WO2017003103A1 - 신규 슈도모나스 종 균주 및 이를 이용한 6-아미노카프로산의 탈아민 방법 - Google Patents
신규 슈도모나스 종 균주 및 이를 이용한 6-아미노카프로산의 탈아민 방법 Download PDFInfo
- Publication number
- WO2017003103A1 WO2017003103A1 PCT/KR2016/005869 KR2016005869W WO2017003103A1 WO 2017003103 A1 WO2017003103 A1 WO 2017003103A1 KR 2016005869 W KR2016005869 W KR 2016005869W WO 2017003103 A1 WO2017003103 A1 WO 2017003103A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- acid
- pseudomonas
- aminocaproic acid
- amino compound
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P1/00—Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes
- C12P1/04—Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes by using bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/38—Pseudomonas
Definitions
- the present invention relates to a novel Pseudomonas stutzeri capable of deaminating an amino compound and a method for deaminating the amino compound using the same.
- Adipic acid is a dicarboxylic acid compound having a molecular formula of (CH 2 ) 4 (COOH) 2 .
- Adipic acid is widely used as a raw material for nylon support materials, plastic plasticizers, dyes, pharmaceuticals, etc., and is particularly important as an intermediate product for the production of polyamides such as nylon 6,6, and has a high commercial value.
- Adipic acid is produced by a chemical process that starts with petroleum compounds as a raw material and goes through a two-step process. Specifically, cyclic compounds such as phenol, cyclohexane, cyclohexene, and benzene, which are starting materials, are converted to ketone-alcohol oil (KA oil), which is called cyclohexanone or cyclohexanol, and then nitric acid. Adipic acid is produced through the oxidation process using. This chemical process has high efficiency and economy, but has the problem of using benzene as a raw material and generating a large amount of nitrogen oxide as a by-product.
- KA oil ketone-alcohol oil
- the present inventors completed the present invention by separating new microorganisms having deamine activity while studying a method of deamine of 6-aminocaproic acid.
- One object of the present invention is to provide a novel microorganism which deamines an amino compound.
- Another object of the present invention is to provide a deamine method of an amino compound using the microorganism.
- amino compound refers to an organic compound having an amino group (-NH 2 ), specifically, a compound in which hydrogen of a hydrocarbon is substituted with an amino group, also referred to as a primary amine.
- the amino compound may be, for example, one or more selected from the group consisting of N-acetyl ornithine, gammaaminobutyric acid, 5-amino valeric acid, and 6-aminocaproic acid, but is not limited thereto.
- the amino compound may be 5-amino valeric acid or 6-aminocaproic acid.
- reaction means leaving an amino group from a compound having an amino group.
- Pseudomonas Pseudomonas stutzeri are Gram-positive, rod-shaped, single polar flagellated soil bacteria.
- the Pseudomonas stuchery strain is an amino compound, in particular 6-amino. It is not known to have the property of deaminating caproic acid, but we have newly isolated and identified a Pseudomonas stuccory strain capable of deamination of an amino compound including 6-aminocaproic acid.
- Pseudomonas stuchery KCCM11587P strain of the present invention can use an amino compound as a nitrogen source.
- Pseudomonas stucheri CJ-MKB (KCCM11587P) according to the present invention was immobilized in cells using an amine group of 6-aminocaproic acid as a single nitrogen source.
- 6-aminocaproic acid has one amine group, which requires a deamination process to use it as a nitrogen source.
- Pseudomonas stucheri strain of the present invention can deamine the amino compound, thereby producing a compound from which the amino group has been removed.
- the ability to deaminize the amino compound of the Pseudomonas stuchery strain may be due to the transaminase possessed by the microorganism.
- Deamination enzymes present in nature are largely divided into ammonia lyase enzyme family (EC 4.3 .-.-) and transaminase enzyme family (EC 2.6 .-.-).
- ammonia lyase the substrate containing the amine group has an electron withdrawing group, but in the case of 6-aminocaproic acid, it has no functional group around the amine group. Therefore, the ammonia lyase reaction is considered difficult.
- Pseudomonas stucheri KCCM11587P of the present invention can deaminize 5-amino valeric acid or 6-aminocaproic acid, etc., which do not have an electron-bearing functional group around the amine group by the transaminase of the strain.
- the amino group-removed compound may be, for example, one or more selected from the group consisting of N-acetylglutamate5-semialdehyde, succinate semialdehyde, glutarate semialdehyde, and adipate semialdehyde, but is not limited thereto. .
- the compound from which the amino group has been removed may be glutarate semialdehyde or adipate semialdehyde.
- Pseudomonas stuchery KCCM11587P strain of the present invention may have a sequence of 16s rRNA of SEQ ID NO: 1.
- the Pseudomonas stuchery strain may specifically have a characteristic of forming a bio film and resistance to ampicillin in addition to the characteristics of the sequence of 16s rRNA of SEQ ID NO: 1.
- the Pseudomonas stuchery specifically contains an N-acetylornithine transaminase gene comprising a nucleotide sequence of SEQ ID NO: 4 and / or a 4-aminobutyrate aminotransferase gene comprising a nucleotide sequence of SEQ ID NO: 6 Can be.
- 4-aminobutyrate transaminase refers to the reaction of '4-aminobutanoate + 2-oxoglutarate ⁇ succinate semialdehyde + L-glutamate'. It means an enzyme which catalyzes and is also named “4-aminobutyrate aminotransferase” or "GABA transaminase.”
- N-acetylornithine aminotransferase means' N 2 -acetyl-L-ornithine + 2 oxoglutarate ⁇ N-acetyl-L-glutamate 5- It refers to an enzyme that catalyzes the reaction of semialdehyde + L-glutamate, also called acetylornithine amino transferase.
- Pseudomonas stuchery KCCM11587P was found to have the ability to deaminize 5-aminovaleric acid and 6-aminocaproic acid, respectively (see FIGS. 2A-F).
- the Pseudomonas stuchery KCCM11587P was confirmed to be a novel microorganism having the ability to deamine the amino compound, unlike conventionally known strains (see FIG. 3).
- Another aspect of the present invention provides a method for deamination of an amino compound comprising culturing the Pseudomonas stucheri strain in a medium containing the amino compound.
- the Pseudomonas stuchery strain is as described above.
- the culture can be made according to the appropriate medium and culture conditions known in the art. Those skilled in the art can also easily adjust the medium and culture conditions.
- the medium may be a liquid medium, but is not limited thereto.
- the culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or combination culture thereof.
- the medium must meet the requirements of the particular strain in an appropriate manner and can be appropriately modified by those skilled in the art.
- the medium may include various nitrogen sources, carbon sources, and trace element components.
- the nitrogen source included in the medium may include an amino compound that is subject to deamination.
- the nitrogen source may be at least one amino compound specifically selected from the group consisting of N-acetyl ornithine, gammaaminobutyric acid, 5-aminovaleric acid and 6-aminocaproic acid.
- the present invention is not limited thereto, but peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and nitric acid other than the above amino compounds
- a nitrogen source consisting of ammonium or the like may be further included.
- Carbon sources that may be used include, but are not limited to, sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, Fatty acids such as linoleic acid, alcohols such as glycerol, ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto.
- sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, Fatty acids such as linoleic acid, alcohols such as glycerol, ethanol, and organic acids such as acetic acid.
- sugars and carbohydrates such as glucose, sucrose, lactose, fructose,
- Sources of phosphorus may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts.
- the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate required for growth, but is not limited thereto.
- essential growth substances such as amino acids and vitamins may be included.
- the medium may further include, but is not limited to, one or more and / or pyridoxalphosphate selected from the group consisting of pyruvate, oxaloacetate, and ⁇ -ketoglutarate.
- the medium or individual components may be added batchwise or continuously in a suitable manner to the culture medium during the culturing process, but is not limited thereto.
- compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the microbial culture in a suitable manner to adjust the pH of the culture.
- anti-foaming agents such as fatty acid polyglycol esters can be used during the culture to suppress bubble generation.
- oxygen or an oxygen-containing gas eg, air
- the temperature of the culture may be usually 20 °C to 45 °C, for example 25 °C to 40 °C. The incubation period can last until the amount of the compound having the desired amino group removed is obtained, for example 10 to 160 hours.
- the method for deaminoating the amino compound may further comprise the step of recovering the compound from which the amino group has been removed from the medium.
- the compound from which the amino group has been removed may be at least one selected from the group consisting of N-acetylglutamate5-semialdehyde, succinate semialdehyde, glutarate semialdehyde, and adipate semialdehyde, but is not limited thereto.
- the method for recovering the compound from which the amino group has been removed from the cell or the culture may collect or recover the compound from which the amino group has been removed from the culture using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, anion exchange chromatography, crystallization and HPLC can be used, but are not limited to these examples.
- Another aspect of the invention provides a method of deamination of an amino compound comprising the step of reacting the cell lysate of the Pseudomonas stucheri cells with the amino compound.
- the Pseudomonas stuccoli strain and the reactive amino compound are as described above.
- cell lysate refers to the cell fragments and cell contents of Pseudomonas stuccory KCCM11587P resulting from the loss or destruction of the membrane of Pseudomonas stucherry KCCM11587P cells, resulting in protein fragmentation Or a liquid phase containing a nucleic acid or the like.
- the solution for reacting the amino compound with the pulverized product of Pseudomonas stuccory cells may include one or more pyribate phosphate selected from the group consisting of pyruvate, oxaloacetate, and ⁇ -ketoglutarate. .
- pyribate phosphate selected from the group consisting of pyruvate, oxaloacetate, and ⁇ -ketoglutarate.
- glutamate As a result of adding a cell crush of Pseudomonas stucheri CJ-MKB to a solution containing 6-amino valeric acid or 6-aminocaproic acid, alpha-keto glutarate and pyridoxalphosphate, glutamate It could be confirmed that it is generated.
- the temperature of the reaction may be 25 °C to 35 °C, specifically 25 °C to 30 °C.
- the reaction time may be 0.5 to 6 hours, 1 to 5 hours, 2 to 4.5 hours or
- the method for deamination of the amino compound can be used for the production of adipic acid.
- 6-Aminocaproic acid as an amino compound in the production of adipic acid can be converted into adipate semialdehyde by adding a nitrogen source to the culture medium of Pseudomonas stuccoli strain of the present invention or by reacting with a cell crush of Pseudomonas stuccoli strain.
- Adipic acid can then be synthesized from the converted adipate semialdehydes using methods known to those skilled in the art. Synthesis of adipic acid from the adipate semialdehyde may be specifically by an aldehyde dehydrogenase reaction.
- novel isolated Pseudomonas stucheri strain KCCM11587P of the present invention can be used to easily deamine the amino compound, and together with this, the amino group-free compound can be industrially produced. Furthermore, the novel Pseudomonas stucheri strain of the present invention can be utilized in a process for producing adipic acid by deamination of 6-aminocaproic acid.
- FIG. 1 is a photograph showing that a strain selected using a minimal medium using 6-aminocaproic acid as a nitrogen source forms a biofilm. Specifically, after culturing a single colony, the result obtained by centrifugation and the resultant were separated into a biofilm and a strain using distilled water.
- Figures 2a to f compare on the TLC the production of glutamate and the degree of degradation of the substrate with and without varying concentrations of 5-aminovaleric acid, 6-aminocaproic acid, alpha-ketoglutaric acid, pyridoxal phosphate and the presence of each substrate One result is shown.
- Figure 3 shows the result of the deamine reaction by the reaction of the cell crushing of various microorganisms and 5-amino valeric acid and 6-aminocaproic acid, respectively, on TLC. Specifically, the reaction was performed by adding 10 mM 5-amino valeric acid or 6-aminocaproic acid, 10 mM alpha-keto glutarate, and 0.1 mM pyridoxalphosphate to each cell pulverized product.
- a new strain Pseudomonas stutzeri CJ-MKB was selected that was able to fix the nitrogen source with 6-aminocaproic acid (6-ACA) and deamination of 6-aminocaproic acid through subculture.
- a minimal medium in which microorganisms can be cultured was prepared as shown in Table 1 below, and 6-aminocaproic acid was used as a nitrogen source for strain culture.
- CJ-MKB strains cultured in the medium were plated on M9 agar plates to secure colonies.
- the resulting colonies had a similar form and were resistant to ampicillin at a concentration of 25 mg / ml. And it was confirmed that a light biofilm (biofilm) is formed around the colony.
- Two colonies were selected and rearranged in M9 liquid medium, and genomic DNA was extracted using a commercially available genomic DNA prep kit. The sequence of 16S ribosomal RNA (16S rRNA) was analyzed for identification of the obtained genome.
- Microorganisms are known to form exopolysaccharides to form bio-flim, and Pseudomonas spp.
- Microorganisms are known to beta-lactam family of antibiotics such as penicillin. Has resistance. Considering the sequence information of the 16S rRNA of the CJ-MKB strain and resistance to the biofilm and ampicillin shown during the cultivation, it was expected that the selected strain was Pseudomonas strain microorganism.
- Nucleic acid sequences identified with homology were 714 short sequences, and thus could not accurately classify the dependencies of microorganisms. Additional protein nucleic acid sequences were analyzed to confirm dependence. When the microorganism uses 6-ACA as the nitrogen source, it is expected that N-acetylornithine transaminase or 4-aminobutyrate transaminase is specific among the transaminases expected to be involved in its enzymatic conversion reaction. The base sequence of the enzyme was confirmed.
- argD_F2 (5 'primer: ATTTAAGGATCCGTCCGCCCCGCACACCCCGG; SEQ ID NO: 11) for the comparative analysis of the nucleotide sequence of Pseudomonas stucheri A1501 and the N-acetylornithine transaminase present in the genome of selected strain CJ-MKB. And nucleic acid sequences were analyzed by PCR using argD_R2 (3 ′ primer: ATTTAAGAGCTCTCAGGCCTGGGTCAGCGTC; SEQ ID NO: 12).
- Pseudomonas stucheri A1501 and N-acetylornithine transaminase of the novel microorganism had the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4, respectively.
- gabT_F (5 'primer: ATTTAACATATGCAACGCCGTGTCGCCGCCGTTCC; SEQ ID NO: 13) and gabT_R (3' primer: ATTTAAGAATTCTCAGGTCTCTCTCCTCCTCTCTCCTCCTCCTCTCTCTCCTCCTCCTCTCTCCTCCTCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT
- nucleic acid sequence of Pseudomonas stucheri A1501 and selected strains was analyzed, and it was confirmed that 21 nucleic acids among 1,257 nucleic acid sequences were different (nucleic acid homology: 98.3294%).
- the selected strain Pseudomonas stutzeri CJ-MKB (Pseudomonas stutzeri CJ-MKB) has the highest homology with Pseudomonas stucheri A1501 among the known microbial genome sequences, it was confirmed that the new strain.
- the Pseudomonas stucheri CJ-MKB strain thus selected was deposited with the Korea Microorganism Conservation Center on October 22, 2014 and received accession number KCCM11587P.
- 6-aminocaproic acid was not observed when 5-amino valeric acid and 6-aminocaproic acid were present at the same time (97 h reaction, lane 5, and 5-1 in FIG. 2F). It was evaluated that 6-aminocaproic acid and 5-aminovaleric acid compete with the nitrogen source when Pseudomonas stucheri CJ-MKB is cultured at the minimum medium condition.
- Pseudomonas stucheri CJ-MKB can use 6-aminocaproic acid as a single nitrogen source, 5-amino valeric acid and 6-aminocaproic acid deamination in the presence of alpha-ketoglutarate and pyridoxalphosphate It can be confirmed that the acceleration (Fig. 2a to f). On the other hand, a small amount of glutamate was confirmed in the 24h reaction, lane 5 and 72h reaction, lane 4 of Fig. 2d and 2e, but did not accumulate continuously. It is believed that with the reaction of 6-aminocaproic acid, glutamate is produced, but since most of the glutamate is used as an amine source, it is rapidly converted without accumulating in cells.
- the concentration of the cell disruption solution was increased to deamination reaction using 5-aminovalate and 6-aminocaproic acid as amine substrates, respectively.
- 10 mM 5-amino valeric acid, 6-aminocaproic acid, 10 mM alpha-keto glutarate, and 0.1 mM pyridoxalphosphate were added to Pseudomonas stucheri CJ-MKB cell pulverization and subjected to reaction for 4 hours at 28 ° C. 3).
- Clostridium aminovalericum, Pseudomonas fluorescens, and Pseudomonas mendocina were cultured, respectively, and 5-amino valeric acid and the cell disruption of each microorganism. Reaction results for 6-aminocaproic acid were compared via TLC. As shown in lanes 5 and 9 of Figure 3, the production of glutamate in the Pseudomonas stucheri CJ-MKB cell pulverization was confirmed. On the other hand, the production of glutamate was not confirmed in other strains.
- the novel strain Pseudomonas stucheri CJ-MKB was confirmed to have the ability to deamine the amino compound.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
본 발명은 아미노 화합물을 탈아민화시킬 수 있는 신규 분리한 슈도모나스 스투체리(Pseudomonas stutzeri) 및 이를 이용한 아미노 화합물을 탈아민화시키는 방법에 관한 것이다.
Description
본 발명은 아미노 화합물을 탈아민화시킬 수 있는 신규 슈도모나스 스투체리(Pseudomonas
stutzeri) 및 이를 이용하여 아미노 화합물을 탈아민화시키는 방법에 관한 것이다.
아디프산(adipic acid)은 (CH2)4(COOH)2의 분자식을 갖는 디카르복실산(dicarboxylic acid) 화합물이다. 아디프산은 나일론 수지원료, 플라스틱 가소제, 염료, 의약품 등의 원료로서 널리 사용되고 있으며, 특히 나일론 6,6과 같은 폴리아미드의 제조에 중요한 중간 생성물로서, 상업적 가치가 매우 높다.
아디프산은 주로 석유화합물을 원료물질로 시작하여, 두 단계의 공정을 거치는 화학적 방법에 의해 생산된다. 구체적으로 시작물질인 페놀, 싸이클로헥산, 싸이클로헥센, 벤젠 등의 고리형 화합물을 싸이클로헥사논 또는 싸이클로헥사놀로 명명되는 케톤-알콜 오일 (ketone-alcohol oil, KA oil)로 전환시킨 다음, 이 후 질산을 이용한 산화공정을 통해 아디프산을 생산한다. 이 화학적 공정은 고효율성 및 경제성을 지녔으나, 벤젠을 원료로 사용하고 막대한 양의 질소 산화물을 부산물로 발생시키는 문제점이 있다. 이러한 문제점과 더불어 최근 강화되는 환경규제로 인해 아디프산의 생산에 있어서 친환경적 공정의 필요성이 대두되었고, 이에 따라 아디프산을 미생물을 통해 생산하려는 노력이 시작되고 있다. 그러나 아디프산 생산의 중간체로 사용될 수 있는 6-아미노카프로산의 정확한 생합성 또는 생분해 경로는 아직까지 알려져 있지 않다. 6-아미노카프로산의 6-아민 그룹을 제거하고 케톤기가 도입되면 아디페이트 세미알데하이드(adipate semialdehyde)가 되며, 알데하이드 디하이드로게나제 (aldehyde dehydrogenase)의 반응을 통해 아디프산을 합성할 수 있을 것으로 예상된다 (Guerrillot L. et al., Eur J Biochem., 1977, 81(1):185-92; Vandecasteele, J.P. et al., Methods Enzymol., 1982, 89: 484-490). 같은 수의 탄소로 이루어진 6-아미노카프로산으로부터 아디프산으로의 효소 전환 반응은 상업적 가치뿐만 아니라 신규 기술로서 가능성이 높게 평가되나, 실제 반응에 관여할 수 있는 효소 또는 미생물 역시 공지되지 않았다.
이에, 본 발명자들은 6-아미노카프로산을 탈아민하는 방법을 연구하던 중 탈아민 활성을 가지는 신규 미생물을 분리함으로써 본 발명을 완성하였다.
본 발명의 일 목적은 아미노 화합물을 탈아민화시키는 신규 미생물을 제공하는 것이다.
본 발명의 다른 목적은 상기 미생물을 이용하여 아미노 화합물의 탈아민 방법을 제공하는 것이다.
본 발명의 일 양태에서, 아미노 화합물을 탈아민화시키는 신규 분리된 슈도모나스 스투체리(Pseudomonas stutzeri) KCCM11587P 균주를 제공한다.
본 발명에서 사용된 용어 "아미노 화합물 (amino compound)"은 아미노기(-NH2)가 있는 유기 화합물을 의미하는 것으로, 구체적으로는 탄화수소의 수소가 아미노기로 치환된 화합물로서, 1차 아민이라고도 한다. 상기 아미노 화합물은, 예를 들면, N-아세틸 오르니틴, 감마아미노부티르산, 5-아미노발레르산 및 6-아미노카프로산으로 이루어진 군으로부터 선택되는 하나 이상일 수 있으나, 이에 제한되는 것은 아니다. 구체적으로 상기 아미노 화합물은 5-아미노발레르산, 또는 6-아미노카프로산일 수 있다.
본 발명에서 사용된 용어 "탈아민화 (deamination)"는 아미노기를 갖는 화합물로부터 아미노기를 이탈시키는 것을 의미한다.
본 발명에서 사용된 용어 "슈도모나스 스투체리 (Pseudomonas
stutzeri)"는 그람-양성(Gram-positive)이고 간균(rod-shaped)이며, 단일극성 편모를 갖는(single polar flagellated) 토양성 박테리아다. 지금까지 슈도모나스 스투체리 균주가 아미노 화합물, 특히 6-아미노카프로산을 탈아민화시키는 특성을 갖는다는 것은 알려지지 않았다. 그러나 본 발명자들에 의해 6-아미노카프로산을 포함하는 아미노 화합물을 탈아민화시킬 수 있는 슈도모나스 스투체리 균주가 새롭게 분리되고 동정되었다.
본 발명의 슈도모나스 스투체리 KCCM11587P 균주는 아미노 화합물을 질소원으로 사용할 수 있다. 일 구체예에서 본 발명에 따른 슈도모나스 스투체리 CJ-MKB(KCCM11587P)가 단일 질소원인 6-아미노카프로산의 아민 그룹을 이용하여 세포 내에서 고정화시키는 것을 확인하였다. 6-아미노카프로산의 경우 하나의 아민 그룹을 가지고 있으며, 이를 질소원으로 사용하기 위해서는 탈아민화 과정이 필요하다.
본 발명의 슈도모나스 스투체리 균주는 아미노 화합물을 탈아민화시킬 수 있으며, 이에 따라 아미노기가 제거된 화합물을 생산할 수 있다.
상기 슈도모나스 스투체리 균주의 아미노 화합물을 탈아민화시키는 능력은 미생물이 가지고 있는 트랜스아미나제(transaminase)에 의한 것일 수 있다. 자연계 상에 존재하는 탈아민화 반응 효소는 크게 암모니아 리아제(ammonia lyase) 효소 계열 (EC 4.3.-.-) 및 트랜스아미나제(transaminase) 효소 계열 (EC 2.6.-.-) 로 나누어진다. 암모니아 리아제의 경우 아민 그룹을 포함하는 기질이 전자를 보유할 수 있는 전자 끄는 기(electron withdrawing group)를 가지고 있으나, 6-아미노카프로산의 경우 아민 그룹 주변에 전자를 보유할 수 있는 작용기를 가지고 있지 않아 암모니아 리아제 반응은 어려울 것으로 판단된다. 반면 트랜스아미나제의 경우 공동 기질 (co-substrate)에 전자 보유 작용기를 이용한 반응이 가능하기 때문에 6-아미노카프로산의 탈아민화 반응을 일으킬 수 있다. 따라서 본 발명의 슈도모나스 스투체리 KCCM11587P는 균주의 트랜스아미나제에 의해 아민 그룹 주변에 전자 보유 작용기를 보유하지 않은 5-아미노발레르산 또는 6-아미노카프로산 등을 탈아민화시킬 수 있다.
상기 아미노기가 제거된 화합물은 예를 들면 N-아세틸글루타메이트5-세미알데하이드, 숙시네이트 세미알데하이드, 글루타레이트 세미알데하이드 및 아디페이트 세미알데하이드로 이루어진 군으로부터 선택되는 하나 이상일 수 있으나, 이에 제한되는 것은 아니다. 구체적으로 상기 아미노기가 제거된 화합물은 글루타레이트 세미알데하이드 또는 아디페이트 세미알데하이드일 수 있다.
본 발명의 슈도모나스 스투체리 KCCM11587P 균주는 서열번호 1의 16s rRNA의 서열을 가지는 것일 수 있다. 또한 상기 슈도모나스 스투체리 균주는 구체적으로 상기 서열번호 1의 16s rRNA의 서열의 특징 이외에 추가적으로 앰피실린에 대한 저항성 및/또는 바이오 필름을 형성하는 특성을 갖는 것일 수 있다.
또한 상기 슈도모나스 스투체리는 구체적으로 서열번호 4의 염기서열을 포함하는 N-아세틸오르니틴 트랜스아미나제 유전자 및/또는 서열번호 6의 염기서열을 포함하는 4-아미노부티레이트 아미노트랜스퍼라제 유전자를 함유하는 것일 수 있다.
본 발명에서 사용된 용어, "4-아미노부티레이트 트랜스아미나제(4-aminobutyrate transaminase)"는 '4-아미노부타노에이트 + 2-옥소글루타레이트 ↔ 숙시네이트 세미알데히드 + L-글루타메이트'의 반응을 촉매하는 효소를 의미는 것으로, '4-아미노부티레이트 아미노트랜스퍼라제' 또는 'GABA 트랜스아미나제'라고도 명명된다.
본 발명에서 사용된 용어, "N-아세틸오르니틴 트랜스아미나제 (N-acetylornithine aminotransferase)"는 'N2-아세틸-L-오르니틴 + 2옥소글루타레이트 ↔ N-아세틸-L-글루타메이트 5-세미알데히드 + L-글루타메이트'의 반응을 촉매하는 효소를 의미는 것으로, '아세틸오르니틴 아미노 트랜스퍼라아제'라고도 명명된다.
일 실시예에서 새롭게 분리 및 동정된 슈도모나스 스투체리 KCCM11587P가 5-아미노발레르산 및 6-아미노카프로산을 각각 탈아민화시키는 능력이 있음을 확인하였다 (도 2a 내지 f 참조). 또한 일 실시예에서 상기 슈도모나스 스투체리 KCCM11587P가 종래 공지된 균주들과 달리 아미노 화합물을 탈아민화시키는 능력을 가진 신규 미생물임을 확인하였다 (도 3 참조).
본 발명의 다른 양태는 상기 슈도모나스 스투체리 균주를 아미노 화합물을 포함한 배지에서 배양하는 단계를 포함하는 아미노 화합물을 탈아민화시키는 방법을 제공한다.
상기 슈도모나스 스투체리 균주에 대해서는 상기한 바와 같다.
상기 배양은 당업계에 알려진 적절한 배지와 배양조건에 따라 이루어질 수 있다. 또한 통상의 기술자라면 배지 및 배양 조건을 용이하게 조정하여 사용할 수 있다. 구체적으로, 상기 배지는 액체 배지일 수 있으나 이에 한정되는 것은 아니다. 배양 방법은 예를 들면, 회분식 배양 (batch culture), 연속식 배양 (continuous culture), 유가식 배양 (fed-batch culture) 또는 이들의 조합 배양을 포함할 수 있으나, 이에 한정되지 않는다.
상기 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 하며, 통상의 기술자에 의해 적절하게 변형될 수 있다. 또한 배지에 다양한 질소원, 탄소원 및 미량원소 성분 등을 포함할 수 있다.
상기 배지에 포함되는 질소원은 탈아민화의 대상이 되는 아미노 화합물을 포함할 수 있다. 상기 질소원은 구체적으로 N-아세틸 오르니틴, 감마아미노부티르산, 5-아미노발레르산 및 6-아미노카프로산으로 이루어진 군으로부터 선택되는 하나 이상의 아미노 화합물일 수 있다. 다만 이에 한정되는 것은 아니며, 상기 아미노 화합물 이외의 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산 암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄 등으로 구성되는 질소원이 더 포함될 수 있다.
사용될 수 있는 탄소원으로는 글루코스, 수크로스, 락토스, 프락토스, 말토스, 전분, 셀룰로스와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함될 수 있다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있으나, 이에 한정되는 것은 아니다.
사용될 수 있는 인의 공급원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함될 수 있으며, 이에 한정되는 것은 아니다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있으며, 이에 한정되는 것은 아니다. 그 외에, 아미노산 및 비타민과 같은 필수 성장 물질이 포함될 수 있다.
또한 배양 배지에 적절한 전구체들이 사용될 수 있다. 구체적으로, 상기 배지는 파이루베이트, 옥살로아세테이트, 및 α-케토글루타레이트로 이루어진 군으로부터 선택되는 하나 이상 및/또는 피리독살포스페이트를 더 포함할 수 있으나, 이에 한정되는 것은 아니다. 상기 배지 또는 개별 성분은 배양과정에서 배양액에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있으나, 이에 한정되는 것은 아니다.
또한, 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 미생물 배양액에 적절한 방식으로 첨가하여 배양액의 pH를 조정할 수 있다. 또한, 배양 중에 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 추가적으로, 배양액의 호기 상태를 유지하기 위하여, 배양액 내로 산소 또는 산소-함유 기체 (예, 공기)를 주입할 수 있다. 배양액의 온도는 통상 20℃ 내지 45℃, 예를 들면 25℃ 내지 40℃일 수 있다. 배양기간은 원하는 아미노기가 제거된 화합물의 양이 얻어질 때까지 지속될 수 있으며, 예를 들면 10 내지 160 시간일 수 있다.
또한 상기 아미노 화합물을 탈아미노시키는 방법은 상기 배지로부터 아미노기가 제거된 화합물을 회수하는 단계를 더 포함할 수 있다. 상기 아미노기가 제거된 화합물은 구체적으로는 N-아세틸글루타메이트5-세미알데하이드, 숙시네이트 세미알데하이드, 글루타레이트 세미알데하이드 및 아디페이트 세미알데하이드로 이루어진 군으로부터 선택되는 하나 이상일 수 있으나, 이에 한정되는 것은 아니다. 세포 또는 배양물로부터 아미노기가 제거된 화합물을 회수하는 방법은 배양방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배양물로부터 생산된 아미노기가 제거된 화합물을 수집 또는 회수할 수 있다. 예를 들면 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으나, 이들 예에 한정되지 않는다.
본 발명의 또 다른 양태는 상기 슈도모나스 스투체리 세포의 분쇄물(cell lysate)과 아미노 화합물을 반응시키는 단계를 포함하는 아미노 화합물을 탈아민화시키는 방법을 제공한다. 상기 슈도모나스 스투체리 균주 및 반응가능한 아미노 화합물에 대해서는 상기한 바와 같다.
본 발명에서 용어 "슈도모나스 스투체리 세포의 분쇄물(cell lysate)"은 슈도모나스 스투체리 KCCM11587P 세포의 막이 소실 또는 파괴되어, 이로 인해 생성된 슈도모나스 스투체리 KCCM11587P의 세포 파편 및 세포 내용물 예를 들면 세포 내 단백질 또는 핵산 등을 포함하는 액체상을 의미한다.
상기 슈도모나스 스투체리 세포의 분쇄물과 아미노 화합물을 반응시키는 용액은 파이루베이트, 옥살로아세테이트, 및 α-케토글루타레이트로 이루어진 군으로부터 선택되는 하나 이상 및/또는 피리독살포스페이트를 포함할 수 있다. 본 발명의 구체적인 일 실시예에서 6-아미노발레르산 또는 6-아미노카프로산, 알파-케토 글루타레이트 및 피리독살포스페이트를 포함하는 용액에 슈도모나스 스투체리 CJ-MKB의 세포 분쇄물을 가한 결과 글루타메이트가 생성되는 것을 확인할 수 있었다. 상기 반응의 온도는 25℃ 내지 35℃, 구체적으로는 25℃ 내지 30℃일 수 있다. 상기 반응시간은 0.5 내지 6시간, 1 내지 5시간, 2 내지 4.5 시간 또는 3 내지 4시간일 수 있다. 상기 탈아민화 방법은 반응 결과물로부터 아미노기가 제거된 화합물을 회수하는 단계를 더 포함할 수 있다.
상기 아미노 화합물을 탈아민화시키는 방법은 아디프산의 생산에 이용할 수 있다. 아디프산의 생산에서 아미노 화합물로서 6-아미노카프로산을 본 발명의 슈도모나스 스투체리 균주의 배양액에 질소원으로 넣어주거나 또는 슈도모나스 스투체리 균주의 세포 분쇄물과 반응시켜 아디페이트 세미알데하이드로 전환시킬 수 있다. 그 다음 상기 전환된 아디페이트 세미알데하이드로부터 통상의 기술자에게 알려진 방법을 이용하여 아디프산을 합성할 수 있다. 상기 아디페이트 세미알데하이드로부터 아디프산의 합성은 구체적으로는 알데하이드 디하이드로게나제 (aldehyde dehydrogenase) 반응에 의한 것일 수 있다.
본 발명의 신규 분리한 슈도모나스 스투체리 균주 KCCM11587P를 이용하여 아미노 화합물을 용이하게 탈아민화시킬 수 있으며, 이와 함께 아미노기가 제거된 화합물을 산업적으로 생산 가능하다. 나아가 본 발명의 신규 슈도모나스 스투체리 균주를 이용하여 6-아미노카프로산을 탈아민화시켜 아디프산을 생산하는 공정에 활용할 수 있다.
도 1은 6-아미노카프로산을 질소원으로 사용한 최소 배지를 이용하여 선별된 균주가 바이오 필름을 형성하는 것을 보여주는 사진이다. 구체적으로 단일 콜로니를 배양한 후 이를 원심분리하여 수득한 결과물 및 이 결과물을 증류수를 이용하여 바이오필름과 균주로 분리시킨 것이다.
도 2a 내지 f는 5-아미노발레르산, 6-아미노카프로산, 알파-케토글루타르산, 피리독살 포스페이트의 다양한 농도 및 각각의 기질의 유무에 따른 글루타메이트의 생성 및 기질의 분해 정도를 TLC 상에서 비교한 결과를 나타낸다.
[5AVA: 10mM 5-아미노발레르산 (standard); 1: 20mM 6-아미노카프로산 (standard); 2: 슈도모나스 스투체리 CJ-MKB + 20mM 6-아미노카프로산; 3: 슈도모나스 스투체리 CJ-MKB + 10mM 6-아미노카프로산 및 20mM 5-아미노발레르산; 4: 슈도모나스 스투체리 CJ-MKB + 20mM 6-아미노카프로산, 10mM 알파-케토글루타레이트 및 0.1mM 피리독살-포스페이트; 4-1: 슈도모나스 스투체리 CJ-MKB + 20mM 6-아미노카프로산 및 10mM 알파-케토글루타레이트; 5: 슈도모나스 스투체리 CJ-MKB + 10mM 6-아미노카프로산, 20mM 5-아미노발레르산, 10mM 알파-케토글루타레이트 및 0.1mM 피리독살-포스페이트; 5-1: 슈도모나스 스투체리 CJ-MKB + 10mM 6-아미노카프로산, 20mM 5-아미노발레르산 및 10mM 알파-케토글루타레이트; 6: 슈도모나스 스투체리 CJ-MKB + 20mM 6-아미노카프로산 및 20mM 글루타메이트; E: 10mM 글루타메이트 (standard)]
도 3은 여러 미생물의 세포 분쇄물과 5-아미노발레르산 및 6-아미노카프로산을 각각 반응시켜 탈아민 반응을 진행한 결과물을 TLC 상에서 나타낸 것이다. 구체적으로 10 mM 5-아미노발레르산 또는 6-아미노카프로산, 10 mM 알파-케토 글루타레이트, 0.1 mM의 피리독살포스페이트를 각 균주들의 세포 분쇄물에 첨가하여 반응을 진행하였다.
[1: 10mM 5-아미노발레르산, 10mM 6-아미노카프로산 (standard); 2: 클로스트리디움 아미노발레리쿰 + 10mM 5-아미노발레르산; 3: 슈도모나스 플루오레센스 + 10mM 5-아미노발레르산; 4: 슈도모나스 멘도시나 + 10mM 5-아미노발레르산; 5: 슈도모나스 스투체리 CJ-MKB + 10mM 5-아미노발레르산; 6: 클로스트리디움 아미노발레리쿰 + 10mM 6-아미노카프로산; 7: 슈도모나스 플루오레센스 + 10mM 6-아미노카프로산; 8: 슈도모나스 멘도시나 + 10mM 6-아미노카프로산; 9: 슈도모나스 스투체리 CJ-MKB + 10mM 6-아미노카프로산; 10: 10mM 글루타메이트 (standard)]
이하 본 발명을 실시예에 의해 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것은 아니다.
실시예 1: 6-아미노카프로산을 질소원으로 사용하는 미생물 동정
1) 6-아미노카프로산을 질소원으로 사용하는 미생물 선별 및 16S rRNA 분석
질소원을 6-아미노카프로산(6-ACA)으로 고정시키고 계대배양 방법을 통해서 6-아미노카프로산을 탈아민화시킬 수 있는 신규 균주 슈도모나스 스투체리(Pseudomonas stutzeri) CJ-MKB를 선별하였다.
선별을 위해 미생물이 배양될 수 있는 최소 배지를 하기 표 1의 조성과 같이 제조하였고, 균주 배양에 필요한 질소원으로 6-아미노카프로산을 사용하였다.
| 배지 조성 | 최종 농도 |
| Na2HPO4·H2O | 15.1 mM |
| KH2PO4 | 22 mM |
| NaCl | 8.6 mM |
| 6-아미노카프로산 | 20 mM |
| MgSO4 | 1 mM |
| CaCl2 | 100 mM |
| (NH4)6Mo7O24·H2O | 3 nM |
| H3BO3 | 400 nM |
| CoCl2·H2O | 30 nM |
| CuSo4·H2O | 10 nM |
| MnCl2·H2O | 80 nM |
| ZnSO4·H2O | 10 nM |
| FeSO4·H2O | 1 mM |
| 글루코스 | 11.1 mM |
구체적으로, 서울특별시 가양동에 소재한 씨제이제일제당㈜ 김포공장의 토양샘플을 상기 표1의 조성을 갖는 배지를 이용하여 37℃, 200rpm 조건에서 배양하였다. 배양된 후보 균주들은 초기 접종 광학밀도 (OD600)를 0.05로 맞춰 상기와 동일한 배양 조건에서 광학밀도가 0.5에 도달할 때까지 배양하였다. 5 차례의 계대 배양을 통해 표 1의 조성을 갖는 배지에서 배양되는 미생물을 선별할 수 있었다. 선별된 미생물을 일차적으로 'CJ-MKB'라 명명하고, 신규 미생물임을 확인하기 위해 다음의 실험을 진행하였다.
상기 배지에서 배양된 CJ-MKB 균주를 M9 아가 플레이트에 도말하여 콜로니들을 확보하였다. 얻어진 콜로니는 유사한 형태를 가지며, 25 mg/ml 농도의 앰피실린에 대하여 저항성을 가졌다. 그리고 콜로니 주변으로 옅은 색의 바이오 필름 (biofilm)이 형성되는 것을 확인하였다. 두 개의 콜로니를 선택하여 M9 액체 배지에 재배양하고 상용화된 genomic DNA prep kit를 이용하여 유전체(genomic DNA)를 각각 추출하였다. 얻어진 유전체의 동정을 위해 16S ribosomal RNA (16S rRNA)의 서열을 분석하였다. 미생물 16S rRNA의 서열 분석에서 보편적으로 사용되는 프라이머 27F (AGA GTT TGA TCC TGG CTC AG; 서열번호 7) 및 프라이머 1492R (GGT TAC CTT GTT ACG ACT T; 서열번호 8)를 이용하여, CJ-MKB 유전체의 16S rRNA가 서열 번호 1의 염기 서열을 가지는 것을 확인하였다.
미국국립생물정보센터(National Center for Biotechnology Information, NCBI)에서 제공되는 BLAST 프로그램을 이용하여 서열 번호 1과 높은 핵산 상동성을 가지는 균주를 검색하였다. (http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome). 그 결과, 슈도모나스 스투체리 NBRIS11 균주 (Pseudomonas stutzeri strain NBRIS11), 감마 프로테오박테리움 BP44-iso8 (Gamma proteobacterium BP44-iso8), 언컬처드 박테리움 클론 9(Uncultured bacterium clone 9), 에스케리키아 콜리 BM0446 균주(Escherichia coli strain BM0446), 및 엔테로박테리아세애 박테리움 BM005 (Enterobacteriaceae bacterium BM005)의 16S rRNA 와 동일한 서열을 가지는 것으로 확인되었다.
확인된 미생물들 중 여러 슈도모나스 종 미생물들이 엑소폴리사카라이드(exopolysaccharide)를 만들어 바이오-필름(bio-flim)을 형성하는 것으로 알려져 있으며, 또한 슈도모나스 종 미생물은 페니실린과 같은 베타-락탐 계열의 항생제에 대한 저항성을 가지고 있다. CJ-MKB 균주의 16S rRNA의 서열 정보와 배양 중에 보여지는 바이오필름, 앰피실린에 대한 저항성을 가지는 것을 고려해 볼 때, 선별된 균주가 슈도모나스 계열의 미생물일 확률이 높을 것으로 예상되었다. 25mg/ml 농도의 앰피실린을 함유한 M9 배지 아가 플레이트에서 얻어진 단일 콜로니를 LB 브로스로 배양하고, 13,000 rpm으로 1분 동안 원심분리하여 배양된 균주를 수득할 수 있었다 (도 1). 수득한 균주에 증류수를 넣고 가볍게 흔들어 주면, 바이오필름과 균주가 쉽게 분리된다.
2) 산화환원효소의 염기서열 분석
선별된 균주가 슈도모나스 속 미생물인지 여부를 확인하기 위해 슈도모나스 종에 존재하는 산화환원효소(oxidoreductase)의 염기서열을 신규 균주 CJ-MKB가 갖고 있는지 분석하였다. 이를 위해 새롭게 디자인한 프라이머 NCPPB 5P (ATGAGCAAGACTAACGAATCCC; 서열번호 9) 및 프라이머 NCPPB 3P (TCCAGAATGGCCAGCCCGCG; 서열번호 10)를 이용하여 서열 분석을 진행하였다. 그 결과 서열번호 2의 염기서열을 가지는 것을 확인하였다.
서열번호 2의 염기서열을 NCBI BLAST로 분석해본 결과, 서열번호 2가 공지된 슈도모나스 스투체리 A1501 균주의 산화환원효소의 몰리브도프테린-결합(molybdopterin-binding) 서열과 동일한 서열을 가지는 것을 확인함으로써, 선별된 신규 균주 CJ-MKB는 슈도모나스속 미생물임을 확인하였다.
3) 트랜스아미나아제의 염기서열 분석
상동성이 확인된 핵산 서열은 714개의 짧은 서열이므로, 미생물의 종속을 정확히 분류할 수 없었다. 이에 추가적인 단백질 핵산 서열을 분석하여 종속을 확인하였다. 미생물이 6-ACA를 질소원으로 사용하는 경우, 이의 효소 전환반응에 관여할 것으로 예상되는 트랜스아미나아제 중 N-아세틸오르니틴 트랜스아미나제 또는 4-아미노부티레이트 트랜스아미나제가 특이적일 것으로 예상하고, 상기 두 효소의 염기서열을 확인하였다.
구체적으로, 슈도모나스 스투체리 A1501과 선별된 균주 CJ-MKB의 게놈(genome)에 존재하는 N-아세틸오르니틴 트랜스아미나제의 염기 서열을 비교 분석하기 위하여 argD_F2 (5' 프라이머: ATTTAAGGATCCGTCCGCCCCGCACACCCCGG; 서열번호 11) 및 argD_R2 (3' 프라이머: ATTTAAGAGCTCTCAGGCCTGGGTCAGCGTC; 서열번호 12)를 사용하여 PCR 수행에 의해 핵산 서열을 분석하였다. 그 결과 슈도모나스 스투체리 A1501과 신규 미생물의 N-아세틸오르니틴 트랜스아미나제가 각각 서열번호 3 및 서열번호 4의 염기 서열을 가지는 것을 확인하였다.
또한 동일한 방법으로 슈도모나스 스투체리 A1501과 선별된 균주의 4-아미노부티레이트 트랜스아미나제의 염기서열을 비교분석하기 위하여 gabT_F (5' 프라이머: ATTTAACATATGCAACGCCGTGTCGCCGCCGTTCC; 서열번호 13)와 gabT_R (3' 프라이머: ATTTAAGAATTCTCAGGTCAGCTCGTCGAAACACT; 서열번호 14)를 이용하여 PCR을 수행하였다. 그 결과 각각 서열번호 5 및 서열번호 6의 염기 서열을 가지는 것을 확인하였다.
슈도모나스 스투체리 A1501과 선별된 균주의 N-아세틸오르니틴 트랜스아미나제 염기 서열을 비교 분석하기 위해 다중서열정렬(Multiple sequence alignment)을 이용하였다. 그 결과, 1,221개의 핵산 서열 중 13개의 핵산이 다른 것으로 확인되었다 (핵산 상동성: 98.9353%). 또한 동일한 방법으로 슈도모나스 스투체리 A1501과 신규 균주의 4-아미노부티레이트 트랜스아미나제의 핵산 서열을 비교 분석한 결과 1,257개의 핵산 서열 중 21개의 핵산이 다른 것으로 확인되었다 (핵산 상동성: 98.3294%)
결론적으로 선별된 균주 슈도모나스 스투체리 CJ-MKB (Pseudomonas stutzeri CJ-MKB)는 현재까지 알려진 미생물 유전체 서열 중에 슈도모나스 스투체리 A1501와 가장 높은 상동성을 가지며, 새로운 균주임이 확인되었다. 이에 따라 선별된 슈도모나스 스투체리 CJ-MKB 균주를 2014년 10월 22일자로 한국미생물보존센터에 기탁하여 수탁번호 KCCM11587P를 부여받았다.
실시예 2: 탈아민 반응성 확인
1) 슈도모나스 스투체리 CJ-MKB의 탈아민 반응성 확인
슈도모나스 스투체리 CJ-MKB의 5-아미노발레르산 및 6-아미노카프로산 탈아민화 반응성 평가를 수행하였다. 트랜스아미나제의 반응은 아민기와 케톤기의 치환 반응이므로, 반응 결과물은 박층 크로마토그래피 (TLC) 를 이용한 물질 분리 후, 닌하이드린 (ninhydrin)의 아민기 발색 반응을 통해서 기질 및 생성물을 쉽게 확인할 수 있다. 슈도모나스 스투체리 CJ-MKB의 트랜스아미나제 활성 확인을 위해 전세포 반응을 진행하였다. 슈도모나스 스투체리 CJ-MKB를 배양하여 광학밀도가 0.7 에 도달하였을 때, 새로운 M9 배지에 계대 배양하였으며, 6-아미노카프로산과 5-아미노발레르산을 질소원으로 고정시키고 배양을 진행하였다. 상기 배지에 필요한 알파-케토글루타레이트와 피리독살-포스페이트를 넣어주고, 5-아미노발레르산 및 6-아미노카프로산의 탈아민화 정도 확인을 위해 TLC를 수행하였다. 반응 부피는 100 ㎕ 였으며, 5-아미노발레르산, 6-아미노카프로산, 알파-케토글루타레이트, 피리독살-포스페이트의 다양한 농도 및 각각의 기질 유무에 따른 글루타메이트 (glutamate) 의 생성 및 기질의 분해 정도를 TLC 상에서 비교하였다. TLC 전개가 끝나고, 3% 닌하이드린 용액으로 아민기가 존재하는 물질을 발색시켰다. TLC 결과를 통해서 5-아미노발레르산, 6-아미노카프로산이 소멸되고, 글루타메이트가 생성되는 것을 확인할 수 있었다 (도 2a 내지 f 참조).
도 2f의 97 h reaction, lane 4에서 나타난 바와 같이, 배지에 20 mM 6-아미노카프로산, 10 mM 알파-케토 글루타레이트, 0.1 mM의 피리독살포스페이트를 첨가해준 균주가 97 시간 이전에 6-아미노카프로산을 모두 반응시키는 것을 확인할 수 있었다. 트랜스아미나제 반응이 충족되었을 때와 비교하면 반응 속도가 느리지만, 피리독살포스페이트가 없는 조건에서도 6-아미노카프로산이 감소하는 것이 TLC 상에서 확인되었다 (도 2f의 97 h reaction lane 4-1). 5-아미노발레르산 및 6-아미노카프로산이 동시에 존재하는 경우에는 6-아미노카프로산의 감소가 확인되지 않았다 (도 2f의 97 h reaction, lane 5, 및 5-1). 이를 통해 슈도모나스 스투체리 CJ-MKB는 최소배지 조건에서 배양할 때, 6-아미노카프로산과 5-아미노발레르산은 질소원으로 경쟁 반응하는 것으로 평가되었다.
이 실험 결과로부터 슈도모나스 스투체리 CJ-MKB가 6-아미노카프로산을 단일 질소원으로 사용할 수 있으며, 알파-케토글루타레이트 및 피리독살포스페이트 존재 하에서 5-아미노발레르산 및 6-아미노카프로산 탈아민화 반응을 가속화시키는 것을 확인할 수 있었다 (도 2a 내지 f). 한편 도 2d 및 도 2e의 24h reaction, lane5와 72h reaction, lane 4에서 적은 양의 글루타메이트가 확인되었지만, 지속적으로 축적되지는 않는 것을 나타났다. 이는 6-아미노카프로산의 반응과 더불어 글루타메이트가 생성되지만, 글루타메이트 대부분이 아민 공급원으로 사용되기 때문에 세포 내에서 축적되지 않고 빠르게 전환되는 것으로 평가된다.
2) 다른 균주들과 슈도모나스 스투체리 CJ-MKB의 탈아민화 반응성 비교
슈도모나스 스투체리 CJ-MKB의 탈아민화 반응성을 추가적으로 검증하기 위해서 세포분쇄액의 농도를 높여서 5-아미노발레이트 및 6-아미노카프로산을 각각 아민 기질로 사용하여 탈아민화반응을 진행하였다. 10 mM 5-아미노발레르산과 6-아미노카프로산, 10 mM 알파-케토 글루타레이트, 0.1 mM의 피리독살포스페이트를 슈도모나스 스투체리 CJ-MKB 세포 분쇄물에 넣고 28℃에서 4시간 반응을 시행하였다 (도 3).
또한 비교예로서 클로스트리디움 아미노발레리쿰(Clostridium aminovalericum), 슈도모나스 플루오레센스(Pseudomonas fluorescens), 슈도모나스 멘도시나(Pseudomonas mendocina)를 각각 배양하여, 각 미생물의 세포분쇄물로 5-아미노발레르산 및 6-아미노카프로산에 대한 반응 결과를 TLC를 통해 비교하였다. 도 3의 lane 5 및 9에서 나타난 바와 같이, 슈도모나스 스투체리 CJ-MKB 세포 분쇄물에서 글루타메이트의 생성을 확인할 수 있었다. 반면 다른 균주들의 경우 글루타메이트의 생성이 확인되지 않았다.
이에 따라 종래 공지된 균주들과 달리 신규 균주 슈도모나스 스투체리 CJ-MKB는 아미노 화합물을 탈아민화시키는 능력을 가지는 것을 확인하였다.
기탁기관명 : 한국미생물보존센터(국외)
수탁번호 : KCCM11587P
수탁일자 : 20141022
Claims (8)
- 아미노 화합물을 탈아민화시키는 신규 분리된 슈도모나스 스투체리(Pseudomonas stutzeri) KCCM11587P.
- 제1항에 있어서, 상기 아미노 화합물은 N-아세틸 오르니틴, 감마아미노부티르산, 5-아미노발레르산 및 6-아미노카프로산으로 이루어진 군으로부터 선택되는 하나 이상인 것인 슈도모나스 스투체리 KCCM11587P.
- 제1항 또는 제2항의 슈도모나스 스투체리 KCCM11587P를 아미노 화합물을 포함한 배지에서 배양하는 단계를 포함하는, 아미노 화합물을 탈아민화시키는 방법.
- 제3항에 있어서, 상기 아미노화합물은 N-아세틸 오르니틴, 감마아미노부티르산, 5-아미노발레르산 및 6-아미노카프로산으로 이루어진 군으로부터 선택되는 하나 이상인 것인 아미노 화합물을 탈아민화시키는 방법.
- 제3항에 있어서, 상기 배지는 파이루베이트, 옥살로아세테이트 및 α-케토글루타레이트로 이루어진 군으로부터 선택되는 하나 이상, 및 피리독살포스페이트를 추가적으로 포함하는 것인 아미노 화합물을 탈아민화시키는 방법.
- 제1항의 슈도모나스 스투체리 KCCM11587P의 분쇄물(cell lysate)과 아미노 화합물을 반응시키는 단계를 포함하는 아미노 화합물을 탈아민화시키는 방법.
- 제6항에 있어서, 상기 아미노 화합물은 N-아세틸 오르니틴, 감마아미노부티르산, 5-아미노발레르산 및 6-아미노카프로산으로 이루어진 군으로부터 선택되는 하나 이상인 것인 아미노 화합물을 탈아민화시키는 방법.
- 제7항에 있어서, 상기 슈도모나스 스투체리 KCCM11587P의 분쇄물과 아미노 화합물을 반응시키는 단계는 파이루베이트, 옥살로아세테이트 및 α-케토글루타레이트로 이루어진 군으로부터 선택되는 하나 이상, 및 피리독살포스페이트를 추가적으로 포함하여 반응시키는 것인 아미노 화합물을 탈아민화시키는 방법.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2015-0094944 | 2015-07-02 | ||
| KR1020150094944A KR101651239B1 (ko) | 2015-07-02 | 2015-07-02 | 신규 슈도모나스 종 균주 및 이를 이용한 6-아미노카프로산의 탈아민 방법 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017003103A1 true WO2017003103A1 (ko) | 2017-01-05 |
Family
ID=56884874
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2016/005869 Ceased WO2017003103A1 (ko) | 2015-07-02 | 2016-06-03 | 신규 슈도모나스 종 균주 및 이를 이용한 6-아미노카프로산의 탈아민 방법 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR101651239B1 (ko) |
| WO (1) | WO2017003103A1 (ko) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20120034640A (ko) * | 2009-05-07 | 2012-04-12 | 게노마티카 인코포레이티드 | 아디페이트, 헥사메틸렌디아민 및 6-아미노카프로산의 생합성을 위한 미생물 및 방법 |
| US20130109064A1 (en) * | 2011-08-19 | 2013-05-02 | Robin E. Osterhout | Microorganisms and methods for producing 2,4-pentadienoate, butadiene, propylene, 1,3-butanediol and related alcohols |
| WO2014099725A1 (en) * | 2012-12-17 | 2014-06-26 | Genomatica, Inc. | Microorganisms and methods for enhancing the availability of reducing equivalents in the presence of methanol, and for producing adipate, 6-aminocaproate, hexamethylenediamine or caprolactam related thereto |
-
2015
- 2015-07-02 KR KR1020150094944A patent/KR101651239B1/ko active Active
-
2016
- 2016-06-03 WO PCT/KR2016/005869 patent/WO2017003103A1/ko not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20120034640A (ko) * | 2009-05-07 | 2012-04-12 | 게노마티카 인코포레이티드 | 아디페이트, 헥사메틸렌디아민 및 6-아미노카프로산의 생합성을 위한 미생물 및 방법 |
| US20130109064A1 (en) * | 2011-08-19 | 2013-05-02 | Robin E. Osterhout | Microorganisms and methods for producing 2,4-pentadienoate, butadiene, propylene, 1,3-butanediol and related alcohols |
| WO2014099725A1 (en) * | 2012-12-17 | 2014-06-26 | Genomatica, Inc. | Microorganisms and methods for enhancing the availability of reducing equivalents in the presence of methanol, and for producing adipate, 6-aminocaproate, hexamethylenediamine or caprolactam related thereto |
Non-Patent Citations (2)
| Title |
|---|
| HAN, Y. ET AL.: "1-Aminocyclopropane-1-Carboxylate Deaminase from Pseudomonas Stutzeri A1501 Facilitates the Growth of Rice in the Presence of Salt or Heavy Metals", J. MICROBIOL. BIOTECHNOL., vol. 25, no. 7, July 2015 (2015-07-01), pages 1119 - 1128, XP055344220, [retrieved on 20150212] * |
| PENROSE, D. M. ET AL.: "Methods for Isolating and Characterizing ACC Deaminase-containing Plant Growth-promoting Rhizobactena", PHYSIOL. PLANT, vol. 118, no. 1, May 2003 (2003-05-01), pages 10 - 15, XP055344224 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101651239B1 (ko) | 2016-08-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA1303536C (en) | Process for producing l-threonine by fermentation | |
| EP2505637A1 (en) | Novel microbial succinic acid producer | |
| JPH119295A (ja) | 発酵法によるl−アミノ酸の製造法 | |
| WO2014175663A1 (ko) | L-아르기닌 생산능이 향상된 코리네박테리움속 미생물 및 이를 이용한 l-아르기닌의 생산 방법 | |
| DK165191B (da) | L-carnitin-producerende mikroorganismer samt fremgangsmaade til fremstilling af l-carnitin under anvendelse af mikroorganismerne | |
| US20230392173A1 (en) | Engineered biosynthetic pathway for production of 4-aminophenylethylamine by fermentation | |
| WO2011052819A1 (ko) | 글리세롤로부터 3-하이드록시프로피온산을 생산하는 새로운 방법 | |
| WO2016182321A1 (ko) | L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법 | |
| WO2015199406A1 (ko) | L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법 | |
| WO2003008601A2 (en) | Lactic acid production | |
| WO2017003103A1 (ko) | 신규 슈도모나스 종 균주 및 이를 이용한 6-아미노카프로산의 탈아민 방법 | |
| EP0692539B1 (en) | Process for producing an optically active gamma-hydroxy-L-glutamic acid | |
| WO2016056773A2 (ko) | L-글루타민을 생산하는 미생물 및 이를 이용한 l-글루타민 생산방법 | |
| WO2023224153A1 (ko) | 1,3-프로판디올 생산 변이 미생물 및 이를 이용한 1,3-프로판디올의 생산 방법 | |
| WO2018124778A1 (ko) | O-포스포세린을 생산하는 에스케리키아 속 미생물 및 이를 이용한 o-포스포세린 또는 l-시스테인을 생산하는 방법 | |
| CN118525102A (zh) | 用于发酵制备邻氨基苯甲酸的葡萄糖和木糖的混合物 | |
| WO2016032158A1 (ko) | L-라이신 생산능을 갖는 코리네박테리움 미생물 및 이를 이용한 l-라이신 생산 방법 | |
| DE10312775B4 (de) | Verfahren und Mikroorganismus zur mikrobiellen Herstellung von L-Alanin | |
| KR100229285B1 (ko) | 신규 고온성 바실러스 속 kls-01 및 이로부터 생산되는 내열성 d-알라닌 아미노트랜스퍼라아제, l-아스파테이트 아미노트랜스퍼라아제 및 알라닌라세마아제 | |
| WO2017003104A1 (ko) | 신규 트랜스아미나제 및 이를 이용한 아미노 화합물의 탈아민 방법 | |
| US6967087B1 (en) | Obligately symbiotic thermophile symbiobacterium toebii SC-1 producing thermostable L-tyrosine phenol-lyase and L-tryptophan indole-lyase and a method for screening its relative bacteria | |
| WO2012118318A2 (ko) | 비천연 아미노산 생산 균주 및 이를 이용한 비천연 아미노산의 제조 방법 | |
| JP4197778B2 (ja) | 光学活性なα−メルカプトカルボン酸の製造方法 | |
| WO2017003105A1 (ko) | 신규 트랜스아미나제 및 이를 이용한 아미노 화합물의 탈아민 방법 | |
| JP3873512B2 (ja) | D−3−(2−ナフチル)アラニンの製造方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16818136 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 32PN | Ep: public notification in the ep bulletin as address of the adressee cannot be established |
Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 12/04/2018) |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16818136 Country of ref document: EP Kind code of ref document: A1 |
