WO2017006145A1 - Methods and pharmaceutical compositions for the treatment of cystic fibrosis - Google Patents

Methods and pharmaceutical compositions for the treatment of cystic fibrosis Download PDF

Info

Publication number
WO2017006145A1
WO2017006145A1 PCT/IB2015/001253 IB2015001253W WO2017006145A1 WO 2017006145 A1 WO2017006145 A1 WO 2017006145A1 IB 2015001253 W IB2015001253 W IB 2015001253W WO 2017006145 A1 WO2017006145 A1 WO 2017006145A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
nucleic acid
inhibitor
anol
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2015/001253
Other languages
English (en)
French (fr)
Inventor
Olivier Tabary
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universite Pierre et Marie Curie
Institut National de la Sante et de la Recherche Medicale INSERM
Original Assignee
Universite Pierre et Marie Curie
Institut National de la Sante et de la Recherche Medicale INSERM
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite Pierre et Marie Curie, Institut National de la Sante et de la Recherche Medicale INSERM filed Critical Universite Pierre et Marie Curie
Priority to PCT/IB2015/001253 priority Critical patent/WO2017006145A1/en
Priority to US15/739,366 priority patent/US11130950B2/en
Priority to PCT/EP2016/065565 priority patent/WO2017005646A1/en
Priority to EP16736045.2A priority patent/EP3317412B1/en
Priority to JP2017567701A priority patent/JP7032140B2/ja
Priority to ES16736045T priority patent/ES2856555T3/es
Publication of WO2017006145A1 publication Critical patent/WO2017006145A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/113Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA

Definitions

  • the present invention relates to methods and pharmaceutical compositions for the treatment of cystic fibrosis.
  • Cystic fibrosis is a genetic disease caused by mutations in the gene encoding the
  • CFTR CI- channel (Riordan, 2008). CF affects several organs, but the most severe consequences are observed in the lung. The pathogenesis of lung disease in CF is still not perfectly understood. The loss of CFTR channel function in CF favors the colonization of the airway surface by highly virulent bacteria. However, the mechanism by which this happens is still a matter of debate. CFTR channel activity is certainly an important contributor to mucociliary clearance.
  • the fine balance between CFTR-dependent CI- secretion and Na+ absorption through the ENaC channel controls the thickness of the periciliary fluid (PCF). In the absence of functional CFTR, fluid absorption prevails over secretion. This imbalance dehydrates the airway surface thereby impairing ciliary beating.
  • Immobilized mucus then becomes a niche for bacterial survival and proliferation.
  • Activation of an alternative chloride channel may be an attractive therapeutic strategy in cystic fibrosis. This approach could be applied to all patients irrespective of their genotype. Instead, therapies aimed at CFTR need to be mutation-specific, an approach that may not be applicable to all classes of mutations.
  • the activation of an alternative chloride channel in CF airways could be beneficial by providing a route for chloride and bicarbonate secretion needed to ameliorate mucociliary clearance and restore anti-microbial activity. More than 20 years ago, it was found that airway epithelial cells possess a second type of CI- secretory pathway.
  • purinergic agonists such as ATP or UTP
  • TMEM16A was identified as a component of Ca2+-activated chloride channel (CaCC).
  • CaCC Ca2+-activated chloride channel
  • TMEM16A also known as anoctamin-1 (ANOl)
  • ANOl anoctamin-1
  • TMEM16A activity and expression were reduced in a CF context by an unknown mechanism.
  • the present invention relates to methods and pharmaceutical compositions for the treatment of cystic fibrosis.
  • the present invention is defined by the claims.
  • the aim of the inventors was to understand the origin of the reduced expression of ANOl in CF by studying the role of miRNAs which regulate negatively gene expression.
  • the inventors performed bio-informatic approaches to study miRNAs that could target ANOl and evaluated the expression levels of miRNAs candidates by RT-qPCR in bronchial epithelial cells lines. They performed functionality experiments studying the miRNAs candidates binding to the 3'UTR of ANOl over-expressing miRNAs, and quantifying the expression of ANOl in these conditions. They also evaluated cells migration rate and ANOl chloride activity modulating a miRNA which regulates ANOl . The inventors have identified different miRNAs including miR-9 as potential regulator of ANOl .
  • miR-9 is overexpressed in CF cells and a decrease of ANOl expression and luciferase activity when they overexpress miR-9 in CF and non-CF cells. Furthermore, the inventors observed a decrease of cells migration rate and ANOl chloride activity when miR-9 is overexpressed. In conclusion, the results showed that miR-9 directly regulates ANOl by pairing to its 3'UTR and that modulate miR-9 allows to change cells migration rate and ANOl chloride activity.
  • a first object of the present invention relates to a method of treating cystic fibrosis in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a nucleic acid miR-9 inhibitor.
  • the term "subject” denotes a mammal.
  • a subject according to the invention refers to any subject (preferably human) afflicted or at risk to be afflicted with cystic fibrosis.
  • the method of the invention may be performed for any type of cystic fibrosis such as revised in the World Health Organisation Classification of cystic fibrosis and selected from the E84 group: mucoviscidosis, Cystic fibrosis with pulmonary manifestations, Cystic fibrosis with intestinal manifestations and Cystic fibrosis with other manifestations.
  • ANOl has its general meaning in the art and refers to the anoctamin-1 protein, also known as TMEM16A.
  • ANOl belongs to a protein family composed of 10 members whose primary sequence and predicted structure (eight transmembrane domains) have no similarity with those of other anion channels.
  • An exemplary human nucleic acid sequence is the NCBI Reference Sequence NM_018043.5 (SEQ ID NO: 1).
  • miRNAs refers to mature microRNA (non-coding small RNAs) molecules that are generally 21 to 22 nucleotides in length, even though lengths of 19 and up to 23 nucleotides have been reported. miRNAs are each processed from longer precursor RNA molecules ("precursor miRNA”: pri-miRNA and pre-miRNA). Pri-miRNAs are transcribed either from non-protein-encoding genes or embedded into protein-coding genes (within introns or non-coding exons).
  • the "precursor miRNAs” fold into hairpin structures containing imperfectly base-paired stems and are processed in two steps, catalyzed in animals by two Ribonuclease Ill-type endonucleases called Drosha and Dicer.
  • miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation.
  • the mature -21 nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme.
  • the dominant mature miRNA sequence is processed from the 5' arm of the miR-9 precursor, and from the 3' arm of the mir-79 precursor.
  • the mature products are thought to have regulatory roles through complementarity to mRNA.
  • a "nucleic acid miR-9 inhibitor" i.e.
  • nucleic acid that inhibits miR-9) is any nucleic acid, for example an oligonucleotide, that reduces (i.e. inhibits) the biological activity of miR-9.
  • nucleic acid miR-9 inhibitors comprise a nucleic acid sequence that is complementary with at least a portion of the nucleic acid sequence of either miR-9 itself or the target mRNA sequences of miR-9; inhibition of miR-9 therefore occurs by binding of the inhibitor to miR-9 or to its target mRNA. In both cases, miR-9 is prevented from recognizing and binding its target sequence and thus cannot induce gene silencing.
  • the nucleic acid miR-9 inhibitor of the invention may comprise a structure that is single stranded, double stranded, partially double-stranded, or hairpin in nature.
  • the nucleic acid miR-9 inhibitor binds to miR-9.
  • the nucleic acid miR-9 inhibitor binds to and sequesters miR-9, so preventing it from binding to its target mRNA sequences. Binding occurs via complementary base pairing between at least one nucleotide present in the nucleic acid miR-9 inhibitor and a corresponding nucleotide present in miR-9, such that at least a portion of the nucleic acid miR-9 inhibitor and miR-9 together define a base-paired nucleic acid duplex.
  • Said complementary base pairing can occur over a region of two or more contiguous nucleotides of miR-9 (e.g. 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides).
  • a base-paired nucleic acid duplex formed when the nucleic acid miR-9 inhibitor binds to miR-9 may comprise one or more mismatch pairings.
  • two or more regions of complementary base-paired nucleic acid duplex are formed, wherein each region is separated from the next by one or more mismatch pairings.
  • complementary refers to a nucleic acid molecule that forms hydrogen bonds with another nucleic acid molecule with Watson-Crick base pairing.
  • Watson-Crick base pairing refers to the following hydrogen bonded nucleotide pairings: A:T and C:G (for DNA); and A:U and C:G (for RNA).
  • two or more complementary nucleic acid molecule strands can have the same number of nucleotides (i.e. have the same length and form one double-stranded region, with or without an overhang) or have a different number of nucleotides (e.g. one strand may be shorter than but fully contained within another strand or one strand may overhang the other strand).
  • the nucleic acid miR-9 inhibitor comprises a nucleic acid sequence complementary to at least a portion of the miR-9 sequence.
  • the nucleic acid miR-9 inhibitor may comprise a nucleic acid sequence complementary to 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides of miR-9.
  • the nucleic acid miR-9 inhibitor comprises a nucleic acid sequence having at least 70% sequence identity to a complementary (i.e. antisense) sequence of miR-9.
  • a first nucleic acid sequence having at least 70% of identity with a second nucleic acid sequence means that the first sequence has 70; 71; 72; 73; 74; 75; 76; 77; 78; 79; 80; 81; 82; 83; 84; 85; 86; 87; 88; 89; 90; 91; 92; 93; 94; 95; 96; 97; 98; 99 or 100% of identity with the second nucleic acid sequence.
  • Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar are the two sequences.
  • Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman, Adv. Appl. Math., 2:482, 1981; Needleman and Wunsch, J. Mol. Biol, 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A., 85:2444, 1988; Higgins and Sharp, Gene, 73 :237-244, 1988; Higgins and Sharp, CABIOS, 5: 151-153, 1989; Corpet et al. Nuc.
  • ALIGN compares entire sequences against one another, while LFASTA compares regions of local similarity.
  • these alignment tools and their respective tutorials are available on the Internet at the NCSA Website, for instance.
  • the Blast 2 sequences function can be employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 1 1, and a per residue gap cost of 1).
  • the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties).
  • the BLAST sequence comparison system is available, for instance, from the NCBI web site; see also Altschul et al, J. Mol.
  • the nucleic acid miR-9 inhibitor comprises a sequence complementary to miR-9.
  • the nucleic acid miR-9 inhibitor comprises a nucleic acid sequence that differs from the complementary (i.e. antisense) sequence of miR9 at a maximum of 10 (e.g.
  • the nucleic acid miR-9 inhibitor comprises a nucleic acid sequence that differs from the complementary (i.e. antisense) sequence of miR9 at a maximum of 5 (e.g. a maximum of 4, 3, 2, or 1) nucleotide positions.
  • said nucleic acid sequence is identical to the complementary (i.e. antisense) sequence of miR9 except at a limited number of nucleotide positions.
  • the nucleic acid miR-9 inhibitor as described above, has a maximum length of 60 (for example 55, 50, 45, 40, 35, 30, or 25) nucleotides.
  • the nucleic acid miR-9 inhibitor is a miR-9 antagomir.
  • an "antagomir” is a nucleic acid oligomer that is designed to bind to a specific target microRNA via complementary base pairing (for example, as described above).
  • An antagomir may have a sequence that is wholly or partially complementary to the target microRNA sequence.
  • Antagomirs may have a single stranded, double stranded, partially double-stranded, or hairpin structure.
  • Antagomirs may further comprise chemically modified nucleotides (e.g. as described below). Methods for designing and creating antagomirs are known in the art.
  • the nucleic acid miR-9 inhibitor is a miR-9 microRNA-sponge.
  • miR-9 microRNA-sponge is a nucleic acid that comprises multiple (e.g. at least 2, 3, 4, 5 or 6) binding sites for a specific target microRNA.
  • a microRNA- sponge is able to bind and sequester multiple target microRNA molecules.
  • a microRNA sponge may comprise an mRNA expressed from a vector (e.g. a viral vector or plasmid vector). The presence in a microRNA-sponge of multiple binding sites for the target microRNA enables microRNAs to be adsorbed in a manner analogous to a sponge soaking up water.
  • a microRNA-sponge may bind target microRNAs via complementary base pairing (for example, as described above).
  • a microRNA-sponge may comprise multiple (e.g. at least 2, 3, 4, 5 or 6) nucleic acid sequences, each sequence being complementary to at least a portion of the target microRNA sequence.
  • a microRNA- sponge may comprise multiple (e.g. at least 2, 3, 4, 5 or 6) nucleic acid sequences, wherein each sequence is complementary to the target microRNA sequence.
  • Methods for designing and creating microRNA-sponges are known in the art.
  • the nucleic acid miR-9 inhibitor comprising two or more nucleic acid sequences, wherein each of said two or more nucleic acid sequences has at least 70% sequence identity to the complementary (i.e. antisense) sequence of miR9 is a miR- 9 microRNA sponge.
  • the nucleic acid miR-9 inhibitor does not bind directly to miR-9 but instead binds to a miR-9 mRNA target site in the ANOl nucleic acid sequence. This has the effect of blocking said target site (for example, by steric interference), preventing its recognition and binding by miR-9, and thus inhibiting miR-9 and its actions.
  • the binding of the nucleic acid miR-9 inhibitor of the invention to a miR-9 mRNA target site does not induce gene silencing (e.g. by mRNA degradation or translational repression) of said target mRNA.
  • the miR- 9 mRNA target site is located on a ANOl 3 ' UTR.
  • the miR-9 inhibitor is a Target Site Blocker (TSB). Binding of the nucleic acid miR-9 inhibitor to a miR-9 mRNA target site may occur via complementary base pairing, as described above.
  • TLB Target Site Blocker
  • binding between the nucleic acid miR-9 inhibitor and the miR-9 mRNA target site occurs via complementary base pairing between at least one nucleotide present in the nucleic acid miR-9 inhibitor and a corresponding nucleotide present in the miR-9 mRNA target site, such that at least a portion of the nucleic acid miR-9 inhibitor and the miR-9 mRNA target site together define a base-paired nucleic acid duplex.
  • Said complementary base pairing can occur over a region of two or more contiguous nucleotides of the miR-9 mRNA target site (e.g. 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides).
  • a base- paired nucleic acid duplex formed when the nucleic acid miR-9 inhibitor binds to the miR-9 mRNA target may comprise one or more mismatch pairings.
  • two or more regions of complementary base-paired nucleic acid duplex e.g. 3, 4, 5 or 6) are formed, wherein each region is separated from the next by one or more mismatch pairings.
  • the mRNA target site is located on the 3' UTR (untranslated region) of the target ANOl mRNA.
  • the nucleic acid miR-9 inhibitor competes with miR- 9 for binding to a miR-9 mRNA target site
  • the nucleic acid comprises the nucleic acid sequence TTTTCTCCGTCTTTGGGACCT (SEQ ID NO: 3).
  • said nucleic acid sequence will bind to the miR-9 mRNA target site in ANOl via complementary binding at the location targeted by the seed region of miR-9, thus preventing miR-9 from binding.
  • the nucleic acid miR-9 inhibitor is a small interfering RNA (siRNA) that is targeted against miR-9.
  • siRNA has its general meaning in the art and refers to a double-stranded interfering RNA.
  • siRNA useful in the present methods comprise short double-stranded RNA from about 17 nucleotides to about 29 nucleotides in length, preferably from about 19 to about 25 nucleotides in length.
  • the siRNA comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base-pairing interactions (hereinafter "base-paired").
  • the sense strand comprises a nucleic acid sequence which is substantially identical to a nucleic acid sequence contained within the target miRNA.
  • a nucleic acid sequence in a siRNA which is "substantially identical" to a target sequence contained within the target mRNA is a nucleic acid sequence that is identical to the target sequence, or that differs from the target sequence by one or two nucleotides.
  • the sense and antisense strands of the siRNA can comprise two complementary, single- stranded RNA molecules, or can comprise a single molecule in which two complementary portions are base-paired and are covalently linked by a single-stranded "hairpin" area.
  • the siRNA can also be altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
  • Such alterations can include addition of non- nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, or modifications that make the siRNA resistant to nuclease digestion, or the substitution of one or more nucleotides in the siRNA with deoxyribonucleotides.
  • One or both strands of the siRNA can also comprise a 3 overhang.
  • a "3' overhang” refers to at least one unpaired nucleotide extending from the 3'-end of a duplexed RNA strand.
  • the siRNA comprises at least one 3' overhang of 1 to about 6 nucleotides (which includes ribonucleotides or deoxyribonucleotides) in length, preferably from 1 to about 5 nucleotides in length, more preferably from 1 to about 4 nucleotides in length, and particularly preferably from about 2 to about 4 nucleotides in length.
  • the 3' overhang is present on both strands of the siRNA, and is 2 nucleotides in length.
  • each strand of the siRNA can comprise 3' overhangs of dithymidylic acid ("TT") or diuridylic acid ("uu").
  • the nucleic acid miR-9 inhibitor of the invention may be a ribonucleic acid (RNA) or a deoxyribonucleic acid (DNA), or may comprise both RNA and DNA.
  • a nucleic acid miR-9 inhibitor (as described above) comprises RNA.
  • a nucleic acid miR-9 inhibitor (as described above) comprises DNA.
  • nucleic acid sequences in this document are written in the direction 5 '-3'. As would be understood by a person skilled in the art, nucleic acid sequences written as RNA and containing the nucleotide U may equally be written as DNA by substituting T for U.
  • nucleic acid(s) and/or nucleotide(s) embraces modified nucleic acid(s) and modified nucleotide(s).
  • a nucleic acid or nucleotide may be modified to increase the stability of said nucleic acid or nucleotide, for example by improving resistance to nuclease degradation.
  • a modified nucleic acid comprises a locked nucleic acid (LNA) nucleotide.
  • LNA locked nucleic acid
  • the ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2' oxygen and 4' carbon.
  • the bridge "locks" the ribose in the 3'-endo (North) conformation, which is often found in A- form nucleic acid duplexes.
  • LNA nucleotides can be mixed with DNA or RNA residues in an oligonucleotide whenever desired.
  • the locked ribose conformation enhances base stacking and backbone pre-organization. This significantly increases the hybridization properties (melting temperature) of oligonucleotides.
  • modified nucleotides include 2'- methoxyethoxy (MOE) nucleotides; 2'- methyl-thio-ethyl, 2'-deoxy-2'-fluoro nucleotides.
  • a nucleic acid molecule of the invention may also be conjugated to one or more cholesterol moieties.
  • the nucleic acid miR-9 inhibitor is conjugated to at least one (for example, 1, 2, 3, or 4) cholesterol moiety.
  • a nucleic acid miR-9 inhibitor of the invention may be constructed such that all of its nucleotides are modified nucleotides.
  • the nucleic acid miR-9 inhibitor consists of modified nucleotides.
  • said modified nucleotides consist of LNA nucleotides, or 2'-0-methyl modified nucleotides, or 2 -0- methoxyethyl modified nucleotides, or 2'-fluro modified nucleotides.
  • the nucleic acid miR-9 inhibitor is a synthetic 2'-0-methyl RNA oligonucleotide, and which competes with miR-9 target mRNAs with stronger binding to the miRNA-associated gene silencing complex.
  • Nucleic acid analogues are composed of three parts: a phosphate backbone, a pucker-shaped pentose sugar, either ribose or deoxyribose, and one of four nucleobases.
  • An analogue may have any of these altered.
  • the analogue nucleobases confer, among other things, different base pairing and base stacking proprieties. Examples include universal bases, which can pair with all four canon bases, and phosphate- sugar backbone analogues such as PNA, which affect the properties of the chain.
  • Artificial nucleic acids include peptide nucleic acid (PNA), Morpholino and LNA, as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Each of these is distinguished from naturally-occurring DNA or RNA by changes to the backbone of the molecule.
  • the nucleic acid miR-9 inhibitor is a nucleic acid analogue selected from: a peptide nucleic acid (PNA), a glycol nucleic acid (GNA), a threose nucleic acid (TNA), and a morpholino.
  • the nucleic acid miR-9 inhibitor may comprise at least one (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18 or 20) modified phosphodiester linkage.
  • the modified phosphodiester linkage is a phosphothiorate linkage.
  • all of the phosphodiester linkages are modified phosphodiester linkages.
  • nucleic acid molecules of the invention may be made using any suitable process known in the art.
  • the nucleic acid molecules may be made using chemical synthesis techniques.
  • the nucleic acid molecules of the invention may be made using molecular biology techniques.
  • the invention provides a nucleic acid vector comprising a nucleic acid sequence encoding a nucleic acid miR-9 inhibitor as described above.
  • the nucleic acid molecules of the present invention may be delivered into a target cell using a viral vector.
  • the viral vector may be any virus which can serve as a viral vector. Suitable viruses are those which infect the target cells, can be propagated in vitro, and can be modified by recombinant nucleotide technology known in the art.
  • the invention provides a viral vector comprising a nucleic acid sequence encoding a nucleic acid inhibitor of miR-9 (as described above), for use in the prevention or treatment of cystic fibrosis in a subject.
  • Viral vectors suitable for use in the present invention include poxvirus vectors (such as non-replicating poxvirus vectors), adenovirus vectors, and adeno-associated virus (AAV) vectors.
  • a "non-replicating viral vector” is a viral vector which lacks the ability to productively replicate following infection of a target cell.
  • a target cell such as a human target cell in an individual undergoing vaccination with a non- replicating viral vector
  • Such a viral vector may also be referred to as attenuated or replication-deficient. The cause can be loss/deletion of genes essential for replication in the target cell.
  • Non-replicating viral vectors cannot effectively produce copies of itself following infection of a target cell.
  • Non- replicating viral vectors may therefore advantageously have an improved safety profile as compared to replication-competent viral vectors.
  • a non-replicating viral vector may retain the ability to replicate in cells that are not target cells, allowing viral vector production.
  • a non-replicating viral vector e.g. a non- replicating poxvirus vector
  • the non-replicating poxvirus vector is selected from: a Modified Vaccinia virus Ankara (MVA) vector, a NYVAC vaccinia virus vector, a canarypox (ALVAC) vector, and a fowlpox (FPV) vector.
  • MVA and NYVAC are both attenuated derivatives of vaccinia virus. Compared to vaccinia virus, MVA lacks approximately 26 of the approximately 200 open reading frames.
  • the adenovirus vector is a non-replicating adenovirus vector (wherein non-replicating is defined as above). Adenoviruses can be rendered non- replicating by deletion of the El or both the El and E3 gene regions.
  • the adenovirus vector is selected from: a human adenovirus vector, a simian adenovirus vector, a group B adenovirus vector, a group C adenovirus vector, a group E adenovirus vector, an adenovirus 6 vector, a PanAd3 vector, an adenovirus C3 vector, a ChAdY25 vector, an AdC68 vector, and an Ad5 vector.
  • the nucleic acid miR-9 inhibitor is administered to the subject using any suitable method that enables the nucleic acid miR-9 inhibitor to reach the lungs.
  • the nucleic acid miR-9 inhibitor may be administered to a subject by any suitable means known in the art.
  • the nucleic acid miR-9 inhibitor (as described above) is administered to the subject systemically (i.e. via systemic administration).
  • the nucleic acid miR-9 inhibitor (as described above) is administered to the subject such that it enters the circulatory system and is distributed throughout the body.
  • the nucleic acid miR-9 inhibitor (as described above) is administered to the subject by local administration, for example by local administration to the lungs.
  • the nucleic acid miR-9 inhibitor is delivered by any device adapted to introduce one or more therapeutic compositions into the upper and/or lower respiratory tract.
  • the devices may be adapted to deliver the therapeutic compositions of the invention in the form of a finely dispersed mist of liquid, foam or powder.
  • the device may use a piezoelectric effect or ultrasonic vibration to dislodge powder attached on a surface such as a tape in order to generate mist suitable for inhalation.
  • the devices may use any propellant system known to those in the art including, but not limited to, pumps, liquefied- gas, compressed gas and the like.
  • Devices of the present invention typically comprise a container with one or more valves through which the flow of the therapeutic composition travels and an actuator for controlling the flow.
  • the devices suitable for administering the constructs of the invention include inhalers and nebulisers.
  • inhalers Various designs of inhalers are available commercially and may be employed to deliver the medicaments of the invention. These include the Accuhaler, Aerohaler, Aerolizer, Airmax, Autohaler, Clickhaler, Diskhaler, Easi- breathe inhaler, Fisonair, Integra, Jet inhaler, Miat-haler, Novolizer inhaler, Pulvinal inhaler, Rotahaler, Spacehaler, Spinhaler, Syncroner inhaler and Turbohaler devices.
  • the delivery is done by means of a nebulizer or other aerosolisation device provided the integrity of the nucleic acid miR-9 inhibitor is maintained.
  • the nucleic acid miR-9 inhibitor may be administered to the subject in a single delivery, such as a bolus delivery. Alternatively, the nucleic acid miR-9 inhibitor may be administered to the subject using a continuous delivery technique, such as a timed infusion. The nucleic acid miR-9 inhibitor may be administered using a repeated delivery regimen, for example on an hourly, daily or weekly basis. Nucleic acid miR-9 inhibitor dosages may be achieved by single or multiple administrations. By way of example, the nucleic acid miR-9 inhibitor may be administered to the subject in a regimen consisting of a single administration. Alternatively, the nucleic acid miR-9 inhibitor may be administered to the subject in a regimen comprising multiple administrations.
  • an administration regimen may comprise multiple administrations per day, or daily, weekly, bi-weekly, or monthly administrations.
  • An example regimen comprises an initial administration followed by multiple, subsequent administrations at weekly or bi-weekly intervals.
  • Another example regimen comprises an initial administration followed by multiple, subsequent administrations at monthly or bi-monthly intervals.
  • administration of the nucleic acid miR-9 inhibitor can be guided by monitoring of CF symptoms in the subject.
  • an example regimen comprises an initial administration followed by multiple, subsequent administrations carried out on an irregular basis as determined by monitoring CF symptoms in the subject.
  • Methods for delivering nucleic acids are known in the art and will be familiar to a skilled person.
  • suitable nucleic acid delivery methods include ionophoresis, microspheres (e.g. bioadhesive microspheres), nanoparticles, dendritic polymers, liposomes, hydrogels, cyclodextrins, and proteinaceous vectors.
  • a “therapeutically effective amount” of the nucleic acid miR-9 inhibitor as above described is meant a sufficient amount of the inhibitor to reach a therapeutic effect. It will be understood, however, that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment.
  • the specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidential with the specific inhibitor employed; and like factors well known in the medical arts.
  • the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day.
  • the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated.
  • a medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient.
  • An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day.
  • the nucleic acid miR-9 inhibitor (or a viral vector encoding said nucleic acid miR-9 inhibitor) may be formulated as a pharmaceutical composition comprising a nucleic acid miR-9 inhibitor (as described above) or a viral vector (as described above) (as active ingredient).
  • a pharmaceutical composition can be formulated according to known methods for preparing pharmaceutical compositions, such as by combining a nucleic acid miR-9 inhibitor or viral vector with a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carriers including water, saline and phosphate-buffered saline.
  • the pharmaceutical composition in addition to a pharmaceutically acceptable carrier can further be combined with one or more of a salt, excipient, diluent, albumin, immunoregulatory agent and/or antimicrobial compound.
  • Pharmaceutically acceptable salts include acid addition salts formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or with organic acids such as acetic, oxalic, tartaric, maleic, and the like. Salts formed with the free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2- ethylamino ethanol, histidine, procaine, and the like.
  • Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof.
  • the pharmaceutical compositions may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, and/or pH buffering agents.
  • buffering agents include, but are not limited to, sodium succinate (pH 6.5), and phosphate buffered saline (PBS; pH 6.5 and 7.5).
  • the invention provides a pharmaceutical composition comprising a nucleic acid miR-9 inhibitor (as described above) or a viral vector (as described above) and a pharmaceutically acceptable carrier.
  • the pharmaceutical composition may contain 5% to 95% of nucleic acid miR-9 inhibitor or viral vector, such as at least 10%, at least 25%, at least 40%, or at least 50, 55, 60, 70 or 75%.
  • nucleic acid miR-9 inhibitor or viral vector such as at least 10%, at least 25%, at least 40%, or at least 50, 55, 60, 70 or 75%.
  • FIGURES are a diagrammatic representation of FIGURES.
  • FIG. 2 miR-9 regulates ANOl expression in non-CF cells.
  • Non-CF cells (16FIBE14o-) were transfected with a mimic of miR-9 or a negative control during 48h.
  • Fig 3 miR-9 regulates chloride activity and migration rate of non-CF cells.
  • Non- CF cells (16FIBE14o-) were transfected with a mimic of miR-9 or a negative control during 48h.
  • a/ ANOl chloride channel activity assessed by I- quenching of halide-sensitive YFP- H148q/I152L protein.
  • Representative and original traces of ANOl chloride activity (right) and quantification (left) of non-CF cells transfected with mimic of mir-9 or a negative control (n 8 in triplicate), bl Migration rates during repair of non-CF cells.
  • Fig 4 miR-9 directly target ANOl 3'UTR in non-CF and CF cells, a/ Relative luciferase activity in non-CF cells (16HBE14o-) transiently transfected with a luciferase- 3'UTR ANOl vector or a luciferase-3'UTR ANOl vector mutated for miR-9 binding sites and co-transfected with with a mimic of miR-9 (mimic miR-9) or a negative control (control).
  • FIG. 5 Use of specific TSB allows to increase ANOl expression, chloride activity and migration rate of CF cells.
  • CF cells CFBE41o-
  • LNA control control
  • FIG. 6 Use of specific TSB allows to increase ANOl expression, chloride activity and migration rate of primary CF cells.
  • the human bronchial epithelial cell lines 16HBE14o " (non-CF) and CFBE41o " (CF) were obtained as a gift from Dr D.C. Gruenert (San Francisco, CA, USA) and cultured in MEM containing 10% bovine growth serum and 1% penicillin/streptomycin. Cells cultures were grown and maintained at 37°C in a 5% C0 2 humidified incubator.
  • hAECB Primary human bronchial epithelial cells
  • MucilAirTM human bronchial air-liquid-interface cultures
  • Non-CF and CF cell lines were transfected with miR-9 mimic, miR-9 inhibitor or a control (Thermo Fischer, France) using HiPerfect (Qiagen, France) at 30nM according to the manufacturer's instructions. Forty eight hours after transfection, cells were lysed for miRNAs and RNAs extraction or for proteins extraction.
  • CF cell lines were transfected with LNA-enhanced oligonucleotides designed to overlap miR-9 target site in ANOl 3'UTR (ANOl TSB) or with a miRCURY LNA microRNA inhibitor negative control (LNA control) (Exiqon, Denmark) using Interferin (Polyplus, Ozyme, France). 24h after transfection, cells were lysed for RNAs and proteins extraction, and chloride activity and migration were measured.
  • ANOl TSB ANOl 3'UTR
  • LNA control miRCURY LNA microRNA inhibitor negative control
  • hAECB cells were transfected adding medium containing LNA control or TSB ANOl without any transfection reagent to the upper compartment of ALI cells. After 2h at 37°C, the medium was removed from the upper compartment to restore the ALI condition. Freshly prepared LNA control or TSB ANOl were added every day during 3 days and ANOl expression, ANOl chloride activity and migration were assessed 24h post-treatment. Luciferase assay
  • Lysates were prepared 48h hours after transfection and assayed for both firefly and renilla luciferase using luciferase assay system (Promega, France). Firefly luciferase activity was normalized to the Renilla luciferase activity. miRNAs andRNA extraction and quantitative RT-PCR (qRT-PCR) analysis
  • miRNAs and RNAs were extracted using Macherey-nagel kit (Diiren, Germany).
  • Reverse Transcription (RT) for human miR-9 and RNU6B were carried out with TaqMan MicroRNA Assay kit (Thermo Fischer) using 20ng miRNAs sample.
  • RT for ANOl and GAPDH were done using High Capacity cDNA Reverse Transcription kit (Thermo Fischer) using lug RNA sample.
  • Quantitative PCR was performed using an ABI StepOnePlusTM (Thermo Fischer) and TaqMan technology. For relative quantification, the ANOl mRNA level, calculated using the 2 " ⁇ method was normalized for GAPDH and for the expression levels of respective non-CF models and miR-9 level was normalized for RNU6B. Each sample was assessed in triplicate to insure experiment quality. miRNA detection using SmartFlareTM probes
  • miR-9 SmartFlareTM probe or a scramble (control) were added to the culture media at a final concentration of 200 pM and incubated during 24h at 37 °C overnight. Then the cells were transfected with the control or the mimic of miR-9 during 24h. The signal of SmartFlareTM were visualized using a Axiovert 200 Zeiss microscope.
  • Cells were cultured on glass coverslips. Cells were transfected with a mimic of miR-9 or a control and 48h after transfection, they were fixed in 4% paraformaldehyde in culture medium supplemented with 10% FBS for 15 min at room temperature and then permeabilized with PBS containing 0.1% Triton X-100 for 15 min. Cells were incubated with ANOl primary antibody (Abeam) overnight in a humidified chamber at 4 °C. After being washed with PBS, cells were subsequently incubated with goat-anti-rabbit IgGAlexa Fluor 488 (Life Technologies) secondary antibody (1 :2000 dilution) for lh at room temperature.
  • ANOl primary antibody Abeam
  • Migration assays were performed using specific wound assays chambers (Ibidi, Biovalley, Marne la Vallee, France) that provided uniform wounds between two monolayers. A constant number of cells producing a confluent layer within 72 h were seeded in each well of Ibidi® silicone culture-inserts. The cells were incubated at 37 °C and 5% C0 2 . After 24h, cells were transfected with a mimic of miR-9 or a negative control (Life Technologies, Saint Aubin, France) or a TSB ANOl/LNA control (Exiqon). The culture-insert was removed 48h later, leaving a cell-free gap (or wound) for cell colonization.
  • wounds were done using a tip soaked in liquid nitrogen.
  • the probe was transfected into the cells and, after 48h of culturing, conductance was stimulated with UTP (10 ⁇ ).
  • ⁇ solution 140 mM was added, and fluorescence was recorded into a plate reader as previously described.
  • the initial ⁇ influx rate following the addition of each solution was computed from changes in YFP fluorescence data using non-linear regression and represents the original and representative traces.
  • slope for fluorescence quenching was performed using a linear regression and correlates to the size of the chloride conductance ( ⁇ uptake).
  • the rate of change (AF/min) is used for bar graph representation.
  • n indicates the number of repeated experiments. Between-group differences were tested using the student t test. Values of p lower than 0.05 were considered significant; in the figures, statistically significant differences with p ⁇ 0.05 (*), p ⁇ 0.01 (**), and p ⁇ 0.001 (***) are indicated.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pulmonology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/IB2015/001253 2015-07-03 2015-07-03 Methods and pharmaceutical compositions for the treatment of cystic fibrosis Ceased WO2017006145A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
PCT/IB2015/001253 WO2017006145A1 (en) 2015-07-03 2015-07-03 Methods and pharmaceutical compositions for the treatment of cystic fibrosis
US15/739,366 US11130950B2 (en) 2015-07-03 2016-07-01 Methods and pharmaceutical compositions for the treatment of cystic fibrosis
PCT/EP2016/065565 WO2017005646A1 (en) 2015-07-03 2016-07-01 Methods and pharmaceutical compositions for the treatment of cystic fibrosis
EP16736045.2A EP3317412B1 (en) 2015-07-03 2016-07-01 Methods and pharmaceutical compositions for the treatment of cystic fibrosis
JP2017567701A JP7032140B2 (ja) 2015-07-03 2016-07-01 嚢胞性線維症の処置のための方法及び医薬組成物
ES16736045T ES2856555T3 (es) 2015-07-03 2016-07-01 Procedimientos y composiciones farmacéuticas para el tratamiento de la fibrosis quística

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/IB2015/001253 WO2017006145A1 (en) 2015-07-03 2015-07-03 Methods and pharmaceutical compositions for the treatment of cystic fibrosis

Publications (1)

Publication Number Publication Date
WO2017006145A1 true WO2017006145A1 (en) 2017-01-12

Family

ID=54347575

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/IB2015/001253 Ceased WO2017006145A1 (en) 2015-07-03 2015-07-03 Methods and pharmaceutical compositions for the treatment of cystic fibrosis
PCT/EP2016/065565 Ceased WO2017005646A1 (en) 2015-07-03 2016-07-01 Methods and pharmaceutical compositions for the treatment of cystic fibrosis

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/065565 Ceased WO2017005646A1 (en) 2015-07-03 2016-07-01 Methods and pharmaceutical compositions for the treatment of cystic fibrosis

Country Status (5)

Country Link
US (1) US11130950B2 (https=)
EP (1) EP3317412B1 (https=)
JP (1) JP7032140B2 (https=)
ES (1) ES2856555T3 (https=)
WO (2) WO2017006145A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019076919A1 (en) 2017-10-17 2019-04-25 INSERM (Institut National de la Santé et de la Recherche Médicale) COMBINED TREATMENT OF CYSTIC FIBROSIS
WO2021074657A1 (en) 2019-10-17 2021-04-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Combination treatment for cystic fibrosis

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023152369A1 (en) * 2022-02-14 2023-08-17 INSERM (Institut National de la Santé et de la Recherche Médicale) Nucleic acid mir-9 inhibitor for the treatment of cystic fibrosis

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103948926A (zh) 2014-03-24 2014-07-30 江苏大学 miR-9抑制剂在制备用于抑制肿瘤生长药物中的用途

Non-Patent Citations (19)

* Cited by examiner, † Cited by third party
Title
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL ET AL., NAT. GENET., vol. 6, 1994, pages 119 - 129
ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402
CORPET ET AL., NUC. ACIDS RES., vol. 16, 1988, pages 10881 - 10890
F. SONNEVILLE ET AL: "WS06.4 miR-9 and ANO1: Therapeutic targets in cystic fibrosis?", JOURNAL OF CYSTIC FIBROSIS, vol. 14, 1 June 2015 (2015-06-01), NL, pages S11, XP055258135, ISSN: 1569-1993, DOI: 10.1016/S1569-1993(15)30036-9 *
FLORENCE SONNEVILLE ET AL: "New Insights about miRNAs in Cystic Fibrosis", AMERICAN JOURNAL OF PATHOLOGY., vol. 185, no. 4, 1 April 2015 (2015-04-01), US, pages 897 - 908, XP055258142, ISSN: 0002-9440, DOI: 10.1016/j.ajpath.2014.12.022 *
GISH.; STATES, NATURE GENET., vol. 3, 1993, pages 266 - 272
HIGGINS; SHARP, CABIOS, vol. 5, 1989, pages 151 - 153
HIGGINS; SHARP, GENE, vol. 73, 1988, pages 237 - 244
HUANG ET AL., COMP. APPLS BIOSCI., vol. 8, 1992, pages 155 - 165
MADDEN ET AL., METH. ENZYMOL., vol. 266, 1996, pages 131 - 141
MYERS; MILLER, CABIOS, vol. 4, 1989, pages 11 - 17
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
PEARSON ET AL., METH. MOL. BIOL., vol. 24, 1994, pages 307 - 31
PEARSON; LIPMAN, PROC. NATL. ACAD. SCI. U.S.A., vol. 85, 1988, pages 2444
RUFFIN MANON ET AL: "Anoctamin 1 dysregulation alters bronchial epithelial repair in cystic fibrosis", BIOCHIMICA ET BIOPHYSICA ACTA. MOLECULAR BASIS OF DISEASE, vol. 1832, no. 12, 27 September 2013 (2013-09-27), pages 2340 - 2351, XP028768899, ISSN: 0925-4439, DOI: 10.1016/J.BBADIS.2013.09.012 *
SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482
W. R. PEARSON, INTERNET PROGRAM® 1996, December 1996 (1996-12-01)
ZHANG; MADDEN, GENOME RES., vol. 7, 1997, pages 649 - 656

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019076919A1 (en) 2017-10-17 2019-04-25 INSERM (Institut National de la Santé et de la Recherche Médicale) COMBINED TREATMENT OF CYSTIC FIBROSIS
US11261445B2 (en) 2017-10-17 2022-03-01 Inserm (Institut National De La Sante Et De La Recherche Medicale) Combination treatment for cystic fibrosis
WO2021074657A1 (en) 2019-10-17 2021-04-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Combination treatment for cystic fibrosis

Also Published As

Publication number Publication date
JP7032140B2 (ja) 2022-03-08
WO2017005646A1 (en) 2017-01-12
ES2856555T3 (es) 2021-09-27
US11130950B2 (en) 2021-09-28
EP3317412B1 (en) 2020-12-02
WO2017005646A8 (en) 2017-10-19
EP3317412A1 (en) 2018-05-09
JP2018520150A (ja) 2018-07-26
US20200040332A1 (en) 2020-02-06

Similar Documents

Publication Publication Date Title
US20220133774A1 (en) Modulation of micrornas against myotonic dystrophy type 1 and antagonists of micrornas therefor
CN104087662A (zh) 对抗、预防和/或测定心力衰竭或心力衰竭的风险的工具和方法
EP2868746A1 (en) Micrornas modulating the effect of glucocorticoid signaling
US20170268009A1 (en) Methods and pharmaceutical compositions for treatment of cystic fibrosis
CN111566212A (zh) miRNA分子,等同物,安塔够妙或其来源用于治疗和/或诊断与神经元缺陷相关的病症和/或疾病或用于神经元生成和/或再生
US11130950B2 (en) Methods and pharmaceutical compositions for the treatment of cystic fibrosis
US20240180953A1 (en) Staufen1 agents and associated methods
US12565650B2 (en) STAUFEN1 regulating agents and associated methods
CN118697757B (zh) miRNA168a的应用
KR102399851B1 (ko) 인슐린 저항성 검출 및 치료용 조성물 및 방법
EP4421173A1 (en) Use of micrornas in the treatment of lung diseases
EP4616905A1 (en) Use of inhibitors of micrornas in the treatment of lung diseases
US20150045410A1 (en) Method of regulating cftr expression and processing
CN112779252B (zh) 靶向SMN2启动子区MeCP2结合的关键甲基化区域的反义寡核苷酸
CN113018440B (zh) miR-7977作为抑制高糖诱导的Ad-MSCs凋亡药物靶标的应用
WO2023152369A1 (en) Nucleic acid mir-9 inhibitor for the treatment of cystic fibrosis
Yang et al. Targeting miR-499-5p for Neuroprotection in Spinal Cord Injury: Implications for Inflammation and ROS-Induced Neuronal Damage
WO2024036343A2 (en) Synergistic nucleic acid based therapeutics and methods of use for treating genetic disorders
WO2024159113A1 (en) Modulators of alternative polyadenylation and methods of use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15784748

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2015784748

Country of ref document: EP

122 Ep: pct application non-entry in european phase

Ref document number: 15784748

Country of ref document: EP

Kind code of ref document: A1