WO2017003105A1 - 신규 트랜스아미나제 및 이를 이용한 아미노 화합물의 탈아민 방법 - Google Patents

신규 트랜스아미나제 및 이를 이용한 아미노 화합물의 탈아민 방법 Download PDF

Info

Publication number
WO2017003105A1
WO2017003105A1 PCT/KR2016/005871 KR2016005871W WO2017003105A1 WO 2017003105 A1 WO2017003105 A1 WO 2017003105A1 KR 2016005871 W KR2016005871 W KR 2016005871W WO 2017003105 A1 WO2017003105 A1 WO 2017003105A1
Authority
WO
WIPO (PCT)
Prior art keywords
acid
transaminase
polypeptide
reaction
microorganism
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2016/005871
Other languages
English (en)
French (fr)
Inventor
이재헌
양영렬
오린석
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CJ CheilJedang Corp
Original Assignee
CJ CheilJedang Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CJ CheilJedang Corp filed Critical CJ CheilJedang Corp
Publication of WO2017003105A1 publication Critical patent/WO2017003105A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli

Definitions

  • the present invention relates to a novel isolated polypeptide having transaminase activity and a polynucleotide encoding the same, a microorganism comprising the polynucleotide, and a method for deamination of an amino compound using the polypeptide or the microorganism.
  • Adipic acid is a dicarboxylic acid compound having a molecular formula of (CH 2 ) 4 (COOH) 2 .
  • Adipic acid is widely used as a raw material for nylon water support materials, plastic plasticizers, dye medicines and the like, and is particularly important as an intermediate product for the production of polyamides such as nylon 6,6, and has a high commercial value.
  • Adipic acid is mainly produced from petroleum compounds as a raw material by chemical process in two steps. Specifically, cyclic compounds such as phenol, cyclohexane, cyclohexene, and benzene, which are starting materials, are converted to ketone-alcohol oil (KA oil), which is called cyclohexanone or cyclohexanol. Adipic acid is produced by oxidation using nitric acid. This chemical process has high efficiency and economy, but has the problem of using benzene as a raw material and generating a large amount of nitrogen oxide as a by-product. In addition to these problems, the recent tightening of environmental regulations has led to the necessity of an environmentally friendly process in the production of adipic acid.
  • KA oil ketone-alcohol oil
  • the present inventors completed the present invention by separating a novel microorganism having deamine activity and finding a new enzyme therefrom while studying a method of deamines 6-aminocaproic acid.
  • One object of the present invention is to provide a novel isolated polypeptide having transaminase activity.
  • Another object of the present invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a microorganism transformed to express the polypeptide.
  • One aspect of the invention provides a novel isolated polypeptide comprising the polypeptide of SEQ ID NO: 7 and having transaminase activity.
  • polypeptide having a transaminase activity refers to a polypeptide having an activity that catalyzes a reversible amino group transfer reaction between an amino acid and ⁇ -keto acid, and the transaminase is an aminotransfer Also called 'aminotransferase'.
  • polypeptide refers to a polymer of amino acids, and a form in which a few amino acids are linked is called a peptide, and when many amino acids are linked to a protein. About 20 kinds of amino acids that make up protein are linked to each other through chemical bonds to make polypeptide.
  • Polypeptides having transaminase activity of the present invention may comprise the amino acid sequence of SEQ ID NO.
  • the polypeptide is an amino acid sequence having at least 75%, at least 80%, specifically at least 90%, more specifically at least 95%, and even more specifically at least 99% of the amino acid sequence of SEQ ID NO: 7.
  • the amino acid sequence of the polypeptide having the activity of catalyzing the amino group transfer reaction of the transaminase of the present invention can be included without limitation.
  • it may include all of its variants or analogs and the like.
  • homologous sequences thereof having the same or similar activity as a given polypeptide sequence or polynucleotide sequence are denoted as "% homology".
  • % homology For example, using standard software that calculates parameters such as score, identity and similarity, in particular BLAST 2.0, or by hybridization experiments used under defined stringent conditions Can be identified by comparison with and the appropriate hybridization conditions defined can be determined by methods well known to those skilled in the art.
  • the polypeptide having the transaminase activity may be derived from Pseudomonas stutzeri. Also specifically, the polypeptide may be derived from Pseudomonas stutzeri CJ-MKB (KCCM11587P). In one embodiment, Pseudomonas stucherry CJ-MKB, a novel strain that immobilizes 6-aminocaproic acid with a nitrogen source, was isolated, thereby obtaining a polypeptide having novel transaminase activity.
  • Polypeptides having transaminase activity of the present invention can deaminize amino compounds.
  • the amino compound that can be deamined by the polypeptide of the present invention may be at least one selected from the group consisting of N-acetyl ornithine, gammaaminobutyric acid, 5-aminovaleric acid and 6-aminocaproic acid, but is not limited thereto. Do not. More specifically, the amino compound may be 5-amino valeric acid or 6-aminocaproic acid.
  • 4-aminobutyrate transaminase it is known to use 4-aminobutyric acid (gammaaminobutyric acid) as a substrate, but there is no known deaminerability to other amino compounds other than 4-aminobutyric acid. It has also been reported that 4-aminobutyrate transaminase derived from Pseudomonas fluorescens is not reactive to 5-aminovaleric acid and 6-aminocaproic acid (Scott, EM; Jacoby, WB, Soluble gamma-). aminobutyric-glutamic transaminase from Pseudomonas fluorescens, J. Biol.
  • polypeptides having transaminase activity of the present invention can catalyze their deamination reaction by using 5-aminovaleric acid or 6-aminocaproic acid as substrates in addition to 4-aminobutyric acid.
  • glutamine is produced by deamination of 5-amino valeric acid or 6-aminocaproic acid by the polypeptide of the present invention.
  • Another aspect of the invention provides a polynucleotide encoding a polypeptide having said transaminase activity.
  • polynucleotide refers to a polymer of nucleotides in which nucleotide monomers are long chained by covalent bonds, and generally have a length of DNA (deoxyribonucleic acid) or RNA (ribonucleic acid) or more. it means.
  • the polynucleotide may comprise a polynucleotide encoding the polypeptide of SEQ ID NO: 7.
  • the polynucleotide may be one comprising the nucleotide sequence of SEQ ID NO: 6.
  • the polynucleotide is a transamin of the present invention as a sequence showing at least 80%, specifically at least 90%, more specifically at least 95%, even more specifically at least 99% homology with the nucleotide sequence of SEQ ID NO: 6. Any nucleotide sequence encoding a protein having active activity can be included without limitation.
  • variants of the nucleotide sequences that encode the same amino acid sequence due to genetic code degeneracy may also be included in the present invention.
  • microorganism transformed to express a polypeptide having said transaminase activity.
  • the microorganism may be a microorganism transformed to express a polynucleotide encoding the polypeptide having transaminase activity, more specifically a microorganism transformed by a recombinant vector operably linked to the expression vector.
  • a recombinant vector operably linked to the expression vector.
  • polypeptide and the polynucleotide are each as described above.
  • operably linked means that the gene sequence is functionally linked with a promoter sequence for initiating and mediating the transcription of a polynucleotide encoding a polypeptide having a transaminase activity of the present invention.
  • Operable linkage with expression vectors can be made using genetic recombination techniques known in the art, and site-specific DNA cleavage and linkage can be made using cleavage and linking enzymes, and the like, in the art.
  • the term "expression vector” refers to a DNA preparation containing a nucleotide sequence of a polynucleotide encoding the target protein operably linked to a suitable regulatory sequence to allow expression of the target protein in a suitable host.
  • the regulatory sequence includes a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation.
  • Examples of commonly used vectors include, but are not limited to, natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • an expression vector comprising a polynucleotide encoding the polypeptide having a transaminase activity
  • the polypeptide having the desired transaminase activity is transformed into the host cell. Can be expressed in.
  • transformation means introducing a vector comprising a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • Transformed polynucleotides include all of them, as long as they can be expressed in the host cell, regardless of whether they are inserted into or located outside the chromosome of the host cell.
  • Methods for transforming a vector of the present invention into such cells include any method of introducing a base into a cell, and can be carried out by selecting a suitable standard technique as known in the art. Electroporation, calcium phosphate co-precipitation, retroviral infection, microinjection, DEAE-dextran, cationic liposome Law, but the present invention is not limited thereto.
  • the term “transformed microorganism” includes both prokaryotic and eukaryotic microorganisms as long as the microorganism is capable of expressing the polypeptide having the transaminase activity.
  • the microorganism may be, for example, the genus Escherichia, Erwinia, Serratia, Providencia, Corynebacterium or Brevibacterium. Brevibacterium) may be a microbial strain belonging to.
  • the microorganism may specifically be an Escherichia genus microorganism, and more specifically, E. coli.
  • Another aspect of the present invention provides a method of deamination of an amino compound, comprising adding a polypeptide having transaminase activity of the present invention or a microorganism expressing the same to a solution containing an amino compound.
  • the polypeptide having the transaminase activity is as described above.
  • the microorganism expressing the polypeptide having transaminase activity may be a microorganism transformed with a recombinant vector comprising a polynucleotide encoding the polypeptide having a transaminase activity of the present invention.
  • the transformed microorganism is as described above.
  • the microorganism may be added to a solution containing an amino compound in the form of a culture of the microorganism or a lysate of the microorganism.
  • the amino compound may be, for example, one or more selected from the group consisting of N-acetyl ornithine, gammaaminobutyric acid, 5-amino valeric acid, and 6-aminocaproic acid, but is not limited thereto.
  • the amino compound may specifically be 5-amino valeric acid or 6-aminocaproic acid.
  • the solution containing the amino compound may include pyruvate, at least one selected from the group consisting of oxaloacetate and ⁇ -ketoglutarate, and pyridoxalphosphate. have.
  • the pyridoxal phosphate may be required as a coenzyme in the reaction of the transaminase of the polypeptide of the present invention.
  • the pyruvate, oxaloacetate and ⁇ -ketoglutarate are amines that accept the amino group released from the amino group in the reaction. It can be used as an amine acceptor.
  • the method of deaminating the amino compound may further include recovering the compound from which the amino group has been removed from the reactant.
  • the amino group-removed compound may be preferably at least one selected from the group consisting of N-acetylglutamate5-semialdehyde, succinate semialdehyde, glutarate semialdehyde, and adipate semialdehyde, but is not limited thereto.
  • the method for recovering the compound from which the amino group has been removed from the cell or the culture may be collected or recovered by removing the compound from which the amino group produced from the culture is removed using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, anion exchange chromatography, crystallization and HPLC can be used, but are not limited to these examples.
  • the method of deamination of the amino compound can be used in the production method of adipic acid.
  • the production method of adipic acid is reacted by adding the transaminase of the present invention or a pulverized solution of the microorganism comprising the same to a solution containing 6-aminocaproic acid as an amino compound, and then converted to the 6-aminocaproic acid
  • Adipic acid can be synthesized from the adipate semialdehyde by using a method known to a person skilled in the art. Synthesis of adipic acid from the adipate semialdehyde may be preferably by an aldehyde dehydrogenase reaction.
  • the polypeptide having the transaminase activity of the present invention was first discovered.
  • the method of deamination of an amino compound using the peptide can be used in a bio-based production method of adipic acid. This means that in the production of adipic acid, which was conventionally produced by a chemical method, it provides a basis for producing adipic acid on a bio-based basis using a novel route.
  • FIG. 1 is a photograph showing that a strain selected using a minimal medium using 6-aminocaproic acid as a nitrogen source forms a biofilm. Specifically, after culturing a single colony, the result obtained by centrifugation and the resultant were separated into a biofilm and a strain using distilled water.
  • Figures 2a to f compare on the TLC the production of glutamate and the degree of degradation of the substrate with and without varying concentrations of 5-aminovaleric acid, 6-aminocaproic acid, alpha-ketoglutaric acid, pyridoxal phosphate and the presence of each substrate One result is shown.
  • FIG. 3 is an SDS-PAGE gel photograph showing overexpression of soluble proteins from E. coli strains transformed with the gene of the transaminase of the present invention.
  • Figure 4 shows the result of the reaction of the overexpression of the transaminase of the present invention E. coli pulverized liquid and 4-aminobutyric acid, 5-amino valeric acid, and 6-aminocaproic acid, respectively, by TLC.
  • Figure 5 shows the result of increasing the reaction time of the transaminase-expressing cell grinding liquid of the present invention and the substrate by TLC.
  • FIG. 6 shows the results of LC-MASS analysis on the samples reacted with 6-aminocaproic acid in FIG. 5.
  • Example 1 6 - Aminocaproic acid Identification of microorganisms used as nitrogen source
  • a new strain Pseudomonas stutzeri CJ-MKB was selected that was able to fix the nitrogen source with 6-aminocaproic acid (6-ACA) and deamine 6-aminocaproic acid through subculture.
  • 6-aminocaproic acid 6-aminocaproic acid
  • Table 1 a minimal medium in which microorganisms can be cultured was prepared as shown in Table 1 below, and 6-aminocaproic acid was used as a nitrogen source for strain culture.
  • the cultured candidate strains were cultured at an initial inoculation optical density (OD600) of 0.05 until the optical density reached 0.5 in the same medium, 37 °C, 200rpm conditions.
  • Five passages were used to select the microorganisms to be cultured in the medium having the composition shown in Table 1.
  • the selected microorganisms were named first 'CJ-MKB', and the following experiment was conducted to confirm that they were new microorganisms.
  • CJ-MKB strains cultured in the medium were plated on M9 agar plates to secure colonies.
  • the colonies obtained had a similar form and were resistant to ampicillin at a concentration of 25 mg / ml. And it was confirmed that a light biofilm (biofilm) is formed around the colony.
  • Two colonies were selected and rearranged in M9 liquid medium, and genomic DNA was extracted using a commercially available genomic DNA prep kit. The sequence of 16S ribosomal RNA (16S rRNA) was analyzed for identification of the obtained genome.
  • Microorganisms are known to form exopolysaccharides to form bio-flim, and Pseudomonas spp.
  • Microorganisms are known to beta-lactam family of antibiotics such as penicillin. Has resistance. Considering the sequence information of the 16S rRNA of the CJ-MKB strain and resistance to the biofilm and ampicillin shown during the cultivation, it was expected that the selected strain was Pseudomonas strain microorganism.
  • SEQ ID NO: 2 had the same sequence as the molybdopterin-binding sequence of the oxidoreductase of the known Pseudomonas stucheri A1501 strain.
  • the selected new strain CJ-MKB was confirmed to be Pseudomonas genus microorganisms.
  • Nucleic acid sequences identified with homology were 714 short sequences, and thus could not accurately classify the dependencies of microorganisms. Additional protein nucleic acid sequences were analyzed to confirm dependence. If the microorganism uses 6-ACA as the nitrogen source, it is expected to be specific for N-acetylornithine transaminase or 4-aminobutyrate transaminase activity among the transaminases expected to be involved in its enzymatic conversion reaction, The base sequences encoding the two enzyme activities were identified.
  • argD_F2 (5 'primer: ATTTAAGGA TCCGTCCGCCCCGCACACCCCGG) Nucleic acid sequences were analyzed by PCR using SEQ ID NO: 12) and argD_R2 (3 'primer: ATTTAAGAGCTC TCAGGCCTGGGTCAGCGTC; SEQ ID NO: 13).
  • nucleotide sequences encoding N-acetylornithine transaminase activity of Pseudomonas stucheri A1501 and the novel microorganisms had the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4, respectively.
  • gabT_F (5 'primer: ATTTAACATATGCAACGCCGTGTCGCCGCCGTTCC; SEQ ID NO: 14) and gabT_R (3' primer: PCR was performed using ATTTAAGAATTCTCAGGTCAGCTCGTCGAAACACT; SEQ ID NO: 15). As a result, it was confirmed that each had a nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6.
  • the selected strain Pseudomonas stutzeri CJ-MKB (Pseudomonas stutzeri CJ-MKB) has the highest homology with Pseudomonas stucheri A1501 among the known microbial genome sequences, it was confirmed that the new strain. Accordingly, the selected strain was deposited with the Korea Microorganism Conservation Center on October 22, 2014 and received accession number KCCM11587P.
  • the degree of degradation was compared on TLC. After TLC development, the 3% ninhydrin solution was used to develop a material having an amine group. Through the TLC results, it was confirmed that 5-amino valeric acid and 6-aminocaproic acid disappeared and glutamate was produced (see FIGS. 2A to f).
  • 6-aminocaproic acid was not observed when 5-amino valeric acid and 6-aminocaproic acid were present at the same time (97 h reaction, lane 5, and 5-1 in FIG. 2F). It was evaluated that 6-aminocaproic acid and 5-aminovaleric acid were competitive reactions with nitrogen sources when Pseudomonas stucheri CJ-MKB was cultured under minimum medium conditions.
  • Pseudomonas stucheri CJ-MKB can use 6-aminocaproic acid as a single nitrogen source, 5-amino valeric acid and 6-aminocaproic acid deamination in the presence of alpha-ketoglutarate and pyridoxalphosphate It can be confirmed that the acceleration (Fig. 2a to f). On the other hand, a small amount of glutamate was confirmed in the 24h reaction, lane 5 and 72h reaction, lane 4 of Fig. 2d and 2e, but did not accumulate continuously. It is believed that with the reaction of 6-aminocaproic acid, glutamate is produced, but since most of the glutamate is used as an amine source, it is rapidly converted without accumulating in cells.
  • Example 3 Of the present invention in E. coli strains Transaminase Induction of overexpression and evaluation of reactivity
  • the nucleotide sequence of SEQ ID NO: 6 (hereinafter, referred to as "gabT"), which is a transaminase gene of Pseudomonas stucheri CJ-MKB, was amplified by PCR and cloned into pETDuet1 vector, which is an E. coli overexpression vector.
  • gabT a transaminase gene of Pseudomonas stucheri CJ-MKB
  • pETDuet1 vector which is an E. coli overexpression vector.
  • the recombinant His-tag was located at the front of the DNA sequence.
  • E. coli Rosetta strains were transformed by inserting the cloned vector by heat shock method.
  • the transformed strain was placed in ampoules of 50 mg / ml in 3 mL of LB solution medium and incubated at 37 ° C. for 12 hours.
  • the cultured strains were put in 50 mL LB containing ampicillin and cultured at 37 ° C., and the optical luminosity (600 nm wavelength) was 0.8.
  • the expression was induced using 0.2 mM IPTG and expressed at 18 ° C. for 48 hours.
  • the cultured strains were washed and then cells were crushed using a sonicator. Overexpression with soluble protein after grinding was confirmed through SDS-PAGE gel results (FIG. 3).
  • Escherichia coli Rosetta strain transformed with the transaminase of Pseudomonas stucheri CJ-MKB was named 'E. coli Rosetta CC04-0058', and it was deposited with the Korea Microorganism Conservation Center on October 22, 2014 and assigned accession number KCCM11589P. received.
  • Example 3-1) 50 ⁇ l of a cell lysate induced by overexpression of the transaminase of the present invention, 10 mM of a substrate (4-aminobutyric acid, 5-aminovaleric acid, or 6-amino Caproic acid), 10 mM alpha-ketoglutarate 0.1 mM pyridoxal-phosphate, and filled with 50 mM HEPES buffer (pH 8.0) to proceed the reaction in a volume of 100 ⁇ l. After reaction at 37 ° C. for 30 minutes, the production of glutamate from each substrate by the transaminase of the present invention was confirmed by TLC (FIG. 4).
  • E. coli cell lysate overexpressed the transaminase gene (lane 2, 4, 6, 8) of the present invention and cell lysate (expressed lanes 1, 3, 5, The glutamate spots produced according to the reaction of 7) were compared. Although quantitative analysis is difficult on TLC, glutamate at a concentration of 1 to 5 mM can identify a rough tendency. As a result, the production of glutamate was confirmed for 4-aminobutyric acid, 5-amino valeric acid, and 6-aminocaproic acid, and it was confirmed that the deamine reaction of each substrate proceeded.
  • the transaminase of the present invention was re-expressed to evaluate the reactivity to 6-aminocaproic acid and 5-aminovaleric acid once more (FIG. 5).
  • the reaction conditions differ only in that the reaction time is increased three times from 30 minutes to 1.5 hours, and other conditions are the same as in Example 3-2).
  • LC-MASS analysis was performed on the samples reacted with 6-aminocaproic acid of FIG. 5. Reproduction experiments were carried out under the same conditions as in Example 3-3).
  • 6-aminocaproic acid the cell pulverization reaction expressing only the empty vector (pET-Duet1) (lane 3 of FIG. 5), the reaction lacking pyridoxal phosphate (PLP) and alpha-ketoglutarate ( Lane 4) of FIG. 5, the reaction of the transaminase of the present invention (lane 5 of FIG. 5), and 10 mM 6-aminocaproic acid (lane 6 of FIG. 5) were confirmed by TLC.
  • the reaction analysis results are shown in Table 2 below (see FIG. 6).
  • novel transaminase of the present invention derived from Pseudomonas stucheri CJ-MKB was used as a substrate in addition to gammaaminobutyric acid, which is known as a substrate, to carry out their deamination reaction using 5-amino valeric acid and 6-aminocaproic acid as substrates. I could see it.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 발명은 트랜스아미나제 활성을 가지는 신규 분리된 폴리펩티드 및 이를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 미생물, 및 상기 폴리펩티드 또는 상기 미생물을 이용하여 아미노 화합물을 탈아민화시키는 방법에 관한 것이다.

Description

신규 트랜스아미나제 및 이를 이용한 아미노 화합물의 탈아민 방법
본 발명은 트랜스아미나제 활성을 가지는 신규 분리된 폴리펩티드 및 이를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 미생물, 및 상기 폴리펩티드 또는 상기 미생물을 이용하여 아미노 화합물을 탈아민화시키는 방법에 대한 것이다.
아디프산(adipic acid)은 (CH2)4(COOH)2의 분자식을 갖는 디카르복실산(dicarboxylic acid) 화합물이다. 아디프산은 나일론 수지원료, 플라스틱 가소제, 염료 의약품 등의 원료로서 널리 사용되고 있으며, 특히 나일론 6,6과 같은 폴리아미드의 제조에 중요한 중간 생성물로서, 상업적 가치가 매우 높다.
아디프산은 주로 석유화합물을 원료물질로 두 단계의 공정을 거치는 화학적 방법으로 생산한다. 구체적으로 시작물질인 페놀, 싸이클로헥산, 싸이클로헥센, 벤젠 등의 고리형 화합물을 싸이클로헥사논 또는 싸이크로헥사놀로 명명되는 케톤-알콜 오일 (ketone-alcohol oil, KA oil)로 전환시킨 다음, 이 후 질산을 이용한 산화공정을 통해 아디프산을 생산한다. 이 화학적 공정은 고효율성 및 경제성을 지녔으나, 벤젠을 원료로 사용하고 막대한 양의 질소 산화물을 부산물로 발생시킨다는 문제점이 있다. 이러한 문제점과 더불어 최근 강화되는 환경규제로 인해 아디프산의 생산에 있어서 친환경적 공정의 필요성이 대두되었으며, 이에 따라 아디프산을 미생물을 통해 생산하려는 노력이 시작되고 있다. 그러나 아디프산 생산의 중간체로 사용될 수 있는 6-아미노카프로산의 정확한 생합성 또는 생분해 경로는 아직까지 알려져 있지 않다. 6-아미노카프로산의 6-아민 그룹을 제거하고 케톤기가 도입되면 아디페이트 세미알데하이드 (adipate semialdehyde)가 되며, 알데하이드 디하이드로게나제 (aldehyde dehydrogenase)의 반응을 통해 아디프산을 합성할 수 있을 것으로 예상된다 (Guerrillot L. et al., Eur J Biochem., 1977, 81(1):185-92; Vandecasteele, J.P. et al., Methods Enzymol., 1982, 89: 484-490). 같은 수의 탄소로 이루어진 6-아미노카프로산으로부터 아디프산으로의 효소 전환 반응은 상업적 가치뿐만 아니라 신규 기술로서 가능성이 높게 평가되나, 실제 반응에 관여할 수 있는 효소 또는 미생물 역시 공지되지 않았다.
이에, 본 발명자들은 6-아미노카프로산을 탈아민하는 방법을 연구하던 중 탈아민 활성을 가지는 신규 미생물을 분리하고, 이로부터 신규 효소를 발견함으로써 본 발명을 완성하였다.
본 발명의 일 목적은 트랜스아미나제 활성을 갖는 신규 분리된 폴리펩티드를 제공하는 것이다.
본 발명의 다른 목적은 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 폴리펩티드를 발현하도록 형질전환된 미생물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 폴리펩티드를 이용하여 아미노 화합물을 탈아민화시키는 방법을 제공하는 것이다.
본 발명의 일 양태는 서열번호 7의 폴리펩티드를 포함하며, 트랜스아미나제 활성을 가지는, 분리된 신규 폴리펩티드를 제공한다.
본 발명에서 용어, "트랜스아미나제(transaminase) 활성을 가지는 폴리펩티드"는 아미노산과 α-케토산 사이의 가역적인 아미노기 전이 반응을 촉매하는 활성을 갖는 폴리펩티드를 의미하는 것으로, 상기 트랜스아미나제는 아미노트랜스퍼라제(aminotransferase)'라고도 부른다.
본 발명에서 용어, "폴리펩티드"는 아미노산의 중합체를 의미하며, 보통 소수의 아미노산이 연결된 형태를 펩티드라 부르고, 많은 아미노산이 연결되면 단백질로 부른다. 단백질을 이루고 있는 약 20 종류의 아미노산들이 화학결합을 통해 서로 연결되어 폴리펩티드를 만든다.
본 발명의 트랜스아미나제 활성을 가지는 폴리펩티드는 서열번호 7의 아미노산 서열을 포함할 수 있다. 또한 상기 폴리펩티드는 서열번호 7의 아미노산 서열과 75% 이상, 80% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 보다 더욱 구체적으로는 99% 이상의 서열 상동성을 가지는 아미노산 서열로서, 본 발명의 트랜스아미나제의 아미노기 전이 반응을 촉매하는 활성을 갖는 폴리펩티드의 아미노산 서열이라면 제한 없이 포함할 수 있다. 또한, 상기 폴리펩티드와 생물학적으로 동일하거나 상응하는 활성을 지니는 한, 그의 변이체 또는 유사체 등을 모두 포함할 수 있다.
본 발명에서 용어, "상동성"은 주어진 폴리펩티드 서열 또는 폴리뉴클레오티드 서열과 일치하는 정도를 의미하며 백분율로 표시될 수 있다. 본 명세서에서, 주어진 폴리펩티드 서열 또는 폴리뉴클레오티드 서열과 동일하거나 유사한 활성을 갖는 그의 상동성 서열이 "% 상동성"으로 표시된다. 예를 들면, 점수(score), 동일성(identity) 및 유사도(similarity) 등의 매개 변수(parameter)들을 계산하는 표준 소프트웨어, 구체적으로 BLAST 2.0를 이용하거나, 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 당업자에게 잘 알려진 방법으로 결정될 수 있다.
상기 트랜스아미나제 활성을 가지는 폴리펩티드는 슈도모나스 스투체리(Pseudomonas stutzeri)로부터 유래된 것일 수 있다. 또한 구체적으로는 상기 폴리펩티드는 슈도모나스 스투체리(Pseudomonas stutzeri) CJ-MKB (KCCM11587P)로부터 유래된 것일 수 있다. 일 실시예에서 6-아미노카프로산을 질소원으로 고정화시키는 신규 균주인 슈도모나스 스투체리 CJ-MKB를 분리하고, 이로부터 신규한 트랜스아미나제 활성을 갖는 폴리펩티드를 수득하였다.
본 발명의 트랜스아미나제 활성을 가지는 폴리펩티드는 아미노 화합물을 탈아민화시킬 수 있다. 본 발명의 폴리펩티드가 탈아민화시킬 수 있는 아미노 화합물은 구체적으로 N-아세틸 오르니틴, 감마아미노부티르산, 5-아미노발레르산 및 6-아미노카프로산으로 이루어진 군으로부터 선택되는 하나 이상일 수 있으나, 이에 제한되지 않는다. 보다 구체적으로 상기 아미노 화합물은 5-아미노발레르산 또는 6-아미노카프로산일 수 있다. 종래 공지된 4-아미노부티레이트 트랜스아미나제의 경우, 기질로서 4-아미노부티르산(감마아미노부티르산)을 사용하는 것은 알려져 있었으나, 4-아미노부티르산 이외에 다른 아미노 화합물에 대한 탈아민 반응성에 대해서는 알려진 바 없다. 또한 슈도모나스 플루오레센스 (Pseudomonas fluorescens) 유래의 4-아미노부티레이트 트랜스아미나제는 5-아미노발레르산 및 6-아미노카프로산에 대한 반응성이 없는 것으로 보고되었다 (Scott, E.M.; Jacoby, W.B., Soluble gamma-aminobutyric-glutamic transaminase from Pseudomonas fluorescens, J. Biol. Chem., 1959, 234, 932-936). 그러나 본 발명의 트랜스아미나제 활성을 가지는 폴리펩티드는 4-아미노부티르산 이외에 5-아미노발레르산 또는 6-아미노카프로산을 기질로 사용하여 이들의 탈아민화 반응을 촉매할 수 있다. 일 실시예에서 본 발명의 폴리펩티드에 의해 5-아미노발레르산 또는 6-아미노카프로산이 탈아민화되어 글루타메이트가 생성되는 것을 확인할 수 있다.
본 발명의 다른 양태는 상기 트랜스아미나제 활성을 갖는 폴리펩티드를 코딩하는 폴리뉴클레오티드를 제공한다.
본 발명에서 용어, "폴리뉴클레오티드"란 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일반적으로 일정한 길이 이상의 DNA(deoxyribonucleic acid)나 RNA(ribonucleic acid) 가닥을 의미한다.
상기 폴리뉴클레오티드는 서열번호 7의 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 것일 수 있다. 구체적으로 상기 폴리뉴클레오티드는 서열번호 6의 염기서열을 포함하는 것일 수 있다. 또한 상기 폴리뉴클레오티드는 서열번호 6의 염기서열과 80%이상, 구체적으로는 90%이상, 보다 구체적으로는 95%이상, 보다 더욱 구체적으로는 99% 이상의 상동성을 나타내는 서열로서 본 발명의 트랜스아미나제 활성을 갖는 단백질을 코딩하는 뉴클레오티드 서열이라면 제한없이 포함할 수 있다. 또한, 유전 암호의 축퇴성(genetic code degeneracy)에 기인하여 동일 아미노산 서열을 코딩하는 상기 뉴클레오티드 서열들의 변이체 또한 본 발명에 포함할 수 있다.
본 발명의 또 다른 양태는 상기 트랜스아미나제 활성을 가지는 폴리펩티드를 발현하도록 형질전환된 미생물을 제공한다. 구체적으로, 상기 미생물은 상기 트랜스아미나제 활성을 가지는 폴리펩티드를 코딩하는 폴리뉴클레오티드가 발현되도록 형질전환된 미생물, 더욱 구체적으로 상기 폴리뉴클레오티드가 발현 벡터에 작동가능하게 연결된 재조합 벡터에 의해 형질전환된 미생물일 수 있다.
상기 폴리펩티드 및 상기 폴리뉴클레오티드는 각각 상기한 바와 같다.
본 발명에서 용어, "작동 가능하게 연결"이란 본 발명의 트랜스아미나제 활성을 가지는 폴리펩티드를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다. 발현 벡터와의 작동가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있다.
본 발명에서 용어 "발현 벡터"는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 암호화하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함한다. 벡터는 적당한 숙주 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다. 본 발명에서 사용되는 벡터는 숙주 중에서 복제 가능한 것이면 특별히 한정되지 않으며 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있으며, 이에 한정되지 않는다. 상기 제조된 트랜스아미나제 활성을 갖는 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 발현 벡터를 숙주 세포에 형질전환(transformation) 또는 형질감염(transfection) 시킴으로써, 목적하는 트랜스아미나제 활성을 갖는 폴리펩티드를 당해 숙주 세포에서 발현시킬 수 있게 된다.
본 발명에서 용어, "형질전환"은 표적 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터를 숙주 세포 내에 도입하여 숙주 세포 내에서 상기 폴리뉴클레오티드가 암호화하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주 세포 내에 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하든지 상관없이 이들 모두를 포함한다. 상기 세포 내로 본 발명의 벡터를 형질전환시키는 방법은 염기를 세포 내로 도입하는 어떤 방법도 포함되며, 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 일렉트로포레이션(electroporation), 칼슘 포스페이트 공동-침전(calcium phosphate co-precipitation), 레트로바이러스 감염(retroviral infection), 미세주입법(microinjection), DEAE-덱스트란(DEAE-dextran), 양이온 리포좀(cationic liposome) 법 등이 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "형질전환된 미생물"은 상기 트랜스아미나제 활성을 가지는 폴리펩티드를 발현할 수 있는 미생물이라면, 원핵 미생물 및 진핵 미생물 어느 것이나 포함된다. 상기 미생물은 예를 들면 에스케리키아(Escherichia) 속, 어위니아(Erwinia) 속, 세라티아(Serratia) 속, 프로비덴시아(Providencia) 속, 코리네박테리움(Corynebacterium) 속 또는 브레비박테리움(Brevibacterium) 속에 속하는 미생물 균주일 수 있다. 상기 미생물은 구체적으로 에스케리키아(Escherichia) 속 미생물일 수 있으며, 더욱 구체적으로는 대장균일 수 있다.
본 발명의 또 다른 양태는 본 발명의 트랜스아미나제 활성을 가지는 폴리펩티드 또는 이를 발현하는 미생물을 아미노 화합물이 함유된 용액에 첨가하는 단계를 포함하는, 아미노 화합물을 탈아민화시키는 방법을 제공한다.
상기 방법에 있어서, 상기 트랜스아미나제 활성을 가지는 폴리펩티드는 상기한 바와 같다.
상기 방법에 있어서, 상기 트랜스아미나제 활성을 갖는 폴리펩티드를 발현하는 미생물은 본 발명의 트랜스아미나제 활성을 갖는 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 재조합 벡터로 형질전환된 미생물일 수 있다. 상기 형질전환된 미생물은 상기한 바와 같다. 상기 미생물은 미생물의 배양물 또는 미생물의 분쇄액(lysate)의 형태로 아미노 화합물이 함유된 용액에 가해질 수 있다.
상기 아미노 화합물은 예를 들면 N-아세틸 오르니틴, 감마아미노부티르산, 5-아미노발레르산 및 6-아미노카프로산으로 이루어진 군으로부터 선택되는 하나 이상일 수 있으나, 이에 제한되지 않는다. 또한 상기 아미노 화합물은 구체적으로는 5-아미노발레르산, 또는 6-아미노카프로산일 수 있다.
상기 아미노 화합물이 함유된 용액은 파이루베이트(pyruvate), 옥살로아세테이트(oxaloacetate) 및 α-케토글루타레이트(α-ketoglutarate)로 이루어진 군으로부터 선택되는 하나 이상, 및 피리독살포스페이트를 포함할 수 있다. 상기 피리독살 포스페이트는 본 발명의 폴리펩티드의 트랜스아미나제의 반응에서 조효소로서 요구될 수 있다 또한 상기 파이루베이트, 옥살로아세테이트 및 α-케토글루타레이트는 반응에서 아미노기로부터 이탈된 아미노기를 받아들이는 아민 받개(amine acceptor)로서 이용될 수 있다.
또한 상기 아미노 화합물을 탈아민화시키는 방법은 상기 반응물로부터 아미노기가 제거된 화합물을 회수하는 단계를 더 포함할 수 있다. 상기 아미노기가 제거된 화합물은 바람직하게는 N-아세틸글루타메이트5-세미알데하이드, 숙시네이트 세미알데하이드, 글루타레이트 세미알데하이드 및 아디페이트 세미알데하이드로 이루어진 군으로부터 선택되는 하나 이상일 수 있으나, 이에 제한되지 않는다. 세포 또는 배양물로부터 아미노기가 제거된 화합물을 회수하는 방법은 배양방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여, 배양물로부터 생산된 아미노기가 제거된 화합물을 수집 또는 회수할 수 있다. 예를 들면 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으나, 이들 예에 한정되지 않는다.
상기 아미노 화합물을 탈아민화시키는 방법은 아디프산의 생산 방법에 이용될 수 있다. 상기 아디프산의 생산 방법은 아미노 화합물로서 6-아미노카프로산을 포함하는 용액에 본 발명의 트랜스아미나제 또는 이를 포함하는 미생물의 분쇄액을 가하여 반응시킨 다음, 상기 6-아미노카프로산으로에서 전환된 아디페이트 세미알데하이드로부터 적합한 통상의 기술자에게 공지의 방법을 이용하여 아디프산을 합성할 수 있다. 상기 아디페이트 세미알데하이드로부터 아디프산의 합성은 바람직하게는 알데하이드 디하이드로게나제 (aldehyde dehydrogenase) 반응에 의한 것일 수 있다.
본 발명의 트랜스아미나제 활성을 갖는 폴리펩티드를 최초로 발굴하였다. 또한, 상기 펩티드를 이용하여 아미노 화합물을 탈아민화시키는 방법은 아디프산의 바이오 기반의 생산 방법에서 이용할 수 있다. 이는 종래에 화학적 방법으로 생산하던 아디프산 생산에 있어서, 신규한 경로를 이용하여 바이오 기반으로 아디프산을 생산할 수 있는 기반을 마련해준 것에 의의가 있다.
도 1은 6-아미노카프로산을 질소원으로 사용한 최소 배지를 이용하여 선별된 균주가 바이오 필름을 형성하는 것을 보여주는 사진이다. 구체적으로 단일 콜로니를 배양한 후 이를 원심분리하여 수득한 결과물 및 이 결과물을 증류수를 이용하여 바이오필름과 균주로 분리시킨 것이다.
도 2a 내지 f는 5-아미노발레르산, 6-아미노카프로산, 알파-케토글루타르산, 피리독살 포스페이트의 다양한 농도 및 각각의 기질의 유무에 따른 글루타메이트의 생성 및 기질의 분해 정도를 TLC 상에서 비교한 결과를 나타낸다.
[5AVA: 10mM 5-아미노발레르산 (standard); 1: 20mM 6-아미노카프로산 (standard); 2: 슈도모나스 스투체리 CJ-MKB + 20mM 6-아미노카프로산; 3: 슈도모나스 스투체리 CJ-MKB + 10mM 6-아미노카프로산 및 20mM 5-아미노발레르산; 4: 슈도모나스 스투체리 CJ-MKB + 20mM 6-아미노카프로산, 10mM 알파-케토글루타레이트 및 0.1mM 피리독살-포스페이트; 4-1: 슈도모나스 스투체리 CJ-MKB + 20mM 6-아미노카프로산 및 10mM 알파-케토글루타레이트; 5: 슈도모나스 스투체리 CJ-MKB + 10mM 6-아미노카프로산, 20mM 5-아미노발레르산, 10mM 알파-케토글루타레이트 및 0.1mM 피리독살-포스페이트; 5-1: 슈도모나스 스투체리 CJ-MKB + 10mM 6-아미노카프로산, 20mM 5-아미노발레르산 및 10mM 알파-케토글루타레이트; 6: 슈도모나스 스투체리 CJ-MKB + 20mM 6-아미노카프로산 및 20mM 글루타메이트; E: 10mM 글루타메이트 (standard)]
도 3은 본 발명의 트랜스아미나제의 유전자로 형질전환된 대장균 균주로부터 가용성 단백질로 과발현되는 것을 보여주는 SDS-PAGE 젤 사진이다.
도 4는 본 발명의 트랜스아미나제의 과발현이 유도된 대장균 분쇄액과 4-아미노부티르산, 5-아미노발레르산, 및 6-아미노카프로산을 각각 반응시킨 결과를 TLC로 나타낸 것이다.
[1: 과발현된 pETDuet1(공벡터)과 GABA(gamma-aminobutyric acid)의 반응; 2: 과발현된 본 발명의트랜스아미나제와 GABA의 반응; 3: 과발현된 pETDuet1과 5-AVA(5-aminovaleric acid)의 반응; 4: 과발현된 본 발명의 트랜스아미나제와 5-AVA의 반응; 5: 과발현된 pETDuet1과 6-ACA(6-aminocaproic acid)의 반응; 6: 과발현된 본 발명의 트랜스아미나제와 6-ACA의 반응; 7: 과발현된 pETDuet1; 8: 과발현된 본 발명의 트랜스아미나제; 9: 10mM 글루타메이트(standard)]
도 5는 본 발명의 트랜스아미나제 발현 세포 분쇄액과 기질과의 반응시간 증가시킨 결과를 TLC로 나타낸 것이다.
[1: 5-AVA(standard); 2: 5-AVA와 과발현된 본 발명의 트랜스아미나제의 반응; 3: 6-ACA와 과발현된 pETDuet1와의 반응; 3: PLP(피리독살 포스페이트) 및 알파-케토글루타레이트가 결여된 6-ACA와 과발현된 본 발명의 트랜스아미나제의 반응; 5: 6-ACA와 과발현된 본 발명의 트랜스아미나제와의 반응; 6: 10mM 6-ACA(standard); 7: 글루타메이트 (standard)]
도 6은 도 5에서 6-아미노카프로산과 반응시킨 샘플들에 대한 LC-MASS 분석 결과를 나타낸다.
이하 본 발명을 실시예에 의해 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것은 아니다.
실시예 1: 6 - 아미노카프로산을 질소원으로 사용하는 미생물 동정
1) 6- 아미노카프로산을 질소원으로 사용하는 미생물 선별 및 16S rRNA 분석
질소원을 6-아미노카프로산(6-ACA)으로 고정시키고 계대배양 방법을 통해서 6-아미노카프로산을 탈아민시킬 수 있는 신규 균주 슈도모나스 스투체리(Pseudomonas stutzeri) CJ-MKB를 선별하였다. 선별을 위해 미생물이 배양될 수 있는 최소 배지를 하기 표 1의 조성과 같이 제조하였고, 균주 배양에 필요한 질소원으로 6-아미노카프로산을 사용하였다.
배지 조성 최종 농도
Na2HPO4·H2O 15.1 mM
KH2PO4 22 mM
NaCl 8.6 mM
6-아미노카프로산 20 mM
MgSO4 1 mM
CaCl2 100 mM
(NH4)6Mo7O24·H2O 3 nM
H3BO3 400 nM
CoCl2·H2O 30 nM
CuSo4·H2O 10 nM
MnCl2·H2O 80 nM
ZnSO4·H2O 10 nM
FeSO4·H2O 1 mM
글루코스 11.1 mM
구체적으로, 서울특별시 가양동에 소재한 씨제이제일제당㈜ 김포공장의 토양샘플을 표 1의 조성을 갖는 배지를 이용하여 37℃, 200rpm 조건에서 배양하였다. 배양된 후보 균주들은 초기 접종 광학밀도 (OD600)를 0.05로 맞춰 동일한 배지, 37℃, 200rpm 조건에서 광학밀도가 0.5에 도달할 때까지 배양하였다. 5 차례의 계대 배양을 통해 표 1의 조성을 갖는 배지에서 배양되는 미생물을 선별할 수 있었다. 선별된 미생물을 일차적으로 'CJ-MKB'라 명명하고, 신규 미생물임을 확인하기 위해 다음의 실험을 진행하였다.
상기 배지에서 배양된 CJ-MKB 균주를 M9 아가 플레이트에 도말하여 콜로니들을 확보하였다. 얻어진 콜로니는 유사한 형태를 가졌으며, 25 mg/ml 농도의 앰피실린에 대하여 저항성을 가졌다. 그리고 콜로니 주변으로 옅은 색의 바이오 필름 (biofilm)이 형성되는 것을 확인하였다. 두 개의 콜로니를 선택하여 M9 액체 배지에 재배양하고, 상용화된 genomic DNA prep kit를 이용하여 유전체(genomic DNA)를 각각 추출하였다. 얻어진 유전체의 동정을 위해 16S ribosomal RNA (16S rRNA)의 서열을 분석하였다. 미생물 16S rRNA의 서열 분석에서 보편적으로 사용되는 프라이머 27F (AGA GTT TGA TCC TGG CTC AG; 서열번호 8) 및 프라이머 1492R (GGT TAC CTT GTT ACG ACT T; 서열번호 9)를 이용하여, CJ-MKB 유전체의 16S rRNA가 서열 번호 1의 염기 서열을 가지는 것을 확인하였다.
미국국립생물정보센터(National Center for Biotechnology Information, NCBI)에서 제공되는 BLAST 프로그램을 이용하여 서열 번호 1과 높은 핵산 상동성을 가지는 균주를 검색하였다. (http://blast.ncbi.nlm.nih.gov/Blast.cgi℃PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome). 그 결과, 슈도모나스 스투체리 NBRIS11 균주 (Pseudomonas stutzeri strain NBRIS11), 감마 프로테오박테리움 BP44-iso8 (Gamma proteobacterium BP44-iso8), 언컬처드 박테리움 클론 9(Uncultured bacterium clone 9), 에스케리키아 콜리 BM0446 균주(Escherichia coli strain BM0446), 및 엔테로박테리아세애 박테리움 BM005 (Enterobacteriaceae bacterium BM005)와 16S rRNA 와 각각 동일한 서열을 가지는 것으로 확인되었다.
확인된 미생물들 중 여러 슈도모나스 종 미생물들이 엑소폴리사카라이드(exopolysaccharide)를 만들어 바이오-필름(bio-flim)을 형성하는 것으로 알려져 있으며, 또한 슈도모나스 종 미생물은 페니실린과 같은 베타-락탐 계열의 항생제에 대한 저항성을 가지고 있다. CJ-MKB 균주의 16S rRNA의 서열 정보와 배양 중에 보여지는 바이오필름, 앰피실린에 대한 저항성을 가지는 것을 고려해 볼 때, 선별된 균주가 슈도모나스 계열의 미생물일 확률이 높을 것으로 예상되었다. 25mg/ml 농도의 앰피실린을 함유한 M9 배지 아가 플레이트에서 얻어진 단일 콜로니를 LB 브로스로 배양하고, 13,000rpm으로 1분 동안 원심분리하여 배양된 균주를 수득할 수 있었다 (도 1). 수득한 균주에 증류수를 넣고 가볍게 흔들어 주면, 바이오필름과 균주가 쉽게 분리된다.
2) 산화환원효소의 염기서열 분석
선별된 균주가 슈도모나스 속 미생물인지 여부를 확인하기 위해 슈도모나스 종에 존재하는 산화환원효소(oxidoreductase)의 염기서열을 신규 균주 CJ-MKB가 갖고 있는지 분석하였다. 이를 위해 새롭게 디자인한 프라이머 NCPPB 5P (ATGAGCAAGACTAACGAATCCC; 서열번호 10) 및 프라이머 NCPPB 3P (TCCAGAATGGCCAGCCCGCG; 서열번호 11)를 이용하여 서열 분석을 진행하였다. 그 결과 서열번호 2의 염기서열을 가지는 것을 확인하였다.
서열번호 2의 염기서열을 NCBI BLAST로 분석해본 결과, 서열번호 2가 공지된 슈도모나스 스투체리 A1501 균주의 산화환원효소의 몰리브도프테린-결합 (molybdopterin-binding) 서열과 동일한 서열을 가지는 것을 확인함으로써, 선별된 신규 균주 CJ-MKB는 슈도모나스 속 미생물임을 확인하였다.
3) 트랜스아미나아제의 염기서열 분석
상동성이 확인된 핵산 서열은 714개의 짧은 서열이므로, 미생물의 종속을 정확히 분류할 수 없었다. 이에 추가적인 단백질 핵산 서열을 분석하여 종속을 확인하였다. 미생물이 6-ACA를 질소원으로 사용하는 경우, 이의 효소 전환반응에 관여할 것으로 예상되는 트랜스아미나제 중 N-아세틸오르니틴 트랜스아미나제 또는 4-아미노부티레이트 트랜스아미나제 활성에 특이적일 것으로 예상하고, 상기 두 효소 활성을 코딩하는 염기서열을 확인하였다.
구체적으로, 슈도모나스 스투체리 A1501과 선별된 균주 CJ-MKB의 게놈(genome)에 존재하는 N-아세틸오르니틴 트랜스아미나제 활성을 코딩하는 염기 서열을 비교 분석하기 위하여, argD_F2 (5' 프라이머: ATTTAAGGA TCCGTCCGCCCCGCACACCCCGG; 서열번호 12) 및 argD_R2 (3' 프라이머: ATTTAAGAGCTC TCAGGCCTGGGTCAGCGTC; 서열번호 13)를 사용하여 PCR 수행에 의해 핵산 서열을 분석하였다. 그 결과 슈도모나스 스투체리 A1501과 신규 미생물의 N-아세틸오르니틴 트랜스아미나제 활성을 코딩하는 염기서열이 각각 서열번호 3 및 서열번호 4의 염기 서열을 가지는 것을 확인하였다.
또한 동일한 방법으로 슈도모나스 스투체리 A1501과 선별된 균주의 4-아미노부티레이트 트랜스아미나제 활성을 코딩하는 염기 서열을 비교분석하기 위하여 gabT_F (5' 프라이머: ATTTAACATATGCAACGCCGTGTCGCCGCCGTTCC; 서열번호 14)와 gabT_R (3' 프라이머: ATTTAAGAATTCTCAGGTCAGCTCGTCGAAACACT; 서열번호 15)를 이용하여 PCR을 수행하였다. 그 결과 각각 서열번호 5 및 서열번호 6의 염기 서열을 가지는 것을 확인하였다.
슈도모나스 스투체리 A1501과 선별된 신규 균주의 N-아세틸오르니틴 트랜스아미나제 염기 서열을 비교 분석하기 위해 다중서열정렬(Multiple sequence alignment)을 이용하였다. 그 결과, 1,221개의 핵산 서열 중 13개의 핵산이 다른 것으로 확인되었다 (핵산 상동성: 98.9353%). 또한 동일한 방법으로 슈도모나스 스투체리 A1501과 신규 균주의 4-아미노부티레이트 트랜스아미나제로 추정되는 핵산 서열을 비교 분석한 결과 1,257개의 핵산 서열 중 21개의 핵산이 다른 것으로 확인되었다 (핵산 상동성: 98.3294%)
결론적으로 선별된 균주 슈도모나스 스투체리 CJ-MKB (Pseudomonas stutzeri CJ-MKB)는 현재까지 알려진 미생물 유전체 서열 중에 슈도모나스 스투체리 A1501와 가장 높은 상동성을 가지며, 새로운 균주임이 확인되었다. 이에 따라 선별된 균주를 2014년 10월 22일자로 한국미생물보존센터에 기탁하여 수탁번호 KCCM11587P를 부여받았다.
실시예 2: 슈도모나스 스투체리 CJ- MKB의 탈아민 반응성 확인
슈도모나스 스투체리 CJ-MKB의 5-아미노발레르산 및 6-아미노카프로산 탈아민화 반응성 평가를 수행하였다. 트랜스아미나제의 반응은 아민기와 케톤기의 치환 반응이므로, 반응 결과물은 박층 크로마토그래피 (TLC)를 이용한 물질 분리 후, 닌하이드린 (ninhydrin)의 아민기 발색 반응을 통해서 기질 및 생성물을 쉽게 확인할 수 있다. 슈도모나스 스투체리 CJ-MKB의 트랜스아미나제 활성 확인을 위해 전세포 반응을 진행하였다. 슈도모나스 스투체리 CJ-MKB를 배양하여 광학밀도가 0.7에 도달하였을 때, 새로운 M9 배지에 계대 배양하였으며, 6-아미노카프로산과 5-아미노발레르산을 질소원으로 고정시키고 배양을 진행하였다. 상기 배지에 필요한 알파-케토글루타레이트와 피리독살-포스페이트를 넣어주고, 5-아미노발레르산 및 6-아미노카프로산의 탈아민 정도 확인을 위해 TLC를 수행하였다. 반응 부피는 100㎕ 였으며, 5-아미노발레르산, 6-아미노카프로산, 알파-케토글루타레이트, 및 피리독살-포스페이트의 다양한 농도 및 각각의 기질 유무에 따른 글루타메이트 (glutamate) 의 생성 및 기질의 분해 정도를 TLC 상에서 비교하였다. TLC 전개가 끝나고, 3% 닌하이드린 용액으로 아민기가 존재하는 물질을 발색시켰다. TLC 결과를 통해서 5-아미노발레르산, 6-아미노카프로산이 소멸되고, 글루타메이트가 생성되는 것을 확인할 수 있었다 (도 2a내지 f 참조).
도 2f의 97h reaction, lane 4에서 나타난 바와 같이, 배지에 20 mM 6-아미노카프로산, 10 mM 알파-케토글루타레이트, 0.1 mM의 피리독살포스페이트를 첨가해준 균주가 97 시간 이전에 6-아미노카프로산을 모두 반응시키는 것을 확인할 수 있었다. 트랜스아미나제 반응이 충족되었을 때와 비교하면 반응 속도가 느리지만, 피리독살포스페이트가 없는 조건에서도 6-아미노카프로산이 감소하는 것이 TLC 상에서 확인되었다 (도 2f의 97 h reaction lane 4-1). 5-아미노발레르산 및 6-아미노카프로산이 동시에 존재하는 경우에는 6-아미노카프로산의 감소가 확인되지 않았다 (도 2f의 97 h reaction, lane 5, 및 5-1). 이를 통해 슈도모나스 스투체리 CJ-MKB를 최소배지 조건에서 배양할 때, 6-아미노카프로산과 5-아미노발레르산은 질소원으로 경쟁 반응하는 것으로 평가되었다.
이 실험 결과로부터 슈도모나스 스투체리 CJ-MKB가 6-아미노카프로산을 단일 질소원으로 사용할 수 있으며, 알파-케토글루타레이트 및 피리독살포스페이트 존재 하에서 5-아미노발레르산 및 6-아미노카프로산 탈아민화 반응을 가속화시키는 것을 확인할 수 있었다 (도 2a 내지 f). 한편 도 2d 및 도 2e의 24h reaction, lane5와 72h reaction, lane 4에서 적은 양의 글루타메이트가 확인되었지만, 지속적으로 축적되지는 않는 것을 나타났다. 이는 6-아미노카프로산의 반응과 더불어 글루타메이트가 생성되지만, 글루타메이트 대부분이 아민 공급원으로 사용되기 때문에 세포 내에서 축적되지 않고 빠르게 전환되는 것으로 평가된다.
실시예 3: 대장균 균주에서 본 발명의 트랜스아미나제 과발현 유도 및 반응성 평가
1) 대장균에서의 본 발명의 트랜스아미나제의 과발현 유도
실시예 1에서 수득한 슈도모나스 스투체리 CJ-MKB 균주의 탈아민 반응에 관여할 것으로 예상된 트랜스아미나제로 추정되는 효소의 활성을 확인하기 위해 하기의 실험을 진행하였다.
구체적으로, 슈도모나스 스투체리 CJ-MKB의 트랜스아미나제 유전자인 서열번호 6의 염기 서열(이하, "gabT"로 지칭함)을 PCR로 증폭시킨 후 대장균 과발현 벡터인 pETDuet1 벡터에 클로닝하였다. gabT를 pETDuet1 벡터에 클로닝하는 과정에서 DNA 서열 앞부분에 His-tag이 위치하도록 재조합하였다. 대장균 로제타 (E.coli Rosetta) 수용균주를 열 충격(heat shock) 방법으로 상기 클로닝된 벡터를 삽입하여 형질전환시켰다. 형질전환 균주를 3 mL의 LB 용액 배지에 50 mg/ml 농도의 앰피실린을 넣고 37 ℃에서 12시간 배양하였다. 다음으로 배양된 균주를 앰피실린을 포함한 50 mL LB에 넣어 37 ℃에서 배양하여 광학광도 (600 nm 파장)가 0.8이 되면, 0.2mM IPTG를 이용하여 발현유도시키고, 18 ℃에서 48시간 발현시켰다. 배양된 균주를 세척한 다음, 소니케이터를 이용하여 세포를 분쇄하였다. 분쇄 후 가용성 단백질로 과발현되는 것을 SDS-PAGE 젤 결과를 통해서 확인하였다 (도 3).
또한 상기 슈도모나스 스투체리 CJ-MKB의 트랜스아미나제로 형질전환된 대장균 로제타 균주를 '대장균 로제타 CC04-0058'로 명명하고, 이를 2014년 10월 22일자로 한국미생물보존센터에 기탁하여 수탁번호 KCCM11589P를 부여받았다.
2) 본 발명의 트랜스아미나제가 과발현된 대장균 분쇄액의 탈아민 반응성 1차 평가
상기 실시예 3-1)에서 본 발명의 트랜스아미나제의 과발현이 유도된 대장균의 분쇄액 (cell lysate) 50 ㎕, 10 mM의 기질 (4-아미노부티르산, 5-아미노발레르산, 또는 6-아미노카프로산), 10 mM의 알파-케토글루타레이트 0.1 mM 피리독살-포스페이트를 넣고, 50 mM HEPES 완충액 (pH 8.0)으로 채워 100 ㎕의 부피로 반응을 진행하였다. 37 ℃에서 30분 반응시킨 후, 본 발명의 트랜스아미나제에 의한 각 기질로부터 글루타메이트의 생성을 TLC를 통해 확인하였다 (도 4).
도 4에서 볼 수 있는 바와 같이, 본 발명의 트랜스아미나제 유전자 (lane 2, 4, 6, 8)를 과발현시킨 대장균 세포 파쇄액과 공벡터를 발현시킨 세포 파쇄액 (lane 1, 3, 5, 7)의 반응에 따라 생성되는 글루타메이트 스팟 (spot) 을 비교하였다. TLC 상으로는 정량 분석에 어려움이 있지만, 1~5 mM 농도의 글루타메이트는 대략적인 경향성을 파악할 수 있다. 결과적으로 4-아미노부티르산, 5-아미노발레르산, 6-아미노카프로산에 대해서 글루타메이트의 생성이 확인되었으며, 각각의 기질에 대한 탈아민 반응이 진행되었음을 확인할 수 있었다. 공벡터를 발현시킨 세포 파쇄액을 4-아미노부티르산과 반응시켰을 때에도 본 발명의 트랜스아미나제 과발현 세포 분쇄액과 비교하여 적지만 글루타메이트의 생성이 확인되었다 (도 4의 lane 1). 이것은 대장균 내에 자체적으로 존재하는 트랜스아미나제 반응의 결과물로 예측된다. 5-아미노발레르산 반응에서는 본 발명의 트랜스아미나제 발현 여부에 따라서 글루타메이트 생성 정도가 현저하게 차이나는 것을 육안으로 확인할 수 있었다 (도 4의 lane 3 및 4). 본 발명의 트랜스아미나제 과발현 세포 분쇄액과 6-아미노카프로산이 반응에서도 글루타메이트가 생성되는 것이 TLC 상에서 확인되었다 (도 4의 lane 6).
3) 본 발명의 트랜스아미나제가 과발현된 대장균 분쇄액의 탈아민 반응성 2차 평가
본 발명의 트랜스아미나제를 재발현시켜 6-아미노카프로산 및 5-아미노발레르산에 대한 반응성을 한번 더 평가하였다 (도 5). 반응 조건은 반응 시간을 30분에서 1.5 시간으로 3배 증가시킨 점에서만 차이가 있고, 그 밖의 다른 조건은 상기 실시예 3-2)와 동일하다.
5-아미노발레르산과 6-아미노카프로산을 각각 기질로 하여 본 발명의 트랜스아미나제와의 반응을 TLC를 통해 확인한 결과, 5-아미노발레르산의 경우 상대적으로 높은 기질 감소와 글루타메이트의 생성을 확인할 수 있었다. 또한 6-아미노카프로산의 경우 공벡터 (pET-Duet1)만 발현시킨 세포 분쇄액 반응 (도 5의 lane 3)과 피리독살포스페이트(Pyridoxal phosphate, PLP)와 알파-케토글루타레이트가 결여된 반응(도 5의 lane 4)에서는 글루타메이트의 생성이 확인되지 않았다. 반면 정상적인 본 발명의 트랜스아미나제의 반응에서는 글루타메이트의 생성이 확인되었다 (도 5의 lane 5).
4) 본 발명의 트랜스아미나제와 6- 아미노카프로산의 반응물에 대한 LC-MASS 분석
도 5의 6-아미노카프로산에 대해 반응한 샘플들에 대하여 LC-MASS 분석을 진행하였다. 실시예 3-3)과 동일한 조건으로 재현실험을 진행하였다. 6-아미노카프로산의 경우 공벡터 (pET-Duet1)만 발현시킨 세포 분쇄액 반응 (도 5의 lane 3), 피리독살포스페이트(Pyridoxal phosphate, PLP)와 알파-케토글루타레이트가 결여된 반응(도 5의 lane 4), 본 발명의 트랜스아미나제의 반응 (도 5의 lane 5), 그리고 10 mM의 6-아미노카프로산 (도 5의 lane 6)을 TLC로 확인하였다. 반응 분석 결과는 아래 표 2와 같다(도 6 참조).
시료 6- ACA ( % )
Lane6 100.0
Lane3 99.5
Lane4 99.1
Lane5 90.6
LC-MASS 분석 결과, 37℃, 1.5시간 반응 조건에서 10mM의 6-아미노카프로산이 본 발명의 트랜스아미나제 반응에 의해 9.4% (0.94mM)가 탈아민 되는 것을 확인하였다.
이러한 실험 결과로부터 슈도모나스 스투체리 CJ-MKB 유래의 본 발명의 신규 트랜스아미나제는 본래 기질로 알려진 감마아미노부티르산 이외에 5-아미노발레르산, 6-아미노카프로산을 기질로 사용하여 이들의 탈아민화 반응을 보이는 것을 확인할 수 있었다.
기탁기관명 : 한국미생물보존센터(국외)
수탁번호 : KCCM11587P
수탁일자 : 20141022
Figure PCTKR2016005871-appb-I000001
기탁기관명 : 한국미생물보존센터(국외)
수탁번호 : KCCM11589P
수탁일자 : 20141022
Figure PCTKR2016005871-appb-I000002

Claims (10)

  1. 서열번호 7의 아미노산 서열을 포함하며 아미노 화합물에 대한 트랜스아미나제 활성을 가지는 분리된 폴리펩티드.
  2. 제1항에 있어서, 상기 아미노 화합물은 5-아미노발레르산 또는 6-아미노카프로산인 폴리펩티드.
  3. 제1항의 트랜스아미나제 활성을 가지는 폴리펩티드를 코딩하는 폴리뉴클레오티드.
  4. 제3항에 있어서, 상기 폴리뉴클레오티드는 서열번호 6의 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드.
  5. 제1항의 폴리펩티드를 발현하도록 형질전환된 미생물.
  6. 제5항에 있어서, 상기 미생물은 에스케리키아 속(genus Escherichia)인 미생물.
  7. 제6항에 있어서, 상기 미생물은 대장균(Escherichia coli)인 미생물.
  8. 제1항의 폴리펩티드, 또는 제5항의 미생물을 아미노 화합물이 함유된 용액에 가하는 단계를 포함하는 아미노 화합물을 탈아민화시키는 방법.
  9. 제8항에 있어서, 상기 아미노 화합물은 N-아세틸 오르니틴, 감마아미노부티르산, 5-아미노발레르산 및 6-아미노카프로산으로 이루어진 군으로부터 선택되는 하나 이상인 아미노 화합물을 탈아민화시키는 방법.
  10. 제8항에 있어서, 상기 용액은 파이루베이트, 옥살로아세테이트 및 α-케토글루타레이트로 이루어진 군으로부터 선택되는 하나 이상, 및 피리독살포스페이트를 추가로 포함하는 아미노 화합물을 탈아민화시키는 방법.
PCT/KR2016/005871 2015-07-02 2016-06-03 신규 트랜스아미나제 및 이를 이용한 아미노 화합물의 탈아민 방법 Ceased WO2017003105A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2015-0094942 2015-07-02
KR1020150094942A KR101716188B1 (ko) 2015-07-02 2015-07-02 신규 트랜스아미나제 및 이를 이용한 아미노 화합물의 탈아민 방법

Publications (1)

Publication Number Publication Date
WO2017003105A1 true WO2017003105A1 (ko) 2017-01-05

Family

ID=57608545

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/005871 Ceased WO2017003105A1 (ko) 2015-07-02 2016-06-03 신규 트랜스아미나제 및 이를 이용한 아미노 화합물의 탈아민 방법

Country Status (2)

Country Link
KR (1) KR101716188B1 (ko)
WO (1) WO2017003105A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2003000289A (ja) * 1996-02-09 2003-01-07 Diversa Corp トランスアミナーゼ及びアミノトランスフェラーゼ
JP2012519004A (ja) * 2009-02-26 2012-08-23 コデクシス， インコーポレイテッド トランスアミナーゼ生体触媒
WO2014197941A1 (en) * 2013-06-12 2014-12-18 Commonwealth Scientific And Industrial Research Organisation Transaminase biocatalysts

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2003000289A (ja) * 1996-02-09 2003-01-07 Diversa Corp トランスアミナーゼ及びアミノトランスフェラーゼ
JP2012519004A (ja) * 2009-02-26 2012-08-23 コデクシス， インコーポレイテッド トランスアミナーゼ生体触媒
WO2014197941A1 (en) * 2013-06-12 2014-12-18 Commonwealth Scientific And Industrial Research Organisation Transaminase biocatalysts

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GenBank 3 July 2013 (2013-07-03), Database accession no. WP_020307792.1 *
DATABASE GenBank 31 January 2014 (2014-01-31), Database accession no. CP000304.1 *

Also Published As

Publication number Publication date
KR20170004509A (ko) 2017-01-11
KR101716188B1 (ko) 2017-03-27

Similar Documents

Publication Publication Date Title
WO2019027267A2 (ko) Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
Prell et al. Adaptive laboratory evolution accelerated glutarate production by Corynebacterium glutamicum
US10865404B1 (en) Aspartase mutant, recombinant expression vector and recombinant bacterium containing aspartase mutant, and use thereof
WO2014175663A1 (ko) L-아르기닌 생산능이 향상된 코리네박테리움속 미생물 및 이를 이용한 l-아르기닌의 생산 방법
US20260002182A1 (en) Engineering bacteria expressing aspartate dehydrogenase and method for producing vitamin b5 by fermentation
EP3498854B1 (en) Method for the fermentative production of l-lysine
WO2016171392A1 (ko) 글루코네이트 리프레서 변이체, 이를 포함하는 l-라이신을 생산하는 미생물 및 이를 이용한 ｌ－라이신 생산방법
WO2017022944A1 (ko) 라이신 디카르복실라아제의 변이주 개발 방법 및 그의 응용
WO2015199406A1 (ko) L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법
US11932896B2 (en) Host cells and methods for producing hydroxytyrosol
CN111471631A (zh) 发酵产生l-赖氨酸的方法
CN111334534A (zh) 使用具有突变的Kup转运蛋白的谷氨酸棒杆菌菌株发酵生产L-赖氨酸的方法
WO2022139523A1 (ko) L-히스티딘 배출 단백질 및 이를 이용한 l-히스티딘 생산 방법
WO2017003104A1 (ko) 신규 트랜스아미나제 및 이를 이용한 아미노 화합물의 탈아민 방법
WO2017003105A1 (ko) 신규 트랜스아미나제 및 이를 이용한 아미노 화합물의 탈아민 방법
EP3599282B1 (en) Method for the fermentative production of l-lysine
KR101898171B1 (ko) 신규 트랜스아미나제 및 이를 이용한 아미노 화합물의 탈아민 방법
US20250043254A1 (en) Particularly suitable 3-desoxyarabinoheptulosanate-7-phosphate synthase for the fermentative preparation of ortho-aminobenzoic acid
WO2020138543A1 (ko) 오르니틴 탈탄산 효소의 변이주 및 그의 응용
WO2016032158A1 (ko) L-라이신 생산능을 갖는 코리네박테리움 미생물 및 이를 이용한 l-라이신 생산 방법
KR101722984B1 (ko) 바륨-알지네이트 담체를 이용한 라이신 디카르복실라아제 과발현 재조합 대장균의 고정화를 통한 고농도 카다베린 생산방법
KR100190501B1 (ko) D-아미노산 아미노트랜스퍼라아제 활성을 갖는 고온성 균주 바실러스 스티아로더모필러스 kl-01
WO2017003103A1 (ko) 신규 슈도모나스 종 균주 및 이를 이용한 6-아미노카프로산의 탈아민 방법
WO2017159976A1 (ko) 퓨트레신을 생산하는 미생물 및 이를 이용한 퓨트레신 생산 방법
WO2024144001A1 (ko) 신규한 폴리뉴클레오티드 및 이를 이용한 l-알라닌 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16818138

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 12.04.2018)

122 Ep: pct application non-entry in european phase

Ref document number: 16818138

Country of ref document: EP

Kind code of ref document: A1