에 따르면, 상기 효모는 야로위아 속(Yarrowia sp.), 사카로마이세스 속(Saccharomyces sp.), 피키아 속(Pichia sp.) 및 캔디다 속(Candida sp.)으로 이루어진 군으로부터 선택되는 효모일 수 있으나 이에 한정되는 것은 아니다. 본 발명의 다른 바람직한 구현예에 따르면, 상기 야로위아 속의 효모는 야로위아 리폴리티카(Yarrowia lipolytica)일 수 있으나 이에 한정되는 것은 아니다.
본 발명의 한 구현예에 따르면, 상기 기질은 지방산 유래의 알코올 및 알칸으로 이루어지는 군으로부터 선택될 수 있으나 이에 한정되는 것은 아니다. 본 발명의 바람직한 구현예에 따르면, 상기 지방산 유래의 알코올, 알칸 및 중쇄 디아민은 각각 탄소수 5 내지 30, 바람직하게는 탄소수 6 내지 20, 보다 바람직하게는 탄소수 8 내지 16을 가질 수 있으나 이에 한정되는 것은 아니다. 본 발명의 다른 바람직한 구현예에 따르면, 상기 알칸은 도데칸일 수 있으나 이에 한정되는 것은 아니다. 본 발명의 다른 바람직한 구현예에 따르면, 상기 중쇄 디아민은 1,12-디아미노도데칸일 수 있으나 이에 한정되는 것은 아니다.
본 발명에서 개시하고 있는 재조합 미생물은 ω-산화 대사 경로 중의 지방 알데히드 디하이드로게나아제 유전자 및 β-산화 대사 경로 관련 유전자가 제거되고, 또한 ω-트랜스아미나아제 유전자가 도입되어 지방 알데히드의 추가적인 산화 및 β-산화 대사를 방지하고, 말단에 아민기를 도입함으로써 중쇄 디아민을 높은 수율로 생산할 수 있다.
도 1은 ω-산화 및 β-산화 대사 반응과 관련된 생성물 및 관련 효소의 종류를 보여주는 것이다.
도 2는 ω-산화와 관련된 지방 알데히드 디하이드로게나아제 유전자 및 β-산화 대사 경로 관련 유전자가 제거되고, 또한 ω-트랜스아미나아제 유전자가 도입된 재조합 미생물의 제조 과정을 개략적으로 나타낸 것이다.
도 3은 균주 개량을 위한 유전자 낙-아웃을 위해 선별 마커로 사용될 ura3 유전자와 낙-아웃 카세트 삽입 후 ura3 유전자를 제거하기 위한 팝-아웃(pop-out)을 갖는 벡터를 개략적으로 나타낸 것이다.
도 4는 본 발명의 형질전환 미생물의 제조에 사용된 낙-아웃 카세트의 제작 과정을 보여주는 개략도이다.
도 5는 균주 개량을 위해 ω-트랜스아미나아제 유전자가 포함된 형절전환 벡터를 개략적으로 나타낸 것이다.
도 6은 본 발명의 형질전환 미생물에서 낙-아웃 및 형질도입된 유전자의 종류를 보여주는 그래프이다.
도 7은 본 발명의 형질전환 미생물이 기질인 도데칸으로부터 생성한 중쇄 디아민의 양을 보여주는 그래프이다.
도 8은 본 발명의 Y2-36 균주를 플라스크에서 배양시 기질인 도데칸으로부터 생성한 중쇄 디아민의 양을 보여주는 그래프이다.
도 9는 본 발명의 Y2-36 균주에서 기질인 도데칸으로부터 중쇄 디아민이 생성되었음을 보여주는 GC/MS 데이터이다.
상기 목적을 달성하기 위하여, 본 발명은
(1) ω-산화 대사 경로 중의 지방 알데히드 디하이드로게나아제 유전자 및 β-산화 대사 경로 관련 유전자가 제거되고, 또한 ω-트랜스아미나아제 유전자가 도입된 재조합 미생물을 제조하는 단계; 및
(2) 상기 재조합 미생물에 기질을 처리하여 배양하는 단계를 포함하는 중쇄 디아민의 생산 방법을 제공한다.
본 발명에 있어서, 상기 "ω-산화"란 용어는 지방산의 메틸기 말단이 산화되어 디카르복시산이 형성되는 대사 과정을 의미하고, "β-산화"란 용어는 카르복시기에서 β-자리의 탄소원자가 산화되어 아세틸 CoA를 방출하면서 그때마다 탄소 원자수가 2개 적은 지방산이 되면서 점차 분해되어 가는 대사 과정을 의미한다. 상기 ω-산화 및 β-산화의 개념과 이러한 대사 과정에 관여하고 있는 효소들에 대해서는 생화학 분야의 통상의 기술자에게 있어서 널리 알려져 있다. 예컨대, ω-산화에 있어서, 지방산이 기질로 이용될 경우에는 먼저 시토크롬 P450 및 NADPH-시토크롬 P450 리덕타아제(reductase)의 작용에 의해 ω-히드록시 지방산이 생성되고, 상기 ω-히드록시 지방산은 지방 알코올 디하이드로게나아제 및 지방 알코올 옥시다아제의 작용에 의해 ω-알데히드 지방산이 생성되며, 상기 ω-알데히드 지방산은 지방 알데히드 디하이드로게나아제의 작용에 의해 디카르복시산이 제조된다. 또한, β-산화에 있어서는 아실-CoA 옥시다아제에 의해 탄소 원자수가 2개 적은 지방산이 생성된다(도 1 참조).
트랜스아미나아제(TA, EC 2.6.1.X)는 자연계에 널리 존재하며 생물의 질소대사에서 아민기의 전이에 관여하는 효소이다. 일반적으로 트랜스아미나아제는 한 아미노산의 아미노기를 제거하여 다른 α-케토산(keto acid)에 전이하는 역할을 한다. 트랜스아미나아제는 넓은 기질특이성, 높은 광학선택성, 빠른 반응속도, 뛰어난 안정성, 그리고 조효소 재생산이 필요 없는 점 등의 여러 뛰어난 장점 때문에 광학적으로 순수한 비천연아미노산 및 아민화합물의 생산을 위해 트랜스아미나아제가 사용되고 있다. 트랜스아미나아제는 Pfam 데이터베이스에 나오는 단백질의 구조와 다중 서열 배열(alignments)을 바탕으로 5개의 그룹으로 나눌 수 있는데, 이중 ω-아미노산:피루베이트 트랜스아미나아제, 오르니틴(ornithine) 트랜스아미나아제, 4-아미노부티레이트 트랜스아미나아제 등을 포함하고 있는 그룹 Ⅲ에 속하는 트랜스아미나아제를 ω-트랜스아미나아제라 한다. 일반적인 트랜스아미나아제와는 달리, ω-트랜스아미나아제는 알파가 아닌 위치에 아민기가 있는 아미노산 또는 카르복실기가 없는 아민 화합물의 아민기를 2-케토글루타레이트 또는 피루베이트와 같은 아민 수용체에 전달해주는 반응을 수행한다. 따라서, ω-트랜스아미나아제는 광학활성 아민 화합물의 생산에 매우 유용한 효소로 사용될 수 있다. 예컨대, ω-트랜스아미나아제는 1990년에 미국의 셀진사(Celgene Co.)가 키랄 아민을 최초로 합성하는데 사용하였고, 최근에는 키랄 아민의 비대칭 합성(asymmetric synthesis) 연구와 동적 분할(kinetic resolution) 향상 관련 연구에서 중요하게 다루어지고 있으며, 2012년 독일의 에보닉사(Evonik)에서 크로모박테리움 비올라세움(Chromobacterium violaceum) DSM30191 균주의 ω-트랜스아미나아제를 이용하여 12-옥소라우르산 메틸 에스테르를 12-아미노라우르산 메틸 에스테르로 전환시킨 예도 알려져 있다.
본 발명의 한 구현예에 따르면, 상기 지방 알데히드 디하이드로게나아제 유전자는 해당 미생물 내에 존재하는 모든 상동형 유전자가 제거된 것이 바람직하지만, 경우에 따라 이들 중 일부 유전자가 제거된 재조합 미생물도 본 발명에 있어서 적용될 수 있다.
본 발명의 한 구현예에 따르면, 상기 지방 알데히드 디하이드로게나아제 유전자는 FALDH1, FALDH2, FALDH3 및 FALDH4 유전자로 이루어진 군으로부터 선택될 수 있으나 이에 한정되는 것은 아니다. 상기 FALDH1, FALDH2, FALDH3 및 FALDH4 유전자는 각각 서열번호 1 및 서열번호 4로 이루어지는 염기서열을 포함할 수 있으나 이에 한정되는 것은 아니다.
본 발명의 다른 구현예에 따르면, 상기 β-산화 대사 경로 관련 유전자는 해당 미생물 내에 존재하는 모든 상동형 유전자가 제거된 것이 바람직하지만, 경우에 따라 이들 중 일부 유전자가 제거된 재조합 미생물도 본 발명에 있어서 적용될 수 있다. 상기 β-산화 대사 경로 관련 유전자는 아실-CoA 옥시다아제 유전자인 것이 바람직하고, 상기 아실-CoA 옥시다아제 유전자는 ACO1, ACO2, ACO3, ACO4, ACO5 및 ACO6 유전자로 이루어진 군으로부터 선택될 수 있으나 이에 한정되는 것은 아니다(도 2 참조). 본 발명의 다른 바람직한 구현예에 따르면, 상기 ACO1, ACO2, ACO3, ACO4, ACO5 및 ACO6 유전자는 각각 서열번호 5 및 서열번호 10으로 이루어지는 염기서열을 포함할 수 있으나 이에 한정되는 것은 아니다.
본 발명의 다른 구현예에 따르면, 상기 ω-트랜스아미나아제 유전자는 서열번호 11로 이루어지는 염기서열을 포함할 수 있으나 이에 한정되는 것은 아니다.
본 발명에 있어서, 본 기술분야에 공지된 통상의 유전자 재조합 기술을 이용하여 상기 지방 알데히드 디하이드로게나아제 유전자 및 β-산화 대사 경로 관련 유전자가 제거되고, 또한 ω-트랜스아미나아제 유전자가 도입된 재조합 미생물을 제조할 수 있다. 본 발명에 있어서, 상기 "제거"란 용어는 해당 유전자의 일부 또는 전부가 물리적으로 제거된 것뿐만 아니라, 해당 유전자로부터 전사된 mRNA로부터 단백질이 만들어지지 않는 상태 및 해당 유전자로부터 발현된 단백질이 기능을 하지 못하는 상태 등도 포괄적으로 포함하는 의미로 사용된다. 또한, 상기 "도입"이란 용어는 미생물의 게놈 내에 유전자가 삽입되거나, 또는 미생물의 게놈 내에 유전자가 삽입되지 않은 채로 해당 유전자가 발현되는 경우 모두를 포괄적으로 포함하는 의미로 사용된다. 사용될 수 있는 유전자 재조합 기술로는 형질전환(transformation), 형질도입(transduction), 형질주입(transfection), 미세주입(microinjection), 전기천공(electroporation) 등의 방법을 예시할 수 있으나 이에 한정되는 것은 아니다.
본 발명에 있어서, 사용될 수 있는 미생물은 ω-산화 및 β-산화 대사 과정을 모두 갖고 있는 임의의 미생물이 제한없이 사용될 수 있으며, 예컨대 효모를 포함하는 진핵생물 및 대장균을 포함하는 원핵생물 등이 사용될 수 있다. 본 발명의 구현예에 따르면, 상기 미생물은 효모를 사용하는 것이 바람직하며, 상기 효모로는 야로위아 속, 사카로마이세스 속, 피키아 속, 캔디다 속 등의 효모가 제한없이 사용될 수 있고, 이 중에서도 야로위아 리폴리티카, 캔디다 트로피칼리스(Candida tropicalis), 캔디다 인판티콜라(Candida infanticola), 사카로마이세스 세레비지애(Saccharomyces cerevisiae), 피키아 알코홀로피아(Pichia alcoholophia) 또는 캔디다 마이코더마(Candida mycoderma)를 사용하는 것이 바람직하며, 야로위아 리폴리티카를 사용하는 것이 더욱 바람직하다.
상기와 같이, 지방 알데히드 디하이드로게나아제 유전자 및 β-산화 대사 경로 관련 유전자가 제거되고, 또한 ω-트랜스아미나아제 유전자가 도입된 미생물의 경우, 알칸이 기질로 공급되면 시토크롬 P450 및 NADPH-시토크롬 P450 리덕타아제의 작용에 의해 두 말단 중 어느 한 쪽이 산화되어 알코올이 형성된 후, 상기 알코올은 지방 알코올 디하이드로게나아제 및 지방 알코올 옥시다아제의 작용에 의해 히드록시기가 산화되어 알데히드가 형성되지만, 지방 알데히드 디하이드로게나아제가 제거되어 있기 때문에 더 이상의 산화가 일어나지 못하게 된다. 그리고, 상기와 같이 형성된 알데히드는 다시 기질이 되어 시토크롬 P450, NADPH-시토크롬 P450 리덕타아제, 지방 알코올 디하이드로게나이제 및 지방 알코올 옥시다아제의 작용에 의해 다른 쪽 말단이 산화됨으로써 양 말단에 알데히드기가 형성되게 된다. 상기와 같이 알칸을 기질로 이용하게 되면 2차례에 걸친 산화 반응을 통해 알데히드가 형성되지만, 기질로 알칸이 아닌 알코올을 이용하게 되면 1차례의 산화만으로도 알데히드가 형성된다. 상기와 같이 형성된 양 말단에 알데히드기는 ω-트랜스아미나아제의 작용에 의해 아민화되어 디아민이 형성된다.
본 발명에 있어서, 상기 ω-산화 대사 경로 중의 지방 알데히드 디하이드로게나아제 유전자 및 β-산화 대사 경로 관련 유전자가 제거되고, 또한 ω-트랜스아미나아제 유전자가 도입된 재조합 미생물을 이용하여 지방 알데히드의 추가적인 산화 및 β-산화 대사를 방지하고, 말단에 아민기를 도입함으로써 중쇄 디아민을 높은 수율로 생산할 수 있다. 상기 지방 알데히드 디하이드로게나아제 및 β-산화 대사 경로 관련 유전자는 해당 미생물 내에 존재하는 모든 상동형 유전자가 제거된 것이 바람직하지만, 경우에 따라 이들 중 일부 유전자가 제거된 재조합 미생물도 본 발명에 있어서 적용될 수 있다.
본 발명에 있어서, 사용될 수 있는 미생물은 ω-산화 및 β-산화 대사 과정을 모두 갖고 있는 임의의 미생물이 제한없이 사용될 수 있으며, 예컨대 효모를 포함하는 진핵생물 및 대장균을 포함하는 원핵생물 등이 사용될 수 있다. 본 발명의 구현예에 따르면, 상기 미생물은 효모를 사용하는 것이 바람직하며, 상기 효모로는 야로위아 속, 사카로마이세스 속, 피키아 속, 캔디다 속 등의 효모가 제한없이 사용될 수 있고, 이 중에서도 야로위아 리폴리티카, 캔디다 트로피칼리스, 캔디다 인판티콜라, 사카로마이세스 세레비지애, 피키아 알코홀로피아 또는 캔디다 마이코더마를 사용하는 것이 바람직하며, 야로위아 리폴리티카를 사용하는 것이 더욱 바람직하다.
본 발명에 있어서, 본 기술분야에 공지된 통상의 유전자 재조합 기술을 이용하여 상기 지방 알데히드 디하이드로게나아제 유전자 및 β-산화 대사 경로 관련 유전자가 제거되고, 또한 ω-트랜스아미나아제 유전자가 도입된 재조합 미생물을 제조할 수 있다. 본 발명에 있어서, 상기 "제거"란 용어는 해당 유전자의 일부 또는 전부가 물리적으로 제거된 것뿐만 아니라, 해당 유전자로부터 전사된 mRNA로부터 단백질이 만들어지지 않는 상태 및 해당 유전자로부터 발현된 단백질이 기능을 하지 못하는 상태 등도 포괄적으로 포함하는 의미로 사용된다. 또한, 상기 "도입"이란 용어는 미생물의 게놈 내에 유전자가 삽입되거나, 또는 미생물의 게놈 내에 유전자가 삽입되지 않은 채로 해당 유전자가 발현되는 경우 모두를 포괄적으로 포함하는 의미로 사용된다.
본 발명에 있어서, "디아민"은 두 개의 아민기(-NH2 기)를 포함하고 있는 화합물을 총칭하는 것으로서, "중쇄 디아민"은 탄소수 5 내지 30, 바람직하게는 8 내지 16을 갖는 디아민 화합물을 모두 포함하는 의미로 사용된다. 본 발명의 바람직한 구현예에 따르면, 상기 중쇄 디아민은 탄소수 12의 1,12-디아미노도데칸인 것이 바람직하지만 이에 한정되는 것은 아니다.
본 발명에 있어서, 단계 (2)의 기질은 지방산 유래의 알코올 및 알칸으로 이루어지는 군으로부터 선택될 수 있으나 이에 한정되는 것은 아니다. 본 발명의 구현예에 따르면, 상기 지방산 유래의 알코올로는 탄소수 5 내지 30, 바람직하게는 8 내지 16을 갖는 알코올이 사용될 수 있으나 이에 한정되는 것은 아니다. 본 발명의 다른 구현예에 따르면, 상기 알칸은 탄소수 5 내지 30, 바람직하게는 8 내지 16을 갖는 알칸, 보다 바람직하게는 탄소수 12의 도데칸이 사용될 수 있으나 이에 한정되는 것은 아니다.
이하, 실시예에 의해 본 발명을 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.
실시예 1. 낙-아웃 카세트의 제작
균주 개량을 위한 유전자 낙-아웃을 위해 선별 마커로 사용될 ura3 유전자와 낙-아웃 카세트 삽입 후 ura3 유전자를 제거하기 위한 팝-아웃을 갖는 벡터를 제작하였다(도 3). 상기 Ura3 유전자는 야로위아 유래의 유전자를 사용하였고, 균주 개량에 사용된 팝-아웃 영역은 총 4가지 서열로 2종의 유전자에서 참조하였으며, 하나는 바실러스 유래의 글루타메이트 생산 유전자, 다른 하나는 살모넬라 또는 클로닝 벡터 pHUKH 유래의 his 오페론에 관여된 유전자를 사용하였다. 상기 팝-아웃 벡터의 제작을 위해 사용된 프라이머와 서열은 아래 표 1에 나타내었다.
팝-아웃 벡터
이름 염기서열 서열번호
HisG1 BglII F aattgggcccagatctcagaccggttcagacaggat 13
EcoRI R tctctgggcggaattcggaggtgcggatatgaggta 14
NotI F tgTTTCTCGgcggccgccagaccggttcagacaggat 15
BamHI R TCCAACGCGTGGATCCggaggtgcggatatgaggta 16
HisG2 BglII F aattgggcccagatctaacgctacctcgaccagaaa 17
EcoRI R tctctgggcggaattctcttctcgatcggcagtacc 18
NotI F tgTTTCTCGgcggccgcaacgctacctcgaccagaaa 19
BamHI R TCCAACGCGTGGATCCtcttctcgatcggcagtacc 20
glt2 BglII F aattgggcccagatctTCAGAACTTGCGCCGATAAA 21
EcoRI R tctctgggcggaattcCTTTGCCAGCTAGACCATAGAG 22
NotI F tgTTTCTCGgcggccgcTCAGAACTTGCGCCGATAAA 23
BamHI R TCCAACGCGTGGATCCCTTTGCCAGCTAGACCATAGAG 24
glt3 BglII F aattgggcccagatctATTGGCGGGTTCGTTACTT 25
EcoRI R tctctgggcggaattcCCTGGAAGAAGGCCGTATTATC 26
NotI F tgTTTCTCGgcggccgcATTGGCGGGTTCGTTACTT 27
BamHI R TCCAACGCGTGGATCCCCTGGAAGAAGGCCGTATTATC 28
낙--아웃 카세트의 제작은 도 4와 같이 진행하였다. 우선 야로위아의 게놈 DNA로부터 낙-아웃시킬 상동성 영역(homologous region, HR)의 PCR과 팝-아웃 벡터로부터 5'과 3'의 두 조각 PCR을 각각 진행하였다. 이후, 5' HR과 3' HR 각각을 PO-ura3 부위와 정렬(align) PCR(2ndPCR)을 진행하여 낙-아웃 카세트를 제작하였다. 각각의 상동성 영역을 증폭하기 위해 사용한 프라이머와 서열은 표 2에 나타내었다.
유전자 결실
이름 염기서열 서열번호
ACO1 F1 TTCCTCAATGGTGGAGAAGA 29
R1 TCTTTATCCTGTCTGAACCGGTCTG GTACCATAGTCCTTGCCATGC 30
F2 ATCGCTACCTCATATCCGCACCTCC CTTCTGTCCCCCGAGTTTCT 31
R2 AAGAAGGGCTTGAGAGTCG 32
ACO2 F1 CCCAACAACACTGGCAC 33
R1 TCTTTATCCTGTCTGAACCGGTCTG CTCCTCATCGTAGATGGC 34
F2 ATCGCTACCTCATATCCGCACCTCC gacaagacccgacaggc 35
R2 AGACCAGAGTCCTCTTCG 36
ACO3 F1 Accttcacagagccaccca 37
R1 ATGGCTCTCTGGGCGgtgttgggggtgttgatgatg 38
F2 TTGTTGTGTTTCTCGcaaggttctcatcgaggcctg 39
R2 Aggaaaggtcgaagagtgctct 40
ACO4 F1 Actgcgagagcgatctg 41
R1 TCTTTATCCTGTCTGAACCGGTCTG TTCATGAGCATGTAGTTTCG 42
F2 ATCGCTACCTCATATCCGCACCTCC gaggacgacaaagccggag 43
R2 AGAGCAGAGTCCTCCTCAA 44
ACO5 F1 AACTTCCTCACAGGCAGCGAGC 45
R1 ATGGCTCTCTGGGCG GAGTAGAGAGTGGGAGTTGAGGTC 46
F2 ttgttgtgtttctcg ccccgtcaaggacgctgag 47
R2 ACAGTAAGGTGGGGCTTGACTC 48
ACO6 F1 AGTCCCTCAACACGTTTACCG 49
R1 TCTTTATCCTGTCTGAACCGGTCTG CCATTTAGTGGCAGCAACGTT 50
F2 ATCGCTACCTCATATCCGCACCTCC GAGCTCTGATCAACCGAACC 51
R2 AGGAAGGGTCTAATGACAGA 52
FALDH1 F1 AATCACTCCTCCTACGC 53
R1 TCTTTATCCTGTCTGAACCGGTCTG TGGTCTCGGGGACACCTC 54
F2 ATCGCTACCTCATATCCGCACCTCC CCATCATCAAGCCCCGAA 55
R2 ACCGACATAATCTGAGCAAT 56
FALDH2 F1 Accactaggtgagatcgag 57
R1 TCTTTATCCTGTCTGAACCGGTCTG CTCCGACACTACCGGAACGC 58
F2 ATCGCTACCTCATATCCGCACCTCC CTTGCTCCCACAGTTGTT 59
R2 GATCACCCAGAACCATAGC 60
FALDH3 F1 GTGACCCCCACCACGTCAC 61
R1 TCTTTATCCTGTCTGAACCGGTCTG TTCTGACATTTTCAGCGCCAC 62
F2 ATCGCTACCTCATATCCGCACCTCC CCATTACGAGCGTTTGACGG 63
R2 CAGGGCTGGGGACCACC 64
FALDH4 F1 TACCGACTGGACCAGATTC 65
R1 TCTTTATCCTGTCTGAACCGGTCTG CGGCAGTGGCAATGATCTTAC 66
F2 ATCGCTACCTCATATCCGCACCTCC GACTCGATTCATCGCTCCTAC 67
R2 CAAATCTTTCGGAAGATTCGG 68
팝-아웃 영역과 ura3를 두 조각으로 PCR하기 위해 사용한 프라이머는 표 3에 나타내었다.
팝-아웃 카세트
이름 염기서열 서열번호
HISG1 F cagaccggttcagacaggat 69
R ggaggtgcggatatgaggta 70
HISG2 F aacgctacctcgaccagaaa 71
R tcttctcgatcggcagtacc 72
glt2 F TCAGAACTTGCGCCGATAAA 73
R CTTTGCCAGCTAGACCATAGAG 74
glt3 F ATTGGCGGGTTCGTTACTT 75
R CCTGGAAGAAGGCCGTATTATC 76
Bipartite Ulura3 cs 2B Atgccctcctacgaagctcgagc 77
Ylura3F Ctcccaacgagaagctggcc 78
실시예 2. 형질도입 벡터의 제작
ω-트랜스아미나아제를 야로위아 균주에 삽입시키기 위하여 도 5에 같은 벡터를 제작하였으며, 이를 위해 사용한 프라이머는 표 4에 나타내었다.
트랜스아미나아제 벡터
이름 염기서열 서열번호
EXP1-F ccaagcttggtaccgagctcaGagtttggcgcccgttttttc 79
EXP1-R CGTTGTTTTTGCATATGTGCTGTAGATATGTCTTGTGTGTAA 80
TEF-F ccaagcttggtaccgagctcaaactttggcaaagaggctgca 81
TEF-R CGTTGTTTTTGCATATGTTTGAATGATTCTTATACTCAGAAG 82
ALK1-F ccaagcttggtaccgagctcagatctgtgcgcctctacagaccc 83
ALK1-R CGTTGTTTTTGCATATGagtgcaggagtattctggggagga 84
XPR2t-F2 gtcgacgcaattaacagatagtttgccg 85
XPR2t-R3 ctcgagggatcccggaaaacaaaacacgacag 86
TA-F CATATGCAAAAACAACGTACTACCTCCC 87
TA-R gtcgacTTAGGCCAAACCACGGGCTTTC 88
ATATG2-ER-F actcctgcactCATatgtccaacgccctcaacctg 89
XTATG2-ER-F ccaatccaacacatatgtccaacgccctcaacctg 90
ER-R-1 CGTTGTTTTTGCATAGAACCGCCACCGCCGCTACCGCCACCGCCCGAACCGCCACCGCCgaatcgtgaaatatccttgggct 91
ER-R-2 CGTTGTTTTTGCATatgAGAACCGCCACCGCCGCTACCGCCACCGCCCGAACCGCCACCGCCgaatcgtgaaatatccttgggct 92
ETATG2 -ER-1 tgattacgccaagcttGagtttggcgcccgttttttc 93
ETATG2 -ER-2 acaggttgagggcgttggacatATGTGCTGTAGATATGTCTTGTGTGTAA 94
TTATG2 -ER-1 tgattacgccaagcttaaactttggcaaagaggctg 95
TTATG2 -ER-2 acaggttgagggcgttggacatATGtttgaatgattcttatactcagaag 96
ER-F atgtccaacgccctcaacctg 97
ER-R-3 CGTTGTTTTTGCATAGAACCGCCACCGCCGCTAC 98
트랜스아미나아제 카세트의 제작은 벡터로부터 2 조각의 PCR 산물 획득시 프로모터부터 ura3까지 증폭하여 카세트 제작에 사용했다는 점을 제외하고는 도 4와 동일한 방법으로 진행하였다. 카세트 제작을 위해 사용한 프라이머는 아래 표 5에 나타내었다.
트랜스아미나아제 카세트
이름 염기서열 서열번호
TA - FALDH4 -F1 TACCGACTGGACCAGATTC 99
TA - FALDH4 -R1 CGGCAGTGGCAATGATCTTAC 100
TA - FALDH4 -F2 ctcctctatggtctagctggcaaagACTCGATTCATCGCTCCTAC 101
TA - FALDH4 -R2 CAAATCTTTCGGAAGATTCGG 102
ATATG2 -F gtcggtaagatcattgccactgccgagatctgtgcgcctctacagac 103
ETATG2 -F gtcggtaagatcattgccactgccgGagtttggcgcccgttttttc 104
TTATG2 -F gtcggtaagatcattgccactgccgaaactttggcaaagaggctgc 105
XTATG2 -F gtcggtaagatcattgccactgccgacgcgtggagagtttgggtt 106
본 발명의 재조합 미생물 균주의 개량을 위해 사용한 유전자 서열들은 각각 서열목록에 기재하였으며, 표 6에 요약하였다.
유전자 서열번호 유전자 서열번호
FALDH1 1 ACO3 7
FALDH2 2 ACO4 8
FALDH3 3 ACO5 9
FALDH4 4 ACO6 10
ACO1 5 ω-트랜스아미나아제 11
ACO2 6 Ura3 12
실시예 3. 재조합 미생물 균주의 제작
상기 실시예 1에서 제조된 낙-아웃 카세트 및 실시예 2에서 제조된 형질도입 벡터를 이용하여 야생형 야로위아 균주에 존재하는 ω-산화 대사 경로 중의 지방 알데히드 디하이드로게나아제 유전자 및 β-산화 대사 경로 관련 유전자의 일부 또는 전부가 제거되고, 또한 ω-트랜스아미나아제 유전자가 도입된 총 8종의 낙-아웃 균주를 제작하였다(도 6). 구체적으로, 유전자를 낙-아웃 또는 도입할 균주를 YPD 플레이트에 도말하여 30℃에서 16-24시간 동안 배양하였다. 배양된 세포를 루프로 긁어서 원-스텝 버퍼(45% PEG4000, 100mM DTT, 0.1L LiAc, 25㎍ single-strand carrier DNA) 100㎕에 넣고 볼텍싱한 후, 낙-아웃 카세트 및 형질도입 벡터(1ng 이상)를 첨가하여 다시 볼텍싱하였고, 39℃에서 1시간 동안 배양하였다. 배양이 끝난 샘플을 선택 배지(YNB w/o 아미노산 6.7g/L, Glucose 20g/L)에 로딩한 뒤 30℃에서 48시간 동안 배양하여 제작된 카세트가 삽입된 균주를 선택하였다. 이후, 선택된 균주의 게놈 상에 카세트들이 정확히 삽입되었는지 확인하기 위해 표 2의 유전자 결실에 포함된 프라이들을 이용하여 PCR을 통해 확인하였다.
카세트가 삽입된 균주는 다른 카세트의 삽입을 진행하기 위해 팝-아웃 과정을 진행하였다. 선택 배지에서 선택된 균주를 YPD 배지 2㎖에 접종하여 30℃에서 16시간 이상 배양한 후, 배양액 200㎕를 5' FOA 배지(YNB w/o 아미노산 6.7g/L, Glucose 20g/L, 5' FOA 0.8g/L, uracil 0.1g/L, uridine 0.1g/L)에 도말하여 30℃에서 48시간 동안 배양하였다. 5' FOA 배지에서 자란 균주들은 YPD 플레이트와 UD 플레이트에 피킹(picking)하여 YPD 플레이트에서 자란 균주들을 선별하였고, 다시 표 2의 프라이머들을 이용하여 PCR 과정을 통해 ura3 유전자가 제거되었는지 여부를 확인하였다. Ura3가 제거된 균주들은 다른 유전자의 낙-아웃을 진행하였다.
실시예 4. 재조합 미생물 균주의 배양
배양 테스트할 균주를 전날 2 ㎖ YPD 배지(Bacto Laboratories, Yeast extract 10g/L, peptone 20g/L, glucose 20g/L)에 접종하여 30℃, 200rpm에서 하루 동안 키웠다. 24-웰 플레이트에 표 7에 기재된 조성을 갖는 성장기 배지(pH 6.0) 2 ㎖을 넣고, 전배양한 배양액 1%를 접종한 후, 플레이트 교반기에서 30℃, 450 rpm으로 하루 동안 배양하였다. 하루 배양한 균주들을 표 8에 기재된 전환기 배지(pH 7.6) 900 ㎕가 분주된 새로운 플레이트에 900 ㎕씩 접종하면서 기질 200 ㎕를 함께 첨가하였고, 30℃, 450 rpm으로 하루 동안 배양하였다. 이때, 기질로는 DMSO에 용해된 도데칸 10 g/L를 사용하였다.
성장기 배지 pH 6.0
성분 농도(g/L)
글루코오스 50
YNB w/o 아미노산 6.7
효모 추출물 10
(NH4)2SO4 5
우라실 0.05
0.1M 포스페이트 버퍼
25℃에서 0.1M 칼륨 포스페이트 버퍼의 제조
pH 1M K2HPO4의 부피(㎖) 1M KH2PO4의 부피(㎖)
6.0 13.2 86.8
전환기 배지 pH 7.6
성분 농도(g/L)
글루코오스 30
YNB w/o 아미노산 6.7
효모 추출물 3
(NH4)2SO4 15
우라실 0.05
L-알라닌 10
0.1M 포스페이트 버퍼
25℃에서 0.1M 칼륨 포스페이트 버퍼의 제조
pH 1M K2HPO4의 부피(㎖) 1M KH2PO4의 부피(㎖)
7.6 86.6 13.4
그 결과, β-산화 대사 관련 유전자만 낙-아웃된 Y1-11 균주의 경우 기질인 도데칸으로부터 1,12-디아미노도데칸을 생산할 수 없었지만, 지방 알데히드 디하이드로게나아제 유전자가 추가로 낙-아웃되고 ω-트랜스아미나아제가 도입된 Y2-20, Y-2-25, Y2-30, Y2-35, Y2-36 및 Y3-1 균주는 모두 뛰어난 1,12-디아미노도데칸 합성 능력을 보여주었다(도 7). 또한, 상기 Y2-36 균주는 플라스크에서 배양시에 12 ㎎/L 정도의 1,12-디아미노도데칸 합성 능력을 보여주었다(도 8). 이하의 실험에서는 Y2-36 균주를 이용한 시료 분석 실험을 수행하였다.
실시예 5. 시료의 분석
실시예 4에서 1,12-디아미노도데칸 합성 능력이 가장 뛰어난 것으로 나타난 Y2-36 균주의 배양액 1000 ㎕에 6N 황산 300 ㎕를 넣고 볼텍싱(vortexing)한 후, 12,000rpm에서 2분 동안 원심분리하였다. 이후 상등액 600 ㎕에 10N 수산화나트륨 200 ㎕ 및 디에틸 에테르 200 ㎕를 넣고 충분히 볼텍싱한 후 12,000rpm에서 2분 동안 원심분리한 후, 용매층만 분리하여 하기의 분석 조건에서 GC/MS 분석을 수행하였다.
분석 조건
① 기기: Agilent 5975 MSD
② 컬럼: HP-5MS
③ 온도: 오븐(150℃ 내지 230℃)
④ 캐리어 가스: He
⑤ 유속: 1 ㎖/분
그 결과, 본 발명의 재조합 Y2-36 균주는 기질인 도데칸으로부터 1,12-디아미노도데칸을 합성할 수 있음을 확인하였다(도 9).

Claims (18)

  1. (1) ω-산화 대사 경로 중의 지방 알데히드 디하이드로게나아제 유전자 및 β-산화 대사 경로 관련 유전자가 제거되고, 또한 ω-트랜스아미나아제 유전자가 도입된 재조합 미생물을 제조하는 단계; 및
    (2) 상기 재조합 미생물에 기질을 처리하여 배양하는 단계를 포함하는 중쇄 디아민의 생산 방법.
  2. 청구항 1에 있어서,
    상기 지방 알데히드 디하이드로게나아제 및 β-산화 대사 경로 관련 유전자는 미생물 내에 존재하는 모든 상동형 유전자가 제거된 중쇄 디아민의 생산 방법.
  3. 청구항 1에 있어서,
    상기 지방 알데히드 디하이드로게나아제 및 β-산화 대사 경로 관련 유전자는 해당 미생물 내에 존재하는 일부 상동형 유전자가 제거된 중쇄 디아민의 생산 방법.
  4. 청구항 1에 있어서,
    상기 지방 알데히드 디하이드로게나아제 유전자는 FALDH1, FALDH2, FALDH3 및 FALDH4 유전자로 이루어진 군으로부터 선택되는 중쇄 디아민의 생산 방법.
  5. 청구항 4에 있어서,
    상기 FALDH1, FALDH2, FALDH3 및 FALDH4 유전자는 각각 서열번호 1 및 서열번호 4로 이루어지는 염기서열을 포함하는 중쇄 디아민의 생산 방법.
  6. 청구항 1에 있어서,
    상기 β-산화 대사 경로 관련 유전자는 아실-CoA 옥시다아제 유전자인 중쇄 디아민의 생산 방법.
  7. 청구항 6에 있어서,
    상기 아실-CoA 옥시다아제 유전자는 ACO1, ACO2, ACO3, ACO4, ACO5 및 ACO6 유전자로 이루어진 군으로부터 선택되는 중쇄 디아민의 생산 방법.
  8. 청구항 7에 있어서,
    상기 ACO1, ACO2, ACO3, ACO4, ACO5 및 ACO6 유전자는 각각 서열번호 5 및 서열번호 10으로 이루어지는 염기서열을 포함하는 중쇄 디아민의 생산 방법.
  9. 청구항 1에 있어서,
    상기 ω-트랜스아미나아제 유전자는 서열번호 11로 이루어지는 염기서열을 포함하는 중쇄 디아민의 생산 방법.
  10. 청구항 1에 있어서,
    상기 미생물은 효모 또는 대장균인 중쇄 디아민의 생산 방법.
  11. 청구항 10에 있어서,
    상기 효모는 야로위아 속, 사카로마이세스 속, 피키아 속 및 캔디다 속으로 이루어진 군으로부터 선택되는 효모인 중쇄 디아민의 생산 방법.
  12. 청구항 11에 있어서,
    상기 야로위아 속의 효모는 야로위아 리폴리티카인 중쇄 디아민의 생산 방법.
  13. 청구항 1에 있어서,
    상기 기질은 지방산 유래의 알코올 및 알칸으로 이루어지는 군으로부터 선택되는 중쇄 디아민의 생산 방법.
  14. 청구항 13에 있어서,
    상기 지방산 유래의 알코올은 탄소수 5 내지 30을 갖는 알코올인 중쇄 디아민의 생산 방법.
  15. 청구항 13에 있어서,
    상기 알칸은 탄소수 5 내지 30을 갖는 알칸인 중쇄 디아민의 생산 방법.
  16. 청구항 15에 있어서,
    상기 알칸은 도데칸인 중쇄 디아민의 생산 방법.
  17. 청구항 1에 있어서,
    상기 중쇄 디아민은 탄소수 5 내지 30을 갖는 디아민 화합물인 중쇄 디아민의 생산 방법.
  18. 청구항 17에 있어서,
    상기 중쇄 디아민은 1,12-디아미노도데칸인 중쇄 디아민의 생산 방법.
PCT/KR2016/012174 2015-10-27 2016-10-27 중쇄 디아민의 생산 방법 WO2017074065A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP16860248.0A EP3378941B1 (en) 2015-10-27 2016-10-27 Method for producing heavy chain diamine
US15/771,830 US11162121B2 (en) 2015-10-27 2016-10-27 Method for producing medium chain diamine

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2015-0149252 2015-10-27
KR20150149252 2015-10-27
KR10-2016-0141018 2016-10-27
KR1020160141018A KR101903552B1 (ko) 2015-10-27 2016-10-27 중쇄 디아민의 생산 방법

Publications (1)

Publication Number Publication Date
WO2017074065A1 true WO2017074065A1 (ko) 2017-05-04

Family

ID=58631829

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/012174 WO2017074065A1 (ko) 2015-10-27 2016-10-27 중쇄 디아민의 생산 방법

Country Status (1)

Country Link
WO (1) WO2017074065A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009096796A (ja) * 2007-05-29 2009-05-07 Mitsubishi Chemicals Corp ペンタメチレンジアミンの製造方法
KR101145405B1 (ko) * 2008-12-03 2012-05-16 한국생명공학연구원 글리세롤 산화경로가 차단된 １、３―프로판디올 생산 변이체
US8530206B2 (en) * 2008-05-21 2013-09-10 Ecover Coordination Center N.V. Method for the production of medium-chain sophorolipids
US9012227B2 (en) * 2007-12-17 2015-04-21 Evonik Degussa Gmbh ω-Aminocarboxylic acids, ω-aminocarboxylic acid esters, or recombinant cells which produce lactams thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009096796A (ja) * 2007-05-29 2009-05-07 Mitsubishi Chemicals Corp ペンタメチレンジアミンの製造方法
US9012227B2 (en) * 2007-12-17 2015-04-21 Evonik Degussa Gmbh ω-Aminocarboxylic acids, ω-aminocarboxylic acid esters, or recombinant cells which produce lactams thereof
US8530206B2 (en) * 2008-05-21 2013-09-10 Ecover Coordination Center N.V. Method for the production of medium-chain sophorolipids
KR101145405B1 (ko) * 2008-12-03 2012-05-16 한국생명공학연구원 글리세롤 산화경로가 차단된 １、３―프로판디올 생산 변이체

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
RUTTER ET AL.: "Engineering Yarrowia Lipolytica for Production of Medium-chain Fatty Acids", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 99, 1 July 2015 (2015-07-01), pages 7359 - 7368, XP002766854 *

Similar Documents

Publication Publication Date Title
US8158391B2 (en) Production of an α-carboxyl-ω-hydroxy fatty acid using a genetically modified Candida strain
WO2019203436A1 (ko) 에탄올 생산 경로가 억제된 내산성 효모 및 이를 이용한 젖산의 제조방법
Wang et al. Recent progress in adaptive laboratory evolution of industrial microorganisms
JP7164112B2 (ja) 重鎖アミノカルボン酸の生産方法
CN1209464C (zh) 多脱氧核苷酸的合成方法
CN113652383B (zh) 一种高产d-泛酸的基因工程菌及其应用
WO2017074065A1 (ko) 중쇄 디아민의 생산 방법
US20230084966A1 (en) Cofactor self-sufficient escherichia coli and construction method and application thereof
WO2017074063A1 (ko) 중쇄 아미노카르복시산의 생산 방법
CN110499274A (zh) 一种基因工程红球菌及其构建方法与应用
US11162121B2 (en) Method for producing medium chain diamine
WO2017074061A1 (ko) 중쇄 디올의 생산 방법
WO2016032158A1 (ko) L-라이신 생산능을 갖는 코리네박테리움 미생물 및 이를 이용한 l-라이신 생산 방법
US20200131538A1 (en) Microorganism with stabilized copy number of functional dna sequence and associated methods
WO2020116941A2 (ko) 디카르복시산 생산을 위한 미생물 및 이를 이용한 디카르복시산 생산방법
WO2019233853A1 (en) Microorganisms and the production of fine chemicals
US11248244B2 (en) Schizochytrium limacinum strain, building method therefor and application thereof
WO2018056794A1 (ko) 아세트산을 유일 탄소원으로 이용할 수 있는 미생물
CA2386255A1 (en) Transformants producing secondary metabolites modified with functional groups, and novel biosynthesis genes
CN112342248A (zh) 一种基因敲除改变体外蛋白合成能力的方法及其应用
CN113174356B (zh) 一种生产苏氨酸的重组细菌及其应用
US20180340195A1 (en) Method for producing heavy chain diol
CN114958636B (zh) 一株高产石榴酸的重组解脂耶氏酵母菌及其构建方法和应用
CN116254242B (zh) 一种atp磷酸核苷转移酶突变体及产l-组氨酸的谷氨酸棒杆菌
WO2020116932A2 (ko) 디카르복시산 생합성 관련 효소 및 이를 이용한 디카르복시산 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16860248

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2016860248

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 15771830

Country of ref document: US