WO2016200336A1 - Regulation of secondary metabolite production in plants - Google Patents

Abstract

The present invention relates to the field of regulation of secondary metabolite production in plants. More specifically, the present invention relates to constructs, compositions and methods for decreasing or increasing secondary metabolite production in plants by altering the expression of the msYABBY5 and/or msMYB12 genes, particularly in spearmint and sweet basil.

Description

REGULATION OF SECONDARY METABOLITE PRODUCTION IN PLANTS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application is related to and claims priority to U.S. provisional patent application Serial No. 62/172,542 filed 8 June 2015. Each application is incorporated herein by reference in its entirety.

SUBMISSION OF SEQUENCE LISTING

[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is entitled 2577250PCTSequenceListing.txt, created on 13 May 2016 and is 27 kb in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in their entirety.

BACKGROUND OF THE INVENTION

[0003] The present invention relates to the field of regulation of secondary metabolite production in plants. More specifically, the present invention relates to constructs, compositions and methods for decreasing or increasing secondary metabolite production in plants, particularly in spearmint and sweet basil.

[0004] The publications and other materials used herein to illuminate the background of the invention, and in particular, cases to provide additional details respecting the practice, are incorporated by reference, and for convenience are referenced in the following text by author and date and are listed alphabetically by author in the appended bibliography.

[0005] Ocimum basilicum (sweet basil) is an aromatic plant that is widely used as a culinary herb and as a source of essential oils. The genus Ocimum consists of about 30 species among which the common basil, Ocimum basilicum is most widely grown. The essential oil produced by sweet basil is rich in phenylpropenes, monoterpenes and sesquiterpenes (Charles et al. 1990; Gang et al., 2001) which are produced in specialized trichomes known as peltate glandular trichomes. They are commercially valuable and widely used in the food, pharmaceutical and cosmetic industry as well as in agriculture. Through breeding, new cultivars are being developed but genetic engineering is a faster way to improve this crop. As more and more genomic and proteomic data is being developed for basil, an efficient transformation protocol is the key to develop superior transgenic varieties. Agrobacterium mediated transformation of basil. Deschamps and Simon (2002) reported the generation of transgenic sweet basil using leaf as explants and kanamycin selection. Their system was efficient in transient expression but the frequency of stable transfomiation was not discussed. Agrobacterium mediated transformation of clove basil (Ocimum gratissimum) using leaf, internode, hypocotyl, petiole and cotyledonary node as explants has also been reported (Khan et al., 2015). Sonication assisted Agrobacterium mediated transformation (SAAT) has been reported to substantially enliance transformation efficiency for non-susceptible plant species (Trick and Finer, 1997).

[0006] Genus Mentha, a member of Labiatae family, is one of the most widely used medicinal and aromatic herbs. The essential oils produced by these plants finds wide usage in food, flavour, cosmetic, pharmaceutical and biofuel industries (Davis et al., 2005; Champagne and Boutry, 2013; Sinha et al., 2013). Plants produce these volatile essential oils as secondary metabolites which have important role in plant defence, plant to plant communication and pollen attraction (Langenheim, 1994; Gershenzon et al., 2000). In mint these essential oils are produced in specialised glandular trichomes known as peltate glandular trichomes (PGT) which are adept at producing and storing large amounts of volatile secretions (McCaskill and Croteau, 1999; Croteau et al., 2000; Champagne and Boutry, 2013; Lange and Turner, 2013). These are found on the aerial surface of the plants. Spearmint {Mentha spicata) essential oil is dominated mainly by two monoterpenes; limonene and carvone. Monoterpenes are the CIO type of terpenoids and are generally colourless, lipophilic and volatile. They are responsible for the characteristic aromas and flavours of essential oils, floral scents and resin of aromatic plants. (Croteau, 1988; Little and Croteau, 1999; Loza-Tavera, 1999). Given their economic importance, strategies to metabolically engineer monoterpenes to increase yield is gaining momentum. Varietal improvement in cultivated spearmint or peppermint varieties has been difficult because they are sterile hybrids making classical breeding approach unfeasible. Hence metabolic engineering is good alternative method to improve essential oil yield and composition.

[0007] Aromatic plants spearmint {Mentha spicata) and sweet basil {Ocimum basilicum) produce valuable secondary metabolites which are extensively exploited for their biological properties and used as major constituents in the production of several products. Spearmint produces two major monoterpenes, limonene and carvone (Ringer et al., 2005). Spearmint oil has been known to have antimicrobial and antioxidant properties (Kizil et al., 2010; Sherer et al., 2013; Roomiani and Roomiani, 2014) for which it has a high commercial value to be used in pharmaceuticals. In addition, it is used as a flavouring agent in several kinds of food which further adds to its commercial value. Sweet basil produces a major phenylpropanoid, eugenol and few terpenoids which includes eucalyptol, linalool and alpha-bergamotene (Gang et al., 2001; Deschamps and Simon, 2010). Sweet basil oil is also known to have antioxidant properties (Jayasinghe et al., 2003) and a strong aroma for which it is been used in pharmaceuticals, perfumeries and cosmetics. These secondary metabolites are produced in specialized structures called peltate glandular trichomes (PGT) (Turner et al., 2000; Werker et al., 1993). These so called "green biofactories" are tiny structures on top of the leaf which makes it easy to harvest and experiment.

[0008] Plant secondary metabolites are critical to various biological processes of the plant which includes chemical signalling, defence mechanism and protection from UV irradiation. They are also important players in mediating plant-environment interactions. Apart from serving plants, they have been serving mankind for generations now by being major constituents of several commercial products. Various plants produce different secondary metabolites which are exploited for their specific characteristic usage in several products. The existing production techniques for producing secondary metabolites employ microbial system or chemical synthesis. Production techniques employing metabolic engineering of pathway for production of compound in its natural host plant with a yield high enough for commercial production remain elusive. Metabolic engineering requires in-depth knowledge about enzymes, transcription factors (TFs) and several other factors involved in the regulation and channeling of the secondary metabolites. Although it is possible to tweak enzymes to alter pathways, it is quite a tedious process as several enzymes have to be altered simultaneously to bring about a prominent impact.

[0009] Plants synthesize terpenes either via mevalonate (MVA) pathway in the cytosol or by 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway in plastids which provides the precursors for terpene biosynthesis (Lange and Croteau, 1999; Vranova et al., 2013). Both these pathways are well studied. MEP pathway in plastids is mainly responsible for producing monoterpene and diterpenes whereas MVA pathway generates sesquiterpenes and triterpenes (Dubey et al., 2003). The downstream monoterpene biosynthetic pathways in both spearmint and peppermint are also characterized well (Karp et al., 1990; Lange et al., 2011). One of the strategies to increase yield in peppermint has been to overexpress genes that codes for enzymes involved in the monoterpene pathway like limonene synthase and limonene hydroxylase (Diemer et al., 2001; Mahmoud and Croteau, 2001) but overexpression of these genes did not enhance oil yields. Mahmoud and Croteau (2001) and Lange et al. (2011) did some pioneering work to evaluate the efficacy of overexpressing genes involved in monoterpene precursor pathways on oil yields in peppermint (M piperita). Peppermint genes encoding for 1 -deoxy-d-xylulose-5-phosphate reductoisomerase (DXR), 1-deoxy-D-xylulose 5-phosphate synthase (DXPS), isopentenyl diphosphate isomerase (IPPI) and grand fir {Abies grandis) geranyl diphosphate synthase (GPPS) gene were used to generate transgenic peppermint under the control of cauliflower mosaic virus (CaMV) 35S promoter. DXR lines showed a 50% increase in oil yields. DXPS transgenic plants did not show significant increase in oil yield whereas transgenic lines overexpressing BPPI and GPPS showed 26% and 18% increases in oil yield, respectively. Most encouraging results were obtained in plants where two genes were manipulated simultaneously, overexpression of DXR and down regulation of menthofuran synthase. These transgenics showed up to 61% increase in oil yields over wild-type controls with low levels of the undesirable side-product (+)-menthofuran and its intermediate (+)-pulegone in the oil composition (Lange et al., 2011). It is increasingly becoming evident that transcription factors (TFs) known as metabolic regulators can activate or repress multiple genes in a metabolic pathway (Vom Endt et al., 2002; Grotewold, 2008; Iwase et al., 2009). Manipulation of such TFs can be more effective for engineering pathways rather than changing individual enzymes involved, because plant metabolic pathways are composed of multiple steps involving various enzymes and is very complex (Martin, 1996; Broun and Somerville, 2001).

[0010] The effectiveness of using TFs to modulate metabolic pathways has been validated in a few studies (Schwinn et al. 2006; Butelli et al., 2008; Luo et al., 2008). While the enzymatic pathway leading to the synthesis of spearmint monoterpenes are well defined (Karp et al., 1990; Croteau et al., 1991; Lange et al., 2011), the developmental regulation of this secondary metabolite pathway still remains elusive. Only two TFs have been reported so far which are involved in regulating terpene secondary metabolism. GaWRKYl which regulates the expression of a δ-cadinene terpene synthase in cotton (Xu et al., 2004) and the bZD? transcription factor OsTGAPl which regulates the production of diterpenoid phytoalexins in rice (Miyamoto et al., 2014).

[0011] Manipulating a single TF can affect an entire metabolic pathway leading to enormous change in the profile or yield of secondary metabolites (Mahjoub et al., 2009). Several TFs like MYB, NAC, WRKY, AP2/ERF and SPL have been isolated and characterized to have a role in controlling the biosynthesis and accumulation of secondary metabolites (Vom Endt et al., 2002; Yang et al., 2012). Of the list, MYB family of TFs have caught profound interest due to large number and diverse members, pursuing several roles including regulation of secondary metabolism as a major role. The MYB TFs can be divided into four classes depending upon the number of imperfect repeats which constitute the MYB DNA-binding region of 52 amino acids (Feller et al., 2011; Dubos et al, 2010). Among the different classes, the R2R3-MYBs are the major class to our knowledge till date. The R2 and R3 repeats form helix-turn-helix motifs and are responsible for binding to target DNA sequences. In recent years, many studies have been reported on the involvement of R2R3-MYBs in the regulation of secondary metabolism (Stracke et al., 2001; Bomal et al., 2013) [6]. Furthermore, they have been characterized as positive and negative regulators of several biosynthetic enzymes involved in the synthesis of flavonoids (Adato et al., 2009) and lignins (Legay et al., 2007).. This highlights the importance of R2R3- MYBs as targets for metabolic engineering of the secondary metabolism pathways.

[0012] Despite intensive work in unravelling the role of R2R3-MYBs in secondary metabolism of Arabidopsis thaliana (Stracke et al., 2001; Dubos et al., 2010), it is thus far difficult to engineer the metabolic pathway in most aromatic plants due to lack of knowledge about its own R2R3-MYBs which might have a more complex control of the pathway. This calls for extensive research in aromatic plants themselves for a better understanding of their role in regulating secondary metabolism. Years of research exploiting the PGTs have revealed several biosynthetic enzymes of the pathway. Despite knowledge about the enzymes involved in the secondary metabolism of these plants (Lange et al., 2000; Champagne and Boutry, 2013; Rastogi et al., 2014) the transcription factors controlling the expression of these enzymes are largely unidentified and poorly investigated. Despite intensive work in unravelling the role of R2R3-MYBs in secondary metabolism of Arabidopsis thaliana (Stracke et al., 2001; Dubos et al., 2010), it is thus far difficult to engineer the metabolic pathway in most aromatic plants due to lack of knowledge about its own R2R3-MYBs which might have a more complex control of the pathway. This calls for extensive research in aromatic plants themselves for a better understanding of their role in regulating secondary metabolism. To date, limited R2R3-MYBs have been characterized in sweet basil (Rastogi et al., 2014) and no R2R3-MYB has been yet characterized in spearmint.

[0013] A comparative RNA sequence analysis of different tissues of spearmint namely PGT, leaf devoid of PGT and leaf in order to investigate genes involved in PGT formation and secondary metabolism in spearmint (Jin et al., 2014). About 119 TF transcripts were found to be differentially expressed between PGTs and leaf-PGTs and one of our top differentially expressed TFs was a YABBY gene. YABBY genes constitute a group of plant specific TFs that are known to play important roles in various aspects of vegetative and floral development in plants (Bowman and Smyth, 1999; Siegfried et al., 1999; Bowman, 2000; Bonaccorso et al., 2012). A typical structure of a YABBY protein consists of an N-terminal C2C2 zinc finger domain, that is responsible for homo- and heterodimerization between YABBYs (Kanaya et al., 2001; Stahle et al., 2009), and a C-terminal YABBY domain of a helix-loop-helix motif, which is commonly found in high mobility group (HMG) of proteins and associated with non-specific DNA binding (Kanaya et al., 2002).The model plant Arabidopsis has six YABBY genes, four of them FILAMENTOUS FLOWER (FIL) or YABBY1 (YAB1), YAB2, YAB3, YAB5, show polar expression in all lateral organ primordia and CRABS CLAW (CRQ and INNER NO OUTER (INO) only in floral tissues.(Bowman and Smyth, 1999; Bowman, 2000). Phylogenetically, it has been proposed that angiosperms have five YABBY gene family members represented by INO, CRC, YAB2, FIL/YAB3, and YAB5 (Yamada et al. 2004; Lee et al. 2005; Toriba et al. 2007).

[0014] Mutant studies in Arabidopsis suggest that YABBYs are required to activate various leaf specific genetic programs resulting in the development of a flattened leaf lamina and suppressing meristem activity and promoting determinate growth (Stahle et al., 2009; Sarojam et al., 2010). CRC and INO specify abaxial cell fate in the carpel and controls nectary and ovule development in flowers (Bowman and Smyth, 1999; Eshed et al., 1999; Villanueva et al., 1999). Apart from Arabidopsis, several YABBY genes have been isolated and analysed from various other angiosperms like Antirrhinum majus (Golz et al., 2004), Oryza stative L. (Jang et al., 2004), Zea mays L. (Ku et al., 2012) and Triticum aestivum L. (Zhao et al., 2006), demonstrating the existence of YABBY genes in dicotyledons and monocotyledons. Emerging studies suggest that role of YABBY genes are not conserved across angiosperms and have diversified during evolution especially in monocots.

[0015] Thus, it is desired to identify genes involved in secondary metabolite production in plants and to identify methods for regulating secondary metabolite production in plants.

SUMMARY OF THE INVENTION

[0016] The present invention relates to the field of regulation of secondary metabolite production in plants. More specifically, the present invention relates to constructs, compositions and methods for decreasing or increasing secondary metabolite production in plants, particularly in spearmint and sweet basil.

[0017] In a first aspect, the present invention provides methods and compositions for regulating secondary metabolite production in plants. In one embodiment, the present invention relates to compositions and methods for over expressing the level and/or activity of YABBY5 in plants for creation of plants with decreased secondary metabolite production. In another embodiment, the present invention relates to compositions and methods for down regulating the level and/or activity of YABBY5 in plants for creation of plants with increased secondary metabolite production. Thus, in one aspect, the present invention provides an isolated nucleic acid comprising a polynucleotide sequence for use in a recombinant DNA construct or a suppression DNA construct for modulating YABBY5 expression, over expression or down regulation, respectively.

[0018] In one embodiment, the present invention provides a plant comprising in its genome a recombinant DNA construct comprising at least one regulatory element operably linked to a polynucleotide comprising (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2 or (ii) a full complement of the nucleic acid sequence of (i), wherein the full complement and the nucleic acid sequence of (i) consist of the same number of nucleotides and are 100% complementary. The polypeptide is preferably a YABBY5 polypeptide. Over expression of a YABBY5 polypeptide in a plant preferably reduces the production of secondary metabolites in plants when compared to a control plant not comprising said recombinant construct. In some embodiments, the regulatory element is a constitutive promoter for the over expression of a YABBY5 polypeptide in a plant.

[0019] In another embodiment, In one embodiment, the present invention provides a plant comprising in its genome a recombinant DNA construct comprising at least one regulatory element operably linked to a polynucleotide comprising (i) a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:l or (ii) a full complement of the nucleic acid sequence of (i). The isolated polynucleotide preferably encodes a YABBY5 polypeptide. Over expression of a YABBY5 polypeptide in a plant preferably reduces the production of secondary metabolites in plants when compared to a control plant not comprising said recombinant construct. In some embodiments, the regulatory element is a constitutive promoter for the over expression of a YABBY5 polypeptide in a plant.

[0020] In a further embodiment, the present invention provides a plant comprising in its genome a recombinant DNA construct comprising at least one regulatory element operably linked to a polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:l. The isolated polynucleotide preferably encodes a YABBY5 polypeptide. Over expression of a YABBY5 polypeptide in a plant preferably reduces the production of secondary metabolites in plants when compared to a control plant not comprising said recombinant construct. In some embodiments, the regulatory element is a constitutive promoter for the over expression of a YABBY5 polypeptide in a plant.

[0021] In one embodiment, the present invention provides a plant comprising in its genome a suppression DNA construct comprising at least one regulatory element operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a YABBY5 polypeptide, and wherein said plant exhibits increased production of secondary metabolites when compared to a control plant not comprising said suppression DNA construct. In some embodiments, the regulatory element is a constitutive promoter for the down regulation of a YABBY5 polypeptide in a plant.

[0022] In another embodiment, the present invention provides a plant comprising in its genome a suppression DNA construct comprising at least one regulatory element operably linked to all or part of (a) a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:l, or (b) a full complement of the nucleic acid sequence of (a), and wherein said plant exhibits increased production of secondary metabolites when compared to a control plant not comprising said suppression DNA construct. In some embodiments, the regulatory element is a constitutive promoter for the down regulation of a YABBY5 polypeptide in a plant.

[0023] In a second aspect, the present invention provides methods and compositions for regulating secondary metabolite production in plants. In one embodiment, the present invention relates to compositions and methods for over expressing the level and/or activity of MYB12 in plants for creation of plants with decreased, secondary metabolite production. In another embodiment, the present invention relates to compositions and methods for down regulating the level and/or activity of MYB12 in plants for creation of plants with increased secondary metabolite production. Thus, in one aspect, the present invention provides an isolated nucleic acid comprising a polynucleotide sequence for use in a recombinant DNA construct for modulating MYB12 expression, overexpression or down regulation.

[0024] In one embodiment, the present invention provides a plant comprising in its genome a recombinant DNA construct comprising at least one regulatory element operably linked to a polynucleotide comprising (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4 or (ii) a full complement of the nucleic acid sequence of (i), wherein the full complement and the nucleic acid sequence of (i) consist of the same number of nucleotides and are 100% complementary. The polypeptide is preferably a MYB12 polypeptide. Over expression of a MYB12 polypeptide in a plant preferably reduces the production of secondary metabolites in plants when compared to a control plant not comprising said recombinant construct. In some embodiments, the regulatory element is a constitutive promoter for the over expression of a MYB12 polypeptide in a plant.

[0025] In another embodiment, In one embodiment, the present invention provides a plant comprising in its genome a recombinant DNA construct comprising at least one regulatory element operably linked to a polynucleotide comprising (i) a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO: 3 or (ii) a full complement of the nucleic acid sequence of (i). The isolated polynucleotide preferably encodes a MYB12 polypeptide. Over expression of a MYB12 polypeptide in a plant preferably reduces the production of secondary metabolites in plants when compared to a control plant not comprising said recombinant construct. In some embodiments, the regulatory element is a constitutive promoter for the over expression of a MYB12 polypeptide in a plant.

[0026] In a further embodiment, the present invention provides a plant comprising in its genome a recombinant DNA construct comprising at least one regulatory element operably linked to a polynucleotide comprises a nucleotide sequence, wherein the nucleotide sequence is hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:3. The isolated polynucleotide preferably encodes a MYB12 polypeptide. Over expression of a MYB12 polypeptide in a plant preferably reduces the production of secondary metabolites in plants when compared to a control plant not comprising said recombinant construct. In some embodiments, the regulatory element is a constitutive promoter for the over expression of a MYB12 polypeptide in a plant.

[0027] In one embodiment, the present invention provides a plant comprising in its genome a suppression DNA construct comprising at least one regulatory element operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a MYB12 polypeptide, and wherein said plant exhibits increased production of secondary metabolites when compared to a control plant not comprising said suppression DNA construct. In some embodiments, the regulatory element is a constitutive promoter for the down regulation of a MYB12 polypeptide in a plant.

[0028] In another embodiment, the present invention provides a plant comprising in its genome a suppression DNA construct comprising at least one regulatory element operably linked to all or part of (a) a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3, or (b) a full complement of the nucleic acid sequence of (a), and wherein said plant exhibits increased production of secondary metabolites when compared to a control plant not comprising said suppression DNA construct. In some embodiments, the regulatory element is a constitutive promoter for the down regulation of a MYB12 polypeptide in a plant.

[0029] In some embodiments, the secondary metabolites that are decreased in a plant of the present invention include, but are not limited to, terpenes and phenylproponoids.

[0030] In other embodiments, the secondary metabolites that are increased in a plant of the present invention include, but are not limited to, terpenes and phenylproponoids.

[0031] In further embodiments, plants having decreased secondary metabolite production showed altered stress response. In other embodiments, plants having down regulation of

MYB12 showed high resistance to whitefly infestation.

[0032] In another embodiment, the present invention includes any of the plants of the present invention wherein the plant is spearmint or sweet basil. In a further embodiment, the present invention includes seed of any of the plants of the present invention, wherein said seed comprises in its genome a recombinant DNA construct or a suppression DNA construct described herein and wherein a plant produced from said seed exhibits regulation of secondary metabolite production when compared to a control plant not comprising said recombinant DNA construct or said suppression DNA construct.

[0033] In a further embodiment, the present invention provides a method of regulating secondary metabolite production in a plant, comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct or a suppression DNA construct described herein and (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome either (a) the recombinant DNA construct and exhibits decreased secondary metabolite production when compared to a control plant not comprising the recombinant DNA construct or (b) the suppression DA construct and exhibits increased secondary metabolite production when compared to a control plant not comprising the suppression DNA construct. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome either (a) the recombinant DNA construct and exhibits increased secondary metabolite production when compared to a control plant not comprising the suppression DNA construct.

[0034] In an additional embodiment, the present invention provides a method of selecting for (or identifying) regulated secondary metabolite production in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct or a suppression DNA construct described herein; (b) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct or the suppression DNA construct; and (c) selecting (or identifying) the progeny plant with regulated secondary metabolite production compared to a control plant not comprising the recombinant DNA construct or the suppression DNA construct.

[0035] In a third aspect, the present invention provides an efficient SAAT method for basil (Ocimum basilicum) using embryos as explants. Sonication and vacuum infiltration of embryos significantly increased the transformation efficiency. This development of an effective method to produce transgenic basil allows metabolic engineering to increase yield or to use basil as a platform for production of novel or altered chemicals. In addition, this development of a method to produce transgenic basil facilitates the development of basil as a model plant to study secondary metabolism.

[0036] In one embodiment, the transformation method comprises a sonication assisted Agrobacterium mediated transformation of basil explants based on a reliable method for basil regeneration. In one embodiment, the explant for regeneration or transformation is an embryo. In another embodiment, the embryo is a mature embryo. In a further embodiment, the mature embryo is a dissected mature embryo.

[0037] In one embodiment, the transformation method comprises the use of a reliable regeneration method for basil. In one embodiment, the regeneration method utilizes the embryo explant as described herein. The embryo explant is dissected from mature imbibed seeds and cultured on shoot induction medium. After 2 weeks, shoot primordia are seen emerging from the calli. These shoots are sub cultured on shoot induction medium. Once the shoots have grown, they are cultured on a shoot elongation medium. The elongated shoots are then cultured on a basal medium for about 2-3 weeks to develop plantlets having roots. Plantlets with well- developed roots are transferred to soil and grown under greenhouse conditions. [0038] In one embodiment, the transformation method comprises preculturing the embryo explants described herein on a shoot induction medium for about 1 day to about 3 days. Agrobacterium tumefaciens containing one or more DNA cassettes each comprising one or more desired nucleic acids are grown using conventional techniques and/or as described herein. The A. tumefaciens are resuspended in conventional medium. The precultured embryo explants are removed from the shoot induction medium and immersed in the A. tumefaciens culture. The immersed precultured embryo explants and A. tumefaciens culture are then sonicated for about 30 seconds to about 120 seconds. In one embodiment, the sonication is performed with an AC input of about 240 V. Following sonication, the sonicated embryo explants are immersed in fresh A. tumefaciens culture and subjected to vacuum infiltration, for about 1 minute to about 5 minutes. After a further period of infection of the sonicated, vacuum infiltrated basil explants, such as about 10 minutes to about 50 minutes, the infected embryo explants are placed on shoot induction medium for several days. The infected embryo explants are then washed with water containing cefatoxime, and the washed infected embryo explants are cultured on a shoot induction medium containing cefatoxime for several weeks in the dark to induce shoot formation. Transformed shoots are selected and transferred to a shoot elongation medium containing cefatoxime and cultured in the light for several weeks. The elongated shoots are then hardened on a basal medium and allowed to root.

BRIEF DESCRIPTION OF THE FIGURES

[0039] Fig. 1 shows a scanning electron microscope picture of spearmint leaf showing many PGTs on leaf surface.

[0040] Fig. 2 shows an amino acid sequence alignment of MsYABBYs. The amino acid sequences are: YAB5: SEQ ID NO:2; Y2: SEQ ID NO:5; Y3: SEQ ID NO:6; Y6: SEQ ID NO:7.

Figs. 3A and 3B show the validation of MsYABBY genes expression pattern in spearmint. Fig. 3 A: qRT-PCR analysis of MsYABBY genes in different tissues, PGT- peltate glandular trichome; leaf-PGT- leaves where PGT were brushed away. Elongation factor 1 (elfl)was used as control. Fig. 14B: In situ hybridization: sense (panel a) and antisense (panel b) probes detection of MsYABBY5

[0041] Fig. 4 shows a phylogenetic tree analysis of MsYABBYs. [0042] Fig. 5A-5D show the subcellular localization of MsYABBYS in N. benthamiana. Fig. 5 A: MsYABBY5 was localized to both nucleus and cytoplasm; Fig. 5B: MsYABBY6; Fig. 5C: MsYABBY2; Fig. 5D: MsYABBY4. Other MsYABBYs were found in nucleus only.

[0043] Figs. 6A and 6B show MsYABBY5 protein localization to golgi and endoplasmic reticulum (ER) in N. benthamiana. Fig. 6A: MsYABBY5 protein colocalized with golgi marker; Fig. 6B: MsYABBY5 protein colocalized with ER marker.

[0044] Figs. 7 A and 7B show that MsYABBY5 was predicted to be involved in secretory pathway (Fig. 7A) and possess a transmembrane domain signal located at N- terminus (SEQ ID NO: 8) (Fig. 7B). Prediction of subcellular localization was performed using a online software TargetP 1.1

[0045] Figs. 8 A-8D show BFA treatment lead to nuclear localization of MsYABBY5 protein in N. benthamiana. Fig. 8 A: mock group treated with DMSO; Fig. 8B: test group treated with 50 μg ml BFA for 3h; Fig. 8C and Fig. 8D are closer view of Fig. 8 A and Fig. 8B, respectively.

[0046] Figs. 9A-9C show the peptide used for MsYABBY5 antibody synthesis and specificity test of MsYABBY5 antibody. Fig. 9A: peptide with low similarity to other YABBY proteins was used for antibody synthesis, namely, LMLESK QDNKLEE (SEQ ID NO:9); Fig. 9B: The peptide was on surface of the protein, located at the closet helix to C-terminus. Fig. 9C: specificity test of MsYABB Y5 antibody. 1, MsYABBY2; 2, MsYABBY4; 3, MsYABBY5; 4, MsYABBY6. The amino acid sequences are: YAB5: SEQ ID NO:2; Y2: SEQ ID NO:5; Y3: SEQ ID NO:6; Y6: SEQ ID NO:7.

[0047] Figs. 1 OA- IOC show that immunogold labelling analysis revealed that MsYABBY5 protein was observed in both nucleus (N) and cytoplasm (C) in peltate glandular trichome of spearmint.

[0048] Figs. 11 A-l 1 C show MsYABBYS promoter analysis and expression pattern. Fig. 11 A. cis acting regulatory elements in the 5UTR (-1116) region of MsYABBY5. Fig. 11B: and Fig. 11C: Trichome specific GUS expression pattern observed in Nicotiana Benthamiana leaves and stemso plants transformed with pMsYABBY5::GUS. The DNA sequence is set forth in SEQ ID NO: 10. The partial coding sequence is set forth in SEQ ID NO:58.

[0049] Figs. 12A-12C show the subcellular localization of MsYABBY5 under its native promoter in N. benthamiana.

[0050] Figs. 13A-13C show Southern blotting analysis of transgenic plants. Fi.g 13A: RNAi lines in spearmint; Fig. 13B: over expression of MsYABBY5 in spearmint; Fig. 13C: over expression of MsYABB Y5 in sweet basil. [0051] Figs. 14A-14D show transcript levels of MsYABBYs in RNAi plants. Fig. 14A: MsYABBYS; Fig. 14B: MsYABBYS; Fig. 14C: MsYABBY4; Fig. 14D: MsYABBY6. Leaves from the second node (2-3 cm) were harvested and used for qPCR analysis. Gene expression is presented as relative to elfl. *, PO.05; **, PO.01.

[0052] Figs. 15A-15C show monoterpene production in wild type and MsYABBYS RNAi plants. Fig. 15 A: GC-MS of wild-type spearmint leaf showing Limonene and carvone as dominant monoterpenes. Fig. 15B: limonene production in RNAi plants. Fig. 15C: Carvone production in RNAi plants. Leaves from the second node (2-3 cm) were harvested and used for GC-MS analysis. Results of terpene production were presented as mean ± SD. *- PO.05; **- PO.01.

[0053] Figs. 16A-16C show transcript levels of MsYABBYS and monoterpene production in MsYABBYS over expression plants. Fig. 16A: MsYABBYS transcripts level in over expression plants. Gene expression was presented as relative to elfl. Fig. 16B: limonene production; Fig. 16C: carvone production. Leaves from the second node (2-3 cm) were harvested and used for analysis. Gene expression was presented as relative to elfl. Results of terpene production were presented as mean ± SD. *, PO.05; **, PO.01.

[0054] Figs. 17A and 17B show ectopic expression of MsYABBYS caused leaf elongation and curling in spearmint (Fig. 17A). Fig. 17B: The ratio of length to width of leaves from transgenic plants were significantly higher. (PO.05) than that of WT.

[0055] Figs 18A-18G show analysis of MsYABBYS over expression in sweet basil. Leaves from the second node (2-4 cm) were harvested and used for analysis. Figs. 18A-18G: compounds determined by GC-MS. Leaves from the second node (2-3 cm) were harvested and used for analysis. Results of terpene and eugenol production were presented as mean ± SD. *, PO.05; **, PO.01.

[0056] Figs. 19A-19C show the morphology of peltate glandular trichome (PGT) in spearmint and sweet basil. Fig. 19A: SEM of sweet basil leaf showing the PGTs on its surface. Fig. 19B: Isolated PGTs of sweet basil viewed under bright field and UV (DAPI stained). Fig. 19C: Isolated PGTs of speamint viewed under bright field and UV (DAPI stained).

[0057] Fig. 20 shows the transcript level of MsYABBYS in MsYABBYS overepression sweet Basil plant.

[0058] Figs. 21A and 21 B show phenotype of ectopic expression of MsYABBYS in sweet basil. Delay of flowering time (Fig. 21 A) and curling leaves (Fig. 2 IB) observed in MsYABBYS overpression plants. [0059] Figs. 22A and 22B show scanning electron micrographs (SEM) of leaf surface. Fig. 22A:)SEM of a spearmint leaf showing two kinds of glandular trichomes, (1) capitate glandular trichome and (2) peltate glandular trichome. Fig. 22B: SEM of sweet basil leaf showing two kinds of glandular trichomes, (1) capitate glandular trichome and (2) peltate glandular trichome

[0060] Fig. 23 shows the amino acid sequence of MsMYB12 (SEQ ID NO:4). The R2 repeat (residues LK . . . LR) and the R3 repeat (residues SD . . . HG). Five conserved tryptophan residues are shown in bold which are needed for the stability of the structure

[0061] Fig. 24 shows a Phylogenetic tree showing the similarity of MsMYB12 to known Arabidopsis thaliana R2R3-MYBs. Spearmint MYB12 is highlighted with a box. Arabidospsis thaliana R2R3-MYB sequences were obtained from TAJR website. Tree was constructed using MEGA6 software by Neighbour-joining method with bootstrap values of 1000 replicates. The scale bar indicates the number of amino acid substitutions per site.

[0062] Figs. 25 A and 25B show expression o and localization of MsMYB12. Fig. 25 A: Expression levels of MsMYB12 showing preferential expression in PGTs. qRT PCR was done to analyse the expression of MsMYB12 along the various tissues [leaf (L), leaf stripped of PGTs (L-T), root (R) and PGTs (T)]. Error bars illustrate the SD of mean values. Fig. 25B: Subcellular localization of MsMYB12 showing nucleus-specific localization in N. benthamiana leaf cells. YFP-tagged MsMYB12 was transiently expressed in N. benthamiana leaf cells by Agrobacterium-mediated infiltration and visualized 2 dpi using YFP and DAPI channel of a confocal microscope. YFP: YFP channel image, DAPI: DAPI channel image, Light: light microscope image, Merged: merged image between YFP, DAPI and light.

[0063] Figs. 26A-26C show Southern blots. Fig. 26A: Southern blot of transgenic sweet basil lines overexpressing MsMYB12 showing different T-DNA insertions. Figs. 26B and 26C: Southern blot of MsMYB12-KNAi and MsMYBl 2-overexpressing spearmint lines respectively, showing a range of insertions. 12μg of DNA was digested with Ndel enzyme. WT: wild type; RNAi-6, RNAi-10, RNAi-12, RNAi-18, RNAi-19, RNAi-24: MsMYBl 2 -KNAi lines; OX-4, OX-22, OX-38, OX-40: s 5¾72-overexpressing lines.

[0064] Figs. 27A-27C show expression analysis of transgenic plants. Fig. 27 A: Reduced- levels of MsMYBl 2 in transgenic spearmint MsMYBl 2-overexpressing lines when compared to WT. Fig. 27B: Increased levels of MsMYBl 2 in transgenic spearmint MsMYBl 2-RNAi lines when compared to WT. Fig. 27C: Ectopic expression of MsMYB12 in transgenic sweet basil. Spearmint and sweet basil elongation factor (efl) gene was used as an internal control respectively. WT: wild type; GFP: GFP overexpressing line; RNAi-6, RNAi-12, RNAi-18, RNAi-19: MsMYBl -RNAi lines; OX-4, OX-22, OX-38, OX-40: Ms i¾/ 2-overexpressing lines. 7; 10: MsMYBl 2 overexpressing lines of sweet basil. Data are indicated as "mean ± SD" of three biological replicates each performed in triplicates. Statistical significance between transgenic plants and WT was analysed using a two-tailed Student's t-test and indicated by asterisks. * indicates p < 0.05; ** indicates p < 0.01; *** indicates p < 0.001.

[0065] Figs. 28A-28D show the amount of secondary metabolites in transgenic spearmint plants. Fig. 28 A: Increased levels of limonene in MsMYBl 2-RNAi lines when compared to WT. Fig. 28B: Increased levels of carvone in MsMYB12-KNAi lines when compared to WT. Fig. 28C: Reduced levels of limonene in s F2?72-overexpressing lines when compared to WT. Fig. 28D: Reduced levels of carvone in s YB/2-overexpressing lines when compared to WT. Camphor was used as an internal standard. WT: wild type; GFP: GFP overexpressing line; RNAi-6, RNAi-12, RNAi-18, RNAi-19: MsMYBl 2-R Ai lines; OX-4, OX-22, OX-38, OX-40: MsMYBl 2-overexpressing lines. Data are indicated as "mean ± SD" of three biological replicates each performed in triplicates. Statistical significance between transgenic plants and WT was analysed using a two-tailed Student's t-test and indicated by asterisks. * indicates p < 0.05; ** indicates p < 0.01 ; *** indicates p < 0.001.

[0066] Figs. 29A-29D show the amount of secondary metabolites in transgenic sweet basil plants. Fig. 29A: Reduced levels of monoterpenes, Fig. 29B: reduced levels of sesquiterpenes, Fig. 29C: reduced levels of phenylpropenes. Fig. 29D: Decreased levels of total terpenes and total phenylpropenes in transgenic lines when compared to WT. Diethyl sebacanate was used as an internal standard. WT: wild type; 7 and 10: s 7i?72-overexpressing lines. Data are indicated as "mean ± SD" of three biological replicates each performed in triplicates. Statistical significance between transgenic plants and WT was analysed using a two-tailed Student's i-test and indicated by asterisks. * indicates p < 0.05; ** indicates p < 0.01; *** indicates p < 0.001.

[0067] Fig. 30 shows whitefly infestation on abaxial surface of spearmint leaves. Abaxial surface of spearmint leaves showing whitefiies and its nymphs. More infestation was observed in -v B/2-overespressing lines when compared to WT and Ms i¾i2-RNAi lines had relatively less infestation. WT: wild type; OX: MsMYBl 2-overexpressing line; RNAi: MsMYBl 2-RNAi line.

[0068] Figs. 31A-31C show whitefly infestation analysis on abaxial surface of spearmint leaves. Abaxial surface of spearmint leaves were counted for the number of eggs and nymphs using a stereomicroscope. Fig. 31 A: Increased number of eggs in OX lines and decreased number of eggs in RNAi lines. Fig. 3 IB: Increased number of nymphs in OX lines and decreased number of nymphs in RNAi lines. Fig. 31C: Total number of whitefly eggs and nymphs in various lines. High infestation in OX lines and reduced infestation in RNAi lines was observed. WT: wild type; OX: MsMYBl 2-overexpressing line; RNAi: MsMYBl 2-RNAi line

[0069] Figs. 32A-32C shows regeneration of transformed shoots from transformed explant using the method of the present invention. Fig. 32A shows dissected embryos. Figs. 32B and 32C show shoot regeneration from transformed calli.

[0070] Fig. 33 shows the emergence of green fluorescent protein (GFP) positive shoots from infected embryos and their development.

[0071] Fig. 34 shows PCR amplification of 600 bp of GFP gene in transgenic basil plants. Lanes 1-8: transgenic plants. WT: wild type non-transformed control.

DETATILED DESRIPITON OF THE INVENTION

[0072] The present invention relates to the field of regulation of secondary metabolite production in plants. More specifically, the present invention relates to constructs, compositions and methods for decreasing or increasing secondary metabolite production in plants, particularly in spearmint and sweet basil.

[0073] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the invention belongs.

[0074] The term "about" or "approximately" means within a statistically meaningful range of a value. Such a range can be within an order of magnitude, preferably within 50%, more preferably within 20%, more preferably still within 10%, and even more preferably within 5% of a given value or range. The allowable variation encompassed by the term "about" or "approximately" depends on the particular system under study, and can be readily appreciated by one of ordinary skill in the art.

[0075] A "control" or "control plant" or "control plant cell" provides a reference point for measuring changes in phenotype of a subject plant or plant cell in which genetic alteration, such as transformation, has been effected as to a polynucleotide of interest. A subject plant or plant cell may be descended from a plant or cell so altered and will comprise the alteration.

[0076] A control plant or plant cell may comprise, for example: (a) a wild-type plant or cell, i.e., of the same genotype as the starting material for the genetic alteration which resulted in the subject plant or cell; (b) a plant or plant cell of the same genotype as the starting material but which has been transformed with a null construct (i.e., with a construct which has no known effect on the trait of interest, such as a construct comprising a marker gene); (c) a plant or plant cell which is a non-transformed segregant among progeny of a subject plant or plant cell; (d) a plant or plant cell genetically identical to the subject plant or plant cell but which is not exposed to conditions or stimuli that would induce expression of the polynucleotide of interest or (e) the subject plant or plant cell itself, under conditions in which the polynucleotide of interest is not expressed.

[0077] "Constitutive promoter" refers to a promoter which is capable of causing a gene to be expressed in most cell types at most.

[0078] A "dsR A" or "RNAi molecule," as used herein in the context of RNAi, refers to a compound, which is capable of down-regulating or reducing the expression of a gene or the activity of the product of such gene to an extent sufficient to achieve a desired biological or physiological effect. The term "dsRNA" or "RNAi molecule," as used herein, refers to one or more of a dsRNA, siRNA, shRNA, ihpRNA, synthetic shRNA, miRNA.

[0079] The term "down regulated," as it refers to genes inhibited by the subject RNAi method, refers to a diminishment in the level of expression of a gene(s) in the presence of one or more RNAi construct(s) when compared to the level in the absence of such RNAi construct(s). The term "down regulated" is used herein to indicate that the target gene expression is lowered by 1-100%. For example, the expression may be reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%.

[0080] The term "expression" with respect to a gene sequence refers to transcription of the gene and, as appropriate, translation of the resulting mRNA transcript to a protein. Thus, as will be clear from the context, expression of a protein coding sequence results from transcription and translation of the coding sequence.

[0081] As used herein, "gene" refers to a nucleic acid sequence that encompasses a 5' promoter region associated with the expression of the gene product, any intron and exon regions and 3' or 5' untranslated regions associated with the expression of the gene product.

[0082] As used herein, "genotype" refers to the genetic constitution of a cell or organism.

[0083] The term "heterologous" or "exogenous" when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature. For instance, the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source. Similarly, a heterologous or exogenous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).

[0084] "Inducible promoter" refers to a promoter which is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress, such as that imposed directly by heat, cold, salt or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus or other biological or physical agent or environmental condition.

[0085] "Introduced" in the context of inserting a nucleic acid fragment (e.g., a recombinant DNA construct) into a cell, means "transfection" or "transformation" or "transduction" and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).

[0086] "MYB12 polypeptide" or "MsMYB12" refers to a Mentha spicata polypeptide encoded by the MsMYB12 locus . The terms "MYB12 polypeptide", "MYB12 protein", "MYB12", "MsMYB12polypeptide", "MsMYB12protein" and "MsMYB12" are used interchangeably herein. The protein (SEQ ID NO:4) encoded by the MsMYB12 gene has the ability to regulate secondary metabolite production in plants. In one embodiment, the plant is spearmint {Mentha spicata). In another embodiment, the plant is sweet basil (Ocimum basilicum). In one embodiment, a nucleotide sequence encoding mRNA for MsMYB12is set forth in SEQ ID NO:3. Over-expressing the MsMYB12 gene reduces the production of secondary metabolites. Down-regulating the MsMYB12 gene increases the production secondary metabolites.

[0087] "Operable linkage" or "operably linked" or "operatively linked" as used herein is understood as meaning, for example, the sequential arrangement of a promoter and the nucleic acid to be expressed and, if appropriate, further regulatory elements such as, for example, a terminator, in such a way that each of the regulatory elements can fulfill its function in the recombinant expression of the nucleic acid to make dsRNA. This does not necessarily require direct linkage in the chemical sense. Genetic control sequences such as, for example, enhancer sequences, can also exert their function on the target sequence from positions which are somewhat distant, or indeed from other DNA molecules (cis or trans localization). Preferred arrangements are those in which the nucleic acid sequence to be expressed recombinantly is positioned downstream of the sequence which acts as promoter, so that the two sequences are covalently bonded with one another. Regulatory or control sequences may be positioned on the 5' side of the nucleotide sequence or on the 3' side of the nucleotide sequence as is well known in the art.

[0088] "Over-expression" or "overexpression" refers to the production of a gene product in transgenic organisms that exceeds levels of production in normal, control or non-transformed organisms.

[0089] As used herein, "phenotype" refers to the detectable characteristics of a cell or organism, which characteristics are the manifestation of gene expression.

[0090] The terms "polynucleotide," "nucleic acid" and "nucleic acid molecule" are used interchangeably herein to refer to a polymer of nucleotides which may be a natural or synthetic linear and sequential array of nucleotides and/or nucleosides, including deoxyribonucleic acid, ribonucleic acid, and derivatives thereof. It includes chromosomal DNA, self-replicating plasmids, infectious polymers of DNA or RNA and DNA or RNA that performs a primarily structural role. Unless otherwise indicated, nucleic acids or polynucleotide are written left to right in 5' to 3' orientation, Nucleotides are referred to by their commonly accepted single-letter codes. Numeric ranges are inclusive of the numbers defining the range.

[0091] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. Amino acids may be referred to by their commonly known three-letter or one-letter symbols. Amino acid sequences are written left to right in amino to carboxy orientation, respectively. Numeric ranges are inclusive of the numbers defining the range.

[0092] "Progeny" comprises any subsequent generation of a plant.

[0093] "Propagule" includes all products of meiosis and mitosis able to propagate a new plant, including but not limited to, seeds, spores and parts of a plant that serve as a means of vegetative reproduction, such as corms, tubers, offsets, or runners. Propagule also includes grafts where one portion of a plant is grafted to another portion of a different plant (even one of a different species) to create a living organism. Propagule also includes all plants and seeds produced by cloning or by bringing together meiotic products, or allowing meiotic products to come together to form an embryo or fertilized egg (naturally or with human intervention). [0094] "Promoter" refers to a nucleic acid fragment capable of controlling transcription of another nucleic acid fragment.

[0095] "Promoter functional in a plant" is a promoter capable of controlling transcription in plant cells whether or not its origin is from a plant cell.

[0096] "Recombinant" refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques. "Recombinant" also includes reference to a cell or vector, that has been modified by the introduction of a heterologous nucleic acid or a cell derived from a cell so modified, but does not encompass the alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural transformation/ transduction/transposition) such as those occurring without deliberate human intervention.

[0097] "Recombinant DNA construct" refers to a combination of nucleic acid fragments that are not normally found together in nature. Accordingly, a recombinant DNA construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that normally found in nature. The terms "recombinant DNA construct" and "recombinant construct" are used interchangeably herein. A suppression DNA construct, used herein, is a type of recombinant DNA construct. In several embodiments described herein, a recombinant DNA construct may also be considered an "over expression DNA construct."

[0098] "Regulatory sequences" refer to nucleotide sequences located upstream (5' non- coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. The terms "regulatory sequence" and "regulatory element" are used interchangeably herein.

[0099] "Stable transformation" refers to the introduction of a nucleic acid fragment into a genome of a host organism resulting in genetically stable inheritance. Once stably transformed, the nucleic acid fragment is stably integrated in the genome of the host organism and any subsequent generation.

[0100] A "trait" refers to a physiological, morphological, biochemical, or physical characteristic of a plant or a particular plant material or cell. In some instances, this characteristic is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch, or oil content of seed or leaves, or by observation of a metabolic or physiological process, e.g. by measuring tolerance to water deprivation or particular salt or sugar concentrations, or by the observation of the expression level of a gene or genes, or by agricultural observations such as osmotic stress tolerance or yield.

[0101] "Transformation" as used herein refers to both stable transformation and transient transformation.

[0102] A "transformed cell" is any cell into which a nucleic acid fragment (e.g., a recombinant DNA construct) has been introduced.

[0103] "Transgenic plant" includes reference to a plant which comprises within its genome a heterologous polynucleotide. For example, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct. "Transgenic plant" also includes reference to plants which comprise more than one heterologous polynucleotide within their genome. Each heterologous polynucleotide may confer a different trait to the transgenic plant. A "transgenic plant" encompasses all descendants, hybrids, and crosses thereof, whether reproduced sexually or asexually, and which continue to harbor the foreign DNA.

[0104] "YABBY5 polypeptide" or " MsYABBY5" refers to a Mentha spicata polypeptide encoded by the MsYABBY5 locus . The terms "YABBY5 polypeptide", "YABBY5 protein", "YABBY", "MsYABBY5 polypeptide", "MsYABBY5 protein" and "MsYABBY" are used interchangeably herein. The protein (SEQ ID NO:2) encoded by the MsYABBY5 gene has the ability to regulate secondary metabolite production in plants. In one embodiment, the plant is spearmint {Mentha spicata). In another embodiment, the plant is sweet basil (Ocimum basilicum). In one embodiment, a nucleotide sequence encoding mRNA for MsYABBY5 is set forth in SEQ ID NO:l. Over-expressing the MsYABBYS gene reduces the production of secondary metabolites. Down-regulating the MsYABBY5 gene increases the production secondary metabolites.

[0105] Sequence alignments and percent identity calculations may be determined using a variety of comparison methods designed to detect homologous sequences including, but not limited to, the Megalign® program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, WI). Unless stated otherwise, multiple alignment of the sequences provided herein were performed using the Clustal V method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal V method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED-4. After alignment of the sequences, using the Clustal V program, it is possible to obtain "percent identity" and "divergence" values by viewing the "sequence distances" table on the same program; unless stated otherwise, percent identities and divergences provided and claimed herein were calculated in this manner.

[0106] Alternatively, the Clustal W method of alignment may be used. The Clustal W method of alignment (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci. 8:189-191 (1992)) can be found in the MegAlign™ v6.1 program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, Wis.). Default parameters for multiple alignment correspond to GAP PENALTY^IO, GAP LENGTH PENALTY=0.2, Delay Divergent Sequences=30%, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight Matrix=IUB. For pairwise alignments the default parameters are Alignment=Slow- Accurate, Gap Penalty=10.0, Gap Length=0.10, Protein Weight Matrix=Gonnet 250 and DNA Weight Matrix=IUB. After alignment of the sequences using the Clustal W program, it is possible to obtain "percent identity" and "divergence" values by viewing the "sequence distances" table in the same program.

[0107] The term "under stringent conditions" means that two sequences hybridize under moderately or highly stringent conditions. More specifically, moderately stringent conditions can be readily determined by those having ordinary skill in the art, e.g., depending on the length of DNA. The basic conditions are set forth by Sambrook et al., Molecular Cloning: A Laboratory Manual, third edition, chapters 6 and 7, Cold Spring Harbor Laboratory Press, 2001 and include the use of a prewashing solution for nitrocellulose filters 5xSSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of about 50% formamide, 2xSSC to 6xSSC at about 40-50 °C (or other similar hybridization solutions, such as Stark's solution, in about 50% formamide at about 42 °C) and washing conditions of, for example, about 40-60 °C, 0.5-6xSSC, 0.1% SDS. Preferably, moderately stringent conditions include hybridization (and washing) at about 50 °C and 6xSSC. Highly stringent conditions can also be readily determined by those skilled in the art, e.g., depending on the length of DNA.

[0108] Generally, such conditions include hybridization and/or washing at higher temperature and/or lower salt concentration (such as hybridization at about 65 °C, 6xSSC to 0.2xSSC, preferably 6xSSC, more preferably 2xSSC, most preferably 0.2xSSC), compared to the moderately stringent conditions. For example, highly stringent conditions may include hybridization as defined above, and washing at approximately 65-68 °C, 0.2xSSC, 0.1% SDS. SSPE (IxSSPE is 0.15 M NaCl, 10 mM NaH₂P0₄, and 1.25 mM EDTA, pH 7.4) can be substituted for SSC (lxSSC is 0.15 M NaCl and 15 mM sodium citrate) in the hybridization and washing buffers; washing is performed for 15 minutes after hybridization is completed.

[0109] It is also possible to use a commercially available hybridization kit which uses no radioactive substance as a probe. Specific examples include hybridization with an ECL direct labeling & detection system (Amersham). Stringent conditions include, for example, hybridization at 42 °C for 4 hours using the hybridization buffer included in the kit, which is supplemented with 5% (w/v) Blocking reagent and 0.5 M NaCl, and washing twice in 0.4% SDS, 0.5xSSC at 55 °C for 20 minutes and once in 2xSSC at room temperature for 5 minutes.

[0110] Embodiments of the present invention which include isolated polynucleotides and polypeptides, recombinant DNA constructs and suppression DNA constructs useful for conferring regulation of secondary metabolite production, compositions (such as plants or seeds) comprising these recombinant DNA constructs or suppression DNA constructs, and methods utilizing these recombinant DNA constructs or suppression DNA constructs are now described.

[0111] Isolated Polynucleotides and Polypeptides:

[0112] The present disclosure includes the following isolated polynucleotides and polypeptides:

[0113] An isolated polynucleotide comprising all or part of (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2, and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i), wherein the full complement and the nucleic acid sequence of (i) consist of the same number of nucleotides and are 100% complementary. Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs or suppression DNA constructs of the present disclosure. The polypeptide is preferably a YABBY5 polypeptide. Over expression of a YABBY5 polypeptide in a plant preferably decreases secondary metabolite production in the plant. Reducing expression of a YABBY5 polypeptide in a plant preferably increases secondary metabolite production in the plant.

[0114] An isolated polypeptide having an amino acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2, and combinations thereof. The polypeptide is preferably a YABBY5 polypeptide. Over expression of a YABBY5 polypeptide in a plant preferably decreases secondary metabolite production in the plant. Reducing expression of a YABBY5 polypeptide in a plant preferably increases secondary metabolite production in the plant.

[0115] An isolated polynucleotide comprising all or part of (i) a nucleic acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:l, and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i). Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs or suppression DNA constructs of the present disclosure. The polypeptide is preferably a YABBY5 polypeptide. Over expression of a YABBY5 polypeptide in a plant preferably decreases secondary metabolite production in the plant. Reducing expression of a YABBY5 polypeptide in a plant preferably increases secondary metabolite production in the plant.

[0116] An isolated polynucleotide comprising a nucleotide sequence, wherein the nucleotide sequence is hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:l. The isolated polynucleotide preferably encodes a YABBY5 polypeptide. Over expression of a YABBY5 polypeptide in a plant preferably decreases secondary metabolite production in the plant. Reducing expression of a YABBY5 polypeptide in a plant preferably increases secondary metabolite production in the plant.

[0117] An isolated polynucleotide comprising all or part of (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4, and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i), wherein the full complement and the nucleic acid sequence of (i) consist of the same number of nucleotides and are 100% complementary. Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs or suppression DNA constructs of the present disclosure. The polypeptide is preferably a MYB12 polypeptide. Over expression of a MYB12 polypeptide in a plant preferably increases secondary metabolite production in the plant. Reducing expression of a MYB12 polypeptide in a plant preferably increases secondary metabolite production in the plant. [0118] An isolated polypeptide having an amino acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4, and combinations thereof. The polypeptide is preferably a MYB12 polypeptide. Over expression of a MYB12 polypeptide in a plant preferably decreases secondary metabolite production in the plant. Reducing expression of a MYB12 polypeptide in a plant preferably increases secondary metabolite production in the plant.

[0119] An isolated polynucleotide comprising all or part of (i) a nucleic acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:l, and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i). Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs or suppression DNA constructs of the present disclosure. The polypeptide is preferably a MYB12 polypeptide. Over expression of a MYB12 polypeptide in a plant preferably decreases secondary metabolite production in the plant. Reducing expression of a MYB12 polypeptide in a plant preferably increases secondary metabolite production in the plant.

[0120] An isolated polynucleotide comprising a nucleotide sequence, wherein the nucleotide sequence is hybridizable under stringent conditions with a DNA molecule comprising the full complement of SEQ ID NO:l. The isolated polynucleotide preferably encodes a MYB12 polypeptide. Over expression of a MYB12 polypeptide in a plant preferably decreases secondary metabolite production in the plant. Reducing expression of a MYB12 polypeptide in a plant preferably increases secondary metabolite production in the plant.

[0121] It is understood, as those skilled in the art will appreciate, that the disclosure encompasses more than the specific exemplary sequences. Alterations in a nucleic acid fragment which result in the production of a chemically equivalent amino acid at a given site, but do not affect the functional properties of the encoded polypeptide, are well known in the art. For example, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity of the encoded products.

[0122] The protein of the current disclosure may also be a protein which comprises an amino acid sequence comprising deletion, substitution, insertion and/or addition of one or more amino acids in an amino acid sequence presented in SEQ ID NO:2 or 4. The substitution may be conservative, which means the replacement of a certain amino acid residue by another residue having similar physical and chemical characteristics. Non-limiting examples of conservative substitution include replacement between aliphatic group-containing amino acid residues such as De, Val, Leu or Ala, and replacement between polar residues such as Lys-Arg, Glu-Asp or Gln- Asn replacement.

[0123] The protein of the present disclosure may also be a protein which is encoded by a nucleic acid comprising a nucleotide sequence comprising deletion, substitution, insertion and/or addition of one or more nucleotides in the nucleotide sequence of SEQ ID NO:l or 3. Nucleotide deletion, substitution, insertion and/or addition may be accomplished by site-directed mutagenesis or other techniques well known in the art.

[0124] The protein of the present disclosure may also be a protein which is encoded by a nucleic acid comprising a nucleotide sequence hybridizable under stringent conditions with the complementary strand of the nucleotide sequence of SEQ ID NO: 1 or 3.

[0125] Recombinant DNA Constructs and Suppression DNA Constructs:

[0126] In one aspect, the present invention includes recombinant DNA constructs.

[0127] In one embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein the polynucleotide comprises (i) a nucleic acid sequence encoding an amino acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO: 2, and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i). The polypeptide is preferably a YABBY5 polypeptide. Over expression of a YABBY5 polypeptide in a plant preferably decreases secondary metabolite production in the plant.

[0128] In another embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein said polynucleotide comprises (i) a nucleic acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:l, and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i). The polypeptide is preferably a YABBY5 polypeptide. Over expression of a YABBY5 polypeptide in a plant preferably decreases secondary metabolite production in the plant.

[0129] In another embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant , wherein said polynucleotide encodes all or part of a YABBY5 polypeptide. Over expression of a YABBY5 polypeptide in a plant preferably decreases secondary metabolite production in the plant.

[0130] In one embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein the polynucleotide comprises (i) a nucleic acid sequence encoding an amino acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4, and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i). The polypeptide is preferably a MYB12 polypeptide. Over expression of a MYB12 polypeptide in a plant preferably decreases secondary metabolite production in the plant.

[0131] In another embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein said polynucleotide comprises (i) a nucleic acid sequence of at least 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3, and combinations thereof; or (ii) a full complement of the nucleic acid sequence of (i). The polypeptide is preferably a MYB12 polypeptide. Over expression of a MYB12 polypeptide in a plant preferably decreases secondary metabolite production in the plant.

[0132] In another embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant], wherein said polynucleotide encodes all or part of a MYB12 polypeptide. Over expression of a MYB12 polypeptide in a plant preferably decreases secondary metabolite production in the plant.

[0133] In another aspect, the present invention includes suppression DNA constructs.

[0134] A suppression DNA construct may comprise at least one regulatory sequence (e.g., a promoter functional in a plant) operably linked to (a) all or part of: (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2, and combinations thereof, or (ii) a full complement of the nucleic acid sequence of (a)(i); or (b) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a YABBY5 polypeptide; or (c) all or part of: (i) a nucleic acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:l, and combinations thereof, or (ii) a full complement of the nucleic acid sequence of (c)(i). The suppression DNA construct may comprise a cosuppression construct, antisense construct, viral-suppression construct, hairpin suppression construct, stem-loop suppression construct, double-stranded RNA-producing construct, RNAi construct, or small RNA construct (e.g., an siRNA construct or an miRNA construct).

[0135] A suppression DNA construct may comprise at least one regulatory sequence (e.g., a promoter functional in a plant) operably linked to (a) all or part of: (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4, and combinations thereof, or (ii) a full complement of the nucleic acid sequence of (a)(i); or (b) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a MYB12 polypeptide; or (c) all or part of: (i) a nucleic acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3, and combinations thereof, or (ii) a full complement of the nucleic acid sequence of (c)(i). The suppression DNA construct may comprise a cosuppression construct, antisense construct, viral- suppression construct, hairpin suppression construct, stem-loop suppression construct, double- stranded RNA-producing construct, RNAi construct, or small RNA construct (e.g., an siRNA construct or an miRNA construct).

[0136] "Suppression DNA construct" is a construct which when transformed or stably integrated into the genome of the plant, results in "silencing" or down regulation of a target gene in the plant. The target gene may be endogenous or transgenic to the plant. "Silencing," as used herein with respect to the target gene, refers generally to the suppression of levels of mRNA or protein/enzyme expressed by the target gene, and/or the level of the enzyme activity or protein functionality. The terms "suppression", "suppressing" and "silencing", used interchangeably herein, include lowering, reducing, declining, decreasing, inhibiting, eliminating or preventing. "Silencing" or "gene silencing" does not specify mechanism and is inclusive, and not limited to, anti-sense, cosuppression, viral-suppression, hairpin suppression, stem-loop suppression, RNAi- based approaches, and small RNA-based approaches.

[0137] A suppression DNA construct may comprise a region derived from a target gene of interest and may comprise all or part of the nucleic acid sequence of the sense strand (or antisense strand) of the target gene of interest. Depending upon the approach to be utilized, the region may be 100% identical or less than 100% identical (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to all or part of the sense strand (or antisense strand) of the gene of interest. In one embodiment, a region is derived from YABBY5 and has the sequence set forth in SEQ ID NO:2. In another embodiment, a region is derived from MYB12 and has the sequence set forth in SEQ ID NO:4.

[0138] A suppression DNA construct may comprise 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 contiguous nucleotides of the sense strand (or antisense strand) of the gene of interest, and combinations thereof. In one embodiment, the suppression DNA construct may comprises the sequence set forth in SEQ ED NO:2. In another embodiment, the suppression DNA construct may comprised the sequence set forth in SEQ ID NO:4.

[0139] Suppression DNA constructs are well-known in the art, are readily constructed once the target gene of interest is selected, and include, without limitation, cosuppression constructs, antisense constructs, viral-suppression constructs, hairpin suppression constructs, stem-loop suppression constructs, double-stranded RNA-producing constructs, and more generally, RNAi (RNA interference) constructs and small RNA constructs such as siRNA (short interfering RNA) constructs and miRNA (microRNA) constructs. In one embodiment, a hairpin suppression construct comprises the sequence set forth in SEQ ID NO:2 present in both a sense and antisense orientation. In another embodiment, a hairpin suppression construct comprises the sequence set forth in SEQ ED NO:4 present in both a sense and antisense orientation.

[0140] Suppression of gene expression may also be achieved by use of artificial miRNA precursors, ribozyme constructs and gene disruption. A modified plant miRNA precursor may be used, wherein the precursor has been modified to replace the miRNA encoding region with a sequence designed to produce a miRNA directed to the nucleotide sequence of interest. Gene disruption may be achieved by use of transposable elements or by use of chemical agents that cause site-specific mutations. In one embodiment, a miRNA suppression construct comprises at least one heterologous regulatory element operably linked to a polynucleotide in which the polynucleotide is a modified plant miRNA precursor in which the precursor has been modified to replace the miRNA encoding region with a sequence designed to produce a miRNA directed to SEQ ID NO: 1 or 3.

[0141] "Antisense inhibition" refers to the production of antisense RNA transcripts capable of suppressing the expression of the target gene or gene product. "Antisense RNA" refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target isolated nucleic acid fragment (U.S. Patent No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or the coding sequence.

[0142] "Cosuppression" refers to the production of sense RNA transcripts capable of suppressing the expression of the target gene or gene product. "Sense" RNA refers to RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro. Cosuppression constructs in plants have been previously designed by focusing on overexpression of a nucleic acid sequence having homology to a native mRNA, in the sense orientation, which results in the reduction of all RNA having homology to the overexpressed sequence (see Vaucheret et al., 1998; and Gura, 2000).

[0143] Another variation describes the use of plant viral sequences to direct the suppression of proximal mRNA encoding sequences (PCT Publication No. WO 98/36083).

[0144] RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al., 1998). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing (PTGS) or RNA silencing and is also referred to as quelling in fungi. The process of post- transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al., 1999).

[0145] Small RNAs play an important role in controlling gene expression. Regulation of many developmental processes, including flowering, is controlled by small RNAs. It is now possible to engineer changes in gene expression of plant genes by using transgenic constructs which produce small RNAs in the plant.

[0146] Small RNAs appear to function by base-pairing to complementary RNA or DNA target sequences. When bound to RNA, small RNAs trigger either RNA cleavage or translational inhibition of the target sequence. When bound to DNA target sequences, it is thought that small RNAs can mediate DNA methylation of the target sequence. The consequence of these events, regardless of the specific mechanism, is that gene expression is inhibited.

[0147] MicroRNAs (miRNAs) are noncoding RNAs of about 19 to about 24 nucleotides (nt) in length that have been identified in both animals and plants (Lagos-Quintana et al., 2001, Lagos-Quintana et al., 2002; Lau et al, (2001; Lee and Ambros, 2001; Llave et al., 2002; Mourelatos et al., 2002; Park et al., 2002; Reinhart et al., 2002). They are processed from longer precursor transcripts that range in size from approximately 70 to 200 nt, and these precursor transcripts have the ability to form stable hairpin structures.

[0148] MicroRNAs (miRNAs) appear to regulate target genes by binding to complementary sequences located in the transcripts produced by these genes. It seems likely that miRNAs can enter at least two pathways of target gene regulation: (1) translational inhibition; and (2) RNA cleavage. MicroRNAs entering the RNA cleavage pathway are analogous to the 21-25 nt short interfering RNAs (siRNAs) generated during RNA interference (RNAi) in animals and posttranscriptional gene silencing (PTGS) in plants, and likely are incorporated into an RNA- induced silencing complex (RISC) that is similar or identical to that seen for RNAi.

[0149] The terms "miRNA-star sequence" and "miRNA* sequence" are used interchangeably herein and they refer to a sequence in the miRNA precursor that is highly complementary to the miRNA sequence. The miRNA and miRNA* sequences form part of the stem region of the miRNA precursor hairpin structure.

[0150] In one embodiment, there is provided a method for the suppression of a target sequence comprising introducing into a cell a nucleic acid construct encoding a miRNA substantially complementary to the target, hi some embodiments the miRNA comprises about 19, 20, 21, 22, 23, 24 or 25 nucleotides. In some embodiments the miRNA comprises 21 nucleotides. In some embodiments the nucleic acid construct encodes the miRNA. In some embodiments the nucleic acid construct encodes a polynucleotide precursor which may form a double-stranded RNA, or hairpin structure comprising the miRNA.

[0151] In some embodiments, the nucleic acid construct comprises a modified endogenous plant miRNA precursor, wherein the precursor has been modified to replace the endogenous miRNA encoding region with a sequence designed to produce a miRNA directed to the target sequence. The plant miRNA precursor may be full-length of may comprise a fragment of the full-length precursor. In some embodiments, the endogenous plant miRNA precursor is from a dicot or a monocot. In some embodiments the endogenous miRNA precursor is from Arabidopsis, tomato, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane or switchgrass.

[0152] In some embodiments, the miRNA template, (i.e. the polynucleotide encoding the miRNA), and thereby the miRNA, may comprise some mismatches relative to the target sequence. In some embodiments the miRNA template has > 1 nucleotide mismatch as compared to the target sequence, for example, the miRNA template can have 1, 2, 3, 4, 5, or more mismatches as compared to the target sequence. This degree of mismatch may also be described by determining the percent identity of the miRNA template to the complement of the target sequence. For example, the miRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the target sequence.

[0153] In some embodiments, the miRNA template, (i.e. the polynucleotide encoding the miRNA) and thereby the miRNA, may comprise some mismatches relative to the miRNA-star sequence. In some embodiments the miRNA template has > 1 nucleotide mismatch as compared to the miRNA-star sequence, for example, the miRNA template can have 1, 2, 3, 4, 5, or more mismatches as compared to the miRNA-star sequence. This degree of mismatch may also be described by determining the percent identity of the miRNA template to the complement of the miRNA-star sequence. For example, the miRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the miRNA-star sequence.

[0154] Regulatory Sequences:

[0155] A recombinant DNA construct or a suppression DNA construct) of the present disclosure may comprise at least one regulatory sequence.

[0156] A regulatory sequence may be a promoter.

[0157] A number of promoters can be used in recombinant DNA constructs of the present disclosure. The promoters can be selected based on the desired outcome, and may include constitutive, tissue-specific, inducible, or other promoters for expression in the host organism.

[0158] Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters".

[0159] High level, constitutive expression of the candidate gene under control of the 35S or UBI promoter may have pleiotropic effects, although candidate gene efficacy may be estimated when driven by a constitutive promoter. Use of tissue-specific and/or stress-specific promoters may eliminate undesirable effects but retain the ability to regulate secondary metabolite production in a plant.

[0160] Suitable constitutive promoters for use in a plant host cell include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Patent No. 6,072,050; the core CaMV 35S promoter (Odell et al., 1985); rice actin (McElroy et al., 1990); ubiquitin (Christensen et al., 1989; Christensen et al., 1992); pEMU (Last et al., 1991); MAS (Velten et al., 1984); ALS promoter (U.S. Patent No. 5,659,026), the constitutive synthetic core promoter SCP1 (International Publication No. 03/033651) and the like. Other constitutive promoters include, for example, those discussed in U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,6^0; 5,268,463; 5,608,142; and 6,177,611.

[0161] In choosing a promoter to use in the methods of the disclosure, it may be desirable to use a tissue-specific or developmentally regulated promoter. [0162] A tissue-specific or developmentally regulated promoter is a DNA sequence which regulates the expression of a DNA sequence selectively in the cells/tissues of a plant critical to tassel development, seed set, or both, and limits the expression of such a DNA sequence to the period of tassel development or seed maturation in the plant. Any identifiable promoter may be used in the methods of the present disclosure which causes the desired temporal and spatial expression.

[0163] Inducible promoters selectively express an operably linked DNA sequence in response to the presence of an endogenous or exogenous stimulus, for example by chemical compounds (chemical inducers) or in response to environmental, hormonal, chemical, and/or developmental signals.

[0164] Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments.

[0165] In one embodiment the at least one regulatory element may be an endogenous promoter operably linked to at least one heterologous enhancer element; e.g., a 35S, nos or ocs enhancer element.

[0166] Additional promoters include: RIP2, mLIP15, ZmCORl, Rabl7, CaMV 35S, RD29A, B22E, Zag2, SAM synthetase, ubiquitin, CaMV 19S, nos, Adh, sucrose synthase, R-allele, and the constitutive promoter GOS2 from Zea mays.

[0167] Recombinant DNA constructs and suppression DNA constructs of the present disclosure may also include other regulatory sequences, including but not limited to, translation leader sequences, introns, and polyadenylation recognition sequences. In another embodiment of the present disclosure, a recombinant DNA construct of the present disclosure further comprises an enhancer or silencer.

[0168] An intron sequence can be added to the 5' untranslated region, the protein-coding region or the 3' untranslated region to increase the amount of the mature message that accumulates in the cytosol. Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold (Buchman and Berg, 1988; Callis et al., 1987).

[0169] Compositions:

[0170] A composition of the present disclosure includes a transgenic plant cell, plant, and seed comprising the recombinant DNA construct or suppression DNA construct. [0171] In one embodiment, a composition of the present disclosure is a plant comprising in its genome any of the recombinant DNA constructs or suppression DNA constructs of the present disclosure (such as any of the constructs discussed above). Compositions also include any progeny of the plant, any seed obtained from the plant or its progeny or any fruit, bulb or tuber obtained from the plant or its progeny, wherein the plant, progeny, seed, fruit, bulb or tuber comprises within its genome the recombinant DNA construct. Progeny includes subsequent generations obtained by conventional plant propagation, breeding or development.

[0172] In some embodiments, the plants include a plant comprising in its genome a recombinant DNA construct comprising at least one regulatory element operably linked to a polynucleotide described herein for the overexpression of a YABBY5 or MYB12 polypeptide and wherein said plant exhibits decreased secondary metabolite production when compared to a control plant not comprising said recombinant DNA construct. In other embodiments, the plants include a plant comprising in its genome a suppression DNA construct comprising at least one regulatory element operably linked to a polynucleotide described herein for reducing expression of a YABBY5 or MYB12 polypeptide and wherein said plant exhibits increased secondary metabolite production when compared to a control plant not comprising said suppression DNA construct. In one embodiment, the plant is spearmint. In another embodiment, the plant is sweet basil.

[0173] In some embodiments, the secondary metabolites that are decreased in a plant of the present invention include, but are not limited to, terpenes and phenylproponoids.

[0174] In some embodiments, the secondary metabolites that are increased in a plant of the present invention include, but are not limited to, terpenes and phenylproponoids.

[0175] In further embodiments, plants having decreased secondary metabolite production showed altered stress response. In other embodiments, plants having down regulation of

MYB12 showed high resistance to whitefly infestation.

[0176] Methods:

[0177] Methods include but are not limited to methods for decreasing or increasing secondary metabolite production in a plant, methods for evaluating secondary metabolite production in a plant, and methods for producing seed. The plant may be spearmint or sweet basil. The seed may be a spearmint or sweet basil seed.

[0178] Methods include but are not limited to the following: [0179] A method for transforming a plant cell comprising transforming a plant cell with any of the isolated polynucleotides or recombinant DNA constructs or suppression DNA constructs of the present disclosure. The plant cell transformed by this method is also included.

[0180] A method for producing a transgenic plant comprising transforming a plant cell with any of the isolated polynucleotides or recombinant DNA constructs or suppression DNA constructs of the present disclosure and regenerating a transgenic plant from the transformed plant cell. The disclosure is also directed to the transgenic plant produced by this method, and transgenic seed obtained from this transgenic plant. The transgenic plant obtained by this method may be used in other methods of the present disclosure.

[0181] A method of altering the level of expression of a polypeptide of the invention in a host cell comprising: (a) transforming a host cell with a recombinant DNA construct or suppression DNA construct described herein; and (b) growing the transformed host cell under conditions that are suitable for expression of the recombinant DNA construct or suppression DNA construct wherein (a) expression of the recombinant DNA construct results in over expression of YABBY5 or MYB12 resulting in decreased production of secondary metabolites in the transformed host cell or (b) expression of the suppression DNA construct results in down regulation or reduced expression of YABBY5 or MYB12 resulting in increased production of secondary metabolites in the transformed host cell.

[0182] A method of selecting for (or identifying) decreased secondary metabolite production in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct as described herein; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) selecting (or identifying) the progeny plant with decreased secondary metabolite production compared to a control plant not comprising the recombinant DNA construct.

[0183] A method of selecting for (or identifying) increased secondary metabolite production in a plant, comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a suppression DNA construct as described herein; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (c) selecting (or identifying) the progeny plant with increased secondary metabolite production compared to a control plant not comprising the suppression DNA construct. [0184] The use of a recombinant DNA construct as described herein for producing a plant that exhibits decreased secondary metabolite production when compared to a control plant not comprising said recombinant DNA construct.

[0185] The use of a suppression DNA construct as described herein for producing a plant that exhibits increased secondary metabolite production when compared to a control plant not comprising said suppression DNA construct.

[0186] The introduction of recombinant DNA constructs or suppression DNA constructs of the present invnetion into plants may be carried out by any suitable technique, including but not limited to direct DNA uptake, chemical treatment, electroporation, microinjection, cell fusion, infection, vector-mediated DNA transfer, bombardment, or Agrobacterium-mediated transformation. Techniques for plant transformation and regeneration have been described in International Patent Publication WO 2009/006276 and are also described herein.

[0187] In a third aspect, the present invention provides an efficient SAAT method for basil (Ocimum basilicum) using embryos as explants. Sonication and vacuum infiltration of embryos significantly increased the transformation efficiency. This development of an effective method to produce transgenic basil allows metabolic engineering to increase yield or to use basil as a platform for production of novel or altered chemicals. In addition, this development of a method to produce transgenic Basil facilitates the development of basil as a model plant to study secondary metabolism.

[0188] In one embodiment, the transformation method comprises the use of a reliable regeneration method for basil. In one embodiment, the regeneration method utilizes the embryo explant as described herein. The embryo explant is dissected from mature imbibed seeds and cultured on shoot induction medium. In one embodiment, the shoot induction medium comprises MS salts, B5 vitamins, sucrose, 6-benzylaminopurine (BA), indole-3-butyric acid (IBA). In one embodiment, the shoot induction medium comprises about 20 mg/1 to about 40 mg l sucrose, preferably about 30 mg/1 sucrose. In a further embodiment, the shoot induction medium comprises about 0.2 mg/1 to about 2 mg/1 BA, preferably about 0.4 mg/1 to about 1 mg/1 BA, more preferably about 0.4 mg/1 BA. In an additional embodiment, the shoot induction medium comprises about 0.1 mg/1 to about 2 mg/1 IBA, preferably about 0.3 mg/1 to about 1 mg/1 IBA, most preferably 0.4 mg/1 EBA. After about 2 weeks, shoot primordia are seen emerging from the calli. These shoots are sub cultured on fresh shoot induction medium.

[0189] Once the shoots have grown, i.e., shoots have been induced from callus, the shoots are cultured on a shoot elongation medium. In one embodiment, the shoot elongation medium comprises MS salts, B5 vitamins, sucrose, 6-benzylaminopurine (BA) and indole-3 -acetic acid (IAA). In another embodiment, the shoot elongation medium comprises about 20 mg/1 to about 40 mg/1 sucrose, preferably about 30 mg/1 sucrose. In a further embodiment, the shoot elongation medium comprises about 1 mg/1 to about 5 mg/1 BA, preferably about 2 mg/1 to about 4 mg/1 BA, more preferably about 3 mg/1 BA. In an additional embodiment, the shoot elongation medium comprises about 0.1 mg/1 to about 2 mg/1 IAA, preferably about 0.3 mg/ to about 1 mg/1 IAA, more preferably 0.5 mg/1 IAA. In one embodiment, the shoots are cultured on the shoot elongation medium for about 1 week to about 5 weeks, preferably about 2 weeks to about 4 weeks, more preferably about 2 weeks to about 3 weeks.

[0190] The elongated shoots are then cultured on a basal medium for about 2-3 weeks to develop plantlets with roots. In one embodiment, the basal medium comprises MS salts, B5 vitamins and sucrose with no plant hormones. In another embodiment, the basal medium comprises about 20 mg/1 to about 40 mg/1 sucrose, preferably about 30 mg/1 sucrose. Plantlets with well-developed roots are transferred to soil and grown under greenhouse conditions.

[0191] In one embodiment, the transformation method comprises preculturing the embryo explants, immersing the precultured embryo explants in a suspension of Agrobacterium tumefaciens, sonicating the resulting suspension, immersing the sonicated embryo explants in fresh suspension of A. tumefaciens, vacuum infiltrating the A. tumefaciens into the sonicated embryo explants, allowing infection of the sonicated embryo explants by the A. tumefaciens to continue, culturing the infected embryo explants, washing the infected embryo explants, culturing the washed, infected embryo explants to induce shoot formation, culturing transformed shoots to induce shoot elongation, and culturing elongated shoots to induce root formation.

[0192] In one embodiment, the embryo explant described herein is cultured on the shoot induction medium described herein which also contains acetosyringone for about 1 day to about 3 days, preferably about 1 day to about 2 days, more preferably 1 day. In one embodiment, the amount of acetosyringone is about 20 μΜ to about 250 M acetosyringone, preferably about 50 μΜ to about 150 μΜ acetosyringone, more preferably about 100 μΜ acetosyringone.

[0193] tumefaciens containing one or more DNA cassettes each comprising one or more desired nucleic acids are grown using conventional techniques and/or as described herein. Any suitable strain of A. tumefaciens may be used and virulence inducers may be used when necessary as is well known to the skilled artisan. Examples of suitable strains of A. tumefaciens include, but are not limited to AGL-1, AGL-2, EHA-105 and others well known to the skilled artisan. In one embodiment, a suitable A. tumefaciens stains is grown on plates containing antibiotics, such as rifampicin, kanamycin and the like, to obtain single colonies. A single colony is then inoculated into culture medium and grown, preferably overnight. In one embodiment, the culture medium is any medium that supports growth of A. tumefaciens. Examples of a suitable culture medium includes, but is not limited to LB medium, YEB medium and others well known to the skilled artisan. A portion of this culture was added to fresh culture medium containing, if necessary, acetosyringone, and grown to a suitable density, such as an OD of 0.8. Γη one embodiment, acetosyringone is present in the medium. In another embodiment, the amount of acetosyringone is about 20 μΜ to about 250 μΜ acetosyringone, preferably about 50 μΜ to about 150 μΜ acetosyringone, more preferably about 100 μΜ acetosyringone. The A. tumefaciens culture was centrifuged to obtain the bacterial cells which are resuspended in conventional medium. In one embodiment, the conventional medium is as LB medium containing acetosyringone. In another embodiment, the conventional medium is YEB medium containing acetosyringone. In a further embodiment, the conventional medium is one well known to the skilled artisan, also containing acetosyringone.

[0194] In one embodiment, the precultured embryo explants are removed from the shoot induction medium and immersed in the A. tumefaciens culture. The immersed precultured embryo explants and tumefaciens culture are then sonicated for about 30 seconds to about 120 seconds, preferably about 60 seconds to about 120 seconds, more preferably about 90 seconds to about 120 seconds, most preferably about 120 seconds. In one embodiment, the sonication was performed using, for examples, a Diagenode-Biorupter sonicator with an AC input of about 240 V. Following sonication, the sonicated embryo explants are immersed in fresh A. tumefaciens culture and subjected to vacuum infiltration, for about 1 minute to about 5 minutes, preferably about 1.5 minutes to about 4.5 minutes, more preferably about 2 minutes to about 4 minutes, still more preferably about 2.5 minutes to about 3.5 minutes and most preferably about 3 minutes. The embryo explants remain in the A. tumefaciens culture for a period of time to ensure suitable infection of the explant material. In one embodiment, this period of infection is about 10 minutes to about 50 minutes, preferably about 15 minutes to about 45 minutes, more preferably about 20 minutes to about 40 minutes, still more preferably about 25 minutes to about 35 minutes and most preferably about 30 minutes.

[0195] After this infection period, the infected embryo explants are placed on the shoot induction medium described herein for several days. In one embodiment, the infected embryo explants are placed on the shoot induction medium for about 1 day to about 5 days, preferably about 2 days to 4 days, and more preferably for about 3 days. The infected embryo explants are then washed with water, preferably sterile distilled water, containing cefatoxime. In one embodiment, the water comprises about 100 mg 1 to about 400 mg/1, preferably about 150 mg/1 cefatoxime. Alternatively, another A. tumefaciens eradicant can be used in place of cefatoxime for washing. The washed infected embryo explants are cultured on the shoot induction medium containing cefatoxime or another A. tumefaciens eradicant for several weeks in the dark to induce shoot formation. In one embodiment, the infected embryo explants are cultured on the shoot induction medium containing cefatoxime or another A. tumefaciens eradicant for about 2 weeks to about 6 weeks, preferably about 3 weeks to about 5 weeks, more preferably about 3 weeks to about 4 weeks. In one embodiment, the shoot induction medium comprises about 100 mg/1 to about 400 mg/1, preferably about 150 mg/1 cefatoxime. Alternatively, another A. tumefaciens eradicant can be used in place of cefatoxime.

[0196] Transformed shoots are selected and transferred to elongation medium containing cefatoxime or other A. tumefaciens eradicant and cultured in the light for several weeks. In one embodiment, the A. tumefaciens contains a DNA cassette comprising a marker and the transformed shoots are selected on the basis of this marker. In another embodiment, the marker is a visual marker, such as green fluorescence or other known visual marker. In one embodiment, the shoot elongation medium is as described herein and further contains an A. tumefaciens eradicant. In one embodiment, the A. tumefaciens eradicant is cefatoxime. Other conventional A. tumefaciens eradicant well known to the skilled artisan can also be used. In another embodiment, the shoot elongation medium comprises about 100 mg/1 to about 400 mg/1, preferably about 150 mg 1 cefatoxime. Alternatively, another .4. tumefaciens eradicant can be used in place of cefatoxime. In one embodiment, the transformed shoots are cultured on the elongation medium containing cefatoxime or another A. tumefaciens eradicant for about 1 week to about 5 weeks, preferably about 2 weeks to about 4 weeks, more preferably about 2 weeks to about 3 weeks.

[0197] The elongated shoots are then hardened on a basal medium and allowed to root to produce plantlets with roots. In one embodiment, the basal medium is as described herein. Plantlets with well-developed roots are transferred to soil and grown. The transgenic plants are then analyzed to identify the plants having the desired nucleic acid(s).

[0198] The practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture and transgenic biology, which are within the skill of the art. See, e.g., Maniatis et al, 1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook et al, 1989, Molecular Cloning, 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook and Russell, 2001, Molecular Cloning, 3rd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Ausubel et al, 1992), Current Protocols in Molecular Biology (John Wiley & Sons, including periodic updates); Glover, 1985, DNA Cloning (JUL Press, Oxford); Russell, 1984, Molecular biology of plants: a laboratory course manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992); Guthrie and Fink, Guide to Yeast Genetics and Molecular Biology (Academic Press, New York, 1991); Harlow and Lane, 1988, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Riott, Essential Immunology, 6th Edition, Blackwell Scientific Publications, Oxford, 1988; Fire et al., RNA Interference Technology: From Basic Science to Drug Development, Cambridge University Press, Cambridge, 2005; Schepers, RNA Interference in Practice, Wiley- VCH, 2005; Engelke, RNA Interference (RNAi): The Nuts & Bolts of siRNA Technology, DNA Press, 2003; Gott, RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology), Human Press, Totowa, NJ, 2004; Sohail, Gene Silencing by RNA Interference: Technology and Application, CRC, 2004.

EXAMPLES

[0199] TTie present invention is described by reference to the following Examples, which are offered by way of illustration and are not intended to limit the invention in any manner. Standard techniques well known in the art or the techniques specifically described below were utilized. EXAMPLE 1

Materials and Methods for Examples 2-7

[0200] Plant Material and transformation: Commercial spearmint variety and sweet basil (O. basilicum) were tested for their secondary metabolites by GC-MS and grown in green house under natural light conditions.

[0201] Agrobacterium mediated transformation of spearmint was performed according to previously published protocol (Niu et al., 1998, 2000). Agrobacterium mediated transformation of sweet basil was performed by the following procedure. O. basilicum seeds were sterilized by washing in 40% Clorox for 3 mins followed by several rinses with sterile water. The sterile seed were imbibed overnight and kept at 4°C. The following day the seeds were dissected under a dissection microscope to harvest the mature embryos. The dissected embryos were precultured in dark for one day in cocultivation medium (CC). Agrobacterium EHA105 strain was used for transformation. Green fluorescence protein gene (eGFP) along with Kanamycin was used as a selection marker. The precultured embryos were immersed in agrobacterium culture and sonicated for 15 s, four times. After sonication, the embryos were immersed in fresh Agrobacterium solution and vacuum infiltrated for 3 mins. After infection for 30 mins, the embryos were placed in CC medium (CC:-MS salts + my inositol lOOmg/1 Sucrose (30 g/1) + BA (0.4 mg 1) +Π3Α (0.4 mg/1) + Cefatoxime (150 mg 1) for 3 days. After 3 days, the embryos were washed multiple times with sterile distilled water containing cefotoxime (150 mg/1). The washed embryos were kept in CC media for 3-4 weeks in dark for shoot induction. After 3-4 weeks GFP positive shoots were selected and transferred to light. The well grown shoots were transferred to elongation media (EM: MS salts + Sucrose (30 g/1) + BA (3 mg/1) +IAA (0.5 mg/1) + Cefatoxime (150 mg/1) for 2-3 weeks. The shoots were hardened on basal media and allowed to root. Plantlets with well-developed roots were transferred to soil and grown under greenhouse conditions before further analysis. Tobacco transformation was done as previously described by Gallois and Marinho 1995.

[0202] Primers: Primers used in the methods of Example 1 are set forth in Table 1

TABLE 1

Primers

Name Sequence (5' to 3') (SEQ ID NO:) purpose

YAB5OSP1 CACACCTAACTGTCACTACAT (11) RACE of 5' end ofyab5

YAB5OSP2 TCCGATGGAGCGTAGCTAAGAC (12) RACE of 5 ' end ofyab5 YAB3OSP1 TCATGCTGGAGAGCAAGAACCAAG (13) RACE of 3' end ofyab5 qyabFl GTGACAGTTAGGTGTGGGCA (14) qPCR ofyab5

qyabR2 CCATTTGGAAGAGGAGCCGA (15) qPCR ofyab5

YAB-GW-5GSP1 CAAGGAATGTAACACAGCTGCTCAGCC (16) GW of yab5

YAB-GW-5GSP2 GCCCACACCTAACTGTCACTACATCAA (17) GW of yab5

yabOE-F CACCATGGATATGGCTGAGCAGC( 18) over expression of yab5 in plant yabOE-R TTTGTTCAGAACGGCTGCCCTT (19) over expression of yab5 in plant

YAB(30)Pv ATCAAACAAGCTGCTGCATG (20) yab5 deletion

YAB(110)R GGGACGATTGATGATTCTCT (21) yab5 deletion

YAB(31)F CACCGTAGTGACAGTTAGGTGTGGGC (22) yab5 deletion

YAB(111)F CACCCCTGAGAAGCGGCAGCGTGT (23) yab5 deletion

yab5-SphI CGCATGCACGCCTCCTCCTTCCAAGAT (24) silencing of yab5

yab5-BamHI CGGATCCAACGGCTGCCCTTCTCATTT(25) silencing of yab5

yab5-XbaI CTCTAGAACGCCTCCTCCTTCCAAGAT (26) silencing of yab5

yab5-XhoI GCTCGAGAACGGCTGCCCTTCTCATTT (27) silencing of yab5

YAB5-BamHI2 CGGATCCCATGGATATGGCTGAGCAGC (28) Over expression of yab5 in

E.coli

YAB5-XhoI2 ACTCGAGTTTGTTCAGAACGGCTGCCCTT (29) Over expression of yab5 in

E.coli

Y2_clF ACAGCACACTCGAAGACATA (30) qPCR ofY2

Y2_clR AACCTAATCTTAATGAGGGG (31) qPCR of Y2

Y3_c0F TTGCTTGTTTGTTGCTATCC (32) qPCR of Y3

Y3_c0R GCTTGACACTGAACAACCCA (33) qPCRofY3

Y6_clF CACATCTTCCTCGTATTCATT (34) qPCR of Y6

Y6_clR CAAAATAAGTGGCATCAAATC (35) qPCR ofY6

Y2-OE-F CACCATGGATGCCTCTGAGCAAAT (36) over expression of Y2 in plant

Y2-OE-R TTTGTTTCGTACAGTCGCCCTTC (37) over expression of Y2 in plant

Y3-OE-F CACCATGTCAATGGAATTGACGGCAG (38) over expression of Y3 in plant

Y3-OE-R AAAACCAAGAGATTTTTGAGCGG (39) over expression of Y3 in plant

Y6-OE-F CACCATGTCAGTTGATATGACTTTGG (40) over expression of Y6 in plant

Y6-OE-R GCTTGTTTTGTTGAGTCCAAA (41) over expression of Y6 in plant

Y2-BamHI CGGATCCCATGGATGCCTCTGAGCAAAT (42) over expression of Y2 in E.coli

Y2-XhoI ACTCGAGTTTGTTTCGTACAGTCGCCCTTC (43) over expression of Y2 in E.coli Y3-BamHI CGGATCCCATGTCAATGGAATTGACGGCAG (44) over expression of Y3 in E.coli

Y3-XhoI ACTCGAGAAAACCAAGAGATTTTTGAGCGG (45) over expression of Y3 in E.coli

Y6-BamHI CGGATCCCATGTCAGTTGATATGACTTTGG (46) over expression of Y6 in E.coli

Y6-NotI AGCGGCCGCGCTTGTTTTGTTGAGTCCAAA (47) over expression of Y6 in E.coli qATPtranl-F CTCTTTGGGCTAGGTGCGAA (48) qPCR of ATP transporter qATPtranl-R TTCAAGGAGATGGCCCAACC (49) qPCR of ATP transporter

Restriction enzyme sites in primers are underlined. CACC overhang for cloning to donor vector is bolded.

[0203] RNA extraction, quantitative PCR, and RACE: Total R A was extracted from different tissues (PGT, leaf-PGT, leaf and root) of spearmint using an RNeasy^® Plus Mini kit from Qiagen. Reverse transcription reaction and quantitative RT-PCR (qRT-PCR) were carried out as described previously (Jin et al., 2014). The housekeeping gene efl, previously reported to express equally among tissues (Nicot et al., 2005) was used as control. Expression level of target gene was represented as mean ± SD.

[0204] Approximate 1 g RNA was employed to synthesize first strand cDNA. The ORF of YABBYs was amplified using a SMARTer™ RACE cDNA amplification kit.

[0205] In Situ Hybridization: In situ hybridization assay was performed according to the method described by Javelle et al. 2011 with some minor modifications. Briefly, samples were fixed in 4% paraformaldehyde (PFA) fixative and subjected to vacuum for 30 min on ice. After that, the vials were kept at 4°C overnight. On the next day, samples were dehydrated with ethanol series, and embedded in Paraplast (McCormick Scientific) until use. The blocks were sectioned at lOum and mounted on Probe-on Plus slides (Fisher Scientific). For probe synthesis, the yabbyS gene was inserted into a pGEM®-T vector (Promega). Sense and antisense probes were synthesized by T7 and SP6 RNA polymerase (Roche), respectively.

[0206] Genomic DNA Walking: Genomic DNA was isolated from young leaves of spearmint using CTAB method. The flanking sequences of MsYABBY5 gene were amplified using a GenomeWalker™ Universal kit.

[0207] Plasmid construction: For sequencing of ORF, full length and flanking region of yabby genes, purified fragments were ligated with pGEM^®-T vector. The resulting product was transformed into Escherichia coli XLl-Blue. To over express or silence MsYABBY5, sequences were amplified with Phusion^® High-Fidelity DNA Polymerase (NEB). The purified fragments were inserted into a gateway donor vector pENTR™/D-TOPO (Invitrogen). Then, the recombinant plasmids were introduced into destination vectors pK2WG2D for over expression in spearmint and sweet basil) via LR recombination. For MSYABBY5 RNAi, four primers with restriction enzymes located at flanking region were used to amplify the fragment showing low similarity to other YABBY genes. The purified PCR product was cloned into the donor vector and subsequently introduced into pK2WG2D via LR recombination. The MsYABBY5 gene was driven by 35S promoter in both overexpression and RNAi plants.

[0208] For subcellular localization of YABBY proteins, YABBY ORFs were amplified and inserted into the pENTR™/D-TOPO^®. The donor vectors harboring ORFs or partial fragments of yabby family genes were introduced into pBADC/YFP vector via LR recombination. For testing expression pattern of MsYABBY5 promoter, the 5'UTR sequence was amplified and inserted into pENTR™D-TOPO^®. Subsequently, the plasmid was transformed into pBGWSF7 via LR recombination. All destination plasmids harbouring target genes were transformed into A. tumefaciens EHA105 by heat shock. The recombinant A. tumefaciens EHA strains are used for plant transformation.

[0209] Southern Blotting: A total of 15 μg genomic DNA was digested with EcoRI at 37°C overnight. The next day, digestion product was electrophoresed on a 1.2% (w/v) agarose gel at 50 V for 4 h. After that, the gel was transferred to a nylon membrane and hybridized by the 35S promoter probe using a DIG DNA labelling and detection kit (Roche).

[0210] Immunogold Labelling: Leaf samples from spearmint were fixed for 3 hours in 4% paraformaldehyde/0.5% glutaraldehyde in 0.1 M phosphate buffer (pH 7.2), and rinsed in 0.1M phosphate buffer (pH 7.2) for three times followed by dehydration in ethanol. After that, the samples were infiltrated with and embedded in LR White. Ultrathin sections around 90 nm were prepared with Leica Ultracut UCT microtome equipped with diamond knives, and collected on uncoated, 300-mesh nickel grids. The procedure of labelling and washing was performed according to the protocol described by Skepper and Powell 2008 with some minor modifications. Briefly, sections were incubated for 4 h on drops of anti-mint YAB5 antibody (produced in rabbit) with 1:100 dilutions in PBSG buffer (1% (w/v) gelatin in PBS buffer). After that, sections were rinsed on drops of TBST (50 niM Tris, 150 mM NaCl, 0.05% Tween 20) for ten times, 2 min for each time. Then, sections were incubated for 1 h on drops of goat anti-rabbit antibody conjugated with 10 nm gold particles with 1:100 dilutions in PBSG buffer (1% (w/v) gelatin in PBS buffer). The sections were further rinsed in TBST buffer for ten times, 2 min each time, and in ddH20 for 30 s. Subsequently, samples were counter- stained by applying the grid on drops of uranyl acetate and lead citrate. Finally, sections were extensively rinsed in ddH₂0 and viewed at 120 kV with a transmission electron microscope (JEOL JEM-1230).

[0211] Subcellular Localization: To investigate subcellular localization pattern of YABBY proteins, the recombinant A. tumefaciens EHA strains were grown in LB medium at 28°C overnight. After centrifugation at 4000xg, 4°C for 15 min, cell pellets were collected and suspended in MMA solution (10 mM MES, 10 mM MgCl₂, 100 μΜ acetosyringone) to OD₆oo=l. The solution was injected into Nicotiana benthamiana. After that, plants were kept at 28°C for 2 d. Leaf samples were collected and viewed with an upright confocal microscope (Zeiss LSM 5 Exciter). [0212] GC-MS Analysis: Terpene and phenylpropanoid production in leaves was determined using a GC-MS method described previously (Jin et al., 2014). Camphor was used as a standard. Results were presented as mean ± SD. Student's t test was used for statistical analysis.

EXAMPLE 2

MsYABBY5 Shows High Expression in Spearmint PGTs

[0213] Mint leaves have several PGTs on both surfaces (Fig. 1). A total of six YABBY like transcripts were identified from the RNA seq data of leaves, out of which only one MsYABBY5 was preferentially expressed in PGTs, the others were more enriched in leaf tissue. Full length ORFs of four most expressed YABBYs including MsYABBYS were amplified from leaf cDNA and PGT cDNA respectively using RACE. All the four cloned ORFs had the conserved C₂C₂ zinc finger domain located at N-terminus and a helix-loop-helix YABBY domain at the C terminus, which are highly conserved among YABBY proteins (Fig. 2). The differential expression pattern of these genes as observed by RNA seq was further validated by quantitative RT-PCR (qRT-PCR) (Fig. 3A). Since we were aiming for TFs involved in regulation of secondary metabolism in mint, we focussed on MsYABBYS. In-situ hybridization also confirmed the PGT specific RNA expression of MsYABBYS, as no signal was observed in the leaf tissue (Fig. 3B, panels a and b). The full length open reading frame of Ms YABBYS was of 573 base pairs encoding a polypeptide of 190 amino acids. BLAST analysis showed that MsYABBYS has greatest sequence similarity to Antirrhinum PROLONGATA YABBY like transcription factor. We generated a phylogenetic tree based on amino acids sequences of YABBY proteins from different plants. The results revealed that MsYABBYS and MsYABBY6, belonged to the YABBY5 subfamily, and the other two MsYABBY2 and MsYABBY4 are members of the YABBY2 subfamily (Fig. 4).

EXAMPLE 3

Subcellular Localization of MsYABBY5 Protein and Immunogold Staining

[0214] To examine the subcellular localization patterns of YABBY proteins, all the four Ms YABBYs were fused with green fluorescent protein (GFP) and agroinfilterated in tobacco. All the Ms YABBYs except MsYABBY5 showed exclusively nuclear localization (Figs. 5B-D). Interestingly, MsYABBY5 showed both nuclear and cytoplasmic localization (Fig. 5A). To understand the organelles MsYABBY5 localized to, we employed golgi and endoplasmic reticulum (ER) markers to examine the localization pattern. The results of co-localization showed that MsYABBY5 localized to both golgi and ER (Figs. 6 A and 6B). Online software prediction programs indicated that MsYABBY5 contained a potential transmembrane (TM) domain (http colon slash slash dgpred dot cbr dot su dot se/index.php?p=fullscan) at the amino terminal and participated in secretory pathway (http colon slash slash www dot cbs dot dtu dot dk/services/TargetP-l.l/output.php) (Fig.s 7A and 7B). To further assess this localization pattern, tobacco leaves were treated with Brefeldin A (BFA). BFA treatment in tobacco results in the complete disappearance of golgi apparatus and disrupts the secretory system (Ritzenthaler et al., 2002; Saint- Jore et al., 2002; Robinson and Ritzenthaler, 2006). After being treated with 50 μg/ml BFA for 3 h, MsYABBY5 was found to exhibit nuclear localization only , while both nuclear and cytosolic distribution was still observed in the control plants (treated with 1:1000 dilution of DMSO in dd¾0) (Figs. 8A-8D).

[0215] To directly observe the distribution pattern of YABBY5 protein, immunogold labelling of native MsYABBY5was carried out in PGT of spearmint. The antibody was synthesized according to a peptide consisting of fourteen amino acids that is located on surface of the predicted three dimensional structure. Subsequently, specificity binding capacity of the antibody was examined by western blotting. The results showed that the antibody exclusively bound to MsYABBY5, due to low similarity of the peptide used for antibody synthesis against MsYABBY2, 4 and 6 (Figs. 9A-9C). The MsYABBY5 proteins conjugated with gold particles were observed to accumulate inside the nucleus and also found in cytoplasm The cell organelles were not clearly distinguishable in the TEM sections hence the localization to cell organelles could not be verified by immunostaining (Figs. lOA-lOC).

EXAMPLE 4

Analysis of the Promoter Region of MsYABBY5

[0216] An 1116 bp, located at 5' UTR region of MSYABBY5 was cloned by genome walking. Bioinformatics analysis of this region revealed the presence of many cis acting regulatory elements apart from the common TATA and CAAT box (http colon slash slash bioinformatics dot psb dot ugent dot be/webtools/plantcare/html/) (Fig. 11 A). Four light-responsive motifs were found in the promoter sequence- two Box4, one TCT and one Spl motif. Regulation of terpene biosynthesis by light is known in many plants (Cordoba et al., 2009). With respect to hormones, two cz^'s-acting elements CGTCA-motif and TGACG-motif, involved in the MeJA- responsiveness were found and one for gibberellin cis elements, TATC box, were found within the sequence (Rouster et al., 1997; Zhou et al., 2012; Zhu et al., 2014). Further, tissue specific expression pattern of the cloned promoter was analysed. The 1116 bp fragment was fused with β-glucuronidase (GUS) reporter gene and transformed into Nicotiana benthamiana plants. The transgenic plants showed trichome specific expression pattern in leaves and stems of tobacco plants (Figs. 1 IB and 11C). No staining was observed in flowers or roots. Hence this promoter is potentially a glandular trichome specific promoter. Additionally, this promoter was used to drive MsYABBYS cDNA fused to cyan fluorescent protein (CFP) reporter gene in N. benthamiana plants. The fluorescence was observed exclusively in trichome head cells but subcellular localization was difficult to decipher (Figs. 12A-12C).

EXAMPLE 5

Silencing of MsYABBY5 Increases Terpene Production in Spearmint

[0217] To understand the function of MsYABBY5 in spearmint PGTs, an RNAi construct targeting a specific region of MsYABBYS was generated and transformed into wild- type spearmint via Agrobacterium tumefaciens mediated T-DNA transfer. Many transgenic lines were generated out of which four independent transgenic lines confirmed by southern for transgene integration were selected for further characterization (Figs. 13A-13C). All these RNAi plants showed transcript reduction of MSYABBY5, especially line RNAi7 which contained multiple T-DNA insertion by qRT-PCR (Fig. 14A). No significant changes were observed in the expression of other leaf specific YABBY genes (MsYABBY2, 4 and 6) suggesting that the RNAi construct was specific and does not target other YABBY genes (Figs. 149B-14D). The RNAi transgenic plants appeared phenotypically similar to wild-type plants. Scanning electron microscopy was performed on these plants to take a closer look at leaf cells and PGTs. No phenotypic changes were observed.

[0218] Next, gas chromatography-mass spectrometry (GC-MS) analysis was performed on these transgenic to evaluate the quality and quantity of the volatiles produced. Young wild- type spearmint leaves has abundance of both limonene and carvone monoterpenes (Fig. 15 A). Limonene is the first committed step towards carvone production. Limonene gets converted to carvone by a two-step reaction. In our growing conditions we observe that in wild -type spearmint, the production of limonene and carvone are about 1.47±0.11 and 2.10±0.25 μg/mg fresh leaf, respectively. All the four transgenic lines showed significant increase in carvone production than the wild type, ranging from 37%-41%. Limonene production was also enhanced in these lines (Figs. 15B and 15C). No difference was observed in the quality of essential oil produced. The RNAi lines were tested for the relative expression levels of enzymes involved in carvone production by q-RT-PCR but no major changes were observed (limonene synthase, limonene 6-monooxygenase and carveol dehydrogenase). Key enzymes of the terpene precursor pathways (DXR, DXS, GPPS small and big subunits) were also tested but no significant changes were found. These results suggest that increase in monoterpene production is probably not due to the transcriptional activation of biosynthetic genes. MsYABBYS might be acting quite upstream to regulate the flux into the terpene pathway.

EXAMPLE 6

Overexpression of Ms YABBY5 Results in Decrease in Terpene Production

[0219] To gain further insight into MsYABBYS role in secondary metabolism, this gene was overexpressed in spearmint under the control of CaMV 35S promoter. Four independent lines confirmed by southern hybridization were selected for further characterization. The results of qRT-PCR showed high expression levels of MsYABBYS in all the transgenic plants (Fig. 16A). GC-MS analysis of young leaves showed a reduction in production of both limonene and carvone which ranged from 20-62% and 22-47%, respectively (Figs. 16B and 16C). The observed phenotype in RNAi and overexpression transgenic lines suggests that MsYABBYS might be a repressor of secondary metabolism in spearmint. Besides the effect on secondary metabolism, the ectopic expression of MsYABBYS also had an effect on leaf morphology. All the transgenic plants showed elongated and slightly curled leaves (Fig. 17A). The ratio of length to width of leaves from transgenic plants were significantly higher (.PO.05) than that of WT (Fig. 17B).

EXAMPLE 7

Ectopic Expression of MsYABBYS Causes a Decrease in Both Terpene and Phenylpropanoid Productions in Sweet Basil

[0220] Sweet Basil essential oil produced in PGTs consists of both terpenes and phenylpropanoids. The wild type GC-MS profile of our sweet basil variety is shown in Figs.

18A-18G. Spearmint PGTs secretory head is composed of eight cells whereas sweet basil PGTs secretory head is made up of four cells. These secretory cells produce the essential oil and secrete it into the subcuticular storage cavity in both these plants (Figs. 19A-19C). To explore the possibility if MsYABBYS can have an effect on secondary metabolites originating from different metabolic pathways in PGTs, we ectopically expressed MsYABBYS in sweet Basil.

Arabidopsis PRODUCTION OF ANTHOCYANIN PIGMENT (PAP1) MYB transcription factor is known as an activator of phenylpropanoid pathway (Borevitz et al., 2000; Mathews et al., 2003; Matousek et al., 2006; BenZvi et al., 2008; Li et al., 2010). Recently it was shown that ectopic expression of PAP1 in Rose plants, led to an increase in volatile compounds originating from both phenylpropanoid and terpenoid pathways in the flowers (BenZvi et al., 2012). This suggested that transcriptional regulators can govern fluxes in multiple metabolic pathways. Three independent Sweet basil transgenic lines confirmed by southern hybridization were selected for further characterization. The results of qRT-PCR showed high expression levels of MsYABBY5 in all the transgenic plants (Fig. 20) GC-MS analysis was performed on T-2 plants and results showed that production of both monoterpene (eucalyptol, β-ocimene and linalool) and sesquiterpene (a-bergamotene, γ-muurolene and copane) decreased, especially for β- ocimene which was hardly found in MsyabbyS over expression plants (Figs. 18A-F). Beside terpene production, phenylpropanoid production was also affected. Eugenol which is the dominant compound, with a production of 1.93±0.58 μg/mg fresh leaf showed a significant reduction (PO.05) in transgenic plants (Fig. 18G). As observed in spearmint, narrow leaves with curled edges were also observed in Msyabby5 over expression plants. Additionally the sweet basil transgenic lines also showed delayed flowering (about 2-3 weeks delay) when compared to wild type plants sown at the same time. (Figs. 14A and 14B) This phenotype cannot be analyzed in our spearmint variety as they are non- flowering sterile hybrids.

EXAMPLE 8

Discussion of Examples 1-7

[0221] Glandular trichomes are found on the aerial surface of approximately 30% of vascular plants. As they can synthesize and store a large amount of secondary metabolites they are aptly termed as plants 'tiny chemical factories". But very few studies have focussed on TFs that regulate glandular trichome specific metabolic pathways (Wang, 2014), which will greatly benefit metabolic engineering efforts to increase yield or develop plant platforms to produce high value compounds. In this study we isolated a YABBY gene that shows high expression in spearmint peltate glandular trichomes. Phylogenetic analysis showed that it belongs to YABBY5 subfamily of YABBY proteins. Manipulation of MsYABBY5 expression by means of suppression and overexpression greatly impacted the quantity of essential oil produced by spearmint plants. This is a novel function for YABBY family of transcription factors.

[0222] MsYABBY5 is likely a repressor of secondary metabolism: Studies in Arabidopsis have implicated YABBY gene family in promoting several aspects of leaf, shoot and flower development. (Alvarez and Smyth, 1999; Chen et al., 1999; Eshed et al., 1999, 2004; Sawa et al, 1999a, 1999b; Siegfried et al., 1999; Golz et al., 2004; Juarez et al., 2004; Goldshmidt et al., 2008; Stahle et al., 2009). yabby5 single mutants in Arabidopsis show no morphological defects but they significantly enhance yablyab3 double mutant phenotype (Sarojam et al., 2010 . PROLONGATA, from Antirihimun belonging to YABBY5 group also redundantly promote leaf growth and polarity (Golz et al., 2004). In rice, YABBY genes functions differ from their Arabidopsis homologs (Jang et al., 2004; Yamaguchi et al., 2004; Dai et al., 2007). Rice YAB1 gene is required for the feedback regulation of gibberellin (GA) biosynthesis (Dai et al., 2007). It was shown that rice YAB1 is involved in GA mediated repression of GA3ox2 gene which is required for the synthesis of GA. Interestingly GA is a primary metabolite derived from the terpene pathway in plant cells. In flowers, nectaries secrete a mixture of chemicals to attract pollinators. Transcriptome analysis of Arabidopsis nectaries revealed that YABBY5 showed preferential expression in nectaries which was unexpected since it was presumed that YABBY5 is expressed quite early in lateral organ primordia. The exact role of AtYABBY5 either in nectary development or in secretion remains unknown (Kram et al., 2009). We have shown that spearmint MsYABBYS is preferentially expressed in PGTs and plays a role in regulating essential oil formation. No affects was observed on the development of PGTs in transgenic lines. Overexpression of MsYABBY5 leads to a decrease in monoterpene production whereas RNAi induced suppression increases monoterpene production. This suggests that MsYABBY5 might be a negative regulator of secondary metabolism in PGTs. YABBY family of proteins control wide range of developmental processes but how it mediates these effects at molecular level largely remains unknown. YABBYs are known to physically interact with components of a transcriptional repressor complex that include LEUNIG (LUG), LEUNIG HOMOLOG (LUH), the LUG-associated coregulator SEUSS, and related SEUSS-LIKE proteins suggesting that YABBY proteins function as transcriptional repressors (Navarro et al., 2004; Stahle et al., 2009). A recent study revealed that YABBYs are bifunctional transcription factors acting as either repressors or activators (Bonaccorso et al., 2012). How MsYABBY5 regulates downstream target genes involved in terpene production in PGTs remains to be explored. Transcriptome analysis of MsYABBYS RNAi lines can provide us with list of genes that changes positively or negatively to MsYABBY5 suppression.

[0223] Changed level of monoterpenes in MsYABBYS transgenic lines are not caused by transcriptional activation of their respective biosynthetic genes: It is known that, in the Lamiaceae family, the secondary metabolites are synthesized almost exclusively in the peltate glands (Hallahan, 2000; Gang et al, 2001). Hence PGTs are specialized organs where the genetic machinery for production of secondary metabolites is specifically active. A systems biology based approach was taken to study the regulation of metabolic pathways in basil PGTs. Comparison of transcriptomic, proteomic, and metabolic profiling data from basil PGTs showed that the pathways involved in the production of metabolites can be regulated at transcriptional level, post-transcriptional level and post-translational level (Xie et al., 2008). MsYABBY5 RNAi lines showed increase in terpene (carvone) production. But this is not due to an increase in transcripts level of the structural genes involved in the pathway. Additionally no significant changes were observed in transcript level of enzymes that are known to be rate limiting steps in the precursor MEP and MVA pathways. The difference between metabolite and transcript levels can be attributed to either posttranscriptional modification, protein stability or enhanced flux in the terpene pathway. The fact that MsYABBY5 expression was able to affect phenylproponoid production in Sweet Basil plants indicates that this gene might be probably functioning upstream regulating flux into metabolic pathways. The MEP pathway and shikimate pathway leading to monoterpene and phenylproponiod precursor production are both localised in the plastids making a direct interactions between these pathways possible. Overexpression of PAP1 in Rosa hybrid simultaneously increased emission of phenylproponoid and terpenoids derived volatiles in flowers. Transcriptional activation of only few biosynthetic genes was observed the rest of the increase was attributed to enhanced flux in both pathways (Ben Zvi et al., 2012). Interactions between phenylpropaniod and terpenoid pathways has also been shown in tomato mutants (Enfissi et al., 2010), as well as in Impomoea flowers (Majetic et al., 2010) but the mechanism remains to be elucidated. We performed RNA seq of isolated PGTs, leaf devoid of PGT and leaf of sweet basil and found a transcript similar to MsYABBY5 enriched in sweet basil PGTs. They show 81.3% sequence similarity (unpublished data). Both mint and basil PGTs are non- photosynthetic organs actively engaged in secondary metabolism. Hence they would rely greatly on exogenous supply of carbon source for energy production. The main site of secondary metabolism in the PGTs is plastids, in contrast to chloroplast they need to import ATP and carbon to sustain their high metabolic activities. Additionally both terpene and phenylproponoid pathways rely on glycolysis and pentose phosphate pathway for supply of precursors and ATP. Further lot of transporters are also involved in moving the metabolite between cell organelles and finally into the secretory cavities. Any of these processes can be regulated by MsYABBY5 to control the production of secondary metabolites. [0224] Ectopic expression shows developmental defects: Ectopic expression of MsYABBY5 showed leaf developmental defects both in spearmint and Basil and additionally delayed flowering in Basil. Ectopic expression of Arabidopsis YABBY members are known to cause significant polarity defects in leaves and produce narrow curled leaves (Alvarez and Smyth, 1999; Bowman and Smyth, 1999; Chen et al., 1999; Eshed et al., 1999; Sawa et al., 1999a, b; Siegfried et al., 1999; Villanueva et al., 1999). Further, there are many primary metabolites that are derived from the terpene pathway affecting growth and development like chlorophyll, cytokinins, sterols, brassinosteroids, gibberellins (diterpene), abscisic acid (sesquiterpene). Monoterpenes and diterpene are produced from the MEP pathway in the plastids whereas triterpenes and sesquiterpenes are produced by the MVA pathway in the cytoplasm. Mint predominantly produces monoterpenes; the same pathway is used to produce diterpene gibberellin. Gibberellin deficient mutant do show developmental defects like lack of apical dominance, delayed flowering and sterility. The developmental phenotypes observed in the overexpression mint and Basil plants can also be due to perturbations in the primary terpene metabolite production especially gibberellin. No obvious effect on chlorophyll production was observed. The usage of PGT specific promoters to drive expression will mitigate these phenotypes associated with ectopic expression of the protein.

[0225] Cytoplasmic localization of MsYABBY5 protein: Subcellular localization of a transcription factors is usually expected to be inside the nucleus. In the case of MsYABBY5 localization was observed both in nucleus and cytoplasm of tobacco cells when it was expressed under 35S promoter. This localisation pattern in tobacco cells can be an artefact due to the usage of strong 35S promoter but all the other MsYABBYs tested under the same promoter showed nuclear localisation. Treatment with Befeldin which disrupts the membranes of golgi and ER restricted the localisation of MsYABBY5 to nucleus. MsYABBY5 sequence is predicted to possess a putative transmembrane domain. Immunostaining also revealed the presence of MsYABBY5 protein outside the nucleus. A more conclusive approach would be to follow in planta MsYABBY5 localisation by generating transgenic plants where the MsYABBYS cDNA tagged with fluorescent proteins are driven under the native promoter. Transient studies were performed in tobacco where MsYABBY5-CFP fusion was expressed under the 5' MsYABBY5 promoter. The localisation was observed in the head regions of tobacco tnchomes making subcellular localisation difficult to observe.

[0226] YABBY mutant studies in Arabidopsis and rice has revealed that YABBYs act non- cell autonomously to control meristem cell fate (Goldshmidt et al., 2008; Tanaka et al., 2012). But no movement of YAB1 protein or RNA has been observed suggesting that YAB1 communicates with the meristem via a secondary messenger or buy activating a signalling cascasde (Goldshmidt et al., 2008). There are several reports of transcription factors especially the ones involved in stress response that reside in the cytoplasm and respond to external signals and are rapidly moved into the nucleus. Some examples from the mammalian systems are STAT (signal transducer and activator of transcription), NF-κΒ (nuclear factor of immunoglobulin kappa B cells), NFAT (nuclear factor of activated T cells), and steroid receptors (Dauvois et al., 1993; Arenzana-Seisdedos et al., 1997; Beals et al., 1997; McBride et al., 2002). From plants, ER membrane-associated basic leucine zipper (bZIP) and NAC089 transcription factors which are responsible for mediating ER related plant immunity and abiotic stress responses show presence in cytoplasm (Liu et al., 2007, Che et al., 2010, Moreno et al, 2012, Yang et al., 2014). Plant secondary metabolism is also closely related to plants abiotic and biotic stress responses.

[0227] This is the first report of a transcription factor regulating monoterpene production in mint plants and assigns a new role for YABBY genes. Sweet basil (Ocimum Basilicum) is an aromatic herb similar to mint that produces essential oil in PGTs. Essential oil of sweet basil has compounds derived from both terpene and phenylproponoid pathways. Remarkably, expression of MsYABBYS in sweet basil affected metabolites originating from both terpenoid and phenylproponoid metabolic pathways. Like the MEP pathway, the precursor pathway for phenylpropanoid - the shikimate pathway is active in plastids; hence an interaction between these two pathways is possible (Herrmann and Weaver, 1999; Tzin and Galili, 2010).

EXAMPLE 9

Materials and Methods for Examples 10-15

[0228] Plant material and RNA isolation: Commercial spearmint variety and sweet basil (O. basilicum) were tested for their secondary metabolites by GC-MS and grown in green house under natural light conditions. Agrobacterium mediated transformation of spearmint was performed according to previously published protocol (Niu et al., 1998; Niu et al., 2000). Agrobacterium mediated transformation of sweet basil was performed by the following procedure. O. basilicum seeds were sterilized by washing in 40% Clorox for 3 mins followed by several rinses with sterile water. The sterile seed were imbibed overnight and kept at 4° C. The following day the seeds were dissected under a dissection microscope to harvest the mature embryos. The dissected embryos were precultured in dark for one day in cocultivation medium (CC). Agrobacterium EHA105 strain was used for transformation. Green fluorescence protein gene (eGFP) along with Kanamycin was used as a selection marker. The precultured embryos were immersed in agrobacterium culture and sonicated for 15 s, four times. After sonication, the embryos were immersed in fresh Agrobacterium solution and vacuum infiltrated for 3 mins. After infection for 30 mins, the embryos were placed in CC medium (CC:-MS salts + my inositol lOOmg/l Sucrose (30 g/1) + BA (0.4 mg 1) +BA (0.4 mg/1) + Cefatoxime (150 mg/1) for 3 days. After 3 days, the embryos were washed multiple times with sterile distilled water containing cefotoxime (150 mg/1). The washed embryos were kept in CC media for 3-4 weeks in dark for shoot induction. After 3-4 weeks GFP positive shoots were selected and transferred to light. The well grown shoots were transferred to elongation media (EM: MS salts + Sucrose (30 g/1) + BA (3 mg/1) +IAA (0.5 mg/1) + Cefatoxime (150 mg/1) for 2-3 weeks. The shoots were hardened on basal media and allowed to root. Plantlets with well-developed roots were transferred to soil and grown under greenhouse conditions before further analysis.

[0229] For PGT RNA isolation, initially, PGTs (Figs. 22A and 22B) were isolated from 2- 3cm leaves as described previously (Jin et al., 2014). Later, total RNA was extracted from PGT using the Spectrum Plant total RNA kit from Sigma according to manufacturer's protocol. Total RNA from other tissues (leaf-PGT, leaf and root) was extracted using an RNeasy^® Plus Mini kit from Qiagen. 500ng of RNA was reverse transcribed to cDNA using iScript™ cDNA Synthesis kit form Bio-Rad.

Primers: Primers used in the methods of Example 9 are set forth in Table 2

TABLE 2

Primers

Name Sequence (5' to 3') (SEQ ID NO:) purpose

Mybl2-OE-F CACCATGGGAAGAGCGCCGTGCT (50) over expression of mybl2 in plant

Mybl2-OE-R TGACAACAACCAAGAAAGCATTGCAC (51) over expression of mybl2 in plant

Mybl2_qPCR_F3 GGAAGAGCGCCGTGCTGTGAGAAAG (52) qPCR ofmybl2

Mybl2_qPCR_R3 CCTGCATTCTTGGGCAATGATCGCC (53) qPCR ofmybl2

Mybl2-Spbl CGCATGCGCACTTGCCGGGTAGAACAG (54) silencing of mybl2

Mybl2-HindIII CAAGCTTCCTCGTCGTCCCAAATCCAC (55) silencing of mybl2

Mybl2-Xbal CTCTAGAGCACTTGCCGGGTAGAACAG (56) silencing of mybl2

Mybl2-XhoI GCTCGAGCCTCGTCGTCCCAAATCCAC (57) silencing of mybl2

Restriction enzyme sites in primers are underlined. CACC overhang for cloning to donor vector is bolded. [0230] Gene amplification and plasmid construction: For sequencing of ORF, full length and flanking region of MYB12 gene, purified fragments were li gated with pGEM^®-T vector. The resulting product was transformed into Escherichia coli XL 1 -Blue. To over express or silence MsMYB12, sequences were amplified with Phusion^® High-Fidelity DNA Polymerase (NEB). The purified fragments were inserted into a gateway donor vector pENTR™/D-TOPO^® (Invitrogen). Then, the recombinant plasmids were introduced into destination vectors pK2WG2D for over expression in spearmint and sweet basil by LR recombination. For MsMYB12 RNAi, four primers with restriction enzymes located at flanking region were used to amplify the fragment showing low similarity to other MYB genes. The purified PCR product was cloned into the donor vector and subsequently introduced into pK2WG2D via LR recombination. The MsMYB12 gene was driven by 35S promoter in both overexpression and RNAi plants.

[0231] For subcellular localization of MYB12 protein, MYB ORF was amplified and inserted into the pENTR™/D-TOPO^®. The donor vector harbouring ORF was introduced into pBADC/YFP vector by LR recombination. All destination plasmids harbouring target gene were transformed into A. tumefaciens EHA105 by heat shock. The recombinant s, tumefaciens EFIA strains were used for plant transformation.

[0232] Selection of transgenic lines: Initially, visual screening using GFP filter was pursued. Later, DNA was isolated from GFP -positive plants and insertion of gene of interest was checked using PCR. DNA-positive lines were then subjected to Southern blot using DIG wash and Block Buffer Set from Roche. DNA probe against CaMV 35S promoter was generated using PCR DIG probe Synthesis kit from Roche. Concentration of probe was quantified by doing a Dot plot using DIG Nucleic Acid Detection kit from Roche as described previously (Javelle et al., 2011).

[0233] Quantitative real time PCR (qRT-PCR): Expression levels of TFs along various tissues (leaf, leaf stripped of PGTs, root and PGTs) were analysed using qRT-PCR. Approximately 500ng of RNA was reverse transcribed to cDNA using iScript™ cDNA Synthesis kit form Bio-Rad. The 20μ1 reactions were carried out according to manufacturer's protocol. . The qRT-PCR reactions were performed in 384- well PCR plate using ABI PRISM 900HT real-time PCR system and KAPA SYBR fast master mix (KAPA Biosystems). 0.3μ1 of cDNA was used for a total PCR reaction of 5μ1 and cycling profile was 50° C for 2 min, 95° C for 10 min, 40 cycles of 95° C for 15 s and 60° C for 60 s. After thermal cycles, the dissociation analysis (melting curve) was carried out to confirm specific amplification of PCR reaction by adding a profile of 95° C for 15 s, 60° C for 15 s and 95° C for 15 s. The threshold cycle (C_T) value of gene is the cycle number required for SYBR Green fluorescence signal to reach the threshold level during the exponential phase for detecting the amount of accumulated nucleic acid (Walker, 2002). In current study, elongation factor 1 {efl) was used as internal control, due to its stable expression in plant (Nicot et al., 2005) and it also showed similar expression levels in all the tissues in the transcriptome data of both spearmint and sweet basil. Comparative delta Cj values of target genes to efl were taken as relative expression among different tissues. The amount of target gene, normalized to efl gene, was calculated by 2^"(C _T ^target s^me-^c _T ^e Error bars represent mean ± SD which were calculate from three biological replicates each analysed in triplicates, including non-template control.

[0234] Subcellular localization of TFs: The full-length cDNAs of TFs without the stop codon were cloned into the gateway vector pENTR/D-TOPO (Invitrogen), and then subsequently transferred into the destination vector pBA-DC-YFP (Zhang et al., 2005) which contains the CaMV 35S promoter and C-terminal in frame YFP, to generate MsMYB12-YFP, ObMYB12-YFP, ObMYB43-YFP and ObMYB4-YFP, respectively. The constructs were then introduced into A. tumefaciens strain EHA105 by heat shock. 4', 6-diamidino-2-phenylindole (DAPI) was used as maker to stain nucleus. Overnight cultures of Agrobacterium grown at 28° C were harvested and resuspended to a final concentration of absorbance of 1.0 at 600 nm in a solution containing lO mM MgCl₂, lOmM MES pH 5.6 and ΙΟΟμΜ acetosyringone. After 3 hour incubation at room temperature, the Agrobacterium mixture was injected into N. benthamiana leaves using a needleless syringe. Infiltrated tobacco plants were placed in the growth chamber at 24° C for 2 days. On the day of confocal imaging, the plants were infiltrated with DAPI ^g/ml) and let to stand for 30 min. Later, fluorescence signals were detected by a confocal scanning laser microscopy (Carl Zeiss LSM 5 Exciter) with a standard filter set.

[0235] GC analysis: For sample preparation about 4-6 leaves of 2-3 cm were ground to a fine powder using liquid nitrogen and homogenised using 500 μΐ ethyl acetate. Camphor was added as an internal control. Samples were incubated for 10 min at room temperature with vigorous shaking followed by a centrifugation for 10 min at 13,000 rpm. The top organic layer was transferred to a new tube and dehydrated using anhydrous Na₂S0₄. The samples were analyzed using GCMS (Agilent Technologies 7890A with 5975C inert MSD with triple axis detector). 2 μΐ of samples were injected and separation was achieved with a temperature program of 50°C for 1 min and increased at a rate of 8°C/min to 300°C and held for 5 min, on a 30 m HP-5 MS column (Agilent Technologies). [0236] Statistical analysis: Data are indicated as "mean ± SD" of three biological replicates each performed in triplicates. Statistical significance between transgenic plants and WT was analysed using a two-tailed Student's t-test and indicated by asterisks. * indicates p < 0.05; ** indicates p < 0.01; *** indicates p < 0.001.

EXAMPLE 10

MsMYB12 Falls Under the Subgroup 7 of the Arabidopsis R2R3-MYBs

[0237] Full length open reading frame (ORF) of MsMYB12 was amplified from PGT cDNA using RACE, sequenced and the corresponding protein sequence was analyzed. The full length ORF of MsMYB12 was of 813 base pairs encoding a polypeptide of 271 amino acids. ORF had the conserved R2 and R3 repeats at the N-terminus which are the know signature MYB domains confirming it as a MYB protein (Feller et al., 2011). These repeats are known to form helix turn helix structures and binds to DNA. They also had five tryptophan residues which is conserved in all MYB proteins and known to be required for the stability of the structure (Fig. 23). A phylogenetic tree was constructed using the amino acid sequences of known Arabidopsis thaliana (At) R2R3-MYBs (Fig. 24). MsMYB12 formed a subgroup with AtMYBlll, AtMYBl l and AtMYB12 which were previously characterized to fall under subgroup 7 of various subgroups of Arabidopsis R2R3-MYBs (Dubos et al., 2010). The R2R3-MYBs in this subgroup are known to regulate flavonoid pathway by activating the biosynthetic enzymes (Stracke et al., 2007).

EXAMPLE 11

MsMYB12 Shows Preferential Expression in PGTs and Localizes to the Nucleus

[0238] Quantitative RT PCR (qRT-PCR) was performed to determine expression levels of the MsMYB12 in different tissues (Leaf (L), leaf stripped of PGT (L-T), root (R), PGT (T)). Results showed that MsMYB12 has a preferential expression in PGT when compared to other tissues (Fig. 25A). This correlates well with the transcriptome data. To examine subcellular localization of TF, the open reading frame of TF was fused with 5 '-terminus of yellow fluorescent protein (YFP) and expressed under the control of CaMV 35S promoter. The recombinant constructs were then introduced into Nicotiana benthamiana leaves by agro infiltration. As shown in Fig. 25B, the recombinant protein specifically localized to nucleus implying its role as a transcription factor. The localization region was confirmed to be nucleus by DAPI staining and merging the YFP and DAPI signals. EXAMPLE 12

Screening of Transgenic Spearmint and Sweet Basil Plants

[0239] Transgenic spearmint with overexpressed and RNAi mediated silenced MsMYB12 and transgenic sweet basil with ectopically overexpressed MsMYB12 were generated by Agrobacterium tumefaciens mediated T-DNA transfer of constructed vectors. These lines were initially screened visually using GFP as a visual marker and were further confirmed by PCR and Southern blot. Ndel makes a single cut within the T-DNA insertion and thus was used to cut the genomic DNA of transgenic plants to analyse the number of T-DNA insertions. cDNA probe against CaMV 35S promoter was synthesized and concentration was analyzed by dot plot. Different lines of transgenic sweet basil overexpressing MsMYB12 showed similar pattern. Assuming those lines to be clones only two lines (line 7 and line 10) which showed a different pattern and single insertion were selected (Fig. 26A). As shown in Fig. 26B, RNAi mediated silenced MsMYBl 2 transgenic spearmint plants showed multiple insertions ranging from one to four. Neglecting the line with four insertions and the lines showing similar pattern the rest (RNAi-6, RNAi- 12, RNAi- 18 and RNAi- 19) were selected for further characterization. Similarly, in transgenic spearmint plants overexpressing MsMYB12, lines (OX-4, OX-22, OX-38 and OX-40) showing single insertion were selected (Fig. 26C). The transgenic plants appeared phenotypically similar to wild-type plants. Scanning electron microscopy was performed on these plants to take a closer look at leaf cells and PGTs. No phenotypical changes were observed.

EXAMPLE 13

Expression Analysis of the Transgenes

[0240] qRT-PCR was performed to analyse the expression of MsMYB12 in transgenic spearmint and sweet basil. Transgenic spearmint plants with silenced MsMYB12 expression showed significant reduction in levels of MsMYB12 (Fig. 27A). Transgenic spearmint lines overexpressing MsMYB12 showed higher levels of MsMYBl 2 compared to wild type (WT) (Fig. 27B). Transgenic sweet basil lines showed ectopic expression of MsMYBl 2 (Fig. 27C). EXAMPLE 14

Secondary Metabolites Analysis of Transgenic Plants

[0241] Secondary metabolites profile of transgenic spearmint and sweet basil plants were analyzed and quantified by GC-MS, which revealed significant changes in the amount of metabolites.

[0242] MsMYB12-RNAi: Compared to WT, spearmint MsMYBl 2-RNAi lines accumulated secondary metabolites in large amounts. For example, the content of limonene was increased markedly by 3.87 fold (in RNAi-6), 2.02 fold (in RNAi-12), 3.80 fold (in RNAi-18) and 5.82 fold (in RNAi-19), respectively (Fig. 28A), whereas carvone was increased by 1.83 fold (in RNAi-6), 2.60 fold (in RNAi-12), 3.15 fold (in RNAi-18) and 3.29 fold (in RNAi-19), respectively (Fig. 28B). An overall maximum increase of ~350% of total secondary metabolites was observed in transgenic plants.

[0243] 35S::MsMYB12: In Ms K572-overexpresing spearmint plants, limonene was maximally reduced by 1.70 fold (in OX-4), 1.19 fold (in OX-22), 2.78 fold (in OX-38) and 1.46 fold (in OX-40), respectively (Fig. 28C), carvone was decreased by 1.29 fold (in OX-4), 1.40 fold (in OX-22), 1.48 fold (in OX-38) and 1.32 fold (in OX-40), respectively (Fig. 28D). An overall maximum reduction of -40% of total secondary metabolites was observed in transgenic plants.

[0244] Ectopic expression of MsMYBl 2 in sweet basil: Ectopic expression of MsMYBl 2 in sweet basil was pursued to explore the possibility if MsMYBl 2 can have multiple effects on secondary metabolites synthesized from different metabolic pathways. Ectopic expression of MsMYBl 2 lead to overall decrease of terpenes, both monoterpenes and sesquiterpenes (Figs. 29A, 29B and 29D). Additionally, phenylpropenes composition was also altered, amount of eugenol was decreased and amount of methyleugenol was increased (Fig. 29C). Changes in the ratio of eugenol to methyleugenol is highly variable in natural conditions as such suggesting that the observed changes in the ratio might not be due to the ectopic expression of MsMYBl 2. However, total amount of phenylpropenes was decreased in transgenics when compared to WT which might be due to ectopic expression of MsMYBl 2 (Fig. 29D). Overall ~50% reduction of secondary metabolites was observed in transgenic plants.

[0245] Changes in amount of terpenes in spearmint and both terpenes and phenylpropenes in sweet basil implies a probable role for MsMYBl 2 in several pathways of secondary metabolism. This kind of multiple effects in several pathways by a single TF has been observed earlier in Rose plants. Ectopic expression of Arabidopsis PRODUCTION OF ANTHOCYANIN PIGMENT (PAP1) MYB in Rose plants, led to an increase in volatile compounds originating from both phenylpropanoid and terpenoid pathways in the flowers (Ben et al., 2012).

EXAMPLE 15

Preliminary Observation of Insect Resistance in Transgenic Plants

[0246] Careful observation of transgenic plants revealed a high infestation of greenhouse whiteflies and their nymphs in MsMYBl 2-overexpressing plants when compared to WT. MsMYBll-KNAi plants had relatively less infestation (Fig. 30). Further analysis under natural conditions was pursued to investigate the effect of terpenes on whitefly infestation. Whitefly infestation was analysed by counting the number of whitefly eggs and nymphs in two lines each in overexpression and RNAi lines which were selected by the ones having lowest and highest limonene content respectively. This was done because limonene is known to be toxic to whitefly (Hollingsworth, 2005). As expected, whitefly infestation was increased in overexpression lines which had reduced levels of limonene and whitefly infestation was decreased in RNAi lines which had increased limonene content (Figs. 31A-31C).

EXAMPLE 16

Discussion of Examples 10-15

[0247] Extensive exploitation of aromatic plants for their commercially valued secondary metabolites calls for novel strategies for metabolic engineering and production of secondary metabolites. A complete understanding of the secondary metabolism pathway by unravelling the enzymes and transcription factors controlling the pathway is indispensable for the same. Also, knowledge about TFs which act as master regulators of glandular trichome specific secondary metabolism pathway will aid in better understanding the process and control mechanism of the pathway. In this study we isolated a R2R3-MYB gene, MsMYBll which shows a preferential expression in PGTs. Phylogenetic analysis showed that MsMYB12 is very similar to the know R2R3-MYBS of subgroup 7 of Arabidopsis R2R3-MYBs. These MYBs have been previously known to be acting as activators of flavonoid pathway. This questions the function of MsMYBl 2 in spearmint which is rich in terpenes and has very scarce amounts of flavonoids. Though the N-terminus of R2R3-MYBs are conserved, C-terminus amino acids are very diverse and unique to each plant suggesting a probable reason for changes in the functions of similar R2R3-MYBs in different plants. This also suggests a possibility of novel function for MsMYBl 2 in spearmint. Manipulation of MsMYBll expression by means of suppression and overexpression greatly impacted the quantity of essential oil produced by spearmint PGTs. Effect on both terpenes and phenylpropenes of sweet basil by ectopic expression of MsMYB12 suggests multiple roles for MsMYB12 in regulating secondary metabolism.

[0248] Spearmint is an edible crop which is extensively propagated in greenhouses and harvested to be sold in the markets. Though spearmint is a strong pest resistant plant, greenhouse whiteflies might end up being a major pest leading to weakening the plants and making it undesirable for consumption. Due to this pest's rapid reproductive rate, application of pesticides might not control its spreading. In this case, using our RNAi plants which has high resistance for the whiteflies might be a better solution for eliminating whitefly infestation. And also, these plants can be used as a platform to investigate the role of terpenes against whitefly infestation.

EXAMPLE 17

Materials and Methods for Example 18

[0249] Explant preparation: Ocimum basilicum seeds were sterilized by washing in 40% Clorox for 3 minutes followed by several rinses with sterile water. The sterile seed were imbibed overnight and kept at 4° C. The following day the seeds were dissected under a dissection microscope to harvest the mature embryos. For transformation, the dissected embryos were precultured in dark for one day.

[0250] Regeneration procedure: Embryos were dissected from mature imbibed seeds and cultured on shoot induction medium comprising MS salts, B5 vitamins, 30 g 1 sucrose, 0.4 mg/1 BA and 0.4 mg/1 IBA. After 2 weeks, shoot primordia were seen emerging from the calli. These shoots were sub cultured to on fresh shoot induction medium. Once the shoots had grown, they were cultured on shoot elongation medium comprising MS salts, B5 vitamins, 30 g/1 sucrose, 3 mg/1 BA and 0.5 mg/1 IAA for elongation. For rooting the elongated shoots were cultured on basal medium comprising MS salts, B5 vitamins and 30 g/1 sucrose with no plant hormones for about 2-3 weeks. Plantlets with well-developed roots were transferred to soil and grown under greenhouse conditions.

[0251] Transformation procedure and selection: Agrobacterium EHA105 strain harboring a plasmid which carried a gene cassette consisting of enhanced green fluorescence protein gene (egfp) under the control of rolD promoter and 35S terminator was used for transformation. Agrobacterium was grown in plates containing rifampicin (5 mg/1) and kanamycin (100 mg/1) at 28° C to obtain single colonies. A single colony was then inoculated in 5 ml LB medium and grown overnight. 500 μΐ of this culture was added to 200 ml of LB medium along with 100 μΐ of acetosyringone and grown to an OD of 0.8. This Agrobacterium culture was centrifuged at 5000 rpm at 4° C and resuspended in LB medium. The precultured embryos were removed from culture and immersed in the Agrobacterium culture. This culture was then sonicated for 15 seconds eight times. After sonication, the old Agrobacterium culture is carefully removed and then a fresh Agrobacterium culture and the precultured, sonicated embyros were added to a culture plate. This culture plate was placed inside a vacuum dessicator (Nalgene) for vacuum infiltration of the precultured, sonicated embyros. The vacuum was applied for 3 minutes using a vacuum pump. The vacuum infiltrated embryos remained in the culture for continued infection.

[0252] After infection for 30 minutes, the embryos were placed on shoot induction medium containing MS salts, B5 vitamins, 30 g/1 sucrose, 0.4 mg/1 6-benzylaminopurine (BA) and 0.4 mg/1 indole-3-butyric acid (ΠΒΑ) and cultured for 3 days. After 3 days, the embryos were washed multiple times with sterile distilled water containing cefotoxime (150 mg/1). The washed embryos were kept on the shoot induction medium containing 150 mg/1 cefatoxime for 3-4 weeks in the dark for shoot induction. After 3-4 weeks GFP positive shoots were selected and transferred to light. The well grown shoots were transferred to shoot elongation media containing MS salts, B5 vitamins, sucrose (30 g/1), BA (3 mg/1) and indole-3-acetic acid (IAA; 0.5 mg/1), to which cefatoxime (150 mg/1) was added for 2-3 weeks. The shoots were hardened on basal medium containing MS salts, B5 vitamins and 30 g/1 sucrose and allowed to root. Plantlets with well-developed roots were transferred to soil and grown under greenhouse conditions before further analysis.

[0253] Molecular characterization of transgenic plants: To confirm stable transformation of GFP positive plants, genomic DNA was extracted from leaves and analyzed by PCR and Southern blot. Genomic DNA was isolated from leaves using the CTAB procedure (Doyle and Doyle 1990). The coding region of GFP gene was amplified by PCR to confirm gene insertion. For Southern blot, 15 μg of genomic DNA from each transgenic plant was digested with EcoRl and probed with a GFP probe that was labelled with digoxigenin using DIG labelling Kit (Roche, catalog number 11 175 033910).

[0254] Inheritance of transgene: seeds from transformed plants were collected and sterilized. They were then germinated on the basal medium plates. The germinating seedlings were screened for GFP fluorescence. EXAMPLE 18

Regeneration and Transformation of Sweet Basil

[0255] A reliable regeneration system from mature Basil embryos was established. The dissected embryos produced shoots after a short calli phase (Figs. 32A-32C). Once the regeneration protocol was standardized for dissected mature embryos, this explant was chosen for transformation. Combined effects of sonication and vacuum infiltration greatly enhanced the frequency of transformation. It is proposed that sonication produces micro injuries on the explants both on the surface and in inner layers making the infection by Agrobacterium more efficient whereas the vacuum infiltration helps to push the agrobacterial cells deeper into the tissues. Sonication method has improved transformation efficiency in soybean, maize, flax, chick pea and banana (Trick and Finer 1997; Santare'm et al. 1998; Valdez-Ortiz et al. 2007; Beranova' et al. 2008; Pathak and Hamzah 2008; Subramanyam et al. 2011). In the present procedure, 2 minutes sonication followed by vacuum infiltration for 3 minutes proved to be ideal for successful transformation. Sonication for a longer time caused damage to the dissected mature embryos. For every 100 dissected mature embryos sonicated, approximately 15-20 stable transgenic lines were obtained. Without sonication, the frequency was 2%.

[0256] Visual selection markers such as Green fluorescent protein (GFP) enable the isolation of transformed cells without any antibiotics or herbicide selection (Fig. 33). GFP positive shoots were clearly visible. These shoots were morphologically indistinguishable from non-transformed control plants. To confirm that these were indeed transformed plants, genomic DNA was isolated and PCR performed using GFP primers. All the plants obtained from the transformation procedures contained GFP transgene, confirming that they were transgenic (Fig. 34). Additionally Southern blot analysis was performed to assess the stable integration of GFP gene in transgenic plants. Results showed transgenic plants contained single to multiple copy insertions. Seeds from these transgenic plants were germinated in media and stable inheritance of GFP gene was observed in T-l generation seedlings. Thus, an efficient SAAT procedure for Basil has been developed that shows stable inheritance of the transgene which will facilitate the use of GM technology to improve this genus.

[0257] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non- claimed element as essential to the practice of the invention.

[0258] Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

BIBLIOGRAPHY

[0259] Adato, A., et al. (2009). Fruit-Surface Flavonoid Accumulation in Tomato Is Controlled by a SIMYB12-Regulated Transcriptional Network. Plos Genetics 5(12): 23.

[0260] Alvarez J, and Smyth DR (1999) CRABS CLAW and SPATULA, two Arabidopsis genes that control carpel development in parallel with AGAMOUS. Development 126: 2377- 2386

[0261] Arenzana-Seisdedos F, Turpin P, Rodriguez M, Thomas D, Hay RT, Virelizier JL, Dargemont C (1997) Nuclear localization of I kappa B alpha promotes active transport of NF- kappa B from the nucleus to the cytoplasm. J Cell Sci 110: 369-378

[0262] Beals CR, Sheridan CM, Turck CW, Gardner P, Crabtree GR (1997) Nuclear export of NF-ATc enhanced by glycogen synthase kinase-3. Science 275: 1930-1933

[0263] Beranova' M, Rakousky S, Va'vrova' Z, Skalicky T (2008). Sonication assisted Agrobacterium-mediated transformation enhances the transformation efficiency in flax (Linux usitatissimum L.). Plant Cell Tissue Org Cult 94:253-259. [0264] Ben Zvi MM, Negre-Zakharov F, Masci T, Ovadis M, Shklarman E, Ben-Meir H, Tzfira T, Dudareva N, Vainstein A (2008) Interlinking showy traits: co-engineering of scent and colour biosynthesis in flowers. Plant Biotechnol J 6: 403-415

[0265] Ben Zvi MM, Shklarman E, Masci T, Kalev H, Debener T, Shafir S, Ovadis M, Vainstein A (2012) PAPl transcription factor enhances production of phenylpropanoid and terpenoid scent compounds in rose flowers. New Phytol 195: 335-345

[0266] Bomal, C, et al. (2013). Opposite action of R2R3-MYBs from different subgroups on key genes of the shikimate and monolignol pathways in spruce. J Exp Botany 65:495-508.

[0267] Bonaccorso O, Lee JE, Puah L, Scutt CP, Golz J F (2012) FILAMENTOUS FLOWER controls lateral organ development by acting as both an activator and a repressor. BMC Plant Biol 12: 176

[0268] Borevitz JO, Xia Y, Blount J, Dixon RA, Lamb C (2000) Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 12: 2383-2393

[0269] Bowman JL (2000) The YABBY gene family and abaxial cell fate. Curr Opin Plant Biol 3:17-22

[0270] Bowman JL, and Smyth DR (1999) CRABS CLAW, a gene that regulates carpel and nectary development in Arabidopsis, encodes a novel protein with zinc finger and helix-loop- helix domains. Development, 126: 2387-2396

[0271] Broun P, Somerville C (2001). Progress in plant metabolic engineering. P Natl Acad Sci USA 98: 8925-8927.

[0272] Buchman and Berg (1988). Mol. Cell Biol 8:4395-4405.

[0273] Butelli E, Titta, L, Giorgio M, Mock HP, Matros A, Peterek S, Schijlen EG, Hall, RD, Bovy AG, Luo J, Martin C (2008) Enrichment of tomato fruit with health-promoting anthocyanins by expression of select transcription factors. Nat Biotechnol 26: 1301-1308.

[0274] Callis et al. (1987). Genes Dev. 1 :1183-1200.

[0275] Champagne, A. and M. Boutry (2013). Proteomic snapshot of spearmint (Mentha spicata L.) leaf trichomes: A genuine terpenoid factory. Proteomics 13(22):3327-3332.

[0276] Charles DJ, Simon DJ, Wood KV (1990). Essential oil constituents of Ocimum micrathum Willd. Agric Food Chem 38:120-122.

[0277] Che P, Bussell JD, Zhou W, Estavillo GM, Pogson BJ, Smith SM (2010) Signaling from the endoplasmic reticulum activates brassinosteroid signaling and promotes acclimation to stress in Arabidopsis. Sci Signal 3: ra69-ra69

[0278] Chen Q, Atkinson A, Otsuga D, Christensen T, Reynolds L, Drews GN (1999) The Arabidopsis FILAMENTOUS FLOWER gene is required for flower formation. Development 126: 2715-2726.

[0279] Christensen et al. (1989). Plant Mol. Biol. 12:619-632.

[0280] Christensen et al.(1992). Plant Mol. Biol 18:675-689.

[0281] Cordoba E, Salmi M, Leon P (2009) Unravelling the regulatory mechanisms that modulate the MEP pathway in higher plants. J Exp Bot 60: 2933-2943

[0282] Croteau R (1988). Catabolism of monoterpenes in essential oil plants. In Flavors and Fragrances: A World Perspective (Lawrence, B.M. et al., eds), pp 65-84, Elsevier [0283] Croteau R, and Kutchan TM, Lewis NG (2000). Natural products (secondary metabolites). In BB Buchanan, W Gruissem, RL Jones, eds, Biochemistry and Molecular Biology of Plants. American Society of Plant Physiology, Rockville, MD, pp 1250-318

[0284] Croteau R, Karp F, Wagschal KC, Satterwhite DM, Hyatt DC, Skotland CB (1991). Biochemical characterization of a spearmint mutant that resembles peppermint in monoterpene content. Plant Physiol 96: 744-752.

[0285] Dai M, Zhao Y, Ma Q, Hu Y, Hedden P, Zhang Q, Zhou DX (2007) The rice YABBYl gene is involved in the feedback regulation of gibberellin metabolism. Plant Physiol 144: 121-133

[0286] Dauvois S, White R, Parker MG (1993) The antiestrogen ICI 182780 disrupts estrogen receptor nucleocytoplasmic shuttling. J Cell Sci 106: 1377-1388

[0287] Davis EM, Ringer KL, McConkey ME, Croteau R (2005) Monoterpene metabolism. Cloning, expression, and characterization of menthone reductases from peppermint. Plant Physiol 137: 873-881.

[0288] Deschamps C, and Simon J E (2002.) Agrobacterium tumefaciens-mediated transformation of Ocimum basilicum and O. citriodomm. Plant Cell Rep (2002) 21 :359-364.

[0289] Deschamps, C. and J. Simon (2010). Phenylpropanoid Biosynthesis in Leaves and Glandular Trichomes of Basil (Ocimum basilicum L.), in Plant Secondary Metabolism Engineering, A.G. Fett-Neto, Ed., Humana Press, p. 263-273.

[0290] Diemer F, Caissard JC, Moja S, Calchat JC, Jullien F (2001). Altered monoterpene composition in transgenic mint following the introduction of 4S-limonene synthase. Plant Physiol Biochem 39: 603-614.

[0291] Dubey VS, Bhalla R, Luthra R (2003) An overview of the non-mevalonate pathway for terpenoid biosynthesis in plants. J Biosci 28: 637-646

[0292] Dubos, C. et al. (2010). MYB transcription factors in Arabidopsis. Trends in Plant Science 15(10):573-581.

[0293] Enfissi EM, Barneche F, Ahmed I, Lichtle C, Gerrish C, McQuinn RP, Giovannoni JJ, Lopez- Juez E, Bowler C, Bramley PM, Fraser PD (2010) Integrative transcript and metabolite analysis of nutritionally enhanced DE-ETIOLATED1 downregulated tomato fruit. Plant Cell 22: 1190-1215

[0294] Eshed Y, Baum SF, Bowman JL (1999) Distinct mechanisms promote polarity establishment in carpels of Arabidopsis. Cell 99: 199-209

[0295] Eshed Y, Izhaki A, Baum SF, Floyd SK, Bowman JL (2004) Asymmetric leaf development and blade expansion in Arabidopsis are mediated by KANADI and YABBY activities. Development 131: 2997-3006

[0296] Feller, A., et al (2011)., Evolutionary and comparative analysis of MYB and bHLH plant transcription factors. The Plant Journal 66(1):94-116.

[0297] Fire et al. (1998). Nature 391 :806.

[0298] Fire et al. (1999). Trends Genet. 15:358.

[0299] Gallois P, and Marinho P (1995) Leaf disk transformation using Agrobacterium tumefaciens-Qxpression of heterologous genes in tobacco. InPlant gene transfer and expression protocols pp 39-48 Springer New York. [0300] Gang, D.R., et al. (2001). An Investigation of the Storage and Biosynthesis of Phenylpropenes in Sweet Basil. Plant Physiology 125(2):539-555.

[0301] Gershenzon J, McConkey ME, Croteau RB (2000) Regulation of monoterpene accumulation in leaves of peppermint. Plant Physiol 122: 205-213

[0302] Goldshmidt A, Alvarez IP, Bowman JL, Eshed Y (2008) Signals derived from YABBY gene activities in organ primordia regulate growth and partitioning of Arabidopsis shoot apical meristems. Plant Cell 20: 1217-1230

[0303] Golz JF, Roccaro M, Kuzoff R, Hudson A (2004) GRAMINIFOLIA promotes growth and polarity of Antirrhinum leaves. Development 131: 3661-3670

[0304] Grotewold E (2008). Transcription factors for predictive plant metabolic engineering: are we there yet. Curr Opin Biotechnol 19: 138-144.

[0305] Gura (2000). Nature 404:804-808.

[0306] Hallahan DL (2000) Monoterpenoid biosynthesis in glandular trichomes of labiate plants. Adv Bot Res 31: 77-120.

[0307] Herrmann KM, Weaver LM (1999) The shikimate pathway. Annu Rev Plant Biol 50: 473-503

[0308] Hollingsworth, R.G., Limonene (2005). A citrus extract, for control of mealybugs and scale insects. Journal of Economic Entomology 98(3):772-779.

[0309] Iwase A, Matsui K, Ohme-Takag, M (2009). Manipulation of plant metabolic pathways by transcription factors. Plant Biotechnol 26: 29-38.

[0310] Jang S, Hur J, Kim SJ, Han MJ, Kim SR, An G (2004) Ectopic expression of OsYABl causes extra stamens and carpels in rice. Plant Mol Biol 56: 133-143

[0311] Jayasinghe, C, et al. (2003). Phenolics Composition and Antioxidant Activity of Sweet Basil (Ocimum basilicum L.). JAgricultural and Food Chemistry 51(15):4442-4449.

[0312] Javelle M, Marco CF, Timmermans M (2011) In situ hybridization for the precise localization of transcripts in plants. J Vis Exp 57: 3328

[0313] Jin, J., et al. (2014). Next generation sequencing unravels the biosynthetic ability of Spearmint (Mentha spicata) peltate glandular trichomes through comparative transcriptomics. BMC Plant Biology 14:292

[0314] Juarez MT, Twigg RW, Timmermans MC (2004) Specification of adaxial cell fate during maize leaf development. Development 131: 4533-4544

[0315] Kanaya E, Watanabe K, Nakajima N, Okada K, Shimura Y (2001) Zinc release from the CH₂C₆ zinc fmger domain of FILAMENTOUS FLOWER protein from Arabidopsis thaliana induces self-assembly. J Biol Chem 276: 7383-7390

[0316] Kanaya E, Nakajima N, Okada K (2002) Non-sequence-specific DNA binding by the FILAMENTOUS FLOWER protein from Arabidopsis thaliana is reduced by EDTA. J Biol Chem 277: 11957-11964

[0317] Karp F, Mihaliak CA, Harris JL, Croteau R (1990). Monoterpene biosynthesis: specificity of the hydroxylations of (-)-limonene by enzyme preparations from peppermint {Mentha piperita), spearmint {Mentha spicata), and perilla {Perilla frutescens) leaves. Arch Biochem Biophys 276: 219-226. [0318] Khan, S. et al. (2015). Agrobacteriun tumefaciens mediated genetic transformation of Ocimum graatissimum: a medicinally important crop. Industrial Crops and Products 71 : 138- 146.

[0319] Kizil, S., et al. (2010). mineral content, essential oil components and biological activity of two Mentha species (M. piperita L., M. spicata L.). Turkish Journal of Field Crops 15(2):148-153.

[0320] Kram BW, Xu WW, Carter CJ (2009) Uncovering the Arabidopsis thaliana nectary transcriptome: investigation of differential gene expression in floral nectariferous tissues. BMC Plant Biol 9: 92.

[0321] Ku LX, Zhang J, Guo SL, Liu HY, Zhao RF, Chen YH (2012) Integrated multiple population analysis of leaf architecture traits in maize {Zea mays L.). J Exp Bot 63: 261-274.

[0322] Lagos-Quintana et al. (2001). Science 294:853-858.

[0323] Lagos-Quintana et al. (2002). Curr. Biol. 12:735-739.

[0324] Lange BM and Turner GW (2013). Terpenoid biosynthesis in trichomes-current status and future opportunities. Plant Biotechnol J 11: 2-22.

[0325] Lange BM, and Croteau R (1999). Genetic engineering of essential oil production in mint. Curr Opin Plant Biol 2: 139-144.

[0326] Lange, B.M., et al. (2000). Probing essential oil biosynthesis and secretion by functional evaluation of expressed sequence tags from mint glandular trichomes. Proc Natl Acad Sciences USA 97(6):2934-2939.

[0327] Lange BM, Mahmoud SS, Wildung MR, Turner GW, Davis EM, Lange I, Baker RC, Boydston RA, Croteau RB (2011). Improving peppermint essential oil yield and composition by metabolic engineering. P Natl Acad Sci USA 108: 16944-16949.

[0328] Langenheim JH (1994) Higher plant terpenoids: a phytocentric overview of their ecological roles. J Chem Ecol 20: 1223-1280.

[0329] Last et al. (1991). Theor. Appl. Genet. 81:581-588.

[0330] Lau et al. (2001). Science 294:858-862.

[0331] Lee and Ambros (2001). Science 294:862-864.

[0332] Lee JY, Baum SF, Alvarez J, Patel A, Chitwood DH, Bowman JL (2005) Activation of CRABS CLAW in the nectaries and carpels of Arabidopsis. Plant Cell 17: 25-36

[0333] Legay, S., et al. (2007). Molecular characterization of EgMYBl, a putative transcriptional repressor of the lignin biosynthetic pathway. Plant Science 173(5):542-549.

[0334] Li X, Gao MJ, Pan HY, Cui DJ, Gruber MY (2010) Purple canola: Arabidopsis PAP1 increases antioxidants and phenolics in Brassica napus leaves. J Agr Food Chem 58: 1639-1645

[0335] Little DB, and Croteau R (1999). Biochemistry of essential oil terpenes: a thirty year overview. In Flavor Chemistry: Thirty Years of Progress (Hornstein, I. et al., eds), pp 239-253, Kluwer Academic/Plenum Press.

[0336] Liu JX, Srivastava R, Che P, Howell SH (2007) An endoplasmic reticulum stress response in Arabidopsis is mediated by proteolytic processing and nuclear relocation of a membrane-associated transcription factor, bZIP28. Plant Cell 19: 4111-4119.

[0337] Llave et al. (2002). Plant Cell 14:1605-1619. [0338] Luo J, Butelli E, Hill L, Parr A, Niggeweg R, Bailey P, Weisshaar B, Martin C (2008) AtMYB12 regulates caffeoyl quinic acid and flavonol synthesis in tomato: expression in fruit results in very high levels of both types of polyphenol. Plant J 56: 316-326

[0339] Loza-Tavera, H. (1999). Monoterpenes in essential oils - biosynthesis and properties. Adv Exp Med Biol 464: 49-62.

[0340] Mahjoub, A., et al. (2009). Overexpression of a grapevine R2R3-MYB factor in tomato affects vegetative development, flower morphology and flavonoid and terpenoid metabolism. Plant Physiology and Biochemistry 47(7):551-561.

[0341] Mahmoud SS, and Croteau RB (2001). Metabolic engineering of essential oil yield and composition in mint by altering expression of deoxyxylulose phosphate reductoisomerase and menthofuran synthase. P Natl Acad Sci USA 98: 8915-8920.

[0342] Majetic CJ, Rausher MD, Raguso RA (2010) The pigment-scent connection: Do mutations in regulatory vs. structural anthocyanin genes differentially alter floral scent production in Ipomoea purpurea? S Afr J Bot 76: 632-642

[0343] Martin C (1996). Transcription factors and the manipulation of plant trais. Curr Opin Biotechnol 7: 130-138.

[0344] Mathews H, Clendennen SK, Caldwell CG, Liu XL, Connors K, Matheis N, Schuster DK, Menasco DJ, Wagoner W, Lightner J, Wagner DR (2003) Activation tagging in tomato identifies a transcriptional regulator of anthocyanin biosynthesis, modification, and transport. Plant Cell 15: 1689-1703

[0345] Matousek J, Vrba L, Skopek J, Orctova L, Pesina K, Heyerick A, Baulcombe D, De Keukeleire D (2006) Sequence analysis of a "true" chalcone synthase (chs _H1) oligofamily from hop (Humulus lupulus L.) and PAPl activation of chs HI in heterologous systems. J Agr Food Chem 54: 7606-7615

[0346] McBride KM, Banninger G, McDonald C, Reich NC (2002) Regulated nuclear import of the STAT1 transcription factor by direct binding of importin-a. EMBO J 21: 1754-1763

[0347] McCaskill D, and Croteau R (1999) Isopentenyl diphosphate is the terminal product of the deoxyxylulose-5-phosphate pathway for terpenoid biosynthesis in plants. Tetrahedron Lett 40: 653-656.

[0348] McElroy et al. (1990). Plant Cell 2:163-171.

[0349] Miyamoto K, Matsumoto T, Okada A, Komiyama K, Chujo T, Yoshikawa H, Nojiri H, Yamane H, Okada K (2014) Identification of target genes of the bZEP transcription factor OsTGAPl, whose overexpression causes elicitor-induced hyperaccumulation of diterpenoid phytoalexins in rice cells. PloS One 9: el 05823.

[0350] Moreno AA, Mukhtar MS, Blanco F, Boatwright JL, Moreno I, Jordan M R, Chen Y, Brandizzi F, Dong X, Orellana A, Pajerowska-Mukhtar KM (2012) IREl ZIP60-mediated unfolded protein response plays distinct roles in plant immunity and abiotic stress responses. PLoS One 7: e31944.

[0351] Mourelatos et al. (2002). Genes Dev. 16:720-728.

[0352] Navarro C, Efremova N, Golz JF, Rubiera R, Kuckenberg M, Castillo R, Tietz O, Saedler H, Schwarz-Sommer Z (2004) Molecular and genetic interactions between STYLOSA and GRAMINIFOLIA in the control of Antirrhinum vegetative and reproductive development. Development 131: 3649-3659 [0353] Nicot N, Hausman JF, Hoffmann L, Evers D (2005) Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. J Exp Bot 56: 2907- 2914.

[0354J Niu X, Lin K, Hasegawa PM, Bressan RA, Weller SC (1998) Transgenic peppermint {Mentha* piperita L.) plants obtained by cocultivation with Agrobacterium tumefaciens. Plant Cell Rep 17: 165-171.

[0355] Niu X, Li X, Veronese P, Bressan RA, Weller SC, Hasegawa PM (2000). Factors affecting Agrobacterium tumefaciens-medi&ted transformation of peppermint. Plant Cell Rep 19: 304-310.

[0356] Odell et al. (1985). Nature 313:810-812.

[0357] Park et al. (2002). Curr. Biol. 12:1484-1495.

[0358] Pathak MR, and Hamzah RY (2008). An effective method of sonication assisted Agrobacterium-mediated transformation of chickpeas. Plant Cell Tissue Organ Cult 93:65-71.

[0359] Rastogi, S., et al. (2014). De novo sequencing and comparative analysis of holy and sweet basil transcriptomes. BMC Genomics 15:18.

[0360] Reinhart et al. (2002). Genes. Dev. 16:1616-1626.

[0361] Ringer, K.L., E.M. Davis, and R. Croteau (2005). Monoterpene metabolism. Cloning, expression, and characterization of (-)-isopiperitenol/(-)-carveol dehydrogenase of peppermint and spearmint. Plant Physiology 137(3):863-872.

[0362] Ritzenthaler C, Nebenfuhr A, Movafeghi A, Stussi-Garaud C, Behnia L, Pimpl P, Staehelin A, Robinson DG (2002) Reevaluation of the effects of brefeldin A on plant cells using tobacco Bright Yellow 2 cells expressing Golgi-targeted green fluorescent protein and COPI antisera. Plant Cell 14: 237-261

[0363] Robinson DG, and Ritzenthaler C (2006) Imaging the early secretory pathway in BY- 2 cells. In T Nagata, K Matsuoka, D Γηζέ, eds, Tobacco BY-2 Cells: From Cellular Dynamics to Omics, Vol 58. Biotechnology in Agriculture and Forestry. Springer- Verlag, Heidelberg, pp 135-151

[0364] Roomiani, L. and M. Roomian (2014). Chemical composition and antibacterial activity of essential oil from (Rosmarinus officinalis) and (Mentha spicata) against oral pathogens. Iranian J Public Health 43:32-32.

[0365] Rouster J, Leah R, Mundy J, Cameron-Mills V (1997) Identification of a methyl jasmonate-responsive region in the promoter of a lipoxygenase 1 gene expressed in barley grain. Plant J 11: 513-523

[0366] Saint-Jore CM, Evins J, Batoko H, Brandizzi F, Moore I, Hawes C (2002) Redistribution of membrane proteins between the Golgi apparatus and endoplasmic reticulum in plants is reversible and not dependent on cytoskeletal networks. Plant J 2: 661-678

[0367] Santare'm ER, Trick HN, Essig JS, Finer JJ (1998). Sonication-assisted Agrobacterium-mediated transformation of soybean immature cotyledons: optimization of transient expression. Plant Cell Rep 17:752-759.

[0368] Sawa S, Ito T, Shimura Y, Okada K (1999a) FILAMENTOUS FLOWER controls the formation and development of Arabidopsis inflorescences and floral meristems. Plant Cell 11 : 69-86 2016/050265

73

[0369] Sawa S, Watanabe K, Goto K, Kanaya E, Morita EH, Okada K (1999b) FILAMENTOUS FLOWER, a meristem and organ identity gene of Arabidopsis, encodes a protein with a zinc finger and HMG-related domains. Gene Dev 13: 1079-1088

[0370] Sarojam R, Sappl PG, Goldshmidt A, Efroni I, Floyd SK, Eshed Y, Bowman JL

(2010) Differentiating Arabidopsis shoots from leaves by combined YABBY activities. Plant Cell 22: 2113-2130

[0371] Scherer, R., et al. (2013). Antioxidant and antibacterial activities and composition of Brazilian spearmint (Mentha spicata L.). Industrial Crops and Products 50(0):408-413.

[0372] Schwinn K, Venail J, Shang Y, Mackay S, Aim V, Butelli E, Oyama R, Bailey P, Davies K, Martin C (2006) A small family of F5-regulatory genes controls floral pigmentation intensity and patterning in the genus Antirrhinum. Plant Cell 18: 831-851

[0373] Siegfried KR, Eshed Y, Baum SF, Otsuga D, Drews GN, Bowman JL (1999) Members of the YABBY gene family specify abaxial cell fate in Arabidopsis. Development 126: 4117-4128

[0374] Sinha R, Bhattacharyya D, Majumdar AB, Datta R, Hazra S, Chattopadhyay S (2013) Leaf proteome profiling of transgenic mint infected with Alternaria alternata. J Proteomics, 93: 117-132.

[0375] Skepper JN, and Powell JM (2008) Immunogold staining of epoxy resin sections for transmission electron microscopy (TEM). Cold Spring Harbor Protocols, 6: pdb-prot5015

[0376] Stahle MI, Kuehlich J, Staron L, von Arnim AG, Golz JF (2009) YABBYs and the transcriptional corepressors LEUNIG and LEUNIG HOMOLOG maintain leaf polarity and meristem activity in Arabidopsis. Plant Cell 21: 3105-3118

[0377] Stracke, R., M. Werber, and B. Weisshaar (2001). The R2R3-MYB gene family in Arabidopsis thaliana. Current Opinion in Plant Biology 4(5):447-456.

[0378] Stracke, R., et al. (2007). Differential regulation of closely related R2R3-MYB transcription factors controls flavonol accumulation in different parts of the Arabidopsis thaliana seedling. The Plant Journal 50(4):660-677.

[0379] Subramanyam K, Subramanyam K, Sailaja KV, Srinivasulu M, Lakshmidevi K

(2011) . Highly efficient Agrobacterium-mediated transformation of banana cv. Rasthali (AAB) via sonic ation and vacuum infiltration. Plant Cell Rep 30:425^436.

[0380] Tanaka W, Toriba T, Ohmori Y, Yoshida A, Kawai A, Mayama-Tsuchida T, Ichikawa D, Mitsuda N, Ohme-Takagi M, Hirano HY (2012) The YABBY gene TONGARI- BOUSHI1 is involved in lateral organ development and maintenance of meristem organization in the rice spikelet. Plant Cell 24: 80-95

[0381] Toriba T, Harada , Takamura A, Nakamura H, Ichikawa H, Suzaki T, Hirano HY (2007) Molecular characterization the YABBY gene family in Oryza sativa and expression analysis of OsYABBYl. Mol Genet Genomics 277: 457-468

[0382] Trick HN, and Finer JJ (1997). SAAT: sonication-assisted Agrobacterium mediated transformation. Transgenic Res 6:329-337.

[0383] Turner, G.W., J. Gershenzon, and R.B. Croteau (2000). Distribution of Peltate Glandular Trichomes on Developing Leaves of Peppermint. Plant Physiology 124(2): 655-664.

[0384] Tzin V, and Galili G (2010) The biosynthetic pathways for shikimate and aromatic amino acids in Arabidopsis thaliana. The Arabidopsis book 8: e0132. [0385] Valdez-Ortiz A, Medina-Godoy S, Elena Valverde M, Paredes-Lo'pez O (2007). A transgenic tropical maize line generated by the direct transformation of the embryo-scutellum by A. tumefaciens. Plant Cell Tissue Organ Cult 91:201-214.

[0386] Vaucheret et al. (1998). Plant J. 16:651 -659.

[0387] Velten et al. (1984). EMBOJ. 3:2723-2730.

[0388] Villanueva JM, Broadhvest J, Hauser BA, Meister RJ, Schneitz K, Gasser CS (1999) INNER NO OUTER regulates abaxial-adaxial patterning in Arabidopsis ovules. Genes Dev 13: 3160-3169.

[0389] Vom Endt, D., J.W. Kijne, and J. Memelink (2002). Transcription factors controlling plant secondary metabolism: what regulates the regulators? Phytochemistry 61(2):107-114.

[0390] Vranova E, Coman D, Gruissem W (2013). Network analysis of the MVA and MEP pathways for isoprenoid synthesis. Annu Rev Plant Biol 64: 665-700.

[0391] Wang G (2014) Recent progress in secondary metabolism of glandular trichome. Plant Biotechnol 31: 353-361.

[0392] Walker, N.J (2002). A Technique Whose Time Has Come. Science 296:557-559.

[0393] Werker, E., et al. (1993). Glandular hairs and essential oil in developing leaves of Ocimum-basilicum 1 (lamiaceae). Annals of Botany 71(l):43-50.

[0394] Xie Z, apteyn J, Gang DR (2008) A systems biology investigation of the MEP/terpenoid and shikimate/phenylpropanoid pathways points to multiple levels of metabolic control in sweet basil glandular trichomes. Plant J 54: 349-361

[0395] Xu YH, Wang JW, Wang S, Wang JY, Chen XY (2004) Characterization of GaWRKYl, a cotton transcription factor that regulates the sesquiterpene synthase gene (+)-δ- cadinene synthase- A. Plant Physiol 135: 507-515

[0396] Yamada T, Ito M, ato M (2004) YABBY2-homologue expression in lateral organs of Amborella trichopoda (Amborellaceae). Int J Plant Sci 165: 917-924

[0397] Yamaguchi T, Nagasawa N, Kawasaki S, Matsuoka M, Nagato Y, Hirano HY (2004) The YABBY gene DROOPING LEAF regulates carpel specification and midrib development in Oryza sativa. Plant Cell 16: 500-509.

[0398] Yang, C.-Q., et al. (2012). Transcriptional Regulation of Plant Secondary MetabolismF. Journal of Integrative Plant Biology 54(10):703-712.

[0399] Yang ZT, Wang MJ, Sun L, Lu SJ, Bi D L, Sun L, Song ZT, Zhang SS, Zhou SF, Liu JX (2014) The membrane-associated transcription factor NAC089 controls ER-stress-induced programmed cell death in plants. PLoS Gene 10: el 004243

[0400] Zhang, X., V. Garreton, and N.-H. Chua (2005). The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation. Genes & Development 19(13):1532-1543.

[0401] Zhao W, Su HY, Song J, Zhao XY, Zhang XS (2006) Ectopic expression of TaYABl, a member of YABBY gene family in wheat, causes the partial abaxialization of the adaxial epidermises of leaves and arrests the development of shoot apical meristem in Arabidopsis. Plant Sci 170: 364-371 [0402] Zhou M, Wu L, Liang J, Shen C, Lin J (2012) Expression analysis and functional characterization of a novel cold-responsive gene CbCORlSa from Capsella bursa-pastoris. Mol Biol Rep 39: 5169-5179

[0403] Zhu W, Zhang L, Lv H, Zhang H, Zhang D, Wang X, Chen J (2014) The dehydrin wzy2 promoter from wheat defines its contribution to stress tolerance. Funct Integr Genomics 14: 111-125.

Claims

WHAT IS CLAIMED IS:

1. A plant comprising in its genome a recombinant DNA construct comprising at least one heterologous regulatory element operably linked to a polynucleotide, wherein said polynucleotide is selected from the group consisting of:

(a) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2;

(b) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO : 2;

(c) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO: 1 ;

(d) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO: 1 ;

(e) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4;

(f) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:4;

(g) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3; and

(h) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO:3; wherein the plant exhibits decreased secondary metabolite production upon over expression of the polynucleotide when compared to a control plant not comprising said recombinant DNA construct.

2. The plant of claim 1, wherein the heterologous regulatory element is a heterologous constitutive promoter.

3. The plant of claim 1, wherein the heterologous regulatory element is a heterologous inducible promoter.

4. The plant of claim 1 , 2 or 3, wherein the plant is spearmint or sweet basil.

5. A plant comprising in its genome a suppressoin DNA construct comprising at least one heterologous regulatory element operably linked to a polynucleotide, wherein said polynucleotide is selected from the group consisting of:

(a) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a MsYABBY5 polypeptide;

(b) all or part of (1) a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:l, or (2) a full complement of the nucleic acid sequence of (1);

(c) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a MsMYB12 polypeptide; and

(d) all or part of (i) a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3, or (ii) a full complement of the nucleic acid sequence of (i); wherein the plant exhibits increased secondary metabolite production upon expression of the polynucleotide when compared to a control plant not comprising said suppression DNA construct.

6. The plant of claim 5, wherein the heterologous regulatory element is a heterologous constitutive promoter.

7. The plant of claim 5, wherein the heterologous regulatory element is a heterologous inducible promoter.

8. The plant of claim 5, 6 or 7, wherein the plant is spearmint or sweet basil.

9. A method of decreasing secondary metabolite production in a plant comprsing:

(i) introducing into a regenerable plant cell a recombinant DNA construct comprising at least one heterologous regulatory element operably linked to a polynucleotide, wherein said polynucleotide is selected from the group consisting of:

(a) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2;

(b) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:2;

(c) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO: 1 ;

(d) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO: 1 ;

(e) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4;

(f) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:4;

(g) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ED NO:3; and

(h) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO:3;

(ii) regenerating a transgenic plant from the regenerable plant cell after step

0),

wherein the transgenic plant comprises in its genome the recombinant DNA construct and exhibits decreased secondary metabolite production upon over expression of the polynucleotide when compared to a control plant not comprising said recombinant DNA construct.

10. The method of claim 9, wherein the heterologous regulatory element is a heterologous constitutive promoter.

11. The method of claim 9, wherein the heterologous regulatory element is a heterologous inducible promoter.

12. The method of claim 9, 10 or 11 , further comprising:

(iii) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits decreased secondary metabolite production when compared to a control plant not comprising the recombinant DNA construct.

13. The method of any one of claims 9-12, wherein the plant is spearmint or sweet basil.

14. A method of increasing secondary metabolite production in a plant comprising:

(i) introducing into a regenerable plant cell a suppression DNA construct comprising at least one heterologous regulatory element operably linked to a polynucleotide, wherein said polynucleotide is selected from the group consisting of:

(a) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a MsYABBY5 polypeptide;

(b) all or part of (1) a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:l, or (2) a full complement of the nucleic acid sequence of (1);

(c) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a MsMYB12 polypeptide; and

(d) all or part of (i) a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3, or (ii) a full complement of the nucleic acid sequence of (i); wherein the transgenic plant comprises in its genome the suppression DNA " construct and exhibits increased secondary metabolite production upon expression of the polynucleotide when compared to a control plant not comprising said suppression DNA construct.

15. The method of claim 14, wherein the heterologous regulatory element is a heterologous constitutive promoter.

16. The method of claim 14, wherein the heterologous regulatory element is a heterologous inducible promoter.

17. The method of claim 14, 15 or 16, further comprising:

(iii) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits decreased secondary metabolite production when compared to a control plant not comprising the recombinant DNA construct.

18. The method of any one of claims 14-17, wherein the plant is spearmint or sweet basil.

19. A method of selecting for (or identifying) decreased secondary metabolite production in a plant, comprising:

(i) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising at least one heterologous regulatory element operably linked to a polynucleotide, wherein said polynucleotide is selected from the group consisting of:

(a) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2;

(b) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:2;

(c) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO: 1 ;

(d) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO: 1 ;

(e) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4;

(f) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:4;

(g) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO: 3; and

(h) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO:3;

(ii) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and

(iii) selecting (or identifying) the progeny plant with decreased secondary metabolite production compared to a control plant not comprising the recombinant DNA construct.

20. The method of claim 19, wherein the heterologous regulatory element is a heterologous constitutive promoter.

21. The method of claim 19, wherein the heterologous regulatory element is a heterologous inducible promoter.

22. A method of selecting for (or identifying) increased secondary metabolite production in a plant, comprising: 82

(i) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a suppression DNA construct comprising at least one heterologous regulatory element operably linked to a polynucleotide, wherein said polynucleotide is selected from the group consisting of:

(a) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a MsYABBY5 polypeptide;

(b) all or part of (1) a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:l, or (2) a full complement of the nucleic acid sequence of (1);

(c) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a MsMYB12 polypeptide; and

(d) all or part of (i) a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3, or (ii) a full complement of the nucleic acid sequence of (i);

(ii) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and

(iii) selecting (or identifying) the progeny plant with increased secondary metabolite production compared to a control plant not comprising the suppression DNA construct.

23. The method of claim 22, wherein the heterologous regulatory element is a heterologous constitutive promoter.

24. The method of claim 22, wherein the heterologous regulatory element is a heterologous inducible promoter.

25. A recombinant DNA construct comprising at least one heterologous regulatory element operably linked to a polynucleotide, wherein said polynucleotide is selected from the group consisting of:

(a) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2;

(b) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:2;

(c) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO: 1 ;

(d) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO: 1 ;

(e) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4;

(f) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:4;

(g) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3; and

(h) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO:3; wherein said recombinant DNA construct when introduced into a plant conveys decreased secondary metabolite production in the plant upon over expression of the polynucleotide when compared to a control plant not comprising said recombinant DNA construct.

26. The recombinant DNA construct of claim 25, wherein the heterologous regulatory element is a heterologous constitutive promoter.

27. The recombinant DNA construct of claim 25, wherein the heterologous regulatory element is a heterologous inducible promoter.

28. A vector comprising the recombinant DNA construct of claim 26, 27 or 28.

29. A plant cell comprising the recombinant DNA construct of claim 26, 27 or 28.

30. A seed comprising the recombinant DNA construct of claim 26, 27 or 28.

31. A suppression DNA construct comprising at least one heterologous regulatory element operably linked to a polynucleotide, wherein said polynucleotide is selected from the group consisting of:

(a) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:2;

(b) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:2;

(c) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO: 1 ;

(d) a polynucleotide comprising a nucleic acid sequence comprising SEQ ED NO: 1 ;

(e) a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:4;

(f) a polynucleotide comprising a nucleotide sequence encoding a polypeptide wherein the amino acid sequence of the polypeptide comprises SEQ ID NO:4;

(g) a polynucleotide comprising a nucleic acid sequence of at least 90% sequence identity, based on the Clustal V or Clustal W method of alignment, when compared to SEQ ID NO:3; and

(h) a polynucleotide comprising a nucleic acid sequence comprising SEQ ID NO:3; wherein said recombinant DNA construct when introduced into a plant conveys increased secondary metabolite production in the plant upon expression of the polynucleotide when compared to a control plant not comprising said suppression DNA construct.

32. The suppression DNA construct of claim 31, wherein the heterologous regulatory element is a heterologous constitutive promoter.

33. The suppression DNA construct of claim 31, wherein the heterologous regulatory element is a heterologous inducible promoter.

34. A vector comprising the suppression DNA construct of claim 31 , 32 or 33.

35. A plant cell comprising the suppression DNA construct of claim 31, 32 or 33. 30. A seed comprising the suppression DNA construct of claim 31 , 32 or 33.