WO2017052232A1 - 밀베마이신을 생산하는 재조합 미생물 및 이를 이용한 밀베마이신 생산 - Google Patents
밀베마이신을 생산하는 재조합 미생물 및 이를 이용한 밀베마이신 생산 Download PDFInfo
- Publication number
- WO2017052232A1 WO2017052232A1 PCT/KR2016/010594 KR2016010594W WO2017052232A1 WO 2017052232 A1 WO2017052232 A1 WO 2017052232A1 KR 2016010594 W KR2016010594 W KR 2016010594W WO 2017052232 A1 WO2017052232 A1 WO 2017052232A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- strain
- domain
- streptomyces
- mila3
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/16—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing two or more hetero rings
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/16—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing two or more hetero rings
- C12P17/162—Heterorings having oxygen atoms as the only ring heteroatoms, e.g. Lasalocid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/465—Streptomyces
Definitions
- strain of Avermitilis (Strept ⁇ c avm Y fc) and a method for producing milbamycin using the same.
- Milbemycin is a genus of Streptomyces hygroscopicus hygroscopicus subsp. aureolacrimosus;
- Streptomyces also referred to as Mai milbe shinny kusu (Streptowyc Aw _y e 'ci «) (NRRL5739 or 4191 1 DSM)), Streptomyces cyano neo draw three mouse subgenus
- Noncyanoge ⁇ (Streptomyces cyaneogriseus subsp. Noncyanogenus), Stemtomyces + 3 ⁇ 4-3 ⁇ 4] ⁇
- i ⁇ (Streptomyces nanchangensis) or Straptomys
- milbe Abamectin (milbemectin) of milbe azithromycin is a structure as shown below, the milbe erythromycin A 3 and A 4 milbe azithromycin is in the form that is heunhap to about 30: 70 ratio.
- Milbemycin is a chemical derivative of Milbemectin.
- Lepimectin is used as a pesticide, and as an animal medicine
- Moxidectin a chemical derivative of Milbemycin Oxime and Nematectin, is commercially available.
- Avermectin is classified as a mectin killer like Milvemycin and is a polyketide-based 16-membered ring macrolide compound produced from Streptomyces avermitilis (5Vreptom_yce; fmv Y / fe). .
- a mixture of Avemectin B la and Avemectin B ib is used as an insecticide for Aungectin as Abamectin
- Emamectin benzoate a chemical derivative of Avemectin, is used as an insecticide component for moths.
- As an animal drug evermectin, doramectin, selamectin, eprinomectin, and the like, which are chemical and biological derivatives of suedectin, have been commercialized.
- Randomization, transposon mutations, etc. are used to improve Avemectin productivity of Streptomyces avermitilis.
- Streptomyces avermitilis has been found to be able to produce a substance by effectively expressing the foreign substance synthesis gene, and is developing as a more effective expression strain through genome engineering [Ikeda et al. 2014].
- millectin large-scale commercial production is currently being carried out, and it is considered that millectin producing strain Streptomyces avermitilis is more advantageous as an industrial strain.
- Milbemycin production is carried out by culturing bacteria belonging to the genus Streptomyces, separating the cells from the culture medium, extracting the produced milbamycin from the cells with an organic solvent, and then purifying the substance containing the target compound obtained. have. Looking at the technology related to the production of conventional milbamycin, Streptomyces Streptomyces Streptomyces in the 1980s at Sankyo, Japan After discovering the production of milbamycin, a random mutation development technique was used to begin production of milbamycin at the commercial level.
- Non-Patent Document 0001 Ikeda et al, J. Bacteriol , 1 75 (7): 20 77 -2078 (199 3 , April)
- Non-Patent Document 0003 Gao et al., Bioresource Technology, 100: 4012-4016 (2009
- Non-Patent Document 0004 Gaol et al, Appl. Environ.Microbiol, 76 (13): 4583-4586
- Non-Patent Document 0005 Gao2 et al., Appl. Microbiol. Biotechnol., 85 (4): 1219-1225 (January 2010)
- Non-Patent Document 0006 Wang et al., J. Appl. Microbiol., 108 (3): 851-858, March 2010
- Non-Patent Document 000 7 Duong et al., J. Microbiol. Biotechnol. , 19 (2): 136-139
- Non-Patent Document 0008 Li et al., Bioresour. Technol., 101 (23): 9228-9235 (2010)
- Non-Patent Document 0009 Zhou et al., Proc. Natl. Acad. Sci. (107 (25): 11250-11254 (June 2010))
- Non-Patent Document 0010 Qiu et al., Appl. Microbiol. Biotechnol., 92 (2): 337-345
- Non-Patent Document 0011 He et al, Appl. Microbiol. Biotechnol., 98 (l): 399-409
- Non-Patent Document 0012 Liu et al., Appl. Environ.Microbiol., 81 (15): 5157-5173
- Non-Patent Document 0013 Wang et al., Bioorg. Med. Chem. Lett., 21 (1 1): 3320-3333 (June 2011)
- Non-Patent Document 0014 Ikeda et al, J. Ind. Microbiol. Biotechnol., 41: 233-250
- Non-Patent Document 0015 Wang et al., The Journal of Antibiotics, 62: 309-313 (2009
- Non-Patent Document 0016 Zhang et al, Appl Microbiol Biotechnol., 97 (23): 10091-10101 (December 2013)
- Non-Patent Document 00 Okada and Iwamatu., J Chem Technol Biotechnol 70 (2): 179- 187 (October 1997)
- Non-Patent Document 00128 Ide et al., Annu. Rep. Sankyo Res. Lab. 45: 1-98 (1993)
- the present invention relates to a recombinant microorganism having high productivity enough to be used as an industrial production strain of milbamycin and a method of producing milbamycin using the same.
- One example provides a recombinant microorganism that produces high yields of milbamycin by replacing a portion of the abemectin gene with a milbemycin producing gene in a high productive strain of manctin.
- Another example provides a recombinant vector that can be used for the production of recombinant microorganisms that produce a high production of milbamycin, including a milbamycin production gene.
- Another example provides a method for producing milbamycin using the recombinant microorganism.
- Another example provides a recombinant Streptomyces avermitilis strain that produces michectin derivatives by substituting a portion of the abemectin producing gene with a millvemycin producing gene in a high productive strain of abemectin.
- Another example provides novel crampectin derivatives or salts thereof.
- Another example provides pesticides and / or animal pharmaceutical compositions comprising the novel michectin derivatives or salts thereof.
- the module and domain of the polyketide synthase which are very similar in molecular structure and produce them, such as avermectin and milbemicin.
- the conversion provides a technique for producing high productivity milbamycin producing strains (see FIGS. 18A-18D).
- the present invention relates to a recombinant microorganism obtained by substituting a part of the abemectin gene with a milbamycin producing gene in a high-productive strain of abemectin.
- the recombinant microorganism may be characterized as having a high efficiency for producing Milbemycin.
- Figure 18a-18c is a diagram showing the molecular structure of abemectin and milbamycin and the configuration of the gene causing it
- Figure 18d is a gene cluster and Worcesterectin polyketide synthase milbamycin polyketide synthase The figure shows a comparison of gene groups. 18A-18D, each circle represents a domain, and each
- Proteins encoded from domains each have the following activity (AT:
- KS keto-acyl group synthase
- KR keto-acyl reductase
- DH dehydratase
- ER enoyl reductase
- ACP Acyl Carrier Protein
- TE TE
- Each synthetase consists of mothers, each parent consists of domains, a family of synthetase genes consists of modular coding genes, and each mother coding gene consists of each domain coding gene.
- Each domain within each module may be arranged in order starting from the KS domain and ending with the ACP domain [eg, from ⁇ -terminal to C-terminal direction, (KS)-(AT)-(DH and / or KR; in any order)-(ACP) order, (KS)-(AT)-(DH)-(ER)-(KR)-(ACP) order for module 7 of milA3].
- the KR domain of Mode 10 of Milbemycin and Avemectin Polyketide Synthetase is not involved in polyketide synthesis, and the KR domain and Avemectin of Milbemycin polyketide synthase Mode 11
- the DH domain of polyketide synthase Mode 7 is inactive.
- Differences in the synthesis of the two compounds are due to the following: 1) AT-specific substrate loading of polyketide synthase loading acetyl-CoA and acetyl-CoA Propionyl-CoA is used as the main substrate, and isobutyryl-CoA and 2-methylbutanoyl-CoA are used as the main substrates for the loading of suedectin synthase.
- the length of the carbon chain linked to 25 varies.
- the carbon bond of the carbon positions 22-23 of the two compounds is determined by the domain configuration of Mode 2 of each synthetase, and double bond or — OH for simplifyectin polyketide synthase Mod 2 with DH-KR domain While generating a bond, milbamycin polyketide synthase mod 2 with DH-ER-KR domain produces a single bond.
- aveA3 and milA3 may depend on the inclusion of module 7 DH (dehydratase) and ER (Enoyl reductase) active domains.
- Parents of aveA3 have a DH domain but are inactive, whereas milA3 contains domains with DH and ER activity in mode 7.
- mod 8 and mod 9 of aveA3 have the same or similar functions as mod 8 and mod 9 of milA3. Therefore, considering the functional aspects, at least a mimemycin-producing activity of the abemectin-producing strain is substituted by replacing the DH domain coding gene in the Mode 7 coding gene of ave A3 with the DH-ER domain coding gene in the Mode 7 coding gene of milA3. You can give it. Randomly,
- Gene 1 of the polyketide synthase gene family that performs millectin biosynthesis (aveAl; e.g., the aveAl gene of Streptow® ye tn Y / fc MA-4680 (1st to 12019th of GeneBank Accession number AB032367.1)
- Polynucleotides Gene # 1 (milAl) of the polyketide synthase gene family where the site (DNA sequence: SEQ ID NO: 66; amino acid sequence (BAA84474.1): SEQ ID NO: 67)) performs milbemicin biosynthesis of a milbamycin-producing strain Substituted with
- gene 3 (aveA3) of the polyketide synthetase gene family that performs millectin biosynthesis
- gene 3 (milA3) of the polyketide synthetase gene family that performs Milsemamycin biosynthesis in Milbemycin producing strains Substituted with all or part of
- a part of aveA3 is replaced with a part of milA3, such as aveA3 (eg,
- Sireptomyces avermitilis M ⁇ -46 At least all of the 7 genes of aveA3 genes 3 or 3 of the polyketide synthase gene family in which all or part of the coding genes (including at least the DH domain coding genes) perform milbamycin biosynthesis in milbamycin-producing strains It may mean that all or part of all 7 coding genes of the burn gene (milA3) are substituted with at least a dehydratase (DH) domain coding gene and an ER (enoyl reductase) coding gene.
- DH dehydratase
- ER enoyl reductase
- the aveA3 may be a gene of GeneBank Accession number AB032367.1.
- All or a portion of a coding gene of the 1841 th region (including at least the DH (dehydratase) domain (including the coding genes of the 976 th to 1 M8 th region of BAA84478.1 (SEQ ID NO: 72))) have.
- Each module, domain, and coding gene thereof of the aveA3 gene can be found on the website
- the recombinant Streptomyces avermitilis strain is a strain of milbamycin . It may have a high efficiency production activity. Of domains, modules, and / or proteins on polyketide synthase
- polyketide synthetase including a complex enzyme including a dehydratase, an enoylreductase (ER) domain, a ketoductase (K) domain, an acyl carrier protein (ACP) domain, and the like.
- ER enoylreductase
- K ketoductase
- ACP acyl carrier protein
- a portion of the aveA3 gene that is substituted with a portion of the milA3 gene may comprise at least all or part of the genes (including at least the DH domain) of genes 7, and a portion of the milA3 gene that replaces it is at least all or part of the genes 7 Coding genes (including at least the DH domain and ER domain).
- KS of mode 7 KS7
- AT7 AT7
- / or gene substitution may occur such that the coding gene sites of the ACP domain (ACP9) of Mode 9 are conserved into the coding gene sites of the domain of Worcesterectin polyketide synthase (aveA3 gene).
- the at least Mor 7 coding gene of the aveA3 gene or the dehydratase (DH) domain coding gene of mod 7 is a dehydratase (DH) domain of the milA3 gene of the milA3 gene or a dehydratase domain of mod 7 and an enoyl reductase (ER) Substituted with a domain coding gene; or
- substitution (b) In addition to the substitution (a) above, it may be a substitution further comprising: (i) one or more coding genes (eg, KS) of the remaining domains except the DH domain coding gene in all 7 coding genes of the aveA3 gene Domain coding gene, AT domain coding gene, KR domain coding gene and ACP domain coding One or more coding genes (eg, KS domain coding genes, AT domain coding genes) in all 7 coding genes of the milA3 gene of the milA3 gene of the Milbemycin producing strain of the group consisting of , One or more selected from the group consisting of KR domain coding gene and ACP domain coding gene);
- coding genes eg, KS
- strains in which all of the aveAl gene is substituted with all of the milAl gene and / or all or part of the aveA3 gene is substituted with all or part of the milA3 gene may be upstream and / or downstream of the gene replacement site of the aveAl and / or aveA3 gene.
- the region having homology with the region may be included in a form linked to either or both ends of all or part of the substituted (introduced) milAl gene and / or milA3 gene. Introduction of sites having such homology may be advantageous in homologous recombination.
- the homology refers to having at least 90%, at least 95%, or at least 98% identity with the original gene sequence.
- the term "Docking region” as used above is a region encoded by both ends of the gene encoding the polyketide synthase, and smoothes protein-protein interaction with the next stage synthetase during polyketide synthesis. It is possible to specify a range of conventional homology sequencing.
- the milbamycin-producing strain is Streptomyces milbemycinicus (milAl gene: SEQ ID NO: 70; milA3 gene: SEQ ID NO: 73; milA3 protein: SEQ ID NO: 74 (BAA84478.1) (Module 7: from 34th) 2139 th polypeptide; Module 8: 2163 thru 3927 th polypeptide; Module 9:
- DH-ER domain in module 7 From 953 Polypeptide from 1775 (DH domain in module 7: polypeptides from 953 to 1 129; ER domain in module 7: polypeptide from 1497 to 1775))); Nose (trept ⁇ c ⁇
- milAl gene Moilingmycin is similar in structure to milbemycin and has the same function, so meiAl and milAlol have the same meaning in this specification
- SEQ ID NO: 69 milA3 gene (herein, meiA3 and mil A3 are used interchangeably): SEQ ID NO: 75 (GenBank: FJ952082 Sequence region 78606 thru 96074 th)
- milA3 protein SEQ ID NO: 76 (Module ⁇ polypeptides 39 th to 2143; Module 8: polypeptides 2166 thru 3931; Module 9:
- ADI03854 Module 7: 35 :: 2150, Module 8: 2173 :: 3938, Module 9: 3990 :: 5738, DH -ER didomain in module 7: 950:: 1772 (DH domain: 950:: 1 126; ER domain: 1494:: 1772))).
- the recombinant strain may produce one or more Milbemycins selected from the group consisting of Milbemycin A3, Milbemycin A4, Milbemycin a2, Milbemycin (x4 and Milbemycin G).
- the recombinant strain may be Streptomyces avermitilis DBM-03-A strain (Accession No. KCTC 12890BP).
- the recombinant strain may be Streptomyces avermitilis DBM-03-B strain (Accession No. KCTC12891BP).
- a recombinant vector comprising all or a portion of the polyketide synthase genes milAl and milA3 (including at least module 7 coding gene or DH-ER domain coding gene of Mode 7) that performs the milbemicin biosynthesis described above
- Recombinant microorganisms comprising introducing into an appropriate host cell (eg, manifenomyces avermitilis)
- Streptomyces avermitilis strain is provided.
- Recombinant microorganisms prepared as described above are characterized by a marked increase in the production efficiency of milbamycin compared to microorganisms in which the recombinant vector is not introduced.
- all or part of the polyketide synthase genes aveAl and aveA3 (at least module 7 coding gene or module 7 DH domain coding) of the host cell e.g., an istectin producing strain such as Streptomyces avermitilis
- Substitutions may occur with all or a portion of the milAl and milA3 (including at least the Mod 7 coding gene or the DH-ER domain coding gene of Mod 7).
- a recombinant vector comprising all or a portion of milAl and milA3 (including at least all 7 coding genes or DH-ER domain coding genes of all 7) is introduced, with the activity of aveAl and aveA3 removed. Milbemycin production effect can be obtained.
- the recombinant microorganism ie, the recombinant
- composition for producing milbamycin comprising the recombinant vector) or the Streptomyces avermitilis strain.
- a method for producing milbamycin using the recombinant microorganism is provided.
- the present invention provides a method of culturing said recombinant Streptomyces avermitilis strain, and from said cultured strain or culture of said strain.
- the present invention relates to a method for producing Milbemycin, comprising the step of obtaining Milbemycin.
- the present invention is Streptomyces
- Avermi The first gene (aveAl) of polyketide synthase, which performstschectin biosynthesis in
- the recombinant Streptomyces avermitilis strain may be a Streptomyces avermitilis DBM-01 strain (Accession No. KCTC 12889BP).
- the invention relates to an istectin derivative or salt thereof, selected from: 5-methoxy-22,23-dihydro-25-methyl-avemectin (5-methoxy- 22,23 -dihydro-25-methyl-avermectin) or salts thereof, and 5-methoxy-22,23-dihydro-25-ethyl-avemectin (5-methoxy-22,23-dihydiO-25-ethyl-avermectin) or Salts thereof.
- the present invention relates to the use of the mandusectin derivative or salt thereof as a crop protection agent and / or as an animal medicine.
- Streptomyces avermitilis is a strain that producesmatiectin, such as m / to SA-01 strain, & m v Y fc MA-4680 strain (NCBI accession number:
- the Streptomyces avermitilis is a polyketide synthase gene cluster for producing mangoine.
- the mantin PKS gene group includes aveAl, aveA2, aveA3 and aveA4 genes, wherein the aveAl gene is a loading module, a mod 1 and a mod 2, the aveA2 gene is a mod 3 to a mod 6, aveA3 is a mod 7 To Mode 9, the aveA4 gene comprises Modules 10 to 12, each of which consists of subdomains.
- Milbemycin producing strains include Streptomyces milbemycinicus, Streptomyces cyneogriseus subgenus Non ⁇ 1 to cyano ⁇ (Streptomyces cyaneogriseus sp. Noncyanogenus) , sat strap My process I chanjen sheath (Streptom ⁇ yces "ic wwgem y ) or Streptomyces
- Milbemycin producing strains include the PKS cluster gene family for producing Milbemycin.
- the composition of the Milbemycin PKS gene group is similar to that of the Abemectin PKS gene group, and includes the milAl, milA2, milA3 and milA4 genes, and each gene is composed of mother and subdomains.
- the present invention relates to the milAl gene of the aveAl yu ⁇ ja of Streptomyces avermitilis, an avemectin-producing strain, and a milbamycin-producing strain.
- the istectin derivative produced by the recombinant Streptomyces avermitilis strain is 22,23-dihydro-25-isopropyl-avemectin (22,23-dihydro-25-isopropyl- avermectin), 5-methoxy -22,23-dihydro-25-methyl-avemectin (5-methoxy-22,23-dihyclro-25-methyl-avermectin), 5-methoxy-22,23-dihydro-25-ethyl-avemectin (5-methoxy-22,23-dihydro-25-ethyl-avermectin) and 5-methoxy-22,23-dihydro-25-isopropyl-avemectin (5-methoxy-22,23-dihydro-25-ethyl-avermectin) isopiOpyl-avermectin) and one or more selected from the group consist
- Streptomyces avermitilis Recombinant Streptomyces producing creamyectin derivatives wherein the aveAl gene is substituted for all or part of the milAl gene of a Milbemycin producing strain
- Avermitilis strains are provided.
- 5-methoxy-22,23-dihydro-25-methyl-avemectin or salt thereof 5-methoxy-22,23 5-methoxy-22,23-dihydro-25-ethyl-avermectin or salts thereof, and the use of these compounds as crop protection agents and / or animal medicines are provided.
- the 5-methoxy-22,23-dihydro-25-methyl-avemectin is represented by the following formula
- 5-methoxy-22,23-dihydro-25-ethyl-avemectin may be represented by the following formula:
- all or part of the aveAl gene of Streptomyces avermitilis is replaced with all or part of the milAl gene of the Milvemycin producing strain, and all or part of the aveA3 gene (at least all of aveA3 Recombinant Streptomyces producing Milbemycin, wherein the DH domain coding gene of 7 is replaced with all or a portion of the milA3 gene of the Milbemycin producing strain (including at least the DH-ER domain coding gene of Mod 7 of milA3) Avermitilis strains are provided.
- the aveA3 gene may be substituted with the milA3 gene as a whole, but it is possible to replace (insert) only the minimum portion of the milA3 gene capable of imparting the ability to produce milbamycin to the host strain.
- the minimum portion of the milA3 gene capable of imparting the ability to produce milbamycin to the host strain may include all 7 of the milA3 genes or the coding gene of the DH-ER domain of all 7, and the aveA3 gene.
- the coding gene of all of 7 or at least a portion of mode 7 comprising at least the DH domain of mode 7 may be substituted with the coding gene of all of mode 7 or the DH-ER domain of mode 7 of the milA3 gene of the Milbemycin producing strain. .
- the strain in which the aveAl gene is substituted with the milAl gene of the Milbemycin producing strain in the Streptomyces avermitilis strain is Streptomyces avermitilis DBM- 01 strain (Accession No. KCTC12889BP).
- the aveAl gene is substituted with the milAl gene of the Milvemycin producing strain, and the coding gene region of Mod 7 of the aveA3 gene is the coding gene region of Mod 7 of the milA3 gene of the Milvemycin producing strain.
- the aveAl gene is substituted with the milA i gene of the Milbemycin producing strain, and the coding gene region of the domains of Mode 7 except for the KS domain of Mode 7 of the ave A3 gene produces Milbemycin.
- the strain substituted with the coding gene site of the domains of Mode 7 except for the KS domain of Mode 7 of the milA3 gene of the strain may be a Straintomyces Avermitilis DBM-03-B strain (Accession Number KCTC12891BP).
- the aveAl gene is substituted with the milA i gene of the Milvemycin producing strain, and the coding gene region of the domains of all 7 except for the KS domain and AT of module 7 of the ave A3 gene
- the coding gene region of the domains of all 9 except for the ACP domain of all 9 of the aveA3 gene is substituted with the coding gene region of the KS domain and the domains of all 7 except the AT domain of the milA3 gene of the milAmycin producing strain.
- Milvemycin Birth-Strains are provided that are substituted with coding gene sites of the domains of Mode 9 except for the ACP domain in Mode 9 of the tnilA3 gene.
- the strain comprises a region from the DH domain of mod 7 of aveA3 to the KR domain of mod 9 (the DH domain of mod 7 of aveA3, KR domain, and ACP domain, mod 8, KS domain of mod 9, AT domain, DH domain, And the coding gene region of the KR domain from the N-terminus to the C-terminus direction is a region of the region (Mod 7 of milA3) from the DH domain of module 7 of m ilA3 to the KR domain of mod 9 of the milbamycin producing strain.
- Coding of DH domain, ER domain, KR domain, and ACP domain, mode 8, mode 9, KS domain, AT domain, DH domain, ER domain, and KR domain in the N-terminal to C-terminal direction) May be substituted with a gene region, for example, Streptomyces abermitilis DBM-03-C strain (Accession No. KCTC13083BP).
- deposited strains are only representative embodiments of the present invention, and the scope of the present invention is not limited thereto.
- all or part of the milAi and / or milA3 genes isolated from the Milbemycin producing strain may be integrated into the host strain genome via homologous recombination.
- Gene replacement vectors can be prepared to make them.
- the vector is a vector capable of removing or inserting a desired gene into a specific gene position of a host genome, and may include a base sequence homologous to a specific gene region to be targeted for homologous recombination to occur.
- a recombinant vector used for the production of the Streptomyces avermitilis recombinant strain.
- the recombinant vector is
- milAl gene and milA3 may be included together in one vector or in separate vectors.
- the recombinant vector comprises a milAl gene of a milbamycin producing strain; And in addition to the milA3 gene of the Milbemycin producing strain or the coding gene of all or part of Mode 7 of milA3 of the Milbemycin producing strain, one or more selected from the group consisting of:
- One or more coding genes selected from domains (eg, KS, AT, KR, and ACP domains) other than the DH-ER domain of mode 7 of milA3 of a milbamycin producing strain;
- the recombinant vector is
- MilAl gene of milbamycin producing strain And a portion or variant thereof of the milA3 gene selected from:
- a portion of the milA3 gene comprising or consisting of coding genes of, for example, the AT domain, DH domain, ER domain, KR domain, and ACP domain of mode 7 of the milA3 gene, deleted of a gene region;
- a modal 7 coding gene variant of milA3 ' wherein the coding gene of the KS domain in module 7 of the milA3 gene of a milAmycin producing strain is substituted with the 3ding gene of the KS domain of mod 7 of the aveA3 gene;
- MilA3 which includes the coding gene region of the AT domain in mode 7 of the milA3 gene of a milAmycin producing strain, eg, KS domain, DH domain, ER domain, KR domain, and ACP domain of mode 7 of milA3 gene Modal 7 coding gene variants of;
- the coding gene region variant of Mode 7 of milA3 in which the coding gene of the KS domain and the AT domain of Mod 7 of the milA3 gene of the Milbemycin producing strain is substituted with the coding gene of the KS domain and the AT domain of Mode 7 of the aveA3 gene, respectively.
- the recombinant vector may further comprise one or more selected from the group consisting of:
- milbe azithromycin a gene encoding the ACP domain of modeul 9 milA 3 gene of the production strain with deletion, for example, modeul of milA3 gene 9 KS domain, the AT domain, modeul of milA3 comprising a gene encoding a DH domain, and a KR domain, 9 coding gene variant;
- the coding gene variant of mode 9 of milA3 in which the coding gene of the ACP domain in module 9 of the mi i A 3 gene of the milbamycin producing strain is substituted with the coding gene of the ACP domain of mode 9 of the aveA3 gene.
- the milA3 gene variant included in the recombinant vector is Regions from the DH domain of mode 7 to the KR domain of mode 9 in the milA 3 gene of the milAmycin producing strain (e.g., the DH domain, ER domain, KR domain, and ACP domain of mode 7 of mode 7 of milA3, mode 8, mode 9 MilA3 gene variant (part) comprising a coding gene of the KS domain, the AT domain, the DH domain, the ER domain, and the KR domain from the N-terminus to the C-terminal direction), but is not limited thereto.
- the DH domain of mode 7 to the KR domain of mode 9 in the milA 3 gene of the milAmycin producing strain e.g., the DH domain, ER domain, KR domain, and ACP domain of mode 7 of mode 7 of milA3, mode 8, mode 9 MilA3 gene variant (part) comprising a coding gene of the KS domain, the AT domain, the DH domain, the ER domain, and the KR domain from the
- the recombinant vector for substituting milAl includes the entire milAl gene, and a region having homology with the upstream and downstream regions of the aveAl gene for homologous recombination is connected to either or both ends of milAl. It may be configured in the form. Further, in another embodiment, the recombinant vector for substituting milA3 comprises all or part of the coding gene of model 7 of the milA3 gene and has a homology with the aveA3 and / or aveA4 gene region for homologous recombination. It may be configured in the form connected to either or both ends of all or part of the coding gene of the seventh model of the milA3 gene.
- the vector is merely an exemplary embodiment of the present application, but the scope of the present application is not limited thereto.
- the vector includes a region having homology with a host gene region for homologous recombination, wherein homology refers to a degree of identity with a nucleotide sequence of a host gene region, for example, 90 nucleotide sequence of the host gene. It may be the same at least%, at least 95% or at least 98%.
- Vectors have been developed for use in Streptomyces, such as phage high copy number plasmids, low copy number plasmids, and E. Coli-Streptomyces sher, These .
- Vectors can be used to implement the present invention.
- pCR-Blunt, pCR2.1 (Invitrogen), pGEM3Zf (Promega) and the sherbet vector pWHM3, pKCl 139 and the like can be illustrated, but is not limited thereto.
- the vector for the purpose of selecting transformed cells
- a selection marker for example markers that confer a selectable phenotype, such as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins, may be used, and positive Screening Markers and Negative Screening markers can be exemplified.
- Positive selection markers are markers that allow positive selection of cells that express selection markers in an environment in which a selective agent is treated, enabling apramycin, neomycin, hygromycin, and histidinol dehydro. Genease (histidinol dehydrogenase gene: hisD) or guanine
- Guanine phosphosribosyltransferase Gpt and the like, but are not limited thereto.
- Negative selection markers are markers that allow negative selection to select and remove cells that have undergone random insertion.
- Herpes simplex virus-thymidine kinase HSV-tk
- Hypoxanthine phosphoribosyl transferase Hprt
- cytosine deaminase diphtheria toxin, and the like, but are not limited thereto.
- Such vector fabrication can be made using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation are known in the art.
- Vectors of the invention act on Streptomyces cells, but can also be transformed into other bacteria or eukaryotic cells, for example for cloning or expression purposes.
- Escherichia coli strains such as the commercial DH5a strain, may be purchased from the American Type Culture Collection (ATCC).
- ATCC American Type Culture Collection
- Mammalian cells, insect cells or yeast cells can also be used effectively.
- the method of introducing the vector of the present invention into a host strain allows the nucleic acid to be introduced into cells
- any method of introduction is included and can be carried out by selecting a suitable standard technique as is known in the art.
- protoplast transformation, electroporation, electroinjection, microinjection, calcium phosphate co-precipitation, calcium chloride / rubidium chloride method, Retroviral infection, DEAE-dextran, cationic liposome method, polyethylene glycol-mediated uptake, gene gun, etc. may be used. It is not limited to this.
- the circular vector may be cut with an appropriate restriction enzyme and introduced into a linear vector form or a linear vector form in which the plasmid is removed.
- Transformants are screening markers, For example, it may be selected according to standard procedures such as the method of selecting a cell expressing antibiotic resistance associated with a recombinant vector as described above.
- Milbemycin may be produced by culturing the recombinant strain thus prepared, and for example, one or more species selected from the group consisting of Milbemycin A3, Milbemycin A4, Milbemycin ⁇ 2, Milbemycin ⁇ 4, and Milbemycin G It can produce mycin.
- Cultivation of the recombinant strains is necessary for growth of the strain and mass production of milbamycin.
- Conditions such as suitable dodoktok temperature, ⁇ and culture time of the medium can be appropriately adjusted.
- Examples of the culture method include, but are not limited to, batch, continuous and fed-batch cultures.
- the medium used for culturing must adequately meet the requirements of the particular strain.
- the medium may comprise various carbon sources, nitrogen sources, personnel and trace element components.
- the expression vector contains an inducible promoter, changes in silver, depletion of nutrients, inducible substances (eg, analogs of carbohydrates such as isopropyl- ⁇ -D-thiogalactopyranoside (IPTG)) Addition, excess .
- inducible substances eg, analogs of carbohydrates such as isopropyl- ⁇ -D-thiogalactopyranoside (IPTG)
- IPTG isopropyl- ⁇ -D-thiogalactopyranoside
- Appropriate induction conditions such as the accumulation of metabolic byproducts, can be applied as needed to induce expression.
- Carbon sources in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch and celrose, oils and fats such as soybean oil, sunflower oil, castor oil, cocobot oil, palmitic acid and stearic acid. Fatty acids such as linoleic acid, glycerol, alcohols such as ethane, and organic acids such as acetic acid, but are not limited thereto. These materials can be used individually or as a mixture.
- nitrogen sources in the medium may include peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. It is not limited to this.
- Nitrogen sources can also be used individually or as a mixture.
- the personnel in the medium may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a sodium-containing salt.
- the culture medium is necessary for growth
- the raw materials described above may be batchwise or in a manner appropriate to the culture during the culturing process. It can be added continuously.
- the pH of the culture can be adjusted by using a basic compound such as sodium hydroxide, potassium hydroxide, ammonia or an acid compound such as phosphoric acid or sulfuric acid in an appropriate manner.
- antifoaming agents such as fatty acid polyglycol esters can be used to inhibit bubble generation.
- Oxygen or an oxygen-containing gas eg, air
- the temperature of the culture can usually be 20 to 45, preferably 25 to 40. Incubation can continue until the desired yield of Milvemycin is achieved.
- Milbemycin produced from recombinant microorganisms can be isolated or substantially purified from cells, cell lysates or culture media by methods well known in the art. Examples of the method for recovering milbamycin include organic solvent extraction, centrifugation,
- Another example of the invention is the recombinant Streptomyces described above.
- the pest control comprehensively refers to the inhibitory effect of fleshing, repelling, etc. on the sea layer.
- the pest is an adult of all arthropods that endangers the animals and / or plants, Collectively the oil layer and eggs, the milbamycin or derivatives thereof, and / or Worcesterectin or derivatives thereof may be adults and / or larvae of all sea layers with control activity.
- the pest may be one or more selected from the group consisting of:
- Hemiptera eg including:
- Delphacidae such as Laodelphax striatellus, rice locust
- Leadoptera e.g., including: Pyralidae, such as Chilo suppressalis, Yellow Rice Root (Tryporyza incertulas), Cnaphalocrocis medinalis, Notarcha derogata) ), Pledia interpunctella, Light moth (Ostrinia furnacalis), European light moth (Ostrinia nubilaris), Chinese cabbage moth (Hellula undalis), Grass moth (Pediasia teterrellus), etc .;
- Pyralidae such as Chilo suppressalis, Yellow Rice Root (Tryporyza incertulas), Cnaphalocrocis medinalis, Notarcha derogata
- Pledia interpunctella Light moth (Ostrinia furnacalis), European light moth (Ostrinia nubilaris), Chinese cabbage moth (Hellula undalis), Grass moth (Pediasia
- Noctuidae for example, Spodoptera litura, Spodoptera exigua : Moth (Pseudaletia separata), Thief moth (Mamestra brassicae), Agrotis ipsilon, Currant Cabbage Butterfly (Plusia nigrisigna), Toricofluia spp., Heliothis spp., Tobacco moth (Helicoverpa spp.) And the like; White butterfly (Pieridae) such as Chinese cabbage butterfly (Pieris rapae); Tortricidae, such as Adoxophyes spp., Peach moth (Grapholita molesta), bean moth (Leguminivora glycinivorella), moth (Matsumuraeses azukivora),
- Carp moths (Carposinidae), such as, for example, carposina niponensis; Oyster moths (Lyonetiidae) such as Lyonetia spp.
- Lymantriidae such as, for example, Lymantria spp., Euproctis spp., And the like
- Yponomeutidae such as, for example, Plutella xylostella
- Gelechiidae such as Pectinophora gossypiella, Phthorimaea operculella, and the like
- Arctiidae such as the Hyphantria cunea, etc .
- Grained moths (Tineidae) such as Tinea translucens and the like
- Thysanoptera for example, including: Flower yellow
- Diptera eg, includes:
- Ogromyzidae such as, Capricorn. (Hylemya antiqua),
- Hyleya platura Rice Leaf Oyster (Agromyza oryzae), Rice Leaf Oyster (Hydrellia griseola), Rice Yellow Oyster Fly (Chlorops oryzae), American Leaf Oyster Fly (Liriomyza trifolii) and the like; Melon fly (Dacus cucurbitae), Mediterranean fruit fly (Ceratitis capitata, etc.);
- Grasshoppers such as Gryllotalpa africana, Oxya yezoensis, rice grasshopper (Oxyajaponica) and the like;
- Hymenoptera such as Athalia rosae, Scissors ants (Acromyrmex spp.), Fire ants (Solenopsis spp.) And the like;
- Phthiraptera such as, for example, Dalinia bovis, Haematopinus eurysternus. Linognathus vituli, Haematopinus suis and the like;
- Mites (eg, including:
- Tetranychidae such as Tetranychus urticae, Panonychus citri, Oligonychus spp. And the like; Eriophyidae, such as Aculops pelekassi; Tarsonemidae, such as
- Toe mites such as short comb toe mite (Cheyletus eruditus), toe mite (Cheyletus malaccensis), Cayletus moorei and the like;
- Nematodes for example, Bursaphelenchus xylophilus, Melodogyne spp., Aphelenchoides besseyi, Strawberry substratum
- the crop may be any plant that can be damaged by the sea layer.
- the step of applying to the crop can be carried out by all conventional methods such as dipping, spraying, application.
- Gene and amino acid sequences described herein are at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, 94 as long as they maintain functional equivalence. It may be interpreted to include cases having at least%, at least 96%, at least 98%, or at least 99% sequence homology. ⁇ Effects of the Invention ⁇
- Milbemycin can be produced in large quantities using the recombinant strain provided in the present invention, and the produced mibemycin can be widely used in agricultural and animal medicine fields.
- me _yd ' «NRRL5739) shows the composition of the milAl gene.
- Figure 2 is Streptomyces Milbemaicinius according to an embodiment (S.
- Figure 3 shows the nucleotide sequence constituting the pGEMB2-MA-DOWN-fu vector.
- 4A to 4C illustrate a process of manufacturing a pCR2.1-milAl-AC2 vector according to an embodiment.
- FIG. 5 illustrates a process of manufacturing a pCR2.1-Adu-MlAge vector according to an embodiment.
- FIG. 6 illustrates a process of manufacturing a P CR2.1-Adu-milAl-Ac2 vector according to an embodiment.
- Figure 7a is a schematic diagram showing the process of insertion of the milAl gene through the cross in the strain introduced milAl integration vector according to an embodiment.
- Figure 7b is a result confirming that milAl was successfully inserted in the strain introduced milAl integration vector according to an embodiment.
- Figure 8 shows the HPLC results of analyzing the material generated from the culture medium of S. avermitilis DBM-01 strain according to one embodiment.
- 9A and 9B illustrate a process of preparing pCR2.1-A3Mmo7A and pCR2.1-A3Mmo7B vectors according to one embodiment.
- Figure 10a is a schematic diagram showing the process of inserting the mod 7 gene through the cross in the strain introduced the mod 7 replacement vector according to an embodiment.
- FIG. 10B illustrates the result of confirming that the Mod 7 is successfully inserted in the strain in which the Mod 7 replacement vector is introduced according to an embodiment.
- FIG. 11A to 11C illustrate DBM-03-A and DBM-03-B generated according to an embodiment. HPLC analysis results are shown. The peak marked retention time among each formed peak shows the same UV-absorption pattern as Milbemycin standard.
- Figure 11a is the HPLC analysis of the Milbemycin standard
- Figure 11c is HPLC analysis of the material produced by S. avermitilis DBM-03-B Each result is shown.
- FIG. 12 shows HPLC results of analyzing the material generated from the culture solution of all 7 substituted strains according to one embodiment, and the material generated at each peak.
- Figure 13 shows the results of sequencing of the coding gene region of the region between the AT-DH mode between the aveA3 gene and the milA3 gene and the KR-ACP mode region.
- FIG. 14 schematically illustrates a process of constructing a pD7K9milA3 vector including a gene region encoding a region from the DH domain of Mode 7 of milA3 to the KR domain of Mode 9 according to an embodiment.
- FIG. 15 schematically shows the preparation of a Streptomyces abemitilis strain into which the milA3 insertion vector pD7K9milA3 is inserted, according to an embodiment.
- 16 is a graph showing the results of HPLC analysis of the product of S. avermitilis DBM-03-C strain prepared according to one embodiment.
- FIG. 17A to 17F are graphs showing the results of UPLC-qTOF-HR-MS analysis of the product of the S. avermitilis DBM-03-C strain prepared according to one embodiment (FIG. 17A: Milbemycin A3; FIG. 17B: Milbe) Mycin A4; FIG. 17C: Milbemycin D; FIG. 17D: Milbemycin alpha2; FIG. 17E: Milbemycin alpha4; FIG. 17F: Milbemycin G).
- Figure 18a-18c is a diagram showing the molecular structure of abemectin and milbamycin and the configuration of the gene causing it
- Figure 18d is a mibemycin polyketide synthase gene cluster (gene cluster) and Worcesterectin polyketide synthase The figure shows a comparison of gene groups.
- a vector for substitution was prepared.
- the vector includes the entire milAl gene, and the upstream and downstream regions of the aveAl gene having homology for integration were formed at both ends of milAl.
- the vector production process will be described in detail.
- Streptomyces milbemycinicus (S. milbemycinicus NRRL5739) genomic
- the milAl gene was obtained from the DNA. Streptomyces milbe Mai Yale kusu For (S. w / em_y 'a « NRRL5739) because milbe erythromycin biosynthetic gene does not have the nucleotide sequence of DNA is known and registered in the NCBI Streptomyces
- Nanzanzen ⁇ ] ⁇ (Streptomyces nanchangensis; Accession no.FJ952082) or
- a primer was designed and used to amplify the gene.
- the gene of the polyketide biosynthesis involved in milbamycin biosynthesis is very large and has a high GC ratio, it is very difficult to amplify it at one time so that the gene is amplified by dividing it into arbitrary two regions (FIG. 1). ).
- the genomic DNA of Streptomyces milbamycinicus (S. w / 1 ⁇ 2em_yd "/ « tf NRRL5739) was subjected to PCR using A1NT2-F primer (GAACCGTGTGCGGAAGAA: SEQ ID NO: 1) and A1CT1-R primer (ATCAGGTCGGTGAGACGGT: SEQ ID NO: 2).
- A1NT2-F primer GAACCGTGTGCGGAAGAA: 1 ⁇ 2em_yd "/ « tf NRRL5739
- A1CT1-R primer ATCAGGTCGGTGAGACGGT: SEQ ID NO: 5 minutes at 95 degrees; 30 seconds at 20 seconds at 98 degrees, 20 seconds at 60 degrees and 10 minutes at 68 degrees; and at 68 degrees
- Genomic DNA of NRRL5739 was prepared using A1CT1-F primer (GCAAGGTCGTCTTTGTGTGC: SEQ ID NO: 3) and A1 CT2-R primer (CCACCAACTCGATATGGGC: SEQ ID NO: 4).
- PCR2.1 vector (TA cloning) after amplification using PCR (5 minutes at 95 degrees; 20 seconds at 98 degrees; 20 seconds at 60 degrees and 30 cycles at 10 seconds at 68 degrees; and 10 minutes at 68 degrees). Vector).
- This vector was named pCR2.1-CT.
- the pCR-NM and pCR-CT vectors prepared above were treated with Ncol restriction enzymes respectively to obtain fragments (NM fragments, CT fragments) (FIG. 1), and one fragment was prepared by ligation of these fragments. It was named pCRl l-milAl (FIG. 2; including the milAl gene sequence (SEQ ID NO: 70)).
- FIG. 2 including the milAl gene sequence (SEQ ID NO: 70)
- a pCR2.1-CT vector was constructed in which the C-terminal region of milAl was replaced with the C-terminal region of aveAl by connecting to pCR2.1-CT cut with BamHI / Hindlll.
- A2-404F primer (GGCGCTGGCAATGGACC: SEQ ID NO: 5) and A 2 PH-1500R from genomic DNA of S. avermitilis SA- strain
- the pCR2.1-CT-Ac2 vector and the pCR2.1-NM vector were respectively treated with Ndel / Xbal restriction enzymes and bound to each other, and the pCR2.1- having the milAl gene whose C-terminal portion of the milAl gene was substituted with that of aveAl.
- a milAl-Ac2 vector was constructed (see FIGS. 4A-4C)-1-3. N-terminus side arm AveD2-F from genomic DNA of S. avermitilis SA-01 strain
- the pCR2.1-milAl-Ac2 vector and the pCR2.1-Adu-MlAge vector were treated with Xmnl restriction enzymes and then combined by infusion ligation to prepare the pCR2.1-Adu-milAl-Ac2 vector (SEQ ID NO: 79). (FIG. 6).
- the pKC1139 vector M.
- a milAl integration vector was introduced into the S. avertmilis SA-01 strain and homologous recombination occurred to obtain a strain in which the aveAl gene of the S. avertmilis SA-01 strain was substituted with the milAl gene, and was produced through culture.
- E. coli strain (ETl2567 / pUZ8002 strain) containing P KC-Adu-milAl-Ac2 vector was inoculated into 3 ml of LB broth containing chloramphenicol, kanamycin, and apramycin-i- and 18 in a shaking incubator at 37 and 200 rpm. Incubate for 24 hours ⁇ Put 25ml LB broth with the above antibiotics in a sterile 250ml flask, inoculate 250ul of culture Incubated for 3 hours under conditions. When the OD reached 0.4 to 0.5, the incubation was terminated and centrifuged at 5000 rpm for 5 minutes (4 conditions).
- Pellet was taken only, released in cooled LB broth lml and washed to obtain a cell suspension.
- incubate actinomycetes for use as a host on ISP4 agar plate for 7 days or more, scrape the Spore with a loop, release it in 2X TY medium, put it in a 50 heating block, and activate for 10 minutes.
- 500 ul E. coli strain prepared as described above
- the pKC-Adu-milAl-Ac2 vector was introduced into the S. avertmilis SA-01 strain.
- the first crossing was induced in the strain into which the pKC-Adu-milAl-Ac2 (Et) vector was introduced so that the entire vector was inserted into the chromosome of the strain.
- ISP-4 solid medium to which apramycin was added at a concentration of 25 ug / ml was prepared, and colonies produced by pKC-Adu-milAl-Ac2 vector were taken, followed by streaking on the prepared solid medium.
- the high temperature sensitive pKC1 139 vector was used to incubate at 37 to 7 days to prevent the cloning of the vector. 2-3. 2nd intersection
- a seed culture medium and a production culture medium for culturing S. avermidlis ⁇ -01 strain were prepared, respectively.
- a suitable amount of DW was mixed to a concentration of 30 g / L (Junsei, Japan), yeast extract 15 g / L (Duchefa, Netherlands), and KH 2 P0 4 0.4 g / L (Junsei). Then set ⁇ to 7.2 and 121, for 15 minutes
- 25 ml of the prepared seed medium was placed in a sterile 250 ml baffled flask, and the strain mycelium was inoculated into the seed medium by l looping from the agar plate. Incubated for 48 hours at 230 rpm and 28 degrees.
- the production medium 251 was put in a sterile 250ml non-baffled flask and inoculated with 1.25ml of the seed culture, and then cultured for 10 days at 230 rpm and 28 degrees.
- the extracted samples were analyzed by HPLC UVD analysis under the conditions ⁇ below.
- the correlation is indicated by an arrow.
- Ivermectin derivative 5 (IV5) was determined as in Chemical Formula 4, and HMBC correlation was indicated by an arrow.
- aveAl the first gene of the avermectin-producing gene family of S. avermitilis SA-() 1, which is an avermectin-producing strain, was analyzed through analysis of the substance.
- milAl the first gene of the Milbemycin-producing gene family of aureolacrimosus
- milAl-inserted strains were 22,23-dihydro-25-methyl-, respectively.
- avermectin CAS No. 137330-81-5; Ref: DE4031039
- 22,23-dihydro-25-ethyl-avermectin CAS No.
- the reference drug is cabbage (5cm / disk) 1 ml, and the number of layers was measured after 1 to 2 days.
- the reference drug is cabbage (5cm / disk) 1 ml
- Abamectin (Sigma) was used.
- the second layer was used, and after dipping into cabbage (05cm / disk) slices, the test layer was inoculated per 10 slices, and the viable number was measured after 1-2 days.
- the control agent was used Evamectin (Sigma). The results obtained above are shown in Table 2 and Table 3, respectively.
- a vector was prepared to replace the seventh generation of the milA3 gene of S. milbemycinicus NRRL5739 with the seventh generation of the substance producing gene family of S. avermitilis DBM-01.
- the vector comprises all or part of the seventh moiety and is configured in such a manner that regions of the aveA3 and aveA4 genes having homology for integration are attached to both ends.
- the vector production process will be described in detail.
- Streptomyces Milbemycinikus (S. w // em i i / ct «NRRL5739) Secures all 7 genes from genomic DNA
- Mode 7 All of Mode 7 and only the KS (Ketosynthase) domain of Mode 7 were host strains.
- MA3-6503R Primer (TGCCAATGATCGCGATGGCCTCATC: SEQ ID NO: 21), for cloning the site corresponding to Mod 7 from Streptomyces milbemycinicus NRRL5739 genomic DNA in two forms (A and B) -104Fin (A) Primer (GGGTCAGTGGCACGAACGCCCATGTGATCCTCG:
- This vector was named pCR2.1-Mo7A, pCR2.1-Mo7B (FIGS. 9A and 9B).
- Binding site was prepared. Below genomic DNA of S. avermitilis DBM-01 strain
- TA cloning vector After amplification using a primer to obtain fragments of the sites corresponding to both arms : cloned into PCR2.1 vector (TA cloning vector), respectively.
- AA3-8600RH aaaaagcttAACGGTGTGTGGAGCGTCAG (SEQ ID NO: 24)
- AA3-5597FSp aaaactagTCGCGATCATTGGCATG (SEQ ID NO: 25)
- AA3-11 IRSp aaaactagtGCTGGACGCCTCCATGGC (SEQ ID NO: 26)
- AA3-1369RSp aaaactagTCGTGCCACTGACCCCGAAC (SEQ ID NO: 27)
- AA4-2300FNS aaatctagaGCTCCGTGCAGACCGAGAAC (SEQ ID NO: 28)
- the vector was recovered, treated with Nsil / Spel and Spel / Hindlll restriction enzymes, and then ligation by ligation to prepare both arms on one vector.
- This vector was named pCR2.1-armA, pCR2.1-armB (FIG. 9).
- the restriction enzyme was cut and pCR2.1-mo7A and pCR2.1-mo7B vectors were cut with EcoRI to obtain an insert. These two fragments were each combined through infusion ligation to complete the structure of the seventh modal replacement vector. These vectors were named pCR2.1-A3Mmo7A and pCR2.1-A3Mmo7B, respectively (FIG. 9).
- the pKC1139 vector and the pCR2.1-A3Mmo7A and pCR2.1-A3Mmo7B vectors are Xbal,
- the pKC1139 vector fragment and the insert fragments of the pCR2.1-A3Mmo7A and pCR2.1-A3Mmo7B vectors were conjugated to A3Mmo7A or pKC1139.
- a form containing the A3Mmo7B structure was produced. These were named as pKC-A3Mmo7A and P KC-A3Mmo7B vectors, respectively (FIG. 9).
- Example 4 Modulation of seven modified strains and confirmation of generated materials
- a Mod 7 replacement vector was introduced into the DBM-01 strain and homologous recombination occurred to obtain a strain in which Mod 7 of S. avermitilis DBM-01 strain was substituted with Mod 7 of milA3, and produced through culturing New materials were identified.
- Lysozyme was treated to prepare protoplasts, pKC-A3Mmo7A (l 10), pKC-A3Mmo7B (1 10) vectors were mixed and treated with PEG1000 to introduce the vector into the DBM-01 strain via PEG-mediated protoplast transformation. After 24 hours of incubation, antibiotics (apramycin) were treated and the aac3iv-F primer (GGTTCATGTGCAGCTCCATC:
- the first crossing was induced to the strain in which the module 7 replacement vector was introduced, so that the entire vector was inserted into the genomic DNA of the mv Yz ' fc DBM-01 strain (FIG. 10).
- ISP-4 solid medium to which apramycin was added at a concentration of 25 g / ml was prepared, and colonies produced by vector introduction were taken, followed by streaking on the prepared solid medium.
- the high temperature sensitive pKC1 139 vector was used to incubate at 37 to 7 days to prevent the cloning of the vector.
- the A3Mmo7A-inserted strain was avm Y fc DBM-03-A
- the A3Mmo7B-inserted strain was S. avermitilis DBM-03-.
- Named B. m 7wY / fc DBM-03-A strain was assigned accession number KCTC 12890BP as of August 31, 2015
- S. avermitilis DBM-03-B strain was assigned accession number KCTC12891BP as of August 31, 2015.
- a seed culture medium and a production culture medium for culturing the Mod 7 substitution strain were prepared, respectively.
- To prepare the seed culture medium soluble starch 30g / L, yeast extract 15g / L, KH 2 PO 4 layer in common stirrer were combined in a suitable amount of DW to a concentration of 0.4g / L ⁇ Hi mixture to give, after expression sufficiently layer, Stirred Com steep liquor was added to a concentration of 5 g / L.
- 25 ml of the prepared seed medium was placed in a sterile 250 ml baffled flask, and the strain mycelium was inoculated into the seed medium by lloop from the agar plate. Incubated for 48 hours at 230 rpm and 28 degrees.
- the extracted samples were analyzed by HPLC UVD analysis under the following conditions.
- FIG. 13 was referenced in the manufacture of the preparation of recombinant vectors for the following genetic modifications.
- the coding gene region of the region containing the KR domain of Mode 9 from the DH domain of Mode 7 of the aveA3 gene of Streptomyces abemitilis DBM-is prepared in Example 2-3 was Straptomys Milbemaicinis (S. milbemycinicus NRRL5739) A vector for substituting the coding gene region of the KR domain containing region of Mode 9 with the DH domain of Mode 7 of the substance-producing gene group milA3 gene
- This vector contains part of milA3 and is intended for recombination within strains.
- Regions of the aveE and aveA3 genes with homology were constructed in the form of linking at both ends.
- primers were designed according to the nucleotide sequence shown in Table 5 below (the DNA fragment to be produced is very large, and the PCR was performed after dividing into three fragments. Synthesized according to the following Example 5-3).
- each fragment was cloned into pGEMTeasy vector (Promega) to identify the base sequence by DN A sequencing.
- the vector thus obtained was named pYJ 1950, pYJ 1951 and pYJ 1952.
- the inserts of each of these plasmids correspond to fragments ⁇ , 3 and 5-6 'of FIG. 14, and each fragment is located at the KR domain region of module 9 through the DH domain of milA3 mod 7 for ease of cloning. Designed by reference.
- Each vector was prepared to cause crossover through homologous recombination in the Mode 7 DH-Mode 9 KR region of Streptomyces abemitilis DBM-01 strain.
- PM5-2 vector and pM6-4 vector containing milA3 region obtained by PCR were prepared, and the restriction enzyme Aflll / Bmtl was treated to pM5-2 vector to obtain fragment 2 of FIG. 14, and to pM6-4 vector. Restriction enzyme BstBI / Sphl was treated to obtain fragment 4 of FIG. 14.
- Genome sequence information of Streptomyces bingchenggensis (Accession no. CP002047.1) for cloning the milbemycin production gene family of S. milbemycinicus NRRL5739. Based on the design, primers were designed by dividing 61kb regions including milA2, milA3, and milA4 regions into 6 regions of 10kb each (see Table 7 and FIG. 19).
- Primer rev. (C) 5 pmol / ul 2 PCR was performed on the mixture under the conditions of the following Table 9 using MyCycler (Bio-Rad).
- M5 and M6 fragments corresponding to milA3 were cloned by pCR2.1 TOPO cloning system (Invitrogen, USA) and transformed into E. coli DH5a to obtain pM5-2 and pM6-4, respectively. .
- the recombinant vector thus obtained was named pYJ1957, and from this, the left flanking region-milA3 module 7 DH-mod 9 obtained by EcoRI / Hindlll restriction enzyme treatment was transferred to pKC 1 139, and milA3 module 7
- a recombinant vector for the expression of the DH-mole 9 KR region was constructed (see FIG. 14; LA: left arm; RA: right arm; 1 ', 2, 3, 4, 5, 6: fragments). It was named pD7K9milA3 (SEQ ID NO: 80; LA: 6074-7261 region; 1 ': 7256-10476 region; 2: 10471-15043 region; 3: 15038-17193 region; 4: 17188-20776 region; 5 and 6') : 20771-21226 site; RA: 21221-22436 site).
- Example 6 Strain Preparation and Confirmation of Product Inserted with a milA3 Insertion Vector (milA3 Integration Vector)
- the milA3 integration vector (pD7K9milA3) prepared in Example 5-3 was introduced into S. avertmilis DBM-01 strain, and induces homologous recombination to occur.
- the strain of aveA3 gene of the avertmilis DBM-01 strain was substituted with the milA3 gene to obtain a strain, and the new material generated through the culture was confirmed.
- the transformants transformed with the vector (pD7K9milA3) were 2xTY (trptone 16 g / L, yeast extract 10 g / L, NaCl 5 g / g containing apramycin, chloramphenicol, and kanamycin).
- L) or LB (peptone l Og / L, yeast extract 5 g / L, sodium chloride l Og / L) was incubated at 37 ° C using a liquid medium. After 12 hours, 1 ul of culture was transferred to 25 mL of 2 ⁇ TY and incubated at 37 ° C. until the optical density became 0.6. The cells in the cultures were washed twice with the same liquid medium, followed by 500 uL of 2?
- the strain production process is schematically shown in FIG.
- the avermitilis DBM-03-C strain was deposited on August 24, 2016 with the Korean Collection for Type Culture, located in Jeongeup-si, Jeollabuk-do, Korea, and was given accession number KCTC13083BP.
- Soluble starch, soybean flour, skim milk, and KH 2 P0 4 were dissolved in DW, and the production culture medium prepared according to pH 7.2 was autoclaved under the same conditions as the seed culture medium, and then 5% of the total production culture medium was used. Inoculate the prepared spawn culture solution at 230 rpm and 28 ° C Incubated for 10 to 15 days under the conditions.
- HPLC HPLC was performed on a Phenomenex Luna (4.6x100 mm, 5 mm) column under an HPLC system (YL Instrument Co. Ltd) consisting of a PDA detector and a gradient pump, and water-based 0.05% (v / v) trifluoroacetic acid (TFA) Using a solvent A and acetonitrile as a solvent B, using a solvent gradient as shown in Table 12, the sample was analyzed for a total of 60 minutes at a flow rate of 1 mL / min at 238 ⁇ 245 nm.
- the S. avermitilis DBM-03-C strain is milbemycin A3 (C AS NO. 51596-10-2), A4 (CAS NO. 51596-11-3), ⁇ 2 (CAS No. 51596 -12-4), D (CAS NO.77855-81- 3), the peaks presumed to be ⁇ 4 (CAS No. 51596-13-5), and G (CAS No.
- 83471-31-2 can be identified, among which milbemycin A3, A4, and D are standard milbemycin and It can be confirmed that it has the same RT value.
- the peaks estimated by milbemycin A3, A4 and D have the same RT value as the standard milbemycin.
- the RT of each material shown in the HPLC analysis result of FIG. 16 is as follows:
- UPLC-qTOF-HR-MS was performed as follows. Corresponding molecular weight values of the six different milbemycins analyzed on the HPLC were determined using a Waters XEVO® G2S Q-TOF mass spectrometer through Xselect® CSH column XP (2.1x100 mm, 2.5 um; Waters); Waters). The solvent gradient used at this time was as Table 13 below.
- FIGS. 17A to 17F The obtained mass spectrum results are shown in FIGS. 17A to 17F (FIG. 17A: Milbemycin A3; FIG. 17B: Milbemycin A4; FIG. 17C: Milbemycin D; FIG. 17D:
- Receipt of the certificate of deposit by the vegetable farming circle deposit 9. y it-til Hanmin ⁇ is located in Shanxi. 39-2 : Colour (3 ⁇ 4 ⁇ 0)
- the national flag is the national night.
- the f * r - ⁇ ⁇ 2M5 year is S ⁇ 31 and the order is lower. ⁇ , kpop3 ⁇ 4-? 's ⁇ 3 ⁇ 4
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
밀베마이신을 생산하는 재조합 스트렙토마이세스 아베르미틸리스 (Streptomyces avermitilis) 균주 및 이를 이용한 밀베마이신 생산 방법이 제공된다.
Description
【발명의 설명】
【발명의 명칭】
밀베마이신을 생산하는 재조합 미생물 및 이를 이용한 밀베마이신 생산 방법 【기술분야】
밀베마이신을 생산하는 재조합 스트렙토마이세스
아베르미틸리스 (Strept ^c avm Y fc) 균주 및 이를 이용한 밀베마이신 생산 방법이 제공된다.
【배경 기술】
스트렙토마이세스 밀베마이시니쿠스 (Streptowyc Aw e _y 'ci«) (NRRL5739 또는 DSM 4191 1 )라고도 칭함), 스트렙토마이세스 시아네오그리세우스 아속
논시아노게 ώ (Streptomyces cyaneogriseus subsp. noncyanogenus), 스트템토마이세스 +¾-¾] Λ| i^(Streptomyces nanchangensis) 또는 스트랩토마이세스
빙촁젠시스 0¾reptow_yc s' >?gc/^«ggm«y)등으로부터 생산되는 폴리케타이드 계열의 16-원환 매크로라이드 화합물로서 다양한 형태의 생물학적, 화학적 유도체로서 농업 및 동물의약품 용도로 상품화되어 있다.
밀베마이신의 대표적인 예인 밀베멕틴 (milbemectin)은 아래 그림과 같은 구조로서, 밀베마이신 A3와 밀베마이신 A4가 약 30:70 비율로 흔합되어 있는 형태이다.
Compound R
Milbemycin A3 CH5
Milbemycin A4 CH2CH3
Milbemectin 이 외에도, 밀베마이신 계열로서 밀베멕틴의 화학적 유도체인
레피멕틴 (Lepimectin)이 살충제로서 이용되고 있으며, 동물의약품으로서
밀베마이신 옥심 (Milbemycin Oxime)과 네마텍틴 (Nemadectin)의 화학적 유도체인 목시덱틴 (Moxidectin)이 상업화되어 있다.
한편, 아베멕틴 (Avermectin)은 밀베마이신과 같이 멕틴계 살층제로 분류되며, 스트렙토마이세스 아베르미틸리스 (5Vreptom_yce;f m v Y/fe) 등으로부터 생산되는 폴리케타이드 계열의 16-원환 매크로라이드 화합물이다. 이들 중 아베멕틴 B l a와 아베멕틴 B i b의 혼합물은 아바멕틴 (Abamectin)으로서 웅애 등에 대한 살충제로, 아베멕틴의 화학적 유도체인 에마멕틴 벤조에이트 (Emamectin benzoate)는 나방 등에 대한 살충제 성분으로 사용되고 있으며, 동물의약품으로서 아베멕틴의 화학적, 생물학적 유도체인 이버멕틴 (Ivermectin), 도라멕틴 (Doramectin), 셀라멕틴 (Selamectin), 에프리노멕틴 (Eprinomectin) 등이 상업화되어 있다.
스트랩토마이세스 아베르미틸리스의 아베멕틴 생산성을 향상시키기 위하여 무작위적인 돌연변이법, 트랜스포존 (transposon) 돌연변이법 등이
적용되었으며, 이를 효율적으로 스크리닝하기 위한 고속스크리닝법이
개발되었다 [Ikeda et al. 1993 ; Weaden and Dyson 1998; Gao1 et al. 2010; Gao2 et al. 2010; Wang et al. 2010]. 또한, 생산균주의 주요 유전자를 제거하거나 과발현하여 생산성을 증가시키는 연구가 성공적으로 진행되었다 [Duong et al. 2009; Li et al. 2010;
Zhuo et al. 2010; Qiu et al. 201 1 ; He et al. 2014; Liu et al. 2015]. 이케다 등은
스트렙토마이세스 아베르미틸리스가 외래의 물질합성 유전자를 효과적으로 발현하여 물질을 생산할 수 있음을 밝히고 지놈엔지니어링을 통해 보다 효과적인 발현 균주로 개발하고 있다 [Ikeda et al. 2014]. 또한, 아베멕틴의 경우 현재 대규모의 상업적 생산이 이뤄지고 있어 아베멕틴 생산균주인 스트렙토마이세스 아베르미틸리스가 산업균주로서 보다 유리할 것으로 여겨지고 있다.
밀베마이신의 생산은 스트렙토마이세스 속에 속하는 세균을 배양하고, 균체를 배양액으로부터 분리하여 생산된 밀베마이신을 균체로부터 유기 용매로 추출한 후, 얻어진 목적 화합물올 포함하는 물질을 정제하는 등의 방법에 의해 행해지고 있다. 종래 밀베마이신의 생산에 관한 기술들을 살펴보면, 일본의 Sankyo 사에서 1980년대 스트렙토마이세스 밀베마이시니쿠스 Streptomyces
밀베마이신을 생산하는 것을 발견한 후, 무작위적인 돌연변이 개발 기술을 통해 상업적 수준의 밀베마이신의 생산을 시작하였다. 그러나, 이와 같이 개발된 균주를 이용하여 밀베마이신을 대량생산 할 때 발효조 내의 용존 산소량에 의한 생산성 변화가 상당히 크다는 것이 보고되었고, 개발된 균주의 생산성을 유지시키는 것이 상당히 어렵다는 것이 보고된 바 있다 [Okada and Iwamatu. 1997; Ide et al.1993]. 또한 상기 균주외 밀베마이신을 생산하는
스트렙토마이세스 빙쳉젠시스에서 조절 유전자인 nsdA의 삭제를 통하여 밀베마이신 A4의 생산성을 향상시켰다는 보고가 있고 [Wang et al. 2009], 스트렙토마이세스 빙촁젠시스에서 milD를 삭제하여 밀베마이신 A3/A4의 생산성을 향상시켰다는 보고가 있다 [Zhang et al. 2013].
그러나, 종래 기술은 원 균주인 스트렙토마이세스 밀베마이시니쿠스 Streptomyces milbemycinic )를 이용하여 상업적 수준으로 생산하는 경우에 있어서도 대량생산의 어려움 때문에 생산성 향상을 이루기 어려우며, 신규의 균주를 이용하는 경우에 있어서도 산업적 수준의 생산성을 얻기 까지 장기간이 걸린다는 문제가 있다.
【선행기술문헌】
【비특허문헌】
(비특허문헌 0001) Ikeda et al., J. Bacteriol., 175(7): 2077-2078 (1993년 4월)
(비특허문헌 oooz Weaden and Dyson, Microbiology, 144:1963-1970 (1998년
7월)
(비특허문헌 0003; Gao et al., Bioresource Technology, 100:4012-4016 (2009년
4월)
(비특허문헌 0004: Gaol et al, Appl. Environ. Microbiol, 76(13):4583-4586
(2010년 7월)
(비특허문헌 0005; Gao2 et al., Appl. Microbiol. Biotechnol., 85(4):1219-1225 (2010년 1월)
(비특허문헌 0006: Wang et al., J. Appl. Microbiol., 108(3):851-858 (2010년 3월) (비특허문헌 0007: Duong et al., J. Microbiol. Biotechnol., 19(2): 136-139
(2009년 2월)
(비특허문헌 0008; Li et al., Bioresour. Technol., 101(23): 9228-9235 (2010년
12월)
(비특허문헌 0009: Zhou et al., Proc. Natl. Acad. Sci. (107(25):11250-11254 (2010년 6월)
(비특허문헌 0010; Qiu et al., Appl. Microbiol. Biotechnol., 92(2):337-345
(2011년 10월)
(비특허문헌 0011: He et al, Appl. Microbiol. Biotechnol., 98(l):399-409
(2014년 1월)
(비특허문헌 0012; Liu et al., Appl. Environ. Microbiol., 81(15):5157-5173
(2015년 8월)
(비특허문헌 0013; Wang et al., Bioorg. Med. Chem. Lett., 21(1 1 ):3320-3333 (2011년 6월)
(비특허문헌 0014: Ikeda et al, J. Ind. Microbiol. Biotechnol., 41 :233-250
(2014년 2월)
(비특허문헌 0015: Wang et al., The Journal of Antibiotics, 62:309-313(2009년
5월)
(비특허문헌 0016; Zhang et al, Appl Microbiol Biotechnol., 97(23): 10091 - 10101(2013년 12월)
(비특허문헌 00Π: Okada and Iwamatu., J Chem Technol Biotechnol 70(2) :179-
187(1997년 10월)
(비특허문헌 0018) Ide et al., Annu. Rep. Sankyo Res. Lab. 45:1-98 (1993년)
【발명의 내용】
【해결하려는 과제】
본 발명은 밀베마이신의 산업용 생산 균주로 사용할 정도의 높은 생산성을 가지는 재조합 미생물 및 이를 이용한 밀베마이신 생산 방법과 관련 있다.
일 예는 아베멕틴의 고생산성 균주에서 아베멕틴 생산 유전자의 일부를 밀베마이신 생산 유전자로 치환함으로써 밀베마이신을 고생산하는 재조합 미생물을 제공한다.
다른 예는 밀베마이신 생산 유전자를 포함하는 밀베마이신을 고생산하는 재조합 미생물 제조에 사용 가능한 재조합 백터를 제공한다.
다른 예는 상기 재조합 미생물을 이용한 밀베마이신 생산 방법을 제공한다.
다른 예는 아베멕틴의 고생산성 균주에서 아베멕틴 생산 유전자의 일부를 밀베마이신 생산 유전자로 치환함으로써 아베멕틴 유도체를 생산하는 재조합 스트렙토마이세스 아베르미틸리스 균주를 제공한다.
다른 예는 신규한 아베멕틴 유도체 또는 이의 염을 제공한다.
다른 예는 상기 신규한 아베멕틴 유도체 또는 이의 염을 포함하는 농약 및 /또는 동물의약용 조성물올 제공한다.
【과제의 해결 수단】
상기 문제를 해결하기 위한 하나의 방안으로서, 본 명세서에서는, 아베멕틴 (avermectin)과 밀베마이신 (milbemycin)의 분자구조가 매우 유사하고 이들을 생산하는 폴리케타이드 합성효소의 모들 (module) 및 도메인 (domain)의 구성이 유사함에 근거하여 아베멕틴 고생산성 균주의 아바멕틴 합성
폴리케타이드 합성효소를 밀베마이신 합성 폴리케타이드 합성효소로
전환함으로서 고생산성의 밀베마이신 생산균주를 제작하는 기술이 제공된다 (도 18a-18d 참조).
하나의 양태로서, 본 발명은 아베멕틴의 고생산성 균주에서 아베멕틴 생산 유전자의 일부를 밀베마이신 생산유전자로 치환하여 얻어진 재조합 미생물에 관한 것이다. 상기 재조합 미생물은 밀베마이신을 고효율로 생산하는 특징으로 갖는 것일 수 있다.
도 18a- 18c는 아베멕틴과 밀베마이신의 분자구조 차이 및 이를 유발하는 유전자의 구성을 보여주는 그림이고, 도 18d는 밀베마이신 폴리케타이드 합성효소 유전자군 (gene cluster)과 아베멕틴 폴리케타이드 합성효소 유전자군을 비교하여 보여주는 그림이다. 도 18a-18d에서, 각 원은 각각 도메인을 나타내며, 각
도메인으로부터 코딩되는 단백질은 각각 다음의 활성을 갖는다 (AT:
아실트랜스퍼라제 (Acyltransferase), KS: 케토-아실기 합성효소 (ketosynthase), KR: 케토-아실기 환원효소 (ketoreductase), DH: 탈수효소 (dehydratase), ER: 엔올 환원효소 (enoyl reductase), ACP: 아실기 운반단백질 (Acyl Carrier Protein), TE:
티오에스터라제 (Thioesterase)). 각각의 합성효소는 모들로 구성되고 각 모들은 도메인들로 구성되며, 합성효소 유전자군은 모듈 코딩 유전자들로 구성되며, 각 모들 코딩 유전자는 각 도메인 코딩 유전자들로 구성된다ᅳ
각 모들 내의 각 도메인은 KS 도메인부터 시작하여 ACP 도메인으로 끝나는 순서로 배열될 수 있다 [예컨대 , Ν-말단에서 C-말단 방향으로, (KS)-(AT)- (DH 및 /또는 KR; in any order)-(ACP) 순서로 배열, milA3의 모듈 7의 경우 (KS)- (AT)-(DH)-(ER)-(KR)-(ACP) 순서로 배열]. 밀베마이신 및 아베멕틴 폴리케타이드 합성효소의 모들 10의 KR도메인은 폴리케타이드 합성에 관여하지 않으며, 밀베마이신 폴리케타이드 합성효소 모들 11의 KR도메인과 아베멕틴
폴리케타이드 합성효소 모들 7의 DH도메인은 활성이 없다.
도 18a-18d에서 알 수 있듯이, 아베멕틴과 밀베마이신의 분자 구조가 매우 유사하고, 아베멕틴 폴리케타이드 합성효소 유전자군과 베마이신 폴리케타이드 합성효소 유전자군은 그 구성이 매우 유사하다.
두 화합물 (아베멕틴과 밀베마이신)의 합성에 있어 차이는 다음에 기인한다: 1) 폴리케타이드 합성효소의 loading 모들의 AT의 기질특이성 차이로 밀베마이신 합성효소의 loading모들의 경우 acetyl-CoA와 propionyl-CoA를 주요 기질로 사용하고, 아베멕틴 합성효소의 loading모들의 경우 isobutyryl-CoA와 2- methylbutanoyl-CoA를 주요기질로 사용하고 있어서, 두 화합물의 각 탄소위치
25번에 연결되어 있는 탄소 사슬의 길이가 달라진다.
2) 두 화합물의 탄소위치 22-23의 탄소결합은 각 합성효소의 모들 2의 도메인 구성에 의해 결정되어, DH-KR도메인을 갖는 아베멕틴 폴리케타이드 합성효소 모들 2의 경우 이중 결합 또는— OH 결합을 생성하는 반면, DH-ER-KR 도메인을 갖는 밀베마이신 폴리케타이드 합성효소 모들 2는 단일결합을 생성한다.
3) 두 화합물의 탄소위치 13의 -OH기의 생성은 각 합성효소의 모들 7의 도메인 구성에 의한다. 아베멕틴 폴리케타이드 합성효소의 경우 KR도메인만 작용하여 — OH가 생성되지만, 밀베마이신 폴리케타이드 합성효소의 경우 DH-ER- KR도메인이 있어 탄소 단일결합의 형태가 생성된다.
상기 내용에 기초하여, 아베멕틴 생성 균주를 밀베마이신 생성 균주로 전환시키기 위하여 필수적으로 필요한 최소한의 도메인만을 선택적으로 치환할 수 있다. 본 명세서에서는 도메인 치환시의 활성 유지 정도를 고려하여, 적절한 모들 또는 도메인 단위를 선택하여 치환을 시도하였다.
보다 구체적으로, aveA3와 milA3의 기능적 차이는 모듈 7의 DH (dehydratase) 와 ER (Enoyl reductase) 활성 도메인의 포함 여부에 의존할 수 있다. aveA3의 모들은 DH 도메인을 갖고 있지만 활성이 없는 반면, milA3는 모들 7에 DH와 ER 활성을 갖는 도메인을 포함한다. 이외에, aveA3의 모들 8과 모들 9는 milA3의 모들 8과 모들 9와 동일 내지 유사한 기능을 갖는다. 따라서, 기능적인 측면을 고려하면, 최소한 aveA3의 모들 7 코딩 유전자 중의 DH도메인 코딩 유전자를 milA3의 모들 7 코딩 유전자 중의 DH-ER도메인 코딩 유전자로 치환시킴으로써, 아베멕틴 생성균주에 밀베마이신 생산 활성을 부여할 수 있다. 임의로,
폴리케타이드 합성효소와 같은 거대 효소에 있어 단백질 상호작용에 의해 합성이 조절되는 것이 매우 중요하기 때문에, 단순한 도메인 치환에 의하여 생길 수 있는 활성 감소를 방지하기 위하여, 모들 단위 (예컨대, 모들 7)로 치환하거나, 또는 앞서 설명한 도메인 이외의 적절한 도메인 또는 모들올 추가로 치환할 수 있다. 일 예에서, 스트렙토마이세스 아베르미틸리스 C re ?tcw ^^ ave »Yifc) 균주에서,
아베멕틴 생합성을 수행하는 폴리케타이드 합성효소 유전자군의 1번 유전자 (aveAl ; 예컨대, Streptowᅳ ye tn Y/fc MA-4680의 aveAl 유전자 (GeneBank Accession number AB032367.1의 1이번째부터 12019번째까지의 폴리뉴클레오타이드
부위 (DNA서열: 서열번호 66; 아미노산서열 (BAA84474.1 ): 서열번호 67)) 등)가 밀베마이신 생산 균주의 밀베마이신 생합성을 수행하는 폴리케타이드 합성효소 유전자군의 1번 유전자 (milAl)로 치환되고,
아베멕틴 생합성을 수행하는 폴리케타이드 합성효소 유전자군의 3번 유전자 (aveA3)의 전부 또는 일부가 밀베마이신 생산 균주에서 밀쎄마이신 생합성을 수행하는 폴리케타이드 합성효소 유전자군의 3번 유전자 (milA3)의 전부 또는 일부로 치환된,
재조합 스트렙토마이세스 아베르미틸리스 균주가 제공된다.
상기 aveA3 일부가 milA3의 일부로 치환된 것은, aveA3 (예컨대,
Sireptomyces avermitilis M、- 46 0엑 aveA3 유전자의 적어도 모들 7 코딩 유전자의 전부 또는 일부 (적어도 DH 도메인 코딩 유전자를 포함)가 밀베마이신 생산 균주에서 밀베마이신 생합성을 수행하는 폴리케타이드 합성효소 유전자군의 3번 유전자 (milA3)의 모들 7 코딩 유전자의 전부 또는 일부 (적어도 DH (dehydratase) 도메인 코딩 유전자 및 ER (enoyl reductase) 도메인 코딩 유전자를 포함)로 치환된 것을 의미할 수 있다.
예컨대, 상기 aveA3는 GeneBank Accession number AB032367.1의
33436번째부터 50034번째까지의 폴리뉴클레오타이드 부위 (DNA서열: 서열번호 71 (polyketide synthase gene cluster (AB032367.1 )의 33436번째부터 50034번째까지의 폴리뉴클레오타이드 부위); 아미노산 서열 (BAA84478.1 ): 서열번호 72 (Module 7: 38번째부터 1841까지 폴리펩티드; Module 8: 1862 번째부터 3641까지 폴리펩티드; Module 9: 3660번째부터 5438까지 폴리펩티드; module 7의 DH domain: 976번째부터 1 148번째까지 폴리펩티드))일 수 있으며, 상기 aveA3의 일부는 적어도 모들 7 (BAA84478.1 (서열번호 72)의 35번째부터 1841번째 또는 38번째부터
1841번째까지의 부위)의 코딩 유전자의 전부 또는 일부 (적어도 DH (dehydratase) 도메인 (BAA84478.1 (서열번호 72)의 976번째부터 1 M8번째까지의 부위)의 코딩 유전자를 포함)을 의미할 수 있다.
aveA3 유전자의 각 모들, 도메인 및 이의 코딩 유전자는 웹사이트
(http://www.ncbi.nlm.nih.gov/protein/5902891)를 통하여 명확하게 특정할 수 있다. 상기 재조합 스트렙토마이세스 아베르미틸리스 균주는 밀베마이신의 . 고효율 생산 활성을 갖는 것일 수 있다.
폴리케타이드 합성효소 상에서 도메인, 모들, 및 /또는 단백질의
변이 (예컨대, 치환) 시에, 각 영역을 암호화하는 유전자를 연결하는 docking 부분간의 상호작용이 해당 폴리케타이드 합성효소의 정상적 발현에 매우 중요하다. 특히 KS (ketosynthase) 도메인 , AT (acyltransferase) 도메인, DH
(dehydratase), ER (enoylreductase) 도메인, K (ketoreductase) 도메인, ACP (acyl carrier protein) 도메인 등을 포함하는 복합효소를 포함하는 폴리케타이드 합성효소 (상기한 도메인들은 N-말단에서 C-말단 방향으로 상기 기재 순서대로 위치하는 것일 수 있다)에서, 각 모들의 KS와 AT는 upstream의 ACP와 상호작용한다. 이를 고려할 때, 아베멕틴 폴리케타이드 합성효소의 정상적 발현을 위해서, aveA3 유전자의 일부가 milA3 유전자의 일부로 치환 시 치환이 일어나는 염기서열의 위치가 중요하게 고려되어야 한다.
상기 milA3 유전자의 일부로 치환되는 aveA3 유전자의 일부는 적어도 모들 7의 전부 또는 일부 (적어도 DH 도메인을 포함)의 코딩 유전자를 포함할 수 있고, 이를 치환하는 milA3 유전자의 일부는 적어도 모들 7의 전부 또는 일부 (적어도 DH 도메인 및 ER도메인을 포함)의 코딩 유전자를 포함할 수 있다. aveA3 유전자의 일부를 밀베마이신 생산 균주의 milA3 유전자의 일부로 치환 시, aveA3 유전자의 N-말단 코딩 부위 및 C-말단 코딩 부위의 docking 영역에 더하여, 모들 7의 KS (KS7), 모들 7의 AT 도메인 (AT7), 및 /또는 모들 9의 ACP 도메인 (ACP9)의 코딩 유전자 부위들이 아베멕틴 폴리케타이드 합성효소 (aveA3 유전자)의 상기 도메인의 코딩 유전자 부위들로 보존되도록 유전자 치환이 일어날 수 있다.
예컨대, aveA3 유전자의 일부 치환은
(a) aveA3 유전자 중 적어도 모들 7 코딩 유전자 또는 모들 7의 DH (dehydratase) 도메인 코딩 유전자가 밀베마이신 생산 균주의 milA3 유전자의 모들 7 코딩 유전자 또는 모들 7의 DH (dehydratase) 도메인 및 ER (enoyl reductase) 도메인 코딩 유전자로 치환되거나; 또는
(b) 상기 (a) 치환에 더하여, 다음을 추가로 포함하는 치환일 수 있다: (i) aveA3 유전자의 모들 7 코딩 유전자 중의 DH 도메인 코딩 유전자를 제외한 나머지 도메인 중 하나 이상의 코딩 유전자 (예컨대, KS 도메인 코딩 유전자 , AT 도메인 코딩 유전자, KR도메인 코딩 유전자 및 ACP 도메인 코딩
유전자로 이루어진 군에서 선택된 하나 이상의 유전자)의 밀베마이신 생산 균주의 milA3 유전자의 모들 7 코딩 유전자 중의 DH 도메인 및 ER도메인을 제외한 나머지 도메인 중 하나 이상의 코딩 유전자 (예컨대, KS 도메인 코딩 유전자, AT도메인 코딩 유전자, KR도메인 코딩 유전자 및 ACP 도메인 코딩 유전자로 이루어진 군에서 선택된 하나 이상)로의 치환;
(ii) aveA3 유전자의 모들 8 및 모들 9의 도메인들 중 하나 이상의 코딩 유전자의 밀베마이신 생산 균주의 milA3 유전자의 모들 8 및 모들 9의 도메인들 중 하나 이상의 코딩 유전자로의 치환; 또는
(iii) 치환 (i) 및 (H)의 조합. ' 앞서 설명한 aveAl 유전자의 전부가 milAl 유전자의 전부로 치환 및 /또는 aveA3 유전자의 전부 또는 일부가 milA3 유전자의 전부 또는 일부로 치환된 균주는, aveAl 및 /또는 aveA3 유전자의 유전자 치환 부위의 N-말단 및 /또는 C- 말단의 docking 영역 코딩 부위가 보존되어 있는 것일 수 있다. 즉, aveAl 유전자의 전부가 milAl 유전자의 전부로 치환 및 /또는 aveA3 유전자의 전부 또는 일부가 milA3 유전자의 전부 또는 일부로 치환된 균주는, aveAl 및 /또는 aveA3 유전자의 유전자 치환 부위의 upstream 및 /또는 downstream 영역과 상동성을 가지는 부위를 상기 치환 (도입)된 milAl 유전자 및 /또는 milA3 유전자의 전부 또는 일부의 어느 한 말단 또는 양쪽 말단에 연결된 형태로 포함할 수 있다. 이러한 상동성을 가지는 부위의 도입은 상동 재조합시에 유리할 수 있다. 상기 상동성은 원래의 유전자서열과 90% 이상, 95% 이상, 또는 98% 이상 동일성을 가짐을 의미한다.
상기 사용된 용어 "Docking 영역' '은 폴리케타이드 합성효소를 코딩하고 있는 유전자 양 끝 부위에 의하여 코딩되는 부위로, 폴리케타이드 합성시 다음 단계의 합성효소와의 단백질-단백질 상호작용올 원활하게 하는 역할을 하는 부위이다. 통상적인 상동성 염기서열 분석을 범위의 특정이 가능하다.
상기 밀베마이신 생산 균주는 스트렙토마이세스 밀베마이시니쿠스 (Streptomyces milbemycinicus) (milAl 유전자: 서열번호 70; milA3 유전자: 서열번호 73; milA3 단백질: 서열번호 74 (BAA84478.1) (Module 7: 34번째부터 2139 번째까지 폴리펩티드; Module 8: 2163번째부터 3927번째까지 폴리펩티드; Module 9:
3951번째부터 5731 번째까지 폴리펩티드: DH-ER domain in module 7: 953번째부터
1775 번째까지 폴리펩티드 (DH domain in module 7: 953번째부터 1 129 번째까지 폴리펩티드; ER domain in module 7: 1497 번째부터 1775 번째까지 폴리펩티드 ))), 스트랩토마이세스 시아네오그리세우스 아속 논시아노게누스 ( trept ^c^
cyaneogriseus subsp. Noncyanogenus; 예 ¾ᅫ , Accession no. CPO 10849),
스트렙토마이세스 +¾-¾1 ] ^{Streptomyces nanchangensis; 예 대, Accession no.
FJ952082; milAl 유전자 (Meilingmycin이 milbemycin과 구조가 유사하고 기능이 동일하여, 본 명세서에서는 meiAl와 milAl올 동일한 의미로 사용함): 서열번호 69; milA3 유전자 (본 명세서에서는 meiA3와 mil A3올 동일한 의미로 사용함): 서열번호 75 (GenBank: FJ952082 Sequence 영역 78606번째부터 96074번째까지
폴리뉴클레오티드); milA3 단백질: 서열번호 76 (Module ^ 39번째부터 2143 번째까지 폴리펩티드; Module 8: 2166번째부터 3931 번째까지 폴리펩티드; Module 9:
3952번째부터 5734 번째까지 폴리펩티드; Module 7의 DH-ER didomain 957번째부터 2143 번째까지 폴리펩티드 (Module 7의 DH domain: 957번째부터 1 133 번째까지 폴리펩티드; 모들 7의 ER domain: 1501번째부터 1779 번째까지 폴리펩티드)) ) 또는 스트렙토口! "이세스 빙 젠시스 (Streptomyces bingchenggensis; 예컨대, Accession no. CP002047.1 ; milAl 유전자: 서열번호 68; milA3 유전자: 서열번호 77 (Accession no. CP002047.1 중 1063754: : 1081234 (유전자가 3'->5' 이어서 reverse complement seq를 기재함)); 단백질: 서열번호 78 (Genbank Accession No. ADI03854; Module 7: 35::2150, Module 8: 2173 ::3938, Module 9: 3990::5738, DH-ER didomain in module 7: 950: : 1772 (DH domain: 950:: 1 126; ER domain: 1494: : 1772)))일 수 있다.
다른 구체예로, 상기 재조합 균주는 밀베마이신 A3, 밀베마이신 A4, 밀베마이신 a2, 밀베마이신 (x4 및 밀베마이신 G 로 이루어진 군에서 선택되는 1종 이상의 밀베마이신을 생산할 수 있다.
다른 구체예로, 상기 재조합 균주는 스트렙토마이세스 아베르미틸리스 DBM-03-A 균주 (수탁번호 KCTC 12890BP)일 수 있다.
다른 구체예로, 상기 재조합 균주는 스트렙토마이세스 아베르미틸리스 DBM-03-B 균주 (수탁번호 KCTC12891BP)일 수 있다.
다른 양태로서, 앞서 설명한 밀베마이신 생합성을 수행하는 폴리케타이드 합성효소 유전자 milAl 및 milA3의 전부 또는 일부 (적어도 모듈 7 코딩 유전자 또는 모들 7의 DH-ER도메인 코딩 유전자를 포함)를 포함하는 재조합 백터를
적절한 숙주세포 (예컨대, 스트렙토마이세스 아베르미틸리스와 같은 아베멕틴 생성 균주)에 도입하는 단계를 포함하는 재조합 미생물 (예컨대, 재조합
스트렙토마이세스 아베르미틸리스 균주)의 제조 방법을 제공한다.
상기와 같이 제조된 재조합 미생물은 상기 재조합 백터가 도입되지 않은 미생물과 비교하여 밀베마이신을 생산 효율이 현저히 증가한 특징을 갖는다. 상기 도입시에, 숙주세포 (예컨대, 스트렙토마이세스 아베르미틸리스와 같은 아베멕틴 생성 균주)의 폴리케타이드 합성효소 유전자 aveAl 및 aveA3의 전부 또는 일부 (적어도 모듈 7 코딩 유전자 또는 모듈 7의 DH 도메인 코딩 유전자景 포함)가 milAl 및 milA3의 전부 또는 일부 (적어도 모들 7 코딩 유전자 또는 모들 7의 DH-ER도메인 코딩 유전자를 포함)로 치환이 일어날 수 있다. 또한, aveAl 및 aveA3의 활성이 제거된 상태에서 milAl 및 milA3의 전부 또는 일부 (적어도 모들 7 코딩 유전자 또는 모들 7의 DH-ER도메인 코딩 유전자를 포함)를 포함하는 재조합 백터가 도입되는 경우 보다 상승된 밀베마이신 생산 효과를 얻을 수 있다.
또 하나의 양태로서, 상기 재조합 미생물 (즉, 상기 재조합
스트램토마이세스 아베르미틸리스 균주) 또는 상기 재조합 백터를 포함하는 밀베마이신 제조용 조성물이 제공된다.
또 하나의 양태로서, 상기 재조합 미생물을 이용한 밀베마이신 생산 방법이 제공된다.
구체예로, 본 발명은 상기 재조합 스트랩토마이세스 아베르미틸리스 균주를 배양하는 단계, 및 상기 배양된 균주 또는 균주의 배양물로부터
밀베마이신을 수득하는 단계를 포함하는, 밀베마이신을 생산하는 방법에 관한 것이다.
또 하나의 양태로서, 본 발명은 스트렙토마이세스
밀베마이신 생합성올 수행하는 폴리케타이드 합성효소의 1번 유전자 (milAl)로 치환되며 , 22,23-디하이드로 -25-이소프로필 -아베멕틴 (22,23-dihydro-25-isopropyl- avermectin), 5-메록시 -22,23-디하이드로 -25-메틸-아베멕틴 (5-methoxy-22,23-dihydro-25- methyl-avermectin), 5-메톡시 -22,23-디하이드로 -25-에틸 -아베멕틴 (5-methoxy-22,23-
dihydro-25-ethyl-avermectin) 및 5-메톡시 -22,23-디하이드로 -25-이소프로필 -아베멕틴 (5- methoxy-22,23-dihydro-25-is이ropyl-avermectin)으로 이루어진 군에서 선택되는 1종 이상의 아베멕틴 유도체를 생산하는 재조합 스트렙토마이세스 아베르미틸리스 균주에 관한 것아다. 예컨대, 상기 재조합 스트렙토마이세스 아베르미틸리스 균주는 앞서 설명한 milAl을 포함하는 재조합 백터를 사용하여 제작된 것일 수 있다.
구체 예로, 상기 재조합 스트렙토마이세스 아베르미틸리스 균주는, 스트렙토마이세스 아베르미틸리스 DBM-01 균주 (수탁번호 KCTC 12889BP)일 수 있다.
또 하나의 양태로서, 본 발명은 하기에서 선택되는, 아베멕틴 유도체 또는 이의 염에 관한 것이다: 5-메톡시 -22,23-디하이드로 -25-메틸 -아베멕틴 (5-methoxy- 22,23-dihydro-25-methyl-avermectin) 또는 이의 염, 및 5-메특시 -22,23-디하이드로 -25- 에틸-아베멕틴 (5-methoxy-22,23-dihydiO-25-ethyl-avermectin) 또는 이의 염.
또 하나의 양태로서, 본 발명은 상기 아베멕틴 유도체 또는 이의 염의 작물 보호제 및 /또는 동물의약품으로서의 용도에 관한 것이다.
이하, 본 발명을 보다 상세하게 설명한다.
스트렙토마이세스 아베르미틸리스는 아베멕틴을 생산하는 균주로서, 그 예로는 m /to SA-01 균주, & m v Y fc MA-4680 균주 (NCBI 등록번호:
NC_003155.4), S. avermitilis 76-02-e 균주 (He et al. 2014), S. avermitilis 14- 12A 균주 (Gao et al. 2009), S. avermitilis 3-1 15 균주 (Gao et al. 2010) 등을 들 수 있으나, 이에 제한되는 것은 아니다.
스트랩토마이세스 아베르미틸리스는 아베멕린을 생산하기 위한 PKS 클러스터 (Polyketide synthase gene cluster; 폴리케타이드 합성효소 유전자
클러스터)라는 거대 유전자군을 포함하고 있다. 상기 아베멕틴 PKS 유전자군은 aveAl , aveA2, aveA3 및 aveA4 유전자를 포함하고 있으며, aveAl 유전자는 로딩 모들과 모들 1번과 모들 2번, aveA2 유전자는 모들 3번 내지 모들 6번, aveA3 유전자는 모들 7 내지 모들 9, aveA4 유전자는 모듈 10번 내지 모들 12번을 포함하고 있고, 각 모들은 하위 도메인들로 구성되어 있다.
밀베마이신 생산 균주는 스트랩토마이세스 밀베마이시니쿠스 Streptomyces milbemycinicus), 스트렙토마이세스 시아네오그리세우스 아속
논入 1아노게 ώ (Streptomyces cyaneogriseus sp. Noncyanogenus), 스트랩토마이세스 난찬젠시스 (Streptom^yces "i c wwgem y) 또는 스트렙토마이세스
빙첸젠시스 (5Vre/?tom_yce^u 7gc½«ggera )를 포함하나, 이에 제한되는 것은 아니다. 스트템토마이세스 하이그로스코피쿠스 아속 아우레오라크리모수스로는, 스트랩토마이세스 밀베마이시니쿠스 ( tre t 기 milbemycinicus) NRRL 5739 균주를 사용할 수 있으나, 이에 제한되는 것은 아니다.
밀베마이신 생산 균주는 밀베마이신을 생산하기 위한 PKS 클러스터 유전자군을 포함하고 있다. 상기 밀베마이신 PKS 유전자군의 구성은 아베멕틴 PKS 유전자군의 구성과 유사하며, milAl , milA2, milA3 및 milA4 유전자를 포함하고 있으며, 각 유전자는 모들 및 하위 도메인들로 구성되어 있다.
본 발명은 아베멕틴 생산 균주인 스트렙토마이세스 아베르미틸리스의 aveA l 유 ^자, 이에 상웅하는 밀베마이신 생산 균주의 milAl 유전자로
치환시킴으로써 스트렙토마이세스 아베르미틸리스 내에 하이브리드 PKS 유전자가 포함되도록 하였고, 상기 하이브리드 PKS 를 포함하는 재조합
스트렙토마이세스 아베르미틸리스 균주가 다양한 아베멕틴 유도체들을 생산할 수 있음을 확인하였다.
상기 재조합 스트렙토마이세스 아베르미틸리스 균주가 생산하는 아베멕틴 유도체는, 22,23-디하이드로 -25-이소프로필 -아베멕틴 (22,23-dihydro-25-isopropyl- avermectin), 5-메특시 -22,23-디하이드로 -25-메틸 -아베멕틴 (5-methoxy-22,23-dihyclro-25- methyl-avermectin), 5-메톡시 -22,23-디하이드로 -25-에틸-아베멕틴 (5-methoxy-22,23- dihydro-25-ethyl-avermectin) 및 5-메록시 -22,23-디하이드로 -25-이소프로필 -아베멕틴 (5- methoxy-22,23-dihydro-25-isopiOpyl-avermectin)으로 이루어진 군에서 선택되는 1종 이상을 포함한다.
또한, 이 중에서 5-메록시 -22,23-디하이드로 -25-메틸-아베멕틴 (5-methoxy- 22,23-dihydro-25-methyl-avermectin), 5-메특시 -22,23-디하이드로 -25-에틸 -아베맥틴 (5- methoxy-22,23-dihydro-25-ethyl-avermectin)은 종래 구축된 화합물 데이터베이스에서 검색되지 않는 신규한 화합물임이 확인되었다. 이들 신규 아베멕틴 유도체들은 작물 보호제 및 /또는 동물의약품 용도로 사용될 수 있으며, 종래 개발된 아베멕틴 유도체들을 대체할 수 있다.
다른 예로, 스트렙토마이세스 아베르미틸리스 (Streptomyces avermitilis)의
aveAl 유전자가 밀베마이신 생산 균주의 milAl 유전자의 전부 또는 일부로 치환되며, 아베멕틴 유도체들을 생산하는 재조합 스트렙토마이세스
아베르미틸리스 균주가 제공된다.
다른 예로, 5-메록시 -22,23-디하이드로 -25-메틸 -아베멕틴 (5-methoxy-22,23- dihydro-25-methyl-avermectin) 또는 이의 염, 5-메록시 -22,23-디하이드로ᅳ 25-에틸- 아베멕틴 (5-methoxy-22,23-dihydro-25-ethyl-avermectin) 또는 이의 염, 및 이들 화합물들의 작물 보호제 및 /또는 동물의약품으로서의 용도가 제공된다.
상기 5-메톡시 -22,23-디하이드로 -25-메틸 -아베멕틴은 다음의 화학식으로 나타낼
또한, 상기 5-메톡시 -22,23-디하이드로 -25-에틸 -아베멕틴은 다음의 화학식으로 나타낼 수 있다:
또한, 앞서 설명한 바와 같이, 아베멕틴 생산 균주인 스트렙토마이세스 아베르미틸리스의 aveAl 유전자 및 aveA3 유전자의 전체 또는 일부 (적어도 aveA3의 모듈 7의 DH 도메인 코딩 유전자를 포함)를, 이에 상웅하는 밀베마이신
생산 균주의 milAl 및 milA3 유전자의 전체 또는 일부 (적어도 milA3의 모들 7의 DH-ER도메인 코딩 유전자를 포함)로 치환시킴으로써 스트렙토마이세스 아베르미틸리스 내에 하이브리드 PKS 유전자가 포함되도록 하였고, 상기 하이브리드 PKS 유전자를 포함하는 재조합 균주가 밀베마이신을 생산할 수 있음이 확인되었다.
따라서, 다른 예로, 스트랩토마이세스 아베르미틸리스 (Streptomyces avermitilis)의 aveAl 유전자의 전부 또는 일부가 밀베마이신 생산 균주의 milAl 유전자의 전부 또는 일부로 치환되고, aveA3 유전자의 전부 또는 일부 (적어도 aveA3의 모들 7의 DH 도메인 코딩 유전자를 포함)가 밀베마이신 생산 균주의 milA3 유전자의 전부 또는 일부 (적어도 milA3의 모들 7의 DH-ER도메인 코딩 유전자를 포함)로 치환된, 밀베마이신을 생산하는 재조합 스트렙토마이세스 아베르미틸리스 균주가 제공된다.
상기 aveA3 유전자는 전체가 milA3 유전자로 치환될 수도 있으나, milA3 유전자 중에서 숙주 균주에 밀베마이신을 생산능을 부여할 수 있는 최소한의 부위만 aveA3 유전자의 상응하는 부위에 치환 (삽입)되는 것이 가능하다. 예를 들어, 상기 milA3 유전자 중에서 숙주 균주에 밀베마이신을 생산능을 부여할 수 있는 최소한의 부위는 milA3 유전자 중 모들 7 전부 또는 모들 7의 DH-ER 도메인의 코딩 유전자를 포함할 수 있으며, aveA3 유전자 중 모들 7 전부 또는 적어도 모들 7의 DH 도메인을 포함하는 모들 7의 일부의 코딩 유전자가, 밀베마이신 생산 균주의 milA3 유전자 중 모들 7 전부 또는 모들 7의 DH-ER 도메인의 코딩 유전자로 치환될 수 있다.
일 구현예로, 스트랩토마이세스 아베르미틸리스 균주에서 aveAl 유전자가 밀베마이신 생산 균주의 milAl 유전자로 치환된 균주는, 스트렙토마이세스 아베르미틸리스 균주는, 스트렙토마이세스 아베르미틸리스 DBM-01 균주 (수탁번호 KCTC12889BP)일 수 있다.
다른 예로, 스트렙토마이세스 아베르미틸리스 균주에서 aveAl 유전자가 밀베마이신 생산 균주의 milAl 유전자로 치환되고, aveA3 유전자의 모들 7의 코딩 유전자 부위가 밀베마이신 생산 균주의 milA3 유전자의 모들 7의 코딩 유전자 부위로 치환된 균주는, 스트랩토마이세스 아베르미틸리스 DBM-03-A
균주 (수탁번호 KCTC12890BP)일 수 있다.
다른 예로, 스트렙토마이세스 아베르미틸리스 균주에서 aveAl 유전자가 밀베마이신 생산 균주의 milAi 유전자로 치환되고, aveA3 유전자의 모들 7 중 KS 도메인을 제외한 모들 7의 도메인들의 코딩 유전자 부위가 밀베마이신 생산 균주의 milA3 유전자의 모들 7 중 KS 도메인을 제외한 모들 7의 도메인들의 코딩 유전자 부위로 치환된 균주는, 스트랩토마이세스 아베르미틸리스 DBM-03-B 균주 (수탁번호 KCTC12891BP)일 수 있다.
다른 예로, 스트랩토마이세스 아베르미틸리스 균주에서 aveAl 유전자가 밀베마이신 생산 균주의 milAi 유전자로 치환되고, aveA3 유전자의 모듈 7 중 KS 도메인 및 AT를 제외한 모들 7의 도메인들의 코딩 유전자 부위가 밀베마이신 생산 균주의 milA3 유전자의 모듈 7 중 KS 도메인 및 AT도메인을 제외한모들 7의 도메인들의 코딩 유전자 부위로 치환되고, aveA3 유전자의 모들 9 중 ACP 도메인을 제외한 모들 9의 도메인들의 코딩 유전자 부위가 밀베마이신 생신- 균주의 tnilA3 유전자의 모들 9 중 ACP 도메인을 제외한 모들 9의 도메인들의 코딩 유전자 부위로 치환된 균주가 제공된다. 상기 균주는 aveA3의 모들 7의 DH 도메인부터 모들 9의 KR도메인까지의 영역 (aveA3의 모들 7의 DH 도메인, KR도메인, 및 ACP 도메인, 모들 8, 모들 9의 KS 도메인, AT도메인, DH 도메인, 및 KR도메인을 N-말단에서 C-말단 방향으로 포함하는 영역)의 코딩 유전자 부위가 밀베마이신 생산 균주의 milA3의 모듈 7의 DH 도메인부터 모들 9의 KR 도메인까지의 영역 (milA3의 모들 7의 DH 도메인, ER도메인, KR 도메인, 및 ACP 도메인, 모들 8, 모들 9의 KS 도메인 , AT도메인, DH 도메인, ER도메인, 및 KR 도메인을 N-말단에서 C-말단 방향으로 포함하는 영역)의 코딩 유전자 부위로ᅵ 치환된 것일 수 있으며, 예컨대, 스트렙토마이세스 아베르미틸리스 DBM-03-C 균주 (수탁번호 KCTC13083BP)일 수 있다.
그러나, 상기 기탁 균주들은 본 발명의 대표적인 구현예에 불과하며, 본 발명의 범위가 이에 제한되는 것은 아니다.
스트렙토마이세스 아베르미틸리스의 aveAl 및 /또는 aveA3 유전자의 치환은, 당업계에 알려진 공지의 기술들, 예를 들어 상동 재조합 ((homologous recombination)에 의하여 수행될 수 있다.
일 구현예로, 밀베마이신 생산 균주에서 분리한 milAi 및 /또는 milA3 유전자의 전체 또는 일부가 상동 재조합을 통하여 숙주 균주 게놈에 통합될 수
있도록 하기 위한 유전자 치환용 백터를 제조할 수 있다. 상기 백터는 숙주 게놈의 특정 유전자 위치로 목적하는 유전자를 제거 또는 삽입할 수 있는 백터로, 상동 재조합이 일어나도록 타겟팅하고자 하는 특정 유전자 부위에 상동인 염기 서열을 포함할 수 있다.
본 발명의 일 양태로서, 상기 스트렙토마이세스 아베르미틸리스 재조합 균주 생산에 사용되는 재조합 백터가 제공된다.
상기 재조합 백터는
(1) 밀베마이신 생산 균주의 밀베마이신 생합성을 수행하는 폴리케타이드 합성효소의 1번 유전자 (milAl); 및
(2) 밀베마이신 생산 균주의 밀베마이신 생합성을 수행하는 폴리케타이드 합성효소의 3번 유전자 (milA3)의 전부 또는 일부 (적어도 milA3 유전자 중 모들 7 코딩 유전자 또는 모들 7의 DH 도메인 코딩 유전자 및 ER도메인 코딩 유전자를 포함)
올 포함하는 것일 수 있다. 이 경우 milAl 유전자와 milA3의 전부 또는 일부는 하나의 백터에 함께 포함되거나 각각 별개의 백터에 포함될 수 있다.
일 구체예에서, 상기 재조합 백터는 밀베마이신 생산 균주의 milAl 유전자; 및 밀베마이신 생산 균주의 milA3 유전자 또는 밀베마이신 생산 균주의 milA3의 모들 7의 전부 또는 일부의 코딩 유전자에 더하여, 다음으로 이루어진 군에서 선택된 하나 이상을 추가로 포함할 수 있다:
밀베마이신 생산 균주의 milA3의 모들 7의 DH-ER도메인을 제외한 도메인들 (예컨대, KS, AT, KR, 및 ACP 도메인) 중에서 선택된 하나 이상의 코딩 유전자;
밀베마이신 생산 균주의 miiA3의 모듈 8의 코딩 유전자 또는 모들 8의 도메인들 중 하나 이상의 코딩 유전자; 및
밀베마이신 생산 균주의 milA3의 모들 9의 코딩 유전자 또는 모들 9의 도메인들 중 하나 이상의 코딩 유전자.
일 구체예에서, 상기 재조합 백터는
밀베마이신 생산균주의 milAl 유전자; 및 다음에서 선택된 milA3 유전자 일부 또는 이의 변이체를 포함할 수 있다:
밀베마이신 생산 균주의 milA3 유전자의 모들 7 중의 KS 도메인의 코딩
유전자 부위가 결실된, 예컨대, milA3 유전자의 모들 7의 AT도메인, DH 도메인, ER도메인, KR도메인 및 ACP 도메인의 코딩 유전자를 포함하거나 이들로 구성된 milA3 유전자의 일부;
밀베마이신 생산 균주의 milA3 유전자의 모듈 7 중의 KS 도메인의 코딩 유전자가 aveA3 유전자의 모들 7의 KS 도메인의 3딩 유전자로 치환된 milA3'의 모들 7코딩 유전자 변이체;
밀베마이신 생산 균주의 milA3 유전자의 모들 7 중의 AT 도메인의 코딩 유전자 부위가 결실된, 예컨대, milA3 유전자의 모들 7의 KS 도메인, DH도메인, ER 도메인, KR도메인 및 ACP 도메인의 코딩 유전자를 포함하는 milA3의 모들 7코딩 유전자 변이체;
밀베마이신 생산 균주의 milA3 유전자의 모들 7 중의 AT도메인의 코딩 유전자가 aveA3 유전자의 모들 7의 AT도메인의 코딩 유전자로 치환된 milA3의 모들 7의 코딩 유전자 변이체;
밀베마이신 생산 균주의 milA3 유전자의 모듈 7 중의 KS 도메인 및 AT 도메인의 코딩 유전자가 결실된, 예컨대, milA3 유전자의 모들 7의 DH 도메인, ER 도메인, KR도메인 및 ACP 도메인의 코딩 유전자를 포함하는 milA3의 모들 7의 코딩 유전자 변이체; 및
밀베마이신 생산 균주의 milA3 유전자의 모들 7 중의 KS 도메인 및 AT 도메인의 코딩 유전자가 각각 aveA3 유전자의 모들 7의 KS 도메인 및 AT 도메인의 코딩 유전자로 치환된 milA3의 모들 7의 코딩 유전자 부위 변이체. 상기 재조합 백터는 다음으로 이루어진 군에서 선택된 하나 이상을 추가로 포함할 수 있다:
밀베마이신 생산 균주의 milA3 유전자의 모들 9 중의 ACP 도메인의 코딩 유전자가 결실된, 예컨대, milA3 유전자의 모들 9의 KS 도메인 , AT도메인, DH 도메인, 및 KR도메인의 코딩 유전자를 포함하는 milA3의 모들 9의 코딩 유전자 변이체; 및
밀베마이신 생산 균주의 miiA3 유전자의 모듈 9 중의 ACP 도메인의 코딩 유전자가 aveA3 유전자의 모들 9의 ACP 도메인의 코딩 유전자로 치환된 milA3의 모들 9의 코딩 유전자 변이체.
일 예에서, 상기 재조합 백터에 포함되는 milA3 유전자 변이체는
밀베마이신 생산 균주의 milA3 유전자 중의 모들 7의 DH 도메인부터 모들 9의 KR도메인까지의 영역 (예컨대, milA3의 모들 7의 DH 도메인, ER도메인, KR 도메인, 및 ACP 도메인, 모들 8, 모들 9의 KS 도메인 , AT도메인, DH 도메인, ER 도메인, 및 KR 도메인을 N-말단에서 C-말단 방향으로 포함하는 영역)의 코딩 유전자를 포함하는 milA3 유전자 변이체 (일부)일 수 있으나 이에 제한되는 것은 아니다.
본원의 일 실시예에서, milAl을 치환하기 위한 재조합 백터는 milAl 유전자 전체를 포함하고, 상동 재조합을 위하여 aveAl 유전자의 upstream 및 downstream 지역과 상동성을 가지는 부위를 milAl의 어느 한쪽 말단 또는 양쪽 말단에 연결된 형태로 구성될 수 있다. 또한, 다른 실시예에서는, milA3을 치환하기 위한 재조합 백터는, milA3 유전자의 7번 모들의 코딩 유전자의 전체 또는 일부를 포함하고, 상동 재조합을 위하여 aveA3 및 /또는 aveA4 유전자 지역과 상동성을 가지는 부위를 milA3 유전자의 7번 모들의 코딩 유전자의 전체 또는 일부의 어느 한쪽 말단 또는 양쪽 말단에 연결된 형태로 구성될 수 있다. 상기 백터는 본원의 대표적인 실시예일뿐이며, 본원의 범위가 이에 제한되는 것은 아니다.
상기 백터는, 상동 재조합을 위하여 숙주 유전자 부위와 상동성을 가지는 부위를 포함하는데, 여기에서 상동이란 숙주 유전자 부위의 염기 서열과의 동일성 정도를 나타내는 것으로, 예를 들어, 숙주 유전자의 염기서열과 90% 이상, 95% 이상 또는 98% 이상 동일한 것일 수 있다.
스트렙토마이세스에서 사용하기 위한 다양한 여러 백터들, 예를 들어 파지 고 카피수 (high copy number) 플라스미드, 저 카피수 플라스미드, 및 대장균 (E. Coli)- 스트렙토마이세스 셔를 백터들이 개발되어 왔으며, 이들 .백터들을 본 발명을 구현하기 위하여 사용할 수 있다. 예를 들어, pCR-Blunt, pCR2.1(Invitrogen), pGEM3Zf(Promega) 및 셔를 백터 pWHM3, pKCl 139 등을 예시할 수 있으나, 이에 제한되는 것은 아니다.
상기 백터는, 형질전환된 세포를 선별하기 위한 목적으로
선별마커 (selection marker)를 더욱 포함할 수 있으며, 예를 들어, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있고, 포지티브 선별마커와 네가티브
선별마커를 예시할 수 있다. 포지티브 선별마커란 선택제 (selective agent)가 처리된 환경에서 선택 마커를 발현하는세포만 생존하도록.하여 포지티브 선택을 가능하게 하는 마커로, 아프라마이신, 네오마이신, 하이그로마이신, 히스티디놀 디하이드로게나제 (histidinol dehydrogenase gene: hisD) 또는 구아닌
포스포리보실트랜스퍼라제 (guanine phosphosribosyltransferase: Gpt) 등이 있으나, 이에 제한되지 않는다. 네가티브 선별마커란 무작위적 삽¾ (random insertion)이 일어난 세포를 선별하여 제거하는 네가티브 선택을 가능하게 하는 마커로, 허피스 심플렉스 바이러스 -싸이미딘 키나제 (Herpes simplex virus-thymidine kinase: HSV-tk), 하이포잔틴 포스포리보실 트랜스퍼자제 (hypoxanthine phosphoribosyl transferase: Hprt), 싸이토신 디아미네즈 (cytosine deaminase), 디프테리아 록신 (Diphtheria toxin) 등이 있으나, 이에 제한되지 않는다.
상기 백터 제작은 당해 기술분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술
분야에서 일반적으로 알려진 제한효소 등을사용할 수 있다.
본 발명의 백터는 스트렙토마이세스 세포에서 작용하지만, 예를 들어 클로닝 또는 발현 목적을 위해 다른 박테리아 또는 진핵 세포로 또한 형질전환될 수 있다. 예를 들어, 아메리칸 타입 컬쳐 컬렉션 (American Type Culture Collection; ATCC)로부터 구입할 수 있거나, 시판 중인 DH5a 균주와 같은 에스케리키아 콜라이 균주가 전형적으로 사용될 수 있다. 바람직한 진핵 숙주 세포로는
포유동물 세포, 곤충 세포 또는 효모 세포가또한 효과적으로 사용될 수 있다. 숙주 균주 내로 본 발명의 백터를 도입 방법은 핵산을 세포 내로
도입하는 어떠한 방법도 포함되며, 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예들 들어, 원형질체 (protoplast) 형질전환, 전기천공법 (electroporation), 전기주입법 (electroinjection), 미세주입법 (microinjection), 인산칼슘공동-침전법 (calcium phosphate co-precipitation), 염화캄슘 /염화루비듐법 , 레트로바이러스 감염 (retroviral infection), DEAE-덱스트란 (DEAE-dextran), 양이온 리포좀 (cationic liposome)법 , 폴리에틸렌글리콜 침전법 (polyethylene glycol-mediated uptake), 유전자총 (gene gun) 등을 이용할 수 있으나, 이에 제한되는 것은 아니다. 이 때 원형의 백터를 적절한 제한효소로 절단하여 선형의 백터 형태 또는 플라스미드를 제거한 선형의 백터 형태로 도입할 수 있다. 형질전환체는 선별마커,
예를 들어 전술한 바와 같이 재조합 백터와 연관된 항생물질 저항성을 발현시키는 세포를 선택하는 방법과 같은 표준 절차에 따라 선택할 수 있다.
이와 같이 제조된 재조합 균주를 배양하여 밀베마이신을 생산할 수 있으며, 예를 들어, 밀베마이신 A3, 밀베마이신 A4, 밀베마이신 α2, 밀베마이신 α4 및 밀베마이신 G 로 이루어진 군에서 선택되는 1종—이상의 밀베마이신을 생산할 수 있다.
재조합 균주의 배양은 균주의 생육과 밀베마이신의 대량 생산에
적합하도톡 온도, 배지의 ρΗ 및 배양시간 등의 조건들을 적절하게 조절할 수 있다. 상기 배양 방법의 예에는, 회분식, 연속식 및 유가식 배양이 포함되나, 이에 제한되는 것은 아니다.
배양에 사용되는 배지는 특정한 균주의 요구조건을 적절하게 만족시켜야 한다. 상기 배지는 다양한 탄소원, 질소원, 인원 및 미량원소 성분을 포함할 수 있다. 발현 백터가 유도성 촉진자를 포함하는 경우에는, 은도 변화, 영양원의 고갈, 무상 유도 물질 (예를 들어, 이소프로필 -β-D-티오갈락토피라노시드 (IPTG)와 같은 탄수화물의 유사 물질)의 첨가, 과잉 .대사 부산물의 축적 등과 같은 적절한 유도 조건은 발현을 유도하는데 필요에 따라 적용될 수 있다.
. 배지 내 탄소원으로는 글루코즈, 사카로즈, 락토즈, 프락토즈, 말토즈, 전분, 셀를로즈와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코벗유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세를, 에탄을과 같은 알코을, 아세트산과 같은 유기산을 예시할 수 있으나, 이에 제한되는 것은 아니다. 이들 물질은 개별적으로 또는 흔합물로서 사용될 수 있다. 배지 내 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄을 예시할 수 있으나, 이에 제한되는 것은 아니다.
질소원 또한 개별적으로 또는 흔합물로서 사용할 수 있다. 배지 내 인원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상웅하는 나트륨 -함유 염을 예시할 수 있으나, 이에 제한되는 것은 아니다. 또한, 배양 배지는 성장에 필요한
황산마그네슘 또는 황산철과 같은 금속염을 포함하거나, 아미노산 및 비타민과 같은 필수 성장 물질을 포함할 수 있으나, 이에 제한되는 것은 아니다. 상기된 원료들은 배양 과정에서 배양물에 적절한 방식에 의해 회분식으로 또는
연속식으로 첨가될 수 있다.
또한, 필요에 따라, 수산화나트륨, 수산화칼륨, 암모니아와 같은 기초 화합물 또는 인산 또는 황산과 같은 산 화합물을 적절한 방식으로 사용하여 배양물의 pH를 조절할 수 있다. 또한, 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 호기 상태를 유지하기 위해 배양물 내로 산소 또는 산소 -함유 기체 (예, 공기)를 주입할 수 있으며, 배양물의 온도는 보통 20 내지 45, 바람직하게는 25 내지 40 일 수 있다. 배양은 원하는 밀베마이신의 생산량이 최대로 얻어질 때까지 계속될 수 있다.
재조합 미생물로부터 생산된 밀베마이신은, 당업계에 널리 알려져 있는 방법으로 세포, 세포 용해물 또는 배양 배지로부터 단리되거나 실질적으로 정제될 수 있다. 밀베마이신의 회수 방법의 예로서, 유기용매 추출법, 원심분리,
초음파파쇄, 여과, 결정법 (crystallization), 이온교환크로마토그래피, 친화성
크로마토그래피, 고성능 액체 크로마토그래피 (high performance liquid chromatography: HPLC), 가스 크로마토그래피 (gas chromatography: GC) 등의 방법이 있으나, 이들 예에 한정되는 것은 아니다. 구체예로, 균주 배양물로부터 유기용매를 이용하여 생성 물질들을 추출한 후, 실리카겔, 알루미나, 덱스트란겔, 이온교환 수지, 합성흡착제, 분자체, C8H17, C18H37, C6H5 등의 화학 결합형 실리카겔 등의 담체를 사용한 크로마토그래피에 부여하여, 얻어진 목적 화합물을 함유하는 분획을 농축 건조시키는 방법으로 회수할 수 있다.
본 발명의 다른 예는 앞서 설명한 재조합 스트렙토마이세스
아베르미틸리스 균주 또는 상기 균주의 배양물; 재조합 백터; 및 아베멕틴 유도체 또는 이의 염으로 이루어진 군에서 선택된 1종 이상을 유효성분으로 포함하는 해층 방제용 조성물을 제공한다.
다른 예는 앞서 설명한 재조합 스트템토마이세스 아베르미틸리스 균주 또는 상기 균주의 배양물; 재조합 백터; 및 아베멕틴 유도체 또는 이의 염으로 이루어진 군에서 선택된 1종 이상을 작물에 적용하는 단계를 포함하는 해층 방제 방법을 제공한다.
상기 해충 방제는 해층에 대한 살층, 기피 등의 저해 효과를 포괄적으로 의이한다ᅳ
상기 해충은 동물 및 /또는 식물에 위해를 가하는 모든 절지 동물의 성충,
유층 및 알을 총칭하는 것으로, 밀베마이신 또는 이의 유도체, 및 /또는 아베멕틴 또는 이의 유도체가 방제 활성을 갖는 모든 해층의 성충 및 /또는 유충일 수 있다. 예컨대, 상기 해충은 다음으로 이루어진 군에서 선택된 1종 이상일 수 있다:
- 반시류 (Hemiptera) (예컨대, 다음을 포함함:
멸구류 (Delphacidae), 예컨대, 애멸구 (Laodelphax striatellus), 벼멸구
(Nilaparvata lugens), 흰등멸구 (Sogatella furcifera) 등; 매미충류 (Deltocephalidae), 예컨대, 끝동매미층 (Nephotettix cincticeps), 두점끝 동매미층 (Nephotettix virescens) 등; 진딧물류 (Aphididae), 예컨대, 목화진딧물 (Aphis gossypii), 복숭아혹잔 딧물 (Myzus persicae), 양배추가루진딧물 (Brevicoryne brassicae), 감자수염진딧물
(Macrosiphum euphorbiae), 싸리수염진딧물 (Aulacorthum solam), 기장테두리진딧물 (Rhopalosiphum padi), 글소리진 물 (Toxoptera citricidus) 등; 노린재류
(Pentatomidae), 예컨대, 풀색노린재 (Nezara antennata), 톱다리개미허리노 린재
(Riptortus clavetus), 호리허리노린재 (Leptocorisa chinensis), 가시점등글노린재.
(Eysarcoris parvus), 썩덩나무노린재 (Halyomorpha mista), 장님노린재 (Lyus lineolaris) 등; 가루이류 (Aleyrodidae), 예 컨대 온실가루이 (Trialeurodes vaporariorum), 담배가루이 (Bemisia tabaci), 은빛잎가루이 (Bemisia argentifolii) 등; 깍지벌레류 (Coccidae), 예컨대, 캘리포니아붉은깍지벌레 (Aonidiella aurantii), 샌호제깍지벌 레 (Comstockaspis perniciosa), 화살깍지벌레 (Unaspis citri), 루비깍지벌레 (Ceroplastes rubens), 이세 리아깍지벌레 (Icerya purchasi) 등; 방패벌레류 (Tingidae); 나무이류 (Psyllidae) 등);
- 인시류 (Lepidoptera) (예컨대, 다음을 포함함: 명나방류 (Pyralidae), 예컨대, 이화명나방 (Chilo suppressalis), 엘로우 라이스 나무좀 (Tryporyza incertulas), 혹명나방 (Cnaphalocrocis medinalis), 목화명나방 (Notarcha derogata), 화랑곡나방 (Plodia interpunctella), 조명나방 (Ostrinia furnacalis), 유럽조명나방 (Ostrinia nubilaris), 배추순나방 (Hellula undalis), 잔디포층나방 (Pediasia teterrellus) 등; 밤나방류
(Noctuidae), 예컨대, 담배거세미나방 (Spodoptera litura), 파밤나방 (Spodoptera exigua): 멸강나방 (Pseudaletia separata), 도둑나방 (Mamestra brassicae), 검거세미나방 (Agrotis ipsilon), 가두배추금날개밤나비 (Plusia nigrisigna), 토리코플루시아류 (Thoricoplusia spp.), 담배밤나방류 (Heliothis spp.), 담배나방류 (Helicoverpa spp.) 등; 흰나비류 (Pieridae), 예컨대, 배추흰나비 (Pieris rapae) 등; 잎말이나방류 (Tortricidae), 예컨대,
애모무늬잎말이나방류 (Adoxophyes spp.), 복숭아순나방 (Grapholita molesta), 콩나방 (Leguminivora glycinivorella), 팔나방 (Matsumuraeses azukivora),
사과애모무늬잎말이나방 (Adoxophyes orana fasciata), 차애모무늬잎말이나방
(Adoxophyes honmai), 차잎말이나방 (Homona magnanima), 검모무늬잎말이나방 (Archips fuscocupreanus), 코드린나방 (Cydia pomonella) 등; 가는나방류
(Gracillariidae), 예컨대, 동백가는나방 (Caloptilia theivora), 사과굴나방
(Phyllonorycter ringoniella) 등; 심식나방류 (Carposinidae), 예컨대, 복승아심식나방 (Carposina niponensis) 등; 굴나방류 (Lyonetiidae), 예컨대, 은무늬굴나방류 (Lyonetia spp.) 등; 독나방류 (Lymantriidae), 예컨대, 매미나방류 (Lymantria spp.), 독나방류 (Euproctis spp.) 등; 집나방류 (Yponomeutidae), 예컨대, 배추좀 나방 (Plutella xylostella) 등; 뿔나방류 (Gelechiidae), 예컨대, 목화다래나방 (Pectinophora gossypiella), 감자뿔나방 (Phthorimaea operculella) 등; 불나방류 (Arctiidae), 예컨대, 미국흰불나방 (Hyphantria cunea) 등; 곡식좀나방류 (Tineidae), 예컨대, 옷좀나방 (Tinea translucens) 등);
- 총채벌레목 (Thysanoptera), 예컨대, 다음을 포함함: 꽃노랑총채벌레
(Frankliniella occidentalis), 오이총채벌레 (Thrips palmi), 볼록총채벌레 (Scirtothrips dorsalis), 파총채벌레 (Thrips tabaci), 대만총채벌레 (Frankliniella intonsa),
담배총채벌레 (Frankliniella fusca) 등;
- 쌍시류 (Diptera) (예컨대, 다음을 포함함:
굴파리류 (Agromyzidae), 예컨대, 고자리파리 . (Hylemya antiqua),
씨고자리파리 (Hylemya platura), 벼잎굴파리 (Agromyza oryzae), 벼애잎굴파리 (Hydrellia griseola), 벼노랑굴파리 (Chlorops oryzae), 아메리카잎굴파리 (Liriomyza trifolii) 등; 멜론파리 (Dacus cucurbitae), 지중해과실파리 (Ceratitis capitata) 등);
- 초시류 (Coleoptera), 예컨대, 점박이 무당벌레 (EpUachna
vigintioctopunctata), 오이잎벌레 (Aulacophora femoralis), 벼룩잎벌레 (Phyllotreta striolata), 며 벌레 (Oulema oryzae), 벼뿌리바구미 (Echinocnemus squameus), 벼물바구미 (Lissorhoptrus oryzophilus), 목화바구미 (Anthonomus grandis), 팔바구미 (Callosobruchus chinensis), 헌팅 바구미 (Sphenophorus venatus), 왜콩풍뎅이 (Popillia japonica), 구리풍뎅이 (An이 nala cuprea), 옥수수잎벌 레류 (Diabrotica spp.), 콜로라도감자잎벌레 (Leptinotarsa decemlineata), 방아벌레류 (Agriotes spp.), 궐련벌레
(Lasioderma serricorne) 등;
- 메뚜기류 (Orthoptera), 예컨대, 땅강아지 (Gryllotalpa africana), 벼메뚜기 (Oxya yezoensis), 벼메뚜기 (Oxyajaponica) 등;
- 막시류 (Hymenoptera), 예컨대, 무잎벌 (Athalia rosae), 가위개미 (일개미)류 (Acromyrmex spp.), 불개미류 (Solenopsis spp.) 등;
- 이목 (Phthiraptera), 예컨대, 소 이 (Damalinia bovis, Haematopinus eurysternus. Linognathus vituli), 돼지 이 (Haematopinus suis) 등;
- 진드기류 (Acarina) (예컨대, 다음을 포함함:
웅애류 (Tetranychidae), 예컨대, 점박이웅애 (Tetranychus urticae), 글웅애 (Panonychus citri), 나무웅애 류 (Oligonychus spp.) 등; 혹응애류 (Eriophyidae), 예컨대, 귤녹웅애 (Aculops pelekassi); 먼지웅애류 (Tarsonemidae), 예컨대,
차먼지웅애 (Polyphagotarsonemus latus); 지응애류 (Tenuipalpidae); 치레웅애류
(tuckerellidae); 가루진드기류 (Acaridae), 예컨대, 긴털가루진드기 (Tyrophagus putrescentiae) 등; 먼지진드기 류 (Pyroglyphidae), 예컨대, 큰다리먼지진드기
(Dermatophagoides farinae), 세로무늬먼지진드기 (Dermatophagoides ptrenyssnus) 등; 발톱진드기류 (Cheyletidae), 예컨대, 짧은빗살발톱진드기 (Cheyletus eruditus), 발톱진드기 (Cheyletus malaccensis), 케일레투스 무레이 (Cheyletus moorei) 등;
음진드기류 (scabies mites), 예컨대, 음진드기 (Sarcoptes scabiei) 등;
선층류 (Nematodes), 예컨대, 소나무재선층 (Bursaphelenchus xylophilus), 뿌리혹선충 (Meloidogyne spp.) 벼잎선층 (Aphelenchoides besseyi), 딸기아선층
(Nothotylenchus acris), 개구중 (Ancylostoma caninum), 모두중 (Capillaria spp.), 개사상충 (Dirofilaria immitis), 가축에 기생하는 선충류 (roundworn) 등.
상기 작물은 해층에 의하여 피해를 입을 수 있는 모든 식물일 수 있다. 상기 작물에 적용하는 단계는 침지, 분사, 도포 등의 통상적인 모든 방법에 의하여 수행될 수 있다.
본 명세서에 기재된 유전자 서열 및 아미노산 서열은 기능성 동등성을 유지하는 한, 60% 이상, 65% 이상, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 92% 이상, 94% 이상, 96% 이상, 98% 이상, 또는 99% 이상의 서열 상동성을 갖는 경우를 포함하는 것으로 해석될 수 있다.
【발명의 효과】
본 발명에서 제공된 재조합 균주를 이용하여 밀베마이신을 대량으로 생산할 수 있으며, 이에 의해 생산된 밀베마이신은농업 및 동물의약품 분야에 폭넓게 활용될 수 있다.
【도면의 간단한 설명】
도 1은 일 실시예에 따른 스트렙토마이세스 밀베마이시니쿠스 (S.
m e _yd ' « NRRL5739)의 milAl 유전자의 구성을 나타낸 것이다.
도 2는 일 실시예에 따른 스트렙토마이세스 밀베마이시니쿠스 (S.
wz ewᅳ yc/ t« NRRL5739)의 milAl 유전자를 확보하는 과정을 나타낸 것이다.
도 3은 pGEMB2-MA-DOWN-fu 백터를 구성하는 염기서열올 나타낸 것이다. 도 4a내지 도 4c는 일 실시예에 따른 pCR2.1-milAl-AC2 백터를 제조하는 과정을 나타낸 것이다.
도 5는 일 실시예에 따른 pCR2.1-Adu-MlAge 백터를 제조하는 과정을 나타낸 것이다.
도 6은 일 실시예에 따른 PCR2.1-Adu-milAl-Ac2 백터를 제조하는 과정을 나타낸 것이다.
도 7a는 일 실시예에 따른 milAl integration 백터가 도입된 균주에서 교차를 통해 milAl유전자가 삽입되는 과정을 나타낸 모식도이다.
도 7b는 일 실시예에 따른 milAl integration 백터가 도입된 균주에서 milAl이 성공적으로 삽입되었는지를 확인한 결과이다.
도 8은 일 실시예에 따른 S. avermitilis DBM-01 균주의 배양액으로부터 생성된 물질을 분석한 HPLC 결과를 나타낸다.
도 9a 및 도 9b는 일 실시예에 따른 pCR2.1-A3Mmo7A 및 pCR2.1- A3Mmo7B 백터를 제조하는 과정을 나타낸 것이다.
도 10a는 일 실시예에 따른 모들 7 교체 백터가 도입된 균주에서 교차를 통해 모들 7 유전자가 삽입되는 과정을 나타낸 모식도이다.
도 10b는 일 실시예에 따른 모들 7 교체 백터가 도입된 균주에서 모들 7 이 성공적으로 삽입되었는지를 확인한 결과이다.
도 11a내지 도 11c는 실시예에 따른 DBM-03-A와 DBM-03-B가 생성한
물질을 분석한 HPLC 분석 결과를 보여준다. 형성된 각 peak중 retention time이 표기된 peak는 Milbemycin표준품과 동일한 UV-흡광패턴 보여주는 것이다. 도 11a는 밀베마이신 표준품의 HPLC 분석결과, 도 l ib는 S. avermitilis DBM-03-A가 생성한 물질의 HPLC 분석결과, 도 11c는 S. avermitilis DBM-03-B가 생성한 물질의 HPLC 분석결과를 각각 나타낸다.
도 12는 일 실시예에 따른 모들 7 치환 균주의 배양액으로부터 생성된 물질을 분석한 HPLC 결과 및 각 피크에서 생성된 물질을 나타낸다.
도 13은 aveA3 유전자와 milA3 유전자의 AT-DH 모들간 영역의 코딩 유전자 부위 및 KR-ACP 모들간 영역의 코딩 유전자 부위의 염기서열 분석 결과를 보여준다.
도 14는 일 실시예에 따른 milA3의 모들 7의 DH 도메인부터 모들 9의 KR 도메인까지의 영역을 코딩하는 유전자 부위를 포함하는 pD7K9milA3 백터의 제작 과정을 모식적으로 보여준다.
도 15는 일 실시예에 따른 milA3 삽입 백터 pD7K9milA3가 삽입된 스트렙토마이세스 아베미틸리스 균주의 제작 과정을 모식적으로 보여준다.
도 16은 일 실시예에 따라서 제작된 S. avermitilis DBM-03-C 균주의 생성 물질의 HPLC 분석 결과를 보여주는 그래프이다.
도 17a 내지 17f는 일 실시예에 따라서 제작된 S. avermitilis DBM-03-C 균주의 생성 물질의 UPLC-qTOF-HR-MS 분석 결과를 보여주는 그래프이다 (도 17a: 밀베마이신 A3; 도 17b: 밀베마이신 A4; 도 17c: 밀베마이신 D; 도 17d: 밀베마이신 alpha2; 도 17e: 밀베마이신 alpha4; 도 17f: 밀베마이신 G).
도 18a-18c는 아베멕틴과 밀베마이신의 분자구조 차이 및 이를 유발하는 유전자의 구성을 보여주는 그림이고, 도 18d는 밀베마이신 폴리케타이드 합성효소 유전자군 (gene cluster)과 아베멕틴 폴리케타이드 합성효소 유전자군을 비교하여 보여주는 그림이다.
【발명을 실시하기 위한 구체적인 내용】
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명이 하기 실시예에 의해 한정되는 것은 아니다.
실시예 L milAl 삽입 백터 (milAl integration vector) 제작
밀베마이신 생산 균주인 스트렙토마이세스 밀베마이시니쿠스 (s.
/ 76em_y - « NRRL5739)의 milAl 유전자를 S. avermitilis SA- 의 aveAl에
치환하기 위한 백터를 제조하였다. 상기 백터는 milAl 유전자 전체를 포함하고, 통합을 위한 상동성을 가지는 aveAl 유전자의 upstream 및 downstream 지역이 milAl의 양쪽 말단에 붙여진 형태로 구성하였다. 이하, 백터 제작 과정을 상세히 설명한다.
1-1. milAl 유전자 확보
스트렙토마이세스 밀베마이시니쿠스 (S. milbemycinicus NRRL5739) genomic
DNA로부터 milAl 유전자를 확보하였다. 스트렙토마이세스 밀베마이시나쿠스 (S. w/ em_y 'a« NRRL5739)의 경우 밀베마이신 생합성 유전자들의 DNA 염기서열이 알려져 있지 않기 때문에, NCBI에 등록된 스트렙토마이세스
난잔젠入] ^(Streptomyces nanchangensis; Accession no. FJ952082) 또는
스트렙토마이세스 빙 ¾ ^.(Streptomyces bingchenggensis; Accession no.
CP002047.1)의 밀베마이신 생합성 유전자군의 염기서열을 기반으로 프라이머를 디자인하여 유전자를 증폭하여 이용하였다. 또한, 밀베마이신 생합성에 관여하는 폴리케타이드 생합성효소의 유전자는 매우 크고 높은 GC비율을 갖기 때문에 한 번에 증폭하는 것은 매우 어려운 일로 이를 극복하기 위해 유전자를 임의의 두 구역으로 나눠 증폭하였다 (도 1).
우선, milAl 유전자의 N-terminus쪽의 단편을 확보하기 위하여,
스트렙토마이세스 밀베마이시니쿠스 (S. w/½em_yd"/«tf NRRL5739)의 genomic DNA를 A1NT2-F 프라이머 (GAACCGTGTGCGGAAGAA: 서열번호 1) 및 A1CT1 -R 프라이머 (ATCAGGTCGGTGAGACGGT: 서열번호 2)를 사용하여 PCR(95도에서 5분; 98도에서 20초, 60도에서 20초 및 68도에서 10분으로 30 사이클; 및 68도에서
10분)을 통해 증폭한후 pCR2.1 백터 (TA 클로닝 백터)에 클로닝하였다. 이 백터를 pCR2.1 -NM으로 명명하였다. 다음으로, milAl 유전자의 C-terminus쪽의 단편을 확보하기 위하여, 스트랩토마이세스 밀베마이시니쿠스 (β. milbemycinicus
NRRL5739)의 genomic DNA를 A1CT1-F 프라이머 (GCAAGGTCGTCTTTGTGTGC: 서열번호 3) 및 A1 CT2-R프라이머 (CCACCAACTCGATATGGGC: 서열번호 4)를
사용하여 PCR(95도에서 5분; 98도에서 20초, 60도에서 20초 및 68도에서 10분으로 30 사이클; 및 68도에서 10분)을 통해 증폭한 후 pCR2.1 백터 (TA 클로닝 백터)에 클로닝하였다. 이 백터를 pCR2.1-CT으로 명명하였다. 상기 제조한 pCR-NM과 pCR-CT 백터를 각각 Ncol 제한효소로 처리하여 단편 (NM fragment, CT fragment)을 확보한 후 (도 1), 이들 단편을 연결 (ligation)하여 하나의 백터를 제조하였으며, 이를 pCRl l-milAl으로 명명하였다 (도 2; milAl gene서열 (서열번호: 70) 포함). 이 때, 연결된 단편의 ORF의 염기서열을 확인한 결과, 스트렙토마이세스
빙촁젠시스 (Streptomyces bingchenggensis)의 염기서열과 100% 일치하는 것을 확인하였다.
1-2. C-termimis쪽 arm 제작
milAl의 모들 2의 위치에 해당하는 일부 DNA sequence와, aveAl docking domain으로 추정되는 부위, 및 aveA2 sequence를 포함하는 DNA를 인공적으로 합성하였고, 합성된 DNA는 pGEM vector에 도입하여 pGEMB2-MA— DOWNᅳ Hi를 제작하였다 (도 3; 서열번호 35 내지 서열번호 37). 상기 제작된 pGEMB2- MA— DOWN_fu를 BamHI/Hindm 제한효소로 잘라 insert를 분리한 후,
BamHI/Hindlll로 자른 pCR2.1-CT에 연결하여 milAl의 C-terminal 부위가 aveAl의 C-terminal 부위로 교체된 pCR2.1-CT-Ac 백터를 제작하였다.
pCR2.1-CT-Ac 백터의 결합부위를 연장하기 위하여, S. avermitilis SA- 균주의 genomic DNA로부터 A2-404F 프라이머 (GGCGCTGGCAATGGACC: 서열번호 5) 및 A2PH-1500R
프라이머 (GATTACGCCAAGCTTGGCTGATTCTCCCGGGACG: 서열번호 6)를 이용하여 aveA2의 N-terminus region을 PCR증폭하고, 이를 infusion ligation을 통해 PCR2.1-CT-AC의 3' 말단에 결합하여, pCR2.1-CT-Ac2.백터를 제작하였다.
pCR2.1-CT-Ac2 백터와 pCR2.1-NM 백터를 각각 Ndel/Xbal 제한효소로 처리한 후 결합하여, milAl 유전자의 C-terminal부분이 aveAl의 것으로 치환된 milAl 유전자를 갖는 pCR2.1-milAl-Ac2 백터를 제작하였다 (도 4a내지 도 4c 참조) - 1-3. N-terminus쪽 arm 제작
S. avermitilis SA-01 균주의 genomic DNA로부터 AveD2-F
프라이머 (GATGACGGAAATCCCCTGG: 서열번호 7), AveD2-R
프라이머 (AGAATGAAAGGAGCGCGA: 서열번호 8), MA1NU-F
프라이머 (GAGGACACAGCTCAGTTGCCCAAAGCCCAGAAC: 서열번호 9), MlAge- R 프라이머 (TGATCGAAGAGCCGGGAGT: 서열번호 10), PHR-MlAg
프라이머 (CCGGCTCTTCGATCAAGCTTGGCGTAATCATGG: 서열번호 11) 및 PXF- 이용하여 N-terminus arm에 해당하는 3개의 단편을 각각 PCR증폭하고, 이를 infusion ligation을 통해 결합하여 pCR2.1-Adu-MlAge 백터를 제작하였다 (도 5).
1- 4. milAl 유전자에 양쪽 arm이 결합된 형태의 vector 제작
pCR2.1-milAl-Ac2 백터와 pCR2.1-Adu-MlAge 백터를 Xmnl 제한효소로 처리한 후 이를 infusion ligation을 통해 결합하여, pCR2.1-Adu-milAl-Ac2 백터 (서열번호 79)를 제작하였다 (도 6). 이를 아베멕틴 생산균주로 도입하기 위해 스트렙토마이시스-대장균 셔를백터인 pKC1139 백터 (M. Bierman et al., Gene, 116:43- 49)와 pCR2.1-Adu-milAl-Ac2 백터를 각각 Xbal, Hindlll 제한효소로 처리한 후 연결 (ligation)하여 pKC1139에 Adu-milAl-Ac2 구조가들어가 있는 형태인, pKC- Adu-milAl-Ac2 백터를 제작하였다. 실시예 2. milAl 치환균주 제작 및 생성물질 확인
milAl integration 백터를 S. avertmilis SA-01 균주 내로 도입시키고, 상동재조합이 일어나도록 유도하여 S. avertmilis SA-01 균주의 aveAl 유전자가 milAl 유전자로 치환된 형태의 균주를 확보하고, 배양을 통해 생성되는
신규물질을 확인하였다.
2- 1. 접합법을 통한 형질전환
PKC-Adu-milAl-Ac2 백터를 포함하고 있는 E. coli 균주 (ETl2567/pUZ8002 strain)를 chloramphenicol, kanamycin, apramycin-i- 넣은 LB 액체배지 3ml에 접종한 후 Shaking incubator에서 37, 200rpm 조건으로 18~24시간 배양하였다ᅳ 멸균된 250ml flask에 25ml LB broth를 위의 항생제와 함께 넣고, 배양액 250ul을 접종한 뒤 동일
조건으로 3시간 배양하였다다 . OD가 0.4~0.5에 이르렀을 때, 배양을 종료하고 5000rpm 에서 5분간 원심분리하였고 (4 조건) , Pellet만 취하여 냉각된 LB broth lml에 풀어주고 세척하여 균체 현탁액을 확보하였다. 또한, S. avertmilis SA-01 균주를 germination 하기 위하여, ISP4 agar plate에 host로 사용할 방선균을 7일 이상 배양하고, Spore를 loop로 긁어서 2X TY 배지에 풀어주고, 50 heating block에 넣고 10분간 activation을 실시하였다. 이와 같이 준비된 E. coli 균주 500ul과
germination된 host균주 S. avertmilis SA-01 500ul을 microtube에 넣고 inverting으로 섞고, 8000rpm 에서 2분간 원심분리하여 상층액을 제거하는 방법으로
접합 (conjugation)을 유도하여, pKC-Adu-milAl-Ac2 백터를 S. avertmilis SA-01 균주 내로 도입시켰다.
2-2. 교차에 의한 유전자 치환
상기와 같이 pKC-Adu-milAl -Ac2(Et) 백터가 도입된 균주에서 1차 교차를 유도하여 백터 전체가 균주의 염색체에 삽입되도록 하였다. 이를 위하여, apramycin이 25ug/ml 농도로 첨가된 ISP-4 고체배지를 제조한 후, pKC-Adu-milAl- Ac2 백터 도입에 의해 생성된 colony를 취한 후, 준비된 고체 배지에 streaking 하였다. 이후 고온에 민감한 pKC1 139 백터의 성질을 이용하여 백터가 복제 되는 것을 막기 위하여 37에서 7일간 배양하였다. 2-3. 2차 교차
상기 1차 교차가 일어난 균주에서 aveAl 유전자를 milAl 유전자로 치환하기 위해 2차 교차를 유도하였다 (도 7). 이를 위하여, apramycin이 25ug/ml 농도로 첨가된 ISP-4 고체배지와 항생제가 첨가 되지 않은 배지를 각각 제조하고, 1차 교차를 유도한 균주를 ISP-4 고체 배지에 도말하여 2차 교차를 유도한후, apramycin 저항성 유무로 후보 균주를 선발하였다. 스크리닝을 통해 확보한 후보 균주의 genomic DNA를 추출하여, aveAl, milAl 일부지역을 확인할 수 있는 프라이머 (표 1)를 사용하여 유전자의 교체가 정확하게 이루어졌는지 확인하였다. 이와 같이 최종 균주를 선발하고 S. avermitilis DBM-01로 명명하였으며,
KCTC(Korean Colletion for Type Cultures, 한국생명공학연구원 미생물자원센터)에 기탁하여 2015년 8월 31일자로 기탁번호 KCTC12889BP 를 부여받았다.
【표 1 ]
S. avermidlis ΌΒΜ-01 균주를 배양하기 위한 종균 배양용 배지와 생산 배양용 배지를 각각 제조하였다. 종균 배지를 제조하기 위하여, soluble starch 30g/L(Junsei, Japan), yeast extract 15g/L(Duchefa, 네덜란드), KH2P04 0.4g/L(Junsei)의 농도가 되도록 적정량의 DW에 흔합한 후 , ρΗ를 7.2로 맞추고 121 , 15분간
고압살균을 수행하였다. 층분히 식은 후, 별살한 Corn steep liquor(Sigma)를 5g/L의 농도가 되도록 첨가하였다. 또한, 생산 배지를 제조하기 위하여, soluble starch 80g/L, soybean meal 10g/L(Sigma), skim milk 15g/L(Difco), KH2P04 0.5 g/L의 농도가 되도록 적정량의 DW에 흔합한 후, pH를 그 2로 맞추고, 121 , 15분간 고압살균을 실시하였다. 생산 배양에 접종할 균주의 양을 층분히 만들기 위해, 상기 제조한 종균 배지 25ml올 멸균된 250ml baffled flask에 넣고, 균주 mycelium을 agar plate로부터 l loop씩 떠서 종균 배지에 접종하였다. 230 rpm 및 28도 조건하에서 48시간 동안 배양하였다. 또한, 생산배지 251 을 멸균된 250ml non-baffled flask 넣고 종균 배양액 1.25ml을 접종한 후, 230 rpm 및 28도 조건하에서 10일 동안 배양하였다. 생산 배양액으로부터 생성된 물질을 추출하기 위하여, 유기용매 (acetonitrile : MeOH = 1 : 1 흔합 용액) 1.5ml과 배양액 0.5ml을 섞고 충분히 vortexing하였다 . 5분간 sonication 한 후, 1시간 동안 교반하였다. 12000rpm에서 5분간 원심분리한후 상등액만 취하여 분석하였다.
추출한 시료를 아래의 조건 δ에서 HPLC UVD 분석을 통해 분석하였다.
- Mobile phase: Acetonitrile/Water(v/v)= 40/60, v/v(5min), 90/10, v/v(30min), 90/10, v/v(10min)
χ98980)83)093) X)69333)Γ0Π χ/-3)078Γ8s3r)ΓΖ£ΐ Χ£.β----- - --·
correlation을 화살표로 표시하였다.
[화학식 3]
5 -methoxy-22 ,23 -dihydro-25 -methyl-avermectin
Ivermectin 유도체 5(IV5)의 구조는 화학식 4와 같이 결정하였으며, HMBC correlation을 화살표로 표시하였다.
[화학식 4]
5 -methoxy-22,23 -dihydro-25 -ethyl-avermectin
결과적으로, 상기 물질의 분석을 통해 avermectin 생산 균주인 S. avermitilis SA-()1의 avermectin 생산 유전자군의 첫번째 유전자인 aveAl을 S. hygroscopicus subsp. aureolacrimosus의 밀베마이신 생산 유전자군의 첫번째 유전자인 milAl으로 교체하였을 때, 숙주 균주와 다른 형태의 물질 생산 패턴을 나타냄을 확인할 수 있었으며, milAl이 삽입된 균주는 각각 22,23-dihydro-25-methyl-avermectin (CAS No. 137330-81-5; Ref: DE4031039), 22,23-dihydro-25-ethyl-avermectin (CAS No. 71972-13- 9;Ref: FR2387231), 22,23-dihydro-25-isopropyl-avermectin (즉, Ivermectin B 1 b, CAS NO. 70209-81-3; Ref. US4199569), 5 -methoxy-22,23 -dihydro-25 -methyl-avermectin, 5-methoxy- 22,23-dihydro-25-ethyl-avermectin, 및 5-methoxy-22,23-dihydro-25-isopropyl-avermectin
(즉, Ivermectin Alb; Ref. US4199569)을 생성함을 알 수 있었다.
이들 중, 5-methoxy-22,23-dihydro-25-methyl-avermectin (화학식 3; IV3) 및 5- methoxy-22,23-dihydro-25-ethyl-avermectin (화학식 4; IV5)의 경우, 물질 구조를 이용한 SciFinder 검색에서 일치하는 구조를 찾지 못하였는 바, 신규 화합물인 것으로 판단되었다.
2-5. S. avermitilis DBM-01 생성물질인 IV3와 IV5의 생물학적 활성 상기 실시예 2-4에서 신규화합물로 확인된 IV3 (화학식 3) 및 IV4 (화학식 4)의 생물학적 활성올 평가하여, 상기 화합물류가 해충의 유층 및 성충, 특히 점박이웅애와 배추좀나방의 해충 구제 (살충)에 활성효과가 있음을 확인하였다. 상기 화합물류의 살충 활성을 측정하기 위하여 다음과 같은 실험을 수행하였다. 상기 시험 화합물 IV3 및 IV4을 각각 용매인 acetone에 용해시키고 농도가 lOOppm이 되도록 용해시켜 stock를 만든 후, 각 시험에서의 처리 농도 (표 2 및 표 3 참조)가 되도록 희석하여 사용하였다. 점박이 웅애의 경우, 성층을 대상으로 하였으며, 상기 준비된 희석액을 배추 ( 5cm/disk)에 1ml을 spray 처리하고, 1 내지 2일 후 생층수를 측정하였다. 이 경우, 대조약제는
아바멕틴 (Sigma)을 사용하였다. 배추좀나방의 경우, 2령층을 대상으로 하였으며, 배추 (05cm/disk) 절편에 침지 처리한 후 시험층을 절편당 10마리 접종하여 1 내지 2일 후 생충수를 측정 하였다. 이 경우, 대조약제는 에바멕틴 (Sigma)를 사용하였다. 상기 얻어진 결과를 아래의 표 그 결과를 표 2 및 표 3에 각각
나타내었다.
【표 2】
점박이 웅애 성층에 대한 IV3 및 IV5의 생물학적 활성 (살층률)
【표 3】
배추좀나방 유층에 대한 IV3, IV5의 생물학적 활성 (살층률)
처리 농도 처리기간 (2일차)
IV3 100
IV5 0.06 ppm 100
Abamectin 96.7 상기 표 3 및 표 4에 나타난 바와 같이, 화합물 IV3 및 IV4는 대조약물과 비교하여 동등 이상의 해층의 유충 및 성층에 대한 방제 활성을 나타냄을 확인할 수 있다. 실시예 3. 모들 7 교체 백터 제작
스트렙토마이세스 밀베마이시니쿠스 (S. milbemycinicus NRRL5739)의 milA3 유전자에 존재하는 7번 모들을 S. avermitilis DBM-01의 물질 생산 유전자군의 7번 모들과 치환하기 위한 백터를 제조하였다. 상기 백터는 7번 모들 전체 또는 일부를 포함하고, 통합을 위한 상동성을 가지는 aveA3, aveA4 유전자의 지역이 양쪽 말단에 붙여진 형태로 구성하였다. 이하, 백터 제작 과정을 상세히 설명한다.
3-1. 스트렙토마이세스 밀베마이시니쿠스 (S. w// em i i/ct« NRRL5739) genomic DNA로부터 모들 7유전자 확보
모들 7 전체와 모들 7 중 KS(Ketosynthase) 도메인만 숙주 균주인 S.
avermitilis DBM- 의 것을 사용한 두 가지 형태로 모들의 치환을 계획하고 이에 따른 유전자를 확보하고자 하였다. 앞서 milA의 클로닝 경우와 마찬가지로 스트렙토마이세스 밀베마이시니쿠스 (S. w/ em_ydm' « NRRL5739)의 모들 7의 염기서열이 알려져 있지 않기 때문에, NCBI에 등록된 스트렙토마이세스
난찬젠시스 (Streptomyces nanchangensis) 또는 스트렙토마이세스
빙촁젠시스 (Streptomyces bingchenggensis)의 milA3의 염기서열을 활용하여
프라이머를 디자인하였다.
스트렙토마이세스 밀베마이시니쿠스 (S. milbemycinicus NRRL5739) genomic DNA 로부터 모들 7에 해당하는 부위를 두 가지 형태로 (A 및 B)로 클로닝하기 위하여, MA3-6503R프라이머 (TGCCAATGATCGCGATGGCCTCATC: 서열번호 21), MA3-104Fin(A) 프라이머 (GGGTCAGTGGCACGAACGCCCATGTGATCCTCG:
서열번호 22) 및 MA3-1368Ffu(B)
프라이머 (GGAGGCGTCCAGCGAACCCATCGCCATCATC: 서열번호 23)를 사용하여 PCR(95도에서 5분; 98도에서 20초, 60도에서 20초 및 68도에서 6분으로 30사이클; 및 68도에서 10분)을 통해 증폭한 후 pCRll 백터 (TA클로닝 백터)에
클로닝하였다. 이 백터를 pCR2.1-Mo7A, pCR2.1-Mo7B로 명명하였다 (도 9a 및 도 9b).
3-2. 양쪽 arm 제작
S. avermitilis DBM-01 균주의 모들 7 지역에 교차를 일으키기 위한
결합부위를 제작하였다. S. avermitilis DBM-01 균주의 genomic DNA를 아래
프라이머를 사용하여 증폭하여 양쪽 arm에 해당하는 부위의 fragment를 확보한 후: PCR2.1 백터 (TA 클로닝 백터)에 각각 클로닝하였다.
AA3-8600RH: aaaaagcttAACGGTGTGTGGAGCGTCAG (서열번호 24)
AA3-5597FSp: aaaactagTCGCGATCATTGGCATG (서열번호 25)
AA3-11 IRSp: aaaactagtGCTGGACGCCTCCATGGC (서열번호 26)
AA3-1369RSp: aaaactagTCGTGCCACTGACCCCGAAC (서열번호 27)
AA4-2300FNS: aaatctagaGCTCCGTGCAGACCGAGAAC (서열번호 28) 백터를 회수하여 Nsil/Spel, Spel/Hindlll 제한효소로 각각 처리 한 후 ligation 하여 두 fragment를 붙인 형태로 양쪽 arm이 백터 하나에 존재하도록 제작하였다. 이 백터를 pCR2.1-armA, pCR2.1-armB 로 명명하였다 (도 9).
확립한 pCR2.1-armA, pCR2.1-armB 백터의 양쪽 arm사이를 Spel
제한효소로 자르고, pCR2.1-mo7A, pCR2.1-mo7B 백터를 EcoRI 으로 잘라서 insert를 수득하였다. 이 두 단편을 각각 infusion ligation을 통해 결합하여 7번 모들 교체 백터의 구조를 완성하였다. 이 백터를 각각 pCR2.1-A3Mmo7A, pCR2.1-A3Mmo7B로 명명하였다 (도 9)
pKC1139 백터와 pCR2.1-A3Mmo7A, pCR2.1-A3Mmo7B 백터를 각각 Xbal,
Hindlll 제한효소로 처리하고, pKC1139 백터 fragment와 pCR2.1-A3Mmo7A, pCR2.1- A3Mmo7B 백터의 insert fragment를 접합하여 pKC1139에 A3Mmo7A또는
A3Mmo7B 구조가 들어가 있는형태를 제작하였다. 이를 각각 pKC-A3Mmo7A, PKC-A3Mmo7B 백터로 명명하였다 (도 9).
실시예 4. 모들 7교체 균주 제작 및 생성물질 확인
모들 7 교체 백터를 DBM-01 균주 내로 도입시키고, 상동 재조합이 일어나도록 유도하여 S. avermitilis DBM-01 균주의 모들 7이 milA3의 모들 7로 치환된 형태의 균주를 확보하고, 배양을 통해 생성되는 신규물질을 확인하였다.
4-1. PEG-mediated protoplast transformation을 통한 백터 도입
Lysozyme을 처리하여 protoplast를 제조하고, pKC-A3Mmo7A(l 10), pKC- A3Mmo7B(1 10) 백터를 섞고 PEG1000를 처리하여, PEG-mediated protoplast transformation을 통해 상기 백터를 DBM-01 균주 내로 도입하였다 . 24시간 배양한 후 항생제 (apramycin)를 처리하였고, 위 백터의 apramycin 저항성 유전자인 aac 유전자를 확인 할 수 있는 aac3iv-F 프라이머 (GGTTCATGTGCAGCTCCATC:
서열번호 29) 및 aac3iv-R프라이머 (CGTCGCGGTGAGTTCAGG: 서열번호 30)를 사용하여 도입이 이루어졌음을 확인하였다. 4-2. S. flverm/ri/i$ DBM-이 균주로 모들 7의 삽입
상기와 같이 모듈 7 교체 백터의 도입이 이루어진 균주에 1차 교차를 유도하여 백터 전체가 m v Yz'fc DBM-01 균주의 genomic DNA에 삽입되도록 하였다 (도 10). 이를 위하여, apramycin이 25 g/ml 농도로 첨가된 ISP-4 고체배지를 제조한 후, 백터 도입에 의해 생성된 colony를 취한 후, 준비된 고체 배지에 streaking 하였다. 이후 고온에 민감한 pKC1 139 백터의 성질을 이용하여 백터가 복제 되는 것을 막기 위하여 37에서 7일간 배양하였다.
상기 1차 교차가 일어난 균주에서 aveA3의 모들 7을 milA3 모들 7로 치환하기 위해 2차 교차를 유도하였다 (도 10). 이를 위하여, apramycin이 25ug/ml 농도로 첨가된 ISP-4 고체배지와 항생제가 첨가 되지 않은 배지를 각각 제조하고, 1차 교차를 유도한 균주를 ISP-4 고체 배지에 도말하여 2차 교차를 유도한 후, apramycin 저항성 유무로 후보 균주를 선발하였다. 스크리닝을 통해 확보한후보 균주의 genomic DNA를 추출하여, aveA3 내의 모들 7, 및 milA3 내의 모들 7 일부지역을 확인할 수 있는 프라이머 (표 4)를 사용하여 유전자의 교체가 정확하게 이루어졌는지 확인하였다 (도 10). 이를 통해 확보된 균주 중 A3Mmo7A가 삽입된 균주를 avm Y fc DBM-03-A, A3Mmo7B가 삽입된 균주를 S. avermitilis DBM-03-
B로 명명하였다. m 7wY/fc DBM-03-A 균주는 2015년 8월 31일자로 기탁번호 KCTC 12890BP 를 부여받았고, S. avermitilis DBM-03-B 균주는 2015년 8월 31일자로 기탁번호 KCTC12891BP 를 부여받았다.
【표 4】
4-4. 모들 7 치환 균주의 생성물질 확인
모들 7 치환 균주를 배양하기 위한 종균 배양용 배지와 생산 배양용 배지를 각각 제조하였다. 종균 배지를 제조하기 위하여, soluble starch 30g/L, yeast extract 15g/L, KH2PO4 0.4g/L의 농도가 되도록 적정량의 DW에 흔합하여 교반기로 층^히 섞어주고, 층분히 식은 후, 별살한 Com steep liquor 을 5g/L의 농도가 되도록 첨가하였다. 또한, 생산 배지를 제조하기 위하여, soluble starch 80g/L, soybean meal lOg/L, skim milk 15g/L, KH2P04 0.5g/L의 농도가 되도록 적정량의 DW에 흔합하여 교반기로 충분히 섞어주고 , ρΗ를 7.2로 맞춘 후, 121 , 15분간 고압살균을 실시하였다. 생산 배양에 접종할 균주의 양을 충분히 만들기 위해, 상기 제조한 종균 배지 25ml을 멸균된 250ml baffled flask에 넣고, 균주 mycelium을 agar plate로부터 lloop씩 떠서 종균 배지에 접종하였다. 230 rpm 및 28도 조건하에서 48시간 동안 배양하였다. 또한, 생산배지 25ml을 멸균된 250ml non-baffled flask 넣고 종균 배양액 1.25ml을 접종한 후, 230 rpm 및 28도 조건하에서 10일 동안 배양하였다. 생산 배양액으로부터 생성된 물질을 추출하기 위하여,
유기용매(^ 0 쒜6 : 1^011 = 1 : 1 흔합 용액) 1.5ml과 배양액 0.5ml을 섞고 층분히 vortexing하였다 . 5분간 sonication 한 후, 1시간 동안 교반하였다. 12000rpm에서
5분간 원심분리한 후 상등액만 취하여 분석하였다.
추출한 시료를 아래의 조건에서 HPLC UVD 분석올 통해 분석하였다.
- Mobile phase: Acetonitrile/Water(v/v)= 40/60 v/v, 90/10 v/v, 90/10 v/v - Flow rate: 0.7 ml/min
- wavelength: 245 nm
- Run time: 40 min
그 결과, 밀베마이신 표준품의 HPLC 결과에서 나온 milbemycin A3와 A4의 peak (도 1 l a 참조)가 S. avermitilis DBM-03-A (도 1 lb 참조), S. avermitilis DBM-03-B 배양액 (도 Uc 참조)의 HPLC분석 결과에서도 형성됨을 확인하였다 (도 1 1a 내지 도 1 1c 참조).
또한, 모들 7 치환 균주를 배양하여 수득한 생성물 중, HPLC로 확인 한 milbemycin A3, milbemycin A4 이외의 생성물질에 대한 분석을 실시하였다. 그 결과: HPLC 상에 보인 major peak에 대한 mass 분석을 실시하여 분자량을 근거로 예측했올 때, milbemycin a2, milbemycin a4, milbemycin G 가 생성 되었음을 확인할 수 있었다 (도 12). 실시예 5. aveA3의 변이를 위한 milA3 삽입 백터 (milA3 integration vector) 제작
아베멕틴과 밀베마이신의 AT-DH 모들간 영역 및 KR-ACP 모들간 영역의 염기서열 분석을 통해 공통적인 amino acid를 코딩하는 지점을 치환이 일어나는 fusion site로 결정하고, amino acid의 서열에 변화를 주지 않는 범위 내에서
제한효소 site를 도입하였다. 상기 결과를 도 13에 나타내었으며, 하기의 유전자 변형을 위한 재조합 백터의 제조의 제작시에 이를 참조하였다.
상기 실시예 2-3에서 제작된 스트렙토마이세스 아베미틸리스 DBM-이의 aveA3 유전자의 모들 7의 DH 도메인부터 모들 9의 KR도메인을 포함하는 영역의 코딩 유전자 부위를 스트랩토마이세스 밀베마이시니쿠스 (S. milbemycinicus NRRL5739)의 물질 생산 유전자군 milA3 유전자의 모들 7의 DH 도메인부터 모들 9의 KR도메인 포함 영역의 코딩 유전자 부위로 치환하기 위한 백터를
제작하였다. 이 백터는 milA3의 일부를 포함하고 균주 내 재조합을 위한
상동성을 지니는 aveE 및 aveA3 유전자의 영역이 양쪽 말단에 연결된 형태로 구성하였다.
5-1. ΜΠΑ3 의 모들 7의 DH도메인부터 모들 9의 KR도메인까지의 코딩 유전자부위의 확보
밀베마이신 생산 균주인 스트렙토마이세스 밀베마이시니쿠스 (S.
/ em "'m « NRRL5739)로부터의 milA3 모들 7 DH〜모들 9 KR 영역까지의 코딩 유전자의 확보를 위해 NCBI에 등록된 또 다른 밀베마이신 생산 균주
스트렙토마이세스 빙촁젠시스 Streptomyces binchengge ii)^ 밀베마이신
폴리케타이드 합성효소의 염기서열을 활용하여, 하기의 표 5와 같은 염기서열로 프라이머를 디자인하였다 (제작하고자 하는 DNA fragment가 매우 거대하여, 3개의 구역 (fragments)로 나누어 PCR을 수행한 후, 하기의 실시예 5-3의 과정을 통해 합성함).
【표 5】
Primer Sequence (5'→ 3') 용도
GCGTCCGGGGTCGACATGGGATGCAGGCCTGAGCGGTTGATGCGGGCCC
DK1F Fragment
G (서열번호 38)
DK1R ATGGG ACTGCGGCTGCTTAAG ACCTCACCCGTC(^ Ί ¾ 2. 39) 합성
DK2F GCTAGCGGGGTGTGGTCG (서열번호 40) Fragment 3 D 2R TTCGAACACGCGGG AATCGAC (서열번호 41)
D 3F GCATGCCGTGTCCACGCGCCC (서열번호 42) Fragment 5-6'
ACACCCACCCCCACAACCACCACCTAGATCTGCCCACCTACGCCTTCCA(
DK3R 합성
서열번호 43) 상기 프라이머를 사용하여 얻어진 각 fragment를 PCR (1. 97 °C 3분, 2. 72 °C
1분, 3. 98 °C 10초, 4. 55 °C 15초, 5. 68 °C 1분 30초, 6. 스텝 3~ 스텝 5 에 대해 31 사이클 반복 수행, 7. 72 V 10분, 8. 4 °C , 9. end)을 통해 증폭하였다. 각 fragment는 pGEMTeasy 백터 (Promega)에 클로닝되어 DN A sequencing을 통해 염기서열을 확인하였다. 이와 같이 얻어진 백터를 pYJ 1950, pYJ 1951, pYJ 1952로 명명하였다. 이들 각 플라스미드의 insert는 도 14의 fragment Γ, 3과 5-6'에 해당하며, 각 fragment는 클로닝의 용이성을 위해 milA3 모들 7의 DH도메인부터 모듈 9의 KR 도메인 영역에 존재하는 제한효소 위치를 참조하여 디자인 하였다.
5-2. Left arm 및 Right arm의 제작
스트렙토마이세스 아베미틸리스 DBM-01 균주의 모들 7 DH〜모들 9 KR 영역에 상동재조합을 통한 교차를 일으키기 위해 각 백터를 제작하였다.
스트렙토마이세스 아베미틸리스 DBM-01 균주의 genomic DNA를 주형으로
사용하고, DKLF/DKLR 및 DKRF/DKRR프라이머를 이용하여 (아래의 표 6 참조) : milA3 유전자의 모들 7 DH〜모들 9 KR 영역에 연결될 left 및 right flanking 영역 fragment를 PCR로 확보한 뒤, 각각 pGEMTeasy 백터에 클로닝하였다. 이 때 각 fragment는 연결 될 milA3 영역과 상동성을 갖도록 디자인 되었고 이를 각각 PYJ1948 및 pYJ1949로 명명하였다. 각각 플라스미드의 insert는 도 14의 LA와 RA에 해당한다.
【표 6】
Primer Sequence (5'→3') 용도
D LF AACCCGAACGACCGAGCGCAGCGGCGGCCGCGAATTCATACGGCTA Left arm
CGAGGAT (서열번호 44) (LA)의 D LR CTCGACCGCACCGACCGGGCCCGCATCAACCGCTCAGGCCTGCATC 제작
CCATGTCGACCCC (서열번호 45)
DKRF GCCAGTAGCGGCGGCGCTGGAAGGCGTAGGTGGGCAGATCTAGGTG Right arm
GTGGTTGTGGGGGTG (서열번호 46) (RA)의 D RR CTTAGGACCGTTATAGTTACGCGCTTCCTCGCTCACTGACTTTAATTA 제작
AAAGCTTACGTTTCGCTTGCCGATG (서열번호 47)
5-3. milA3 유전자에 양쪽 arm이 결합된 형태의 vector 제작
스트렙토마이세스 밀베마이시니쿠스 (S. w/½em_yrim' « NRRL5739)로부터의
PCR을 통해 확보된 milA3영역을 포함하는 pM5-2백터 및 pM6-4백터를 제작하고, pM5-2백터 에 제한효소 Aflll/Bmtl를 처리하여 도 14의 fragment 2를 얻었으며 , pM6-4백터에 제한효소 BstBI/Sphl를 처리하여 도 14의 fragment 4를 확보하였다.
상기 과정을 보다 구체적으로 기재하면 다음과 같다:
스트렙토마이세스 밀베마이시니쿠스 (S. milbemycinicus NRRL5739)의 milbemycin 생산유전자군을 클로닝하기 위하여, 스트렙토마이세스 빙쳉젠시스 (S. bingchenggensis BCW-1) 의 genome 염기서열 정보 (Accession no. CP002047.1)를 기반으로 milA2, milA3, milA4 지역을 포함하는 61kb의 영역을 각각 lOkb씩 6개 영역으로 나누어 프라이머를 디자인 하였다 (표 7 및 도 19 참조)
Fragment 1
M l aaaactagtGG AG AGG A AG AAGG AG AGCCG (서열번호
M10810-1
49)
aaaatgcatCACCCACACAGGACAGGGA (서열번호
M10762-2NF
50) Fragment 2
M2 - aaaactagtATGACAGGCCGGGTACATCA (서열번호 ^포
MC20300-2R
51)
aaaatgcatCGCGTACCTG ATGTCCCTGA (서열번호
M20255-3NF Fragment 3
M3 52)
^포
M30434-3R aaaactagtGGCCACACGGTCTTCATCG (서열번호 53)
M30377-NF2 aaaatgcatCCTGCACACCGACCGAGAC (서열번호 54) Fragment 4
M4
M40160-4R 匪 ctagtACCTTCGTACCCGTCTCGC (서열번호 55)
aaaatgcatGTGCGGACG ATCGTG AG AAG (서열번호
M40091-5NF Fragment 5
M5 56)
극
M50273-5R aaaactagtAACACGCGGGAATCGACC (서열번호 57)
aaaatgcatGTAGTCCGTCGGCATCACAC (서열번호
M50196-6NF Fragment 6 6 58)
M60390-6R aaaactagTCGAGACCGTCCCTATGTCC (서열번호 59)
M30290-F ACGTCAGGAAGCGGTTCA (서열번호 60) Fragment
M4N
M34887-R CGTCCGAACGTTTCTGGA (서열번호 61 ) , M4N 증폭
M4M4502F GAGCTCCAGAAACGTTCGG (서열번호 62) Fragment M4CN
M4CN
M4F7910R GGATCGTCAACATCTCCTCC (서열번호 63)
M4C-ScF CGGCCACCAGAACACCTTC (서열번호 64) Fragment M4CC
M4CC
M4C25R ACACGCTTCTCACGATCGTC (서열번호 65) 다음의 표 8의 조건으로 PCR용 mixture를 제조하였다:
【표 8】
PCR 용 mixture의 조성
Component 1 reaction 당 (μί)
5X GXL buffer 5 Primer를 제외한
2.5 mM dNTPs 2 component를 모두 흔합 후
S. milbemycinicus Genomic DNA (1/50 2 ' 21 ul / tube 첨가 dil.)
DW 16.5
PrimeSTAR Pol. 0.5
Primer for. (N), 5 pmol/ul 2
Primer rev. (C), 5 pmol/ul 2 상기 mixture에 대하여 MyCycler (Bio-Rad사)를 사용하여 다음의 표 9의 조건에서 PCR을 수행하였다
【표 9】
증폭된 DNA fragment 중 milA3에 해당되는 fragment인 M5와 M6를 pCR2.1 TOPO cloning 시스템 (Invitrogen, 미국)을 이움하여 클로닝하고 E. coli DH5a를 형질전환하여 각각 pM5-2, pM6-4를 확보하였다.
상기 얻어진 fragments와, 상기 표 5의 프라이머 DK1F/DK1R, DK2F/DK2R, DK3F/DK3R를 사용한 PCR 결과물 및 left, right flanking 영역과 단계적으로 overlap PCR 방법과 통상적인 ligation반웅을 통하여 pLitmus28 (NEB, 미국) 에서 한 fragment로 연결하였다. 이와 같이 얻어진 재조합 백터를 pYJ1957로 명명 하고, 이로부터 EcoRI/Hindlll 제한효소 처리를 통해 얻은 left flanking region-milA3 모들 7 DH〜모들 9 KR-right flanking region을 pKC 1 139로 옮겨 milA3 모들 7
DH〜모들 9 KR 영역의 발현을 위한 재조합 백터 (milA3 삽입 백터; milA3 integration vector)를 제작하였다 (도 14 참조; LA: left arm; RA: right arm; 1 ', 2, 3, 4, 5, 6: fragments). 이를 pD7K9milA3으로 명명하였다 (서열번호 80; LA: 6074-7261 부위; 1 ': 7256-10476 부위 ; 2: 10471-15043 부위 ; 3 : 15038-17193 부위 ; 4: 17188-20776 부위 ; 5 및 6': 20771 -21226 부위 ; RA: 21221-22436 부위). 실시예 6. milA3 삽입 백터 (milA3 integration vector)가삽입된 균주 제작 및 생성물질 확인
상기 실시예 5-3에서 제작된 milA3 integration 백터 (pD7K9milA3) 를 S. avertmilis DBM-01 균주 내로 도입시키고, 상동재조합이 일어나도록 유도하여 S.
avertmilis DBM-01 균주의 aveA3 유전자가 milA3 유전자로 치환된 형태의 균주를 확보하고, 배양을 통해 생성되는 신규물질을 확인하였다.
6-1. 접합법을 통한 백터 도입 및 유전자 치환
E. coli ET12567/pUZ8002 (The John Innes Foundation, 영국) 를 치환
백터 (pD7K9milA3)로 형질전환시킨 형질전환체를 아프라마이신 (apramycin), 클로람페니콜 (chloramphenicol), 카나마이신 (kanamycin)이 포함된 2xTY (trptone 16 g/L, yeast extract 10 g/L, NaCl 5 g/L) 또는 LB (peptone l Og/L, yeast extract 5 g/L, sodium chloride l Og/L) 액체 배지를 이용하여 37 °C에서 배양하였다. 12 시간 후, 1 ul의 배양액을 25 mL의 2xTY에 옮기고 , 37 °C에서 광학 밀도 (optical density)가 0.6이 될 때까지 배양하였다. 배양액의 세포를 동일한 액체 배지로 두 번 세척한 뒤, 500 uL의 2? Ύ로 현탁하여 얼음에 보관하였다. 스트렙토마이세스 아베미틸리스 DBM-01의 포자액 30-50 uL를 원심분리 (12,000 rpm으로 10분간)하고, 500 uL의 2xTY 에 현탁한 후, 50 °C에서 10분 동안 열층격을 가하여 균사액을 준비하였다. 얼음에 보관해둔 E. coli 현탁액 500 uL과 상기 준비된 균사액 500 uL을 서로 흔합한 후 MS (agar 20g/L, D-mannitol 20g/L, soya flour 20g/L) 배지에 도포하여 28 °C에서 24시간 동안 배양한 뒤 날리딕신산 (nalidixic acid)과 아프라마이신 (apramycin) 각 lmg을 배지위에 도말하였다. 7~10일 뒤 아프라마이신 저항성을 지닌 콜로니를 선별하고 37 °C에서의 배양을 통해 항생제 저항성 여부를 재확인 후, 삼차 스트릭킹 (streaking)을 통해 얻은 콜로니에 대해 PCR 및 PCR 결과물에 대한 sequencing을 수행하여 일차교차 균주를 선별하였다.
상기 선별된 콜로니로부터의 계대배양을 통해 이차교차를 유도하고, 이를 아프라마이신이 첨가된 ISP4 고체배지와 아프라마이신이 첨가되지 않은 ISP4 고체배지에 각각 도말하여 아프라마이신 저항성을 잃은 콜로니를 선별하였다ᅳ 상기 사용된 ISP4 고체배지의 조성을 아래의 표 10에 나타내었다:
【표 10】
Reagents g/L
Soluble starch 10.0
KH2P04 1.0
MgS047H20 1.0
NaCl 1.0
(NH4)2S04 2.0
CaC03 2.0
Trace salt solution 1 mL
Agar 20.0
PCR분석을 통해 최종 milA3가 치환된 이차교차 균주가 확보되었다.
상기 균주 제작 과정을 도 15에 모식적으로 나타내었다.
상기와 같이 확보된 균주를 S. avermitilis DBM-03-C로 명명하였다. S.
avermitilis DBM-03-C 균주는 2016년 8월 24일자로 대한민국 전라북도 정읍시에 위치하는 한국생명공학연구원 (Korean collection for type culture)에 기탁하여 수탁번호 KCTC13083BP를 부여받았다.
6-2. milA3 치환균주의 배양
Milbemyci의 생산확인을 위한 종균배양 및 생산배양을 수행하였으며, 이 때 상용된 배지의 조성을 다음의 표 11에 나타내었다:
【표 1 1】
Seed culture g/L Main culture g/L
Soluble starch 30.0 Soluble starch 80.0
Yeast extract 15.0 Soybean flour 10.0
Corn steep liquor 5.0 Skim milk 15.0
KH2P04 0.4 KH2P04 0.5 각 분량의 soluble starch, yeast extract, corn steep liquor, 및 KH2P04를 DW에 녹여서 흔합한 후, NaOH를 사용하여 pH 7.2로 맞춘 후, 121 °C에서 20 분간 고압살균하였다. ISP4 고체배지 (상기 표 5 참조)에 배양한 milA3 발현 균주 (S. avermitilis DBM-03-C)의 포자 혹은 mycelium을 긁어 종균배지에 접종한 뒤 28 °C , 230rpm에서 40~48 시간 배양하여 종균배양액을 준비하였다. Soluble starch, soybean flour, skim milk, 및 KH2P04를 DW에 녹이고 pH 7.2에 맞춰 제조한 생산배양 배지를 종균배양 배지와 같은 조건하에서 고압 멸균한 뒤 생산배양 배지 총 부피의 5 % 비율로 상기 준비된 종균배양액을 접종하여 230 rpm 및 28 °C
조건에서 10~15 일간 배양하였다.
6-3. 생성물질의 추출 및 분석
분석을 위한 시료의 전처리를 위하여, 상기 얻어진 배양액 0.5 mL을 동일 부피의 acetonitrile 및 methanol 흔합 용액 (acetonitrile:methanol=l : l (v:v)) 또는 동일 부피의 ethyl acetate 와 흔합하여 2 분간 vortex 처리 한 뒤 10 분간 초음파 추출을 수행하였다. 5분간 원심분리하여 고형물을 제외하고 상층액만을 취하였다.
동일한 방법으로 추출을 3회 반복하여 분석시료를 확보하였다. 상기 확보된 시료는 HPLC 및 UPLC-qTOF-HR-MS를 통해 분석하였다.
HPLC는 PDA detector와 gradient pump로 구성된 HPLC system (YL Instrument Co. Ltd)하에서 Phenomenex Luna (4.6x100 mm, 5 mm) column을 이용하여 수행하였고 물 기반의 0.05% (v/v) trifluoroacetic acid (TFA)를 용매 A로 하고 acetonitrile을 용매 B 로 하고 표 12와 같은 용매 기울기를 사용하여, 238~245 nm 에서 1 mL/min 의 flow rate로 총 60 분간 시료를 분석하였다.
【표 12】
Time (min) 0.05 % TFA in water (%(v/v)) Acetonitrile (%(v/v))
0 60 40
5 60 40
35 10 90
. 55 10 90
60 60 40
Milbemycin A3/A4의 30%/70% (w/w) 표준품인 milbemectin (Bioaustralis, Australia) 및 milbemycin D (Bioaustralis, Australia)를 사용하여 본 HPLC 분석 조건에서의 해당 milbemycin의 retention time (RT) 및 245 nm에서의 absorbance를 확인하였다. 상기 확보된 시료 (S. avermitilis DBM— 03-C 균주)의 생성 물질을 분석한 결과를 도 16에 나타내었다. 도 16에서, (a)는 표준폼 milbemectin
(Bioaustralis, Australia) 및 milbemycin D (Bioaustralis, Australia)의 분석 결과를, (b)는 S. S. avermitilis DBM-03-C 균주의 생성물질 분석 결과를 각각 보여준다. 도 16에 나타난 바와 같이 , 상기 S. avermitilis DBM-03-C 균주는 milbemycin A3 (C AS NO. 51596-10-2), A4 (CAS NO. 51596-11-3), α2 (CAS No. 51596-12-4), D (CAS NO. 77855-81-
3), α4 (CAS No. 51596-13-5), 및 G (CAS No. 83471-31-2)로 추정되는 피크를 확인할 수 있고, 이 중에서, milbemycin A3, A4, 및 D는 표준품 milbemycin과 동일한 RT값을 지님을 확인할 수 있다. 특히 milbemycin A3, A4 및 D로 추정되는 peak는 표준품 milbemycin 과 동일한 RT 값을 지님을 알 수 있다. 도 16의 HPLC 분석 결과에 나타난 각 물질의 RT는 다음과 같다:
Milbemycin A3 RT: 29.0 min
Milbemycin A4 RT: 32.1 min
Milbemycin D RT: 35.4 min
Milbemycin a2 RT: 33.7 min
Milbemycin a4 RT: 36.3 min
Milbemycin G RT: 39.4 min.
HPLC 상에서 milbemycin으로 추정되는 물질의 분자량을 비교하기 위하여, UPLC-qTOF-HR-MS를 다음과 같이 수행하였다. 상기 HPLC 상에서 분석된 여섯 종류의 milbemycin의 해당 분자량 값을 Xselect® CSH column XP (2.1x100 mm, 2.5 um; Waters)을 통해 Waters XEVO® G2S Q-TOF mass spectrometer; Waters) 상에서 확인하였다. 이 때 사용된 용매 기울기는 아래의 표 13과 같이 하였다.
【표 13]
Time (min) Water (vol%) Acetonitrile (vol%)
0 50 50
1 50 50
7 25 75
15 10 90
18 10 90
20 50 50 상기 얻어진 질량 스펙트럼 결과를 도 17a 내지 17f에 나타내었다 (도 17a: 밀베마이신 A3; 도 17b: 밀베마이신 A4; 도 17c: 밀베마이신 D; 도 17d:
밀베마이신 alpha2; 도 17e: 밀베마이신 alpha4; 도 17f: 밀베마이신 G). 도 17a 내지 17f에 나타난 바와 같이, milbemycin A3에 해당하는 m/z=527.3014, milbemycin A4 및 α2에 상웅하는 m/z=541.3171, milbemycin D및 α4를 나타내는 m/z=555.3327, milbemycin G의 값인 m/z=569.3484을 negative ion mode에서 확인할 수 있었으며 ,
각각 분자의 알려진 분자량과 잘 일치하는 것으로 보아 제작된 재조합 스트렙토마이세스 아베르미틸리스 DBM-03-C 가 밀베마이신을 생산함을 알 수 있었다. 【수탁번호】
기탁기관명 : 한국생명공학연구원
수탁번호 : KCTC12889BP
수탁일자 : 20150831 기탁기관명 : 한국생명공학연구원
수탁번호 : KCTC12890BP
수탁일자 : 20150831 기탁기관명 : 한국생명공학연구원
수탁번호 : KCTC12891BP
수탁일자 : 20150831 기탁기관명 : 한국생명공학연구원
수탁번호 : KCTC13083BP
수탁일자 : 20160824
¾허§¾¾ 위한 부다쾌스 s ^체 조 ¾ 수락 t ¾
꾹채양식 원기탁에 의한 수탁증 수신: 9.y it- til한민^ 는산시 연 Ϋ· - 안ᅳ 번 . 39-2:». ( ¾ ί0)
π,.과학적 «/또는 학상외 위치
i에 i시' ¾ «t-«t«ii n다 * t<>] ᅵ어 있 ;
\xl 과학?! 성¾
I ! 제안 ¾ ½H†^상의 .
《 !發시
!I!, 수¾ '¾ 수탁 , 성기 '항^ I에 fi,시 ¾ '5!«*# §Ά 2015 ! s j Stilus?.수¾하¾다.
!v. }¾¾> ^ 수¾
¾새기학기 :숀 에 항^ 1에 표시된 oh »4 수^하¾으^, 에
IV, 국개기탁기 a
¾¾: 한 ¾¾■ 연구 ¾ 미 자 ¾4W
';'-±: 대 £ !시 iHR 4«!A 1 ¾!지
(우 305-8C6 .
시' ψί]: 1)15. ø,. μ.
^허^ ^다 i^s국체 s약 하의 미생¾ 수탁 §명'
국^양식 에 $ im 7.1에 η}4' ? ¾Ϋί
원기탁에 의한수탁중 오기^
대한민국 충¾남도 논산시 동안 S- 1U3 ¾]¾ K (xmo) i. 미생 ·§·의 > ¾ 기 지에 £!j 쑤이진 :i! ¾; 국¾기^기¾이 ¾ 박' ,»!..¾:
Strcpiom ccs « i'crmrliUs ΠΒΜ-03-Α KCTC 12890BP
Π. 과학^ 성¾ 는 ¾큐학상의 워치 ΐχ] δ!· *i ¾ ί i 뻬! χ M. )
ΠΙ. 수령 ?4수학
·;·} 상기 f *r -ψ ΙΙΛ 2M5년 S« 31 ¾차^ 수¾하¾다. ϊν, 이팝¾ -?'의 十¾
¾¥:ᅳ한 ¾ - ¾ .자원 m
^f?i?-7i¾* 4MM ¾한¾ 가¾ 자
.¾¾ ¾«-a- '-여' ·?¥€ 서병:
대한민국 대 j시 .{H구 vi'y-i- 서명 : 2015.0, li.
생 ' i ' 구
히춤원읔 한 ^\4,^ 국태 ¾뱍 하의 미脊 u
국재양식
¾· ι하기 '에 ?,!"ϋ «ΗΊ ¾··¾¾■
원기탁에 의한 수락쯩 수산: 오기훈
남도 ¾산시 연 ·?-·§· *안≤ i i ;½-23 v iQ)
■'Η';- I "! 시¾ 미^ -에 대 8여 φβ—사 이 ats 있 :
1 } 제' ϊ ! 상피
!H. 수 ¾ ¾ ψ
¾ 국채31^기 상기 항^ I에 표시¾ 비^ 수^받: a 2015년 S?! 31 ¾자.? - 수 ¾¾¾다.
IV. '이; ¾ ^ί ¾
Ί·'· 국 기 ^기 «fi ¾·¾■ I. 에 ¾시« 수학 e a L 에
IV. 국채기탁기 ¾
¾¾: K'卜' |¾¾1학'?»예 미생 -자왼 러
¾ ¾기학기 대 Α ' :
¾ίί ¾ ft부여' -? ^원 서 ' ¾:
쑤소: 대한 대¾시 '?(·¾·? 과학. 125 'il -
(우 306-808
서병 : 2015, 9, 14,.
특허절차상 미생물 기탁의
승인에 관한부다페스트 조약 국제용 양식
오기훈
대한민국 충청남도 논산시 이건 문서의 아랫부분에 기재된 연무읍 동안로 1113번길 39-23 국제기탁기관에 의해
(우) 33010 조약 7. 1에 따라 발행된
원기탁에 관한 접수
I . 미생물의 명칭 기탁자에 의해.주어진 명칭 : 국제기탁기관이 부여한 수탁번호:
Streptomyces avermit ill's DBMᅳ 03一 C CTC13083BP
Π . 과학적 성질 및 /또는 분류학상 위치 상기 I에 표시된 미생물에 다음을 첨부하였다.
[ X ] 과학적 성질
[ X ] 분류학상 위치
(적용대상에 체크할 것) m. 수령 및 수탁 본 국제기탁기관은 상기 I .에 표시된 미생물을 수탁받고 2016년 8월 24일 (원기탁 일자) 수령하였다.
IV. 국제기탁기관
국제기탁기관을 대표하는 권한을 명칭: 한국생명공학연구원 미생물자원센터
가지거나 권한을 부여받은 담당자의 주소: 전라북도 정읍시 입신길 181
날인:
한국생명공학연구원
(우) 56212
대한민국
날짜 : 2026년 8월 30일
1조약 6.4(d)는, 국제기탁기관의 지위를 획득한 날; 국제기탁기관의 지위를 획득한 이후에 부다페스트 조약국 이외에서 행해진 기탁을 부다페스트 조약에 의한 기탁으로 전환한 경우에는 국제기탁기관이 접수한 날로 적용한다.
FORM BP/4 단일 페이지
Claims
【청구항 1】
스트렙토마이세스 아베르미틸리스 (Stre tow ^ avrn Yito) 균주에서, 아베멕틴 생합성을 수행하는 폴리케타이드 합성효소의 1번
유전자 (aveAl)의 밀베마이신 생산 균주의 밀베마이신 생합성을 수행하는 폴리케타이드 합성효소의 1번 유전자 (milAl)로의 치환; 및
아베멕틴 생합성을 수행하는 폴리케타이드 합성효소의 3번 유전자 (aveA3) 또는 이의 일부가 밀베마이신 생산 균주에서 밀베마이신 생합성을 수행하는 폴리케타이드 합성효소의 3번 유전자 (milA3) 또는 이의 일부로 치환된,
재조합 스트템토마이세스 아베르미틸리스 균주.
【청구항 2】
제 1항에 있어서, 상기 aveA3 유전자의 일부가 밀베마이신 생산 균주의 milA3 유전자의 일부의 치환된 것은, aveA3 유전자 중 적어도 모들 7 코딩 유전자 또는 모들 7의 DH (dehydratase) 도메인 코딩 유전자가 밀베마이신 생산 균주의 milA3 유전자의 모들 7 코딩 유전자 또는 모들 7의 DH (dehydratase) 도메인 및 ER (Enoyl reductase) 도메인 코딩 유전자로 치환된 것을 포함하는, 재조합 스트렙토마이세스 아베르미틸리스 균주.
【청구항 3]
게 2항에 있어서, 상기 aveA3 유전자의 일부가 밀베마이신 생산 균주의 milA3 유전자의 일부로 치환된 것은,
(i) aveA3 유전자의 모들 7 코딩 유전자의 KS 도메인 코딩 유전자 , AT 도메인 코딩 유전자 , KR도메인 코딩 유전자 및 ACP 도메인 코딩 유전자로 이루어진 군에서 선택된 하나 이상의 유전자가 밀베마이신 생산 균주의 milA3 유전자의 모들 7 코딩 유전자의 KS 도메인 코딩 유전자 , AT 도메인 코딩 유전자, KR 도메인 코딩 유전자 및 ACP 도메인 코딩 유전자로 이루어진 군에서 선택된 하나 이상으로 치환된 것;
(ii) aveA3 유전자의 모들 8 및 모들 9의 도메인들 중 하나 이상의 코딩 유전자가 밀베마이신 생산 균주의 milA3 유전자의 모들 8 및 모들 9의 도메인들 중 하나 이상의 코딩 유전자로의 치환된 것; 또는
(iii) 치환 (i) 및 (ii)의 조합
을 추가로 포함하는 것인,
재조합 스트렙토마이세스 아베르미틸리스 균주.
【청구항 4】
제 1항 내지 게 3항 중 어느 한 항에 있어서, 상기 밀베마이신 생산 균주는 스트렙토마이세스 밀베마이시니쿠스 (Streptomyces milbemycinicus),
스트템토마이세스 시아네오그리세우스 아속 논시아노게누스 (Streptomyces cyaneogriseus subsp. Noncyanogenus), 스트랩토마이세스 난찬젠시스 (Streptomyces nanchangensis), 또는 스트렙토마이세스 빙 ¾1젠시스 (Streptomyces bingchenggensis)인, 재조합 스트렙토마이세스 아베르미틸리스 균주.
【청구항 5】
제 1항 내지 제 3항 중 어느 한 항에 있어서, 상기 재조합 균주는
밀베마이신 A3, 밀베마이신 A4, 밀베마이신 α2, 밀베마이신 α4, 밀베마이신 G, 및 밀베마이신 D로 이루어진 군에서 선택되는 1종 이상의 밀베마이신을 생산하는 것인, 재조합 스트랩토마이세스 아베르미틸리스 균주.
【청구항 6】
제 1항에 있어서, 상기 재조합스트 ¾토마이세스 아베르미틸리스 균주는 스트렙토마이세스 아베르미틸리스 DBM-03-A균주 (수탁번호 KCTC12890BP)인, 재조합 스트렙토마이세스 아베르미틸리스 균주.
【청구항 71
제 1항에 있어서, 상기 재조합 스트램토마이세스 아베르미틸리스 균주는 스트렙토마이세스 아베르미틸리스 DBM-03-B 균주 (수탁번호 KCTC12891BP)인, 재조합 스트 ¾토마이세스 아베르미틸리스 균주.
【청구항 8】
제 1항에 있어서, 상기 재조합 스트렙토마이세스 아베르미틸리스 균주는 스트렙토마이세스 아베르미틸리스 DBM-03-C 균주 (수탁번호 KCTC13083BP)인, 재조합 스트램토마이세스 아베르미틸리스 균주.
【청구항 9】
스트랩토마이세스 아베르미틸리스 균주에서, aveAl 유전자가 밀베마이신 생산 균주의 milAl로의 치환되고,
22,23-디하이드로 -25-이소프로필 -아베멕틴 (22,23-dihydro-25-isopropyl-
avermectin), 5-메톡시 _22, -디하이드로 _25-메틸 -아베멕틴 (5-methoxy-22,23-dihydro-25- methyl-avermectin), 5-메특시 -22,23-디하이드로 -25-에틸 -아베멕틴 (5-methoxy-22,23- dihydro-25-ethyl-avermectin) 및 5-메록시 -22,23-디하이드로 -25-이소프로필-아베멕틴 (5- methoxy-22,23-dihydro-25-isopropyl-avermectin)으로 이루어진 군에서 선택되는 1종 이상의 아베멕틴 유도체를 생산하는,
재조합 스트렙토마이세스 아베르미틸리스 균주.
【청구항 10]
게 9항에 있어서, 상기 재조합 스트렙토마이세스 아베르미틸리스 균주는, 스트렙토마이세스 아베르미틸리스 DBM-01 균주 (수탁번호 KCTC12889BP)인, 재조합 스트렙토마이세스 아베르미틸리스 균주.
【청구항 11】
(1) 밀베마이신 생산 균주의 밀베마이신 생합성을 수행하는 폴리케타이드 합성효소의 1번 유전자 (milAl); 및 ·
(2) 밀베마이신 생산 균주의 밀베마이신 생합성을 수행하는 폴리케타이드 합성효소의 3번 유전자 (milA3)의 전부 또는 일부
를 포함하는 재조합 백터.
【청구항 12]
제 11항에 있어서ᅵ, 상기 milA3의 일부는 적어도 milA3 유전자 중 모들 7 코딩 유전자 또는 모들 7의 DH 도메인 코딩 유전자 및 ER도메인 코딩 유전자를 포함하는 것인, 재조합 백터.
【청구항 13]
제 12항에 있어서, 다음으로 이루어진 군에서 선택된 하나 이상을 추가로 포함하는 재조합 백터:
밀베마이신 생산 균주의 milA3의 모들 7의 KS 도메인 , AT 도메인, KR 도메인, 및 ACP 도메인 중에서 선택된 하나 이상의 코딩 유전자;
밀베마이신 생산 균주의 milA3의 모들 8의 코딩 유전자 또는 모들 8의 도메인들 중 하나 이상의 코딩 유전자; 및
밀베마이신 생산 균주의 milA3의 모들 9의 코딩 유전자또는 모들 9의 도메인들 중 하나 이상의 코딩 유전자.
【청구항 14】
제 11항에 있어서,
밀베마이신 생산 균주의 milAl 유전자; 및
밀베마이신 생산 균주의 milA3 유전자 중의 모들 7의 DH 도메인부터 모들 9의 KR도메인까지의 영역의 코딩 유전자를 포함하는 milA3 유전자의 일부
를 포함하는, 재조합 백터.
【청구항 15】
제 11항 내지 제 14항 증 어느 한 항에 있어서, 상기 밀베마이신 생산 균주는 스트렙토마이세스 밀베마이시니쿠스 (Streptomyces milbemycinicus), 스트렙토마이세스 시아네오그리세우스 아속 논시아노게누스 (Streptomyces cyaneogriseus subsp. noncyano genus), 스트렙토마이세스 난찬젠시스 (Streptomyces nanchangensis) 또는 스트렙토마이세스 빙 :핸젠시스 (Streptomyces bingchenggensis)인, 재조합 백터.
【청구항 16]
게 1항 내지 제 3항 및 게 6항 내지 게 8항 중 어느 한 항의 재조합
스트렙토마이세스 아베르미틸리스 균주를 포함하는, 밀베마이신 생산용 조성물.
【청구항 17]
거 11항 내지 제 3항 및 제 6항 내지 제 8항 중 어느 한 항의 재조합
스트렙토마이세스 아베르미틸리스 균주를 배양하는 단계, 및
상기 배양된 균주 또는 균주의 배양물로부터 밀베마이신을 수득하는 단계를 포함하는,
밀베마이신을 생산하는 방법.
【청구항 18】
하기에서 선택되는 아베멕틴 유도체 또는 이의 염:
5-메특시 -22,23-디하이드로 -25-메틸 -아베멕틴 (5-methoxy-22,23-dihydro-25- methyl-avermectin), 및
5-메록시 -22,23-디하이드로 -25-에틸 -아베멕틴 (S-methoxy^S^^dihydro S-ethyl- avermectin).
【청구항 19]
게 9항 또는 제 10항 중 어느 한 항의 재조합 스트렙 '토마이세스
아베르미틸리스 균주 또는 상기 균주의 배양물; 또는
제 18항의 아베멕틴 유도체 또는 이의 염 를 포함하는, 해층 방제용 조성물.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20150133892 | 2015-09-22 | ||
| KR10-2015-0133892 | 2015-09-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017052232A1 true WO2017052232A1 (ko) | 2017-03-30 |
Family
ID=58386318
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2016/010594 Ceased WO2017052232A1 (ko) | 2015-09-22 | 2016-09-22 | 밀베마이신을 생산하는 재조합 미생물 및 이를 이용한 밀베마이신 생산 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR101833984B1 (ko) |
| WO (1) | WO2017052232A1 (ko) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110857447A (zh) * | 2018-08-23 | 2020-03-03 | 中国科学院上海生命科学研究院 | 提高米尔贝霉素a3/a4或其衍生物产量的方法 |
| CN114763553A (zh) * | 2021-01-12 | 2022-07-19 | 中国农业科学院植物保护研究所 | 一种提高大环内酯抗生素产量的重组载体和重组菌与应用 |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102017788B1 (ko) * | 2017-09-18 | 2019-09-03 | 주식회사 팜한농 | 밀베마이신 d를 생산하는 재조합 미생물 및 밀베마이신 d 생산 방법 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4199569A (en) * | 1977-10-03 | 1980-04-22 | Merck & Co., Inc. | Selective hydrogenation products of C-076 compounds and derivatives thereof |
| US5292647A (en) * | 1992-11-30 | 1994-03-08 | Eli Lilly And Company | Strain of streptomyces for producing avermectins and processes therewith |
| CN1687403A (zh) * | 2005-06-06 | 2005-10-26 | 中国农业大学 | 产伊维菌素的工程菌及其构建方法与应用 |
| WO2015135242A1 (zh) * | 2014-03-10 | 2015-09-17 | 浙江海正药业股份有限公司 | 表达阿维菌素类似物的重组微生物及其用途 |
-
2016
- 2016-09-22 WO PCT/KR2016/010594 patent/WO2017052232A1/ko not_active Ceased
- 2016-09-22 KR KR1020160121760A patent/KR101833984B1/ko active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4199569A (en) * | 1977-10-03 | 1980-04-22 | Merck & Co., Inc. | Selective hydrogenation products of C-076 compounds and derivatives thereof |
| US5292647A (en) * | 1992-11-30 | 1994-03-08 | Eli Lilly And Company | Strain of streptomyces for producing avermectins and processes therewith |
| CN1687403A (zh) * | 2005-06-06 | 2005-10-26 | 中国农业大学 | 产伊维菌素的工程菌及其构建方法与应用 |
| WO2015135242A1 (zh) * | 2014-03-10 | 2015-09-17 | 浙江海正药业股份有限公司 | 表达阿维菌素类似物的重组微生物及其用途 |
Non-Patent Citations (2)
| Title |
|---|
| HUANG, JUN ET AL.: "Gene Replacement for the Generation of Designed Novel Avermectin Derivatives with Enhanced Acaricidal and Nematicidal Activities", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 81, no. 16, 15 August 2015 (2015-08-15), pages 5326 - 5334, XP055371782 * |
| PAN, JUN-JIE ET AL.: "Three New Milbemycins from a Genetically Engineered Strain S. Avermitilis MHJ1011", THE JOURNAL OF ANTIBIOTICS, vol. 69, no. 2, February 2016 (2016-02-01), pages 104 - 107, XP055371784 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110857447A (zh) * | 2018-08-23 | 2020-03-03 | 中国科学院上海生命科学研究院 | 提高米尔贝霉素a3/a4或其衍生物产量的方法 |
| CN110857447B (zh) * | 2018-08-23 | 2023-06-23 | 中国科学院分子植物科学卓越创新中心 | 提高米尔贝霉素a3/a4或其衍生物产量的方法 |
| CN114763553A (zh) * | 2021-01-12 | 2022-07-19 | 中国农业科学院植物保护研究所 | 一种提高大环内酯抗生素产量的重组载体和重组菌与应用 |
| CN114763553B (zh) * | 2021-01-12 | 2024-03-26 | 中国农业科学院植物保护研究所 | 一种提高大环内酯抗生素产量的重组载体和重组菌与应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101833984B1 (ko) | 2018-03-02 |
| KR20170035346A (ko) | 2017-03-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP4765032B2 (ja) | 新規スピノシンを産生するポリケチド合成酵素 | |
| Jha et al. | Metabolic engineering of rational screened Saccharopolyspora spinosa for the enhancement of spinosyns A and D production | |
| WO2017052232A1 (ko) | 밀베마이신을 생산하는 재조합 미생물 및 이를 이용한 밀베마이신 생산 | |
| US6197591B1 (en) | Streptomyces avermitilis regulatory genes for increased avermectin production | |
| AU752343B2 (en) | Streptomyces avermitilis gene directing the ratio of B2:B1 avermectins | |
| US6248579B1 (en) | Streptomyces avermitilis gene directing the ratio of B2:B1 avermectins | |
| AU778837B2 (en) | Streptomyces avermitilis gene directing the ratio of B2:B1 avermectins | |
| MXPA04007777A (es) | Gen de streptomyces avertmitilis que rige la relacion de avermectinas b2:b1. | |
| US20070026488A1 (en) | Biosynthesis of bryostatins by polyketide synthases (PKS) | |
| KR20080020832A (ko) | 벼에서 분리한 당전이효소 유전자를 포함하는 대장균을이용한 플라보놀 3-o-배당체 생산 방법 | |
| MXPA00007915A (en) | I(streptomyces avermitilis) gene directing the ratio of b2:b1 avermectins | |
| AU1881902A (en) | Streptomyces avermitilis gene directing the ratio of B2:B1 avermectins |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16848957 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16848957 Country of ref document: EP Kind code of ref document: A1 |














