WO2015093946A2 - New effects of plant ahl proteins - Google Patents

Abstract

The invention relates to a method to change an annual plant into a perennial plant, to change a monocarpic plant into a polycarpic plant, to change a herbaceous plant into a woody plant, to increase branching in a plant, to keep plant cells in a juvenile state, to prevent flowering in a plant and/or to increase the ploidy level in a plant or plant cell, characterised in that a protein selected from the AHL15 clade of AHL proteins or an ortholog of such a protein is introduced into said plant or plant cell. The AHL15 clade consists of the proteins AHL15, AHL16, AHL17, AHL18, AHL19, AHL20, AHL21, AHL22, AHL23, AHL24, AHL25, AHL26, AH27, AHL28, AHL29.

Description

Title: New effects of plant AHL proteins

The invention relates to the field of plant biotechnology. In particular it relates to the area of the controlled duplication of ploidy, the speed of the lifecycle of a plant and an increase in branching in plants, more specifically through the controlled expression or activation or knock down of a gene encoding a transcriptional regulator that is central to these processes.

Introduction

AT-HOOK MOTIF CONTAINING NUCLEAR LOCALIZED (AHL) proteins in plants have been suggested in the prior art for various effects. In WO 2004/069865 it has been shown that AHL proteins are capable of inducing apomixis or asexual reproduction in plants. Further, other morphological changes, such as the modification of the regenerative capacity of a plant and modulation of plant growth have been mentioned therein as effects of (over)expression of these types of proteins.

From a morphological point of view, the AHL proteins are part of a large family of nuclear proteins that bind to the minor groove of DNA at AT-rich stretches.

This family of genes has been reported to have further effects. US 2003/167537 (patented as US 6,717,034) reported that the proteins were useful to improve plant biomass. In the same light, the later application US 2007/022495 (patented as US 7,858,848) has mentioned the use of the genes/proteins for increasing the size of the plants, the yield, the size of the seeds, to increase photosynthesis and to increase several kinds of stress and pathogen tolerance or resistance.

Nevertheless, AHL proteins still produce hitherto unnoticed effects. Summary of the invention

The present invention is directed to a method to change an annual plant into a perennial plant, characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said annual plant. Also provided is a method to change a monocarpic plant into a polycarpic plant,

characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said monocarpic plant.

A further part of the invention is a method to change a herbaceous plant into a woody plant, characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said herbaceous plant. The method also is directed to a method to enhance branching in a plant, characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said plant. Also a method for keeping a plant cell in a juvenile state, characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said plant cell is provided in the current invention.

Further, a method for producing a perennial plant from an annual plant, characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said annual plant, is provided in the present invention.

Further, part of the invention is a method to increase the ploidy level in a plant or plant cell, characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said plant or plant cell. Also part of the invention is a method to prevent flowering in a plant characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said plant. Further part of the invention is a method to enhance production of secondary metabolites, preferably pharmaceutically active compounds, in a plant, characterised in that a protein selected from the A clade of

Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said plant

Preferably, in the above methods of the invention, said protein is selected from the group of Arabidopsis AHL15, AHL16, AHL 17, AHL18, AHL19, AHL20, AHL21, AHL22, AHL23, AHL24, AHL25, AHL26, AH27, AHL28, AHL29, B. oleracea AT-hook DNA-binding protein BoHookl, M. trunculata AT-hook DNA-binding protein XP_003616459.1 (Mtr_5g080580) and proteins that are more than 70% identical to said proteins.

Alternatively, said protein is an ortholog of Arabidopsis thaliana clade A AHL proteins, having a single copy AT-Hook motif with a core sequence RPRGR[P/A]GSKN[P/A]K followed by a PPC/DUF296 motif with a central G[R/T/Q/K] [F/Y][E/D]ILS sequence.

The invention further preferably includes an embodiment wherein introduction of the protein in the plant or plant cell is achieved via an expression vector. Said expression vector preferably comprises a nucleotide sequence that encodes for said protein, wherein said nucleotide sequence is selected from the group of sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27 and 29 and sequences that have an identity of more than 70%, preferably more than 80%, more preferably more than 85%, more preferably more than 90%, more preferably more than 95%, more preferably more than 96%, more preferably more than 97%, more preferably more than 98%,, preferably more than 99% with said sequences. Alternatively, introduction of the protein in the plant or plant cell is achieved via protein translocation. Also part of the invention is the use of a protein selected from the Arabidopsis thaliana A clade of AHL proteins or an ortholog of such a protein for increasing the ploidy levels in a plant or plant cell. Further, the invention comprises the use of a protein selected from the Arabidopsis thaliana A clade of AHL proteins or an ortholog of such a protein for changing an annual plant into a perennial plant, monocarpic to polycarpic. In another embodiment the invention comprises the use of a protein selected from the Arabidopsis thaliana A clade of AHL proteins or an ortholog of such a protein for increasing branching in a plant. Also, the invention comprises the use of a protein selected from the Arabidopsis thaliana A clade of AHL proteins or an ortholog of such a protein for maintaining a plant cell in a juvenile state.

Description of figures

Figure.1 Arabidopsis AHL15 and close homologs

redundantly prolong leaf juvenility during vegetative development

(A) The phenotype of 21-day-old wild type, ahll5 ahll9

35S::amiRAHL20, pAHL15::AHL15-GUS and ahll5 _PAHL15::AHL15-GUS plants grown under long day (LD) conditions. The AHL15-GUS protein has a dominant negative effect, causing strong phenotypes especially in the ahl 15 loss-of -function mutant background.

(B) Leave shape of 30-day-old wild type, ahll5 ahll9

35S::amiRAHL20, pAHL15::AHL15-GUS and ahll5 pAHL15::AHL15-GUS plants grown under LD.

(C) . GUS staining showing AHL15-GUS expression in a 6-day-old seedling and in juvenile (2^nd and 4^th) and adult (12^th) leaves of

pAHL15::AHL15-GUS plants under LD conditions.

(D) Quantitative RT-PCR analysis oiAHL15, AHL20, AHL29, and AHL 19 expression in the shoot 1, 2 and 3 weeks after germination in short day (SD) conditions. Error bars indicate minimum and maximum values of two biological replicates. Relative expression levels oiAHL genes in samples were normalized to ^-TUBULIN -6. Figure 2. Ectopic AHL15 expression induces juvenility traits during the adult reproductive phase of Arabidopsis.

(A) A rosette leaf -like bract formed on the first inflorescence node of wild type Arabidopsis in long day (LD) conditions.

(B) A rosette of juvenile leaves formed from the first inflorescence node of a 35S::AHL15 plant in LD conditions.

(C) An adult bract leaf formed form the first aerial node of a 35S::amiRAHL20 ahll5-l ahll9-l\Aant in LD conditions.

(D) A juvenile leaf -like bracts produced on a lateral inflorescence of a 4 months old 35S::AHL15 plant in LD.

(E) A bract leaf and a lateral inflorescence developing from an inflorescence node of an untreated 35S::AHL15-GR plant

(F) A rosette with juvenile leaves developing from an inflorescence node of a 35S::AHL15-GR plant 2 weeks after DEX application.

(G) Scanning electron micrographs of 35S::AHL15-GR epidermal leaf cells: a juvenile leaf (left) and an adult leaf (middle) of an untreated plant, and a juvenile-like leaf from an aerial rosette of a DEX treated plant (right).

(H, I) GUS activity in (H) a juvenile (left) or adult leaf (middle) or a bract (right) of an untreated 35S::AHL15-GR pSPL3::GUS-SPL3 plant, or in (I) four subsequent leaves of an aerial rosette produced by a 35S::AHL15- GR pSPL3::GUS-SPL3 plant after DEX application.

Figure 3. Shoot phenotype of wild type and 35S::AHL15 plants.

(A) Wild type (Col) plant grown in LD. (B) 35S::AHL15 plant grown in LD with many rosette leaves and branched inflorescences.

(C) 35S::AHL15 plant grown in SD with many rosette leaves and areal rosettes.

(D) A 35S::AHL15-GR plant grown in LD.

(E) A 35S::AHL15 -GR plant grown in LD following DEX treatment, showing many areal rosettes and increased branching. All plants are approximately shown at the same magnification. Figure 4. Ectopic AHL15 expression extents the life strategy of Arabidopsis.

(A) An axillary inflorescence meristem develops into an aerial rosette on an axil of a dead cauline leaf after seed ripening in a 4 month-old 35S::AHL 15 plant grown in LD.

(B) The production of aerial rosettes is induced after the top parts of inflorescences have been removed to harvest the seeds from a 5 months old 35S::AHL 15 plant grown in LD.

(C) Comparison of seed yield in grams per wild type or 35S::AHL15 plant grown in LD at 2, 3 or 4 months after flowering. Error bars indicate standard error of the mean of 6 biological replicates.

(D) Phenotype of a wild type (Col, left) and a 35S::AHL15 plant (right) in LD 3 months after flowering.

(E) Efficient production of new inflorescences and seed set after the first seed batch has been harvested from a 5 months old 35S::AHL15 plant grown in LD (see B).

(F) Induction of vegetative growth on inflorescences of a 5 months old 35S::AHL15-GR plant treated with DEX in LD.

Figure 5. Ectopic expression of AHL15 homologs and orthologs also extends the life strategy of Arabidopsis. (A,B) Phenotypic characterization of Arabidopsis plants overexpressing

Arabidopsis AHL15 homologs AHL19, AHL20, AHL27 and AHL29 (A) or the AHL15 orthologs from B. oleracea (35S::Bo-Hookl) and M. trunculata (35S::AC129090)(B) in LD. All overexpression lines produce aerial rosettes during seed ripening and display enhanced branching.

Figure 6. Secondary growth development in wild type and 35S::AHL15 plants.

(A, C) Cross-section of main inflorescence stem (4-5 mm above the rosette) from 2-weeks-old wild type (A) or 35S::AHL15 (C) plant.

(B) Cross-section of main inflorescence stem (5-7 mm above the rosette) from a 2-months-old wild type plant.

(D) Cross-section of main inflorescence stem (5-7 mm above the rosette) from 3-months-old 35S::AHL 15 plant, showing extensive secondary growth. Red lines in B and D indicate the positions of the zoomed in images on the right. All of the cross-sections are stained with toluidine blue.

Figure 7. AHL15 represses SPL genes expression in a miRNA-independent manner.

(A) Quantitative RT-PCR of the transcripts of SPLs genes in 2- week-old of 35S::AHL15-GR treated with DEX and in the absence of DEX.

(B) GUS activity showing of GUS-SPL3 expression in 3-week-old of 35S::AHL15-GR treated with DEX (bottom) and in the absence of DEX (upper).

(C) Quantitative RT-PCR of the transcripts of SPLs genes in the rosette base regions of 35S::AHL15 ines relative to wild-type 1 week after flowering.

(D and E) GUS staining showing GUS-SPL3 and SPL9-GUS expression in the rosette base regions of wild-type (D) and 35S::AHL15 (E) background 1 week after flowering. (F) The number of rosette leaves of lack abaxial trichome in

35S::AHL15, 35S::MIM156, and 35S::AHL15 35S::MIM 156 plants grown SD.

(G) Shoot phenotype of 35S::AHL15-GR and SPL9::rSPL9 double transgenic plants without DEX treatment (upper) and after DEX treatment

(bottom). (H) 21-day-old 35S::MIM156 (top) and 35S::AHL15 35S::MIM156 plants grown SD (bottom).

(I, J) GUS activity in 35S::AHL15-GR plants expressing miR156- resistant reporters for SPL3 and SPL9 (GUS-rSPL3, rSPL9-GUS) without DEX (I) and in present of DEX (G). In A and C, error bars indicate minimum and maximum values of two biological replicates. Samples were normalized to 6-TUBULIN-6.

Figure 8. AHL15 acts downstream of miR156.

(A) AHL15-GUS expression in wild-type and 35S::MIM156 background 1 week after germination.

(B) The phenotype of 21-day-old pAHL15::AHL15-GUS, 35S::miR156 and 35S::miR156 pAHL15::AHL15-GUS plants grown under LD conditions.

(C) Number of rosette leaves without abaxial trichomes produced in pAHL15::AHL15-GUS, 35S::miR156 and 35S::miR156 pAHL15::AHL15- GUS plants.

(D) Shoot phenotype of 35S::miR156, 35S::miR156

pAHL15::AHL15-GUS and spl9 spll5 plants grown under LD conditions.

(E) Vegetative growth on inflorescences of 4 month-old

35S::miR156 and 35S::miR156 35S::AHL15 planta under LD conditions.

(F) Quantitative RT-PCR analysis on AHL15 and close homologs in the areal node regions of spW spll5 relative to wild-type plants. Figure 9. Model for the role of AHL15 and close homologs in the regulation of vegetative phase change. After germination, high expression oiAHL15 and close homologs maintains the juvenile vegetative phase. Gradual down regulation of miR156 during the vegetative phase leads to upregulation of SPL gene expression, Increased SPL protein levels down regulate AHL genes, and induce a switch from juvenile to adult, and vegetative to reproductive phase. (Ectopically expressed) AHL proteins in turn repress SPL gene expression. Blunted lines indicate gene repression. Figure 10. Plants derived from 35S::AHL15-induced somatic embryos frequently are polyploid. A comparative analysis of the flower size, the chloroplast number in stomatal guard cells, and the nucleus size in root epidermis cells between a wild type plant and a 35S::AHL15 diploid or tetraploid plants derived from somatic embryos developing on germinating seedlings. The bigger flowers, the duplication of the chloroplast number from approximately 10 to 20 per paired guard cell, and the larger nucleus are typical for a tetraploid plant.

Figure 11. Polyploid cells occur in 35S::AHL15-induced but not in 2,4-D-induced embryonic callus.

(A,B) A fusion between the centromere-specific Histon 3 protein and GFP expressed from the CaMV 35S promoter (35S::CenH3-GFP) is used as marker for the ploidy number of cells. (A) Cells of a 2,4-D induced embryonic callus on wild type cotyledons of immature zygotic embryos (IZEs) are diploid, whereas (B) embryonic calli on 35S::AHL15 IZE cotyledons contain many polyploid cells.

Figure 12. Overview of the AT-hook motif in the AHL proteins. A. General overview of the organisation of the AHL protein, the AT-hook motif may be present in one or two copies; B. Phylogenetic tree showing the relation between the Arabidopsis AHL proteins; C and D:

Alignment of the the type I (C) and type II (D) At-hook motifs present in indicated AHL proteins (Figure from Zhao et al., 2013, PNAS) Figure 13. Ectopic expression of AHL15 induces juvenility traits and extends life strategy in tobacco.

(A, B) Two weeks old Nicotiana tabacum SRI 35S::AHL15-GR plants were transferred and grown for 1 week on medium without DEX (A), or on medium with DEX (B). The white arrows in (B) indicate juvenile-like leaves that developed after DEX induction.

(C, D) Seven weeks old Nicotiana tabacum SRI wild type (C) and 35S::AHL 15-GR (D) plants just before spraying with DEX, showing comparable phenotypes.

(E) Twelve weeks old Nicotiana tabacum SRI wild type and 35S::AHL15-GR plants, 5 weeks after spraying with DEX. The wild type plants senesce, whereas 35S::AHL15-GR plants stay green and produce branches with new leaves and flowers.

Detailed description of the invention

As used in the present application, the term plant refers to eukaryotic, autotrophic organisms, which are characterised by direct usage of solar energy for their primary metabolism, their permanent cell wall and in case of multicellular individuals their open unlimited growth. In case of heterotrophic plants, the organisms are in an evolutionary context essential- ly derived from autotrophic plants in their structure and metabolism.

With the term plant cell is meant any self-propagating cell bounded by a semi permeable membrane and containing one or more plastids. Such a cell requires a cell wall if further propagation is required. 'Plant cell', as used herein, includes without limitation, seeds, suspension cultures, embryos, meristematic regions, callous tissues, protoplasts, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores.

A construct is an engineered gene unit, usually involving a gene of interest (that has been fused to a promoter), a marker gene and

appropriate control sequences, to be transferred into the target tissue.

Transformant is a cultured plant or plant cell, that has been genetically altered through the uptake of nucleic acid(s). Such a nucleic acid is determined to be a heterologous nucleic acid if it is derived from a different species, or - when derived from the same species - if it is inserted in another locus in the genome than where it would occur naturally.

As used herein, the term variety is as defined in the UPOV treaty and refers to any plant grouping within a single botanical taxon of the lowest known rank, which grouping can be: (a) defined by the expression of the characteristics that results from a given genotype or combination of genotypes, (b) distinguished from any other plant grouping by the

expression of at least one of the said characteristics, and (c) considered as a unit with regard to its suitability for being propagated unchanged.

The term cultivar (for cultivated variety) as used herein is defined as a variety that is not normally found in nature but that has been cultivated by humans, i.e. having a biological status other than a "wild" status, which "wild" status indicates the original non-cultivated, or natural state of a plant or accession. The term "cultivar" further includes, but is not limited to, semi-natural, semi-wild, weedy, traditional cultivar, landrace, breeding material, research material, breeder's line, synthetic population, hybrid, founder stock/base population, inbred line (parent of hybrid cultivar), segregating population, mutant/genetic stock, and

advanced/improved cultivar.

As used herein, crossing means the fertilization of female plants (or gametes) by male plants (or gametes). The term "gamete" refers to the reproductive cell (egg or sperm) produced in plants by meiosis, or by first or second restitution, or double reduction from a gametophyte and involved in sexual reproduction, during which two gametes of opposite sex fuse to form a diploid or polyploid zygote. The term generally includes reference to a pollen (including the sperm cell) and an ovule (including the ovum).

Crossing therefore generally refers to the fertilization of ovules of one individual with pollen from another individual, whereas selfing refers to the fertilization of ovules of an individual with pollen from genetically the same individual.

A marker is any indicator that is used in methods for inferring differences in characteristics of genomic sequences or transform ants.

Examples of such indicators are antibiotic resistance markers, autotrophic markers, restriction fragment length polymorphism (RFLP) markers, amplified fragment length polymorphism (AFLP) markers, single nucleotide polymorphisms (SNPs), insertion mutations, microsatellite markers (SSRs), sequence-characterized amplified regions (SCARs), cleaved amplified polymorphic sequence (CAPS) markers or isozyme markers or combinations of the markers described herein which defines a specific genetic and chromosomal location.

As used herein, locus is defined as the genetic or physical position that a given gene occupies on a chromosome of a plant.

The term regeneration - in plant cultures - determines a morphogenetic response to a stimulus that results in the production of callus, organs, embryos or whole plants.

Shoot or axillarybranching is the process by which axillary meristems, located on the axils of leaves, develop in to buds that are subsequently activated to give new flowers or branches.

Phase transition or -change means that during development, the plant undergoes a transition from embryo development to a juvenile stage of vegetative development, followed by an adult stage of vegetative development (vegetative phase change) and a reproductive phase (reproductive phase change or floral induction), during which it produces flowers or other types of reproductive structures.

Rejuvenation is the reversal of a phase transition in plant development, for example from the reproductive- to the vegetative phase, or from the adult to the juvenile vegetative phase.

A juvenile state of a plant cell or -tissue is defined by the phase during vegetative development that leaf cells and tissues have juvenile characteristics, such as absence of trichomes on the abaxial (lower) side of the leaves, a low length/width (L/W) ratio of the leaf blade, a low degree of serration of the leaf margin and relatively large cell size, high expression of miR156, and low expression of the miR156 targets, the 10 members of the SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL) family of transcription factors.

A monocarpic plant is a plant that flowers and sets seeds one time and then dies. In contrast, polycarpic plants flower and set seeds multiple times during their life time.

An annual plant is a plant surviving just for one growing season during which reproduction takes place by formation of seed. A biennial plant is a flowering plant that takes two years to complete its life cycle, where the first year is used for vegetative growth while the plant flowers and dies in the second year. Annual and biennial plants are usually monocarpic. In contrast, a perennial plant is a plant that lives for more than a few years and where the survival of the plant often is caused by new outgrowths from a rootstock (in case of herbaceous perennials) or from a shrub or a tree (in case of woody perennials). Also included in the perennial plants are so-called 'evergreens', plants that retain a mantle of leaves throughout the year. Most perennial plants are polycarpic.

Vegetative propagation - reproduction of plants using a nonsexual process, usually involving the culture of vegetative plant parts such as stems and leaf cuttings. Ectopic expression: expression of a gene outside of its natural spatial and temporal expression pattern.

Polyploid cells and organisms are those containing more than two paired (homologous) sets of chromosomes. Most eukaryotic species are diploid, meaning they have two sets of chromosomes— one set inherited from each parent

Polyploidisation is the addition of one or multiple complete sets of chromosomes.

Doubled haploids (DHs) are plants that have two copies of each chromosome, (2n), like diploids, but were created from a single grain of pollen, an ovum, or indeterminate gametes that were cultured, their chromosomes doubled through chemical or genetic means, and the cultured tissue grown into a plant. The haploid genome of the gametes, when doubled, produces a plant with a complete genome, with two identical copies of every gene. Thus, DHs are homozygous at every locus. DHs have been made for many plants to assist breeding.

An AT-HOOK MOTIF CONTAINING NUCLEAR LOCALIZED protein or AHL protein is a protein that has one or two AT-hook DNA- binding motifs as well as a plant and prokaryote conserved domain of unknown function #296 (PPC/DUF296) (Fujimoto S. et al., 2004, Plant Mol. Biol. 56:225-239). This PPC/DUF296 domain plays a role in directing AHL proteins to the cell nucleus ( Zhao et al., 2013, Proc. Natl. Acad. Sci.

110:E4688-97, and to mediate protein-protein interactions between other AHL proteins or transcription factors (Zhao et al., 2013, Proc. Natl. Acad. Sci. 110:E4688-97. AHL proteins are thought to interfere with gene expression by binding adenine/thymine rich DNA with their AT-hook domain, At-hook domains are characterized by a central arginine-glycine- arginine (RGR) core element flanked on one or both sides by a proline.

Based on other conserved amino acids flanking the RGR core, a type I and a type II At-hook motif are distinguished (Huth, J. et al., 1997, Nat. Struct. Biol.4:657-665; Zhao et al., 2013, Proc. Natl. Acad. Sci. 110:E4688-97). While the RGR core provides a concave surface and fits the minor groove, the flanking proline residues take care that the remainder of the protein does not fill up the minor groove and accordingly provides a binding affinity in the millimolar range. Residues upstream and downstream of the RGR element provide additional affinity and DNA specificity. The type I AT-hook motif has conserved sequences GSKXK (GSKDKXKXP in AHL proteins) at the carboxy end of the RGR element, which has been suggested to enhance DNA binding affinity (Huth, J. et al., 1997, Nat. Struct. Biol.4:657-665; Zhao et al., 2013, Proc. Natl. Acad. Sci. 110:E4688-97).

In Arabidopsis this family of genes is well characterized and it consists of 29 members (designated AHLl to AHL29), in which two clades (A and B) can be recognized (Zhao et al., 2013, Proc. Natl. Acad. Sci.

110:E4688-97)). As will be clear from the experimental results, the current invention is mainly directed to clade A according to Zhou et al., hereinafter also indicated as the AHL 15 clade.

All the relevant AT-Hook proteins are part of clade A, members of which can be distinguished from B clade members by a single copy type I AT-Hook motif with the core sequence RPRGR[P/A]GSKN[P/A]K (see Fig. 12).

Zhao et al. (2013, Proc. Natl. Acad. Sci. 110:E4688-97) show that substituting the second R or G in the conserved core of (RGRPG) of the AT- Hook motif of AHL29/SOB3 with an H or Q respectively, generates a dominant negative protein that can not bind DNA anymore and also inhibits other redundantly acting AHL proteins, resulting in longer hypocotyls in the light. The reason for this is that AHL proteins form heterodimers and interact with other nuclear proteins via their PPC/DUF296 domain. This knowledge enables selection of useful mutants via TILLING, TALENS, ZF- nucleases or CRISPR/Cas, as these methods are well-established tools for site-specific introduction of basepair changes needed to obtain the desired amino acid substitution Such plants would be useful because they have a very quick generation time and would thus be ideal for testing in breeding.

Alternatively, a gene coding for such a mutant protein may be introduced into a plant under control of an inducible promoter. The, at the moment it is needed, the expression of the protein can be initiated and the ageing process caused by inhibition of the endogenous or heterologous AHL clade 15 proteins will occur, resulting e.g. in a hastened setting of seed. It will be clear to the skilled person that a temporary reversal of the processes that are cuaued by overexpression of the AHL 15 clade proteins may be useful. .

Members of the Arabidopsis AHL A clade and orthologs thereof in other plant species are characterized by a single copy AT-Hook motif with the core sequence RPRGR[P/A]GSKN[P/A]K followed by a PPC/DUF296 motif where the central G[R/T/Q/K][F/Y][E/D]ILS sequence has been shown to be important for interaction with non-AHL nuclear proteins (Zhou et al., 2013). The sequences of the Arabidopsis proteins of the AHL 15 clade are given as SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 and 30. These proteins and the genes encoding them have sometimes been indicated in the present text as close homologs.

The term nucleic acid means a single or double stranded DNA or RNA molecule.

The term functional fragment thereof is typically used to refer to a fragment of an AHL protein that is capable of providing the effects as determined in the claims of the present application.

The term functional homologue is typically used to refer to a protein sequence that is highly homologous to or has a high identity with the herein described AHL proteins belonging to the AHL 15 clade, which protein is capable of providing the effects as determined in the claims of the present application. Included are artificial changes or amino acid residue substitutions that at least partly maintain the effect of the AHL15 clade protein. For example, certain amino acid residues can conventionally be replaced by others of comparable nature, e.g. a basic residue by another basic residue, an acidic residue by another acidic residue, a hydrophobic residue by another hydrophobic residue, and so on. Examples of hydrophobic amino acids are valine, leucine and isoleucine. Phenylalanine, tyrosine and tryptophan are examples of amino acids with an aromatic side chain, and cysteine and methionine are examples of amino acids with sulphur- containing side chains. Serine and threonine contain aliphatic hydroxyl groups and are considered to be hydrophilic. Aspartic acid and glutamic acid are examples of amino acids with an acidic side chain. In short, the term functional homologue thereof includes variants of the AHL15 clade protein in which amino acids have been inserted, replaced or deleted and which at least partly maintain the effect of the AHL15 clade protein (i.e. the effects as determined in the claims of the present application). Preferred variants are variants which only contain conventional amino acid

replacements as described above and especially where these changes do not occur in the above defined At-hook motif (RPRGR[P/A]GSKN[P/A]K) and the PPC/DUF296 domain (G[R/T/Q/K][F/Y][E/D]ILS). A high identity in the definition as mentioned above means an identity of at least 80, 85 or 90%. Even more preferred are amino acids that have an identity of 91, 92, 93, 94 or 95%. Most preferred are amino acids that have an identity of 96, 97, 98 or 99% with the amino acid sequence of an AHL15 clade protein

A functional homologous nucleic acid sequence is a nucleic acid sequence that encodes a functional homologous protein as described above.

Homology and/or identity percentages can for example be determined by using computer programs such as BLAST, ClustalW or ClustalX. Functional homologs in other plants are listed as SEQ ID NOs 31- 158 (in most cases both the nucleic acid and the orthologous protein encoded by it are given). All of these proteins listed in this part of the sequence listing are deemed to fall within the definition of a functional homologous protein and the nucleid acid sequences within the definition of a functional homologous nucleic acid sequence.

Many nucleic acid sequences code for a protein that is 100% identical to any of the AHL15 clade proteins. This is because nucleotides in a nucleotide triplet may vary without changing the corresponding amino acid (wobble in the nucleotide triplets). Thus, without having an effect on the amino acid sequence of a protein the nucleotide sequence coding for this protein can be varied. However, in a preferred embodiment, the invention provides a method comprising transforming plants with a nucleic acid sequence that occurs in nature and codes for an AHL15 clade protein or a functional homologous protein thereof.

It is clear to a person skilled in the art that through the provision of accession numbers Arabidopsis proteins and orthologs in Medicago and rice a generic group of AHL15 clade proteins of the invention is disclosed, which gives the person skilled in the art access to the amino acid sequences and the nucleotide sequences coding for these proteins. On basis of these sequences homologous proteins derived from other plant sources (also called orthologues, paralogues) can be easily found. Thus also encompassed by the present invention are homologous proteins of the proteins of the invention derived from other plant sources. Orthologues or paralogues of proteins of the invention can be identified through searching established public databases such as the NCBI databases [http://www.ncbi.nlm.nih.gov/]. The terms stringency or stringent hybridization conditions refer to hybridization conditions that affect the stability of hybrids, e.g., temperature, salt concentration, pH, formamide concentration and the like. These conditions are empirically optimised to maximize specific binding and minimize non-specific binding of primer or probe to its target nucleic acid sequence. The terms as used include reference to conditions under which a probe or primer will hybridise to its target sequence, to a detectably greater degree than other sequences (e.g. at least 2-fold over background). Stringent conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridise specifically at higher

temperatures. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridises to a perfectly matched probe or primer. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M Na+ ion, typically about 0.01 to 1.0 M Na+ ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes or primers (e.g. 10 to 50 nucleotides) and at least about 60°C for long probes or primers (e.g. greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringent conditions or "conditions of reduced stringency" include hybridization with a buffer solution of 30% formamide, 1 M NaCl, 1% SDS at 37°C and a wash in 2x SSC at 40°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in O.lx SSC at 60°C. Hybridization procedures are well known in the art and are described in e.g. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. eds. (1998) Current protocols in molecular biology. V.B. Chanda, series ed. New York: John Wiley & Sons. The present invention now provides a method for changing an annual plant into a perennial plant by introducing into said plant an

(over)expression of a protein from the AHL15 clade or an ortholog or functional fragment thereof. In agriculture it is often advantageous to have a perennial plant, since this means that no specific uprooting of old plants and sowing of new seeds needs to be performed before a new growth and harvest cycle can be started. Especially for those crop plants where the produce is formed by stems and leaves there is an advantage if by simply cutting the full grown stems or leaves from the plants and then further culturing the plants until new stems and leaves are formed the harvest cycle can be performed. For those plants, the specific embodiment that providing the plants with a protein from the AHL15 clade or functional homologue, an ortholog or functional fragment thereof would also result in the prevention of flowering is an additional boost for the development of harvestable stems and leaves. Plants that would be very suitable in this respect are lettuce (Lactuca spp, especially L. sativa), tomato (Solanum lycopersicum), Brasssica sp. (especially the Brassica varieties that are eaten as cabbage or sprouts), oil seed crops, Camellia sinensis (tea plant) and tobacco. Changing an annual plant into a perennial plant is also very advantageous for a continuous production of seeds. Beyond the mere production of seeds, an additional advantage is that the time to produce new plants is shorter, which is a tremendous advantage in breeding. Using plants according to the invention, i.e. plants that have been provided with a protein from the AHL15 clade or functional homologue, an ortholog or functional fragment thereof, decreases the time that is needed to grow and develop newe varieties.

Further part of the invention is a method of changing a monocarpic plant into a polycarpic plant. It will be readily understood that polycarpy is a characteristic that is very advantageous in crop plants, where the number of harvests can be increased over time by changing from monocarpy to polycarpy. It has also been found that by introducing into a plant an

(over)expression of a protein from the AHL15 clade or an ortholog or functional fragment thereof the plant will increase shoot branching, meaning that axillary meristems, located on the axils of leaves, develop in to buds that are subsequently activated to give new flowers or branches. Such an increase in branching is especially useful in crops where the branches or leaves are the produce that needs to be harvested. Accordingly, this effect adds to the effect of making plants perennial. However, also plants that are already perennial may benefit from an increased branching. In a next embodiment the invention comprises (over)expression of an AHL15 clade protein or an ortholog or functional fragment thereof for keeping plants or the tissue of such plants in a juvenile state.

A juvenile state of a plant cell or -tissue is used with respect to leaf cells and tissues, and is defined by the phase during vegetative development that plant tissues have juvenile characteristics, such as absence of trichomes on the abaxial (lower) side of the leaves, a low length/width (L/W) ratio of the leaf blade, a low degree of serration of the leaf margin being relatively large in cell size, high expression of miR156, and low expression of its targets, the 10 members of the SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL) family of transcription factors. Juvenile leaves are less prone to senescence and may contain higher metabolites for defense.

However, the action of AHL15 is not limited to this change. During development, a plant undergoes several phase transitions from embryo development to a juvenile stage of vegetative development, followed by an adult stage of vegetative development (vegetative phase change) and a reproductive phase (reproductive phase change or floral induction), during which it produces flowers or other types of reproductive structures. AHL15 can be used to induce rejuvenation, a reversal of a phase transition in plant development, for example from the reproductive to the vegetative phase, or from the adult to the juvenile vegetative phase.

Ectopic expression of the AHL proteins can be used to reverse these phase changes, whereas inhibition of the expression of the proteins or an other event that generates loss-of-function can be used to enhance the phase changes resulting in a more rapid plant life cycle.

One of the accompanying effects of the juvernile characteristics is that such tissues are known to produce more secondary metabolites.

Accordingly, the invention comprises a method of enhancing the production of secondary metabolites. Such secondary metabolites may be any

seconmdary metabolites, but preferred are thos that have pharmaceutical activity such as, but not limited to polyphenols (like phenylpropanoids, kaempferol and its derivatives, quercetin and tannins), glucosinolates, (like glucosinates, sinigrin), isoprenoids (like carotenoids - like vitamin A -, phytosterols, vitamin E, terpenoids), sinapic acid, gallic acid and gamma- amino butyric acid (GAB A).

Also, an increase in the amount of secondary metabolites that are produced generally will also increase the resistance to pests and pathogens, since many of the secondary metabolites that are produced in (juvenile) plants have antibiotic activity.

Further, the invention provides a method for producing a higher ploidy level in a plant or plant cell by introducing into said plant or cell an (over)expression of a protein from the AHL 15 clade or an ortholog or functional fragment thereof. Although most organisms have a diploid genome, in plants also other ploidies are found. A substantial number of plants know tetraploid varieties (such as potato), but also triploid, hexaploid (wheat) and octoploid (canola) variations are found. In general, it can be stated that polyploid plants have a larger vigour, which means that they provide a higher yield and are less sensitive to stress and/or pathogens. The increase in nuclear ploidy affects the structural and anatomical

characteristics of the plant. In general, polyploidy results in increased leaf and flower size, stomatal density, cell size and chloroplast count. These phenomena are collectively referred to as the gigas effect (Acquaah, G. Principles of plant genetics and breeding, Blackwell Publishing, Oxford, UK, 2007).

Physiological changes are also known to accompany genome duplication. These mainly result from change of metabolism resulting in a general increase in secondary metabolites. This property has found application in the breeding of medicinal herbs in the production of

pharmaceuticals.

Further, high frequencies of chromosome mutations are desirable in modern breeding techniques, such as tilling, as they provide new sources of variation. The multi-allelic nature of loci in polyploids has many

advantages that are useful in breeding. The masking of deleterious alleles, that may arise from induced mutation, by their dominant forms cushions polyploids from lethal conditions often associated with inbred diploid crops. This concept has been instrumental in the evolution of polyploids during bottlenecks where there is enforced inbreeding (Comai, L., 2005, Nature Rev. Gen. 6:836-846). Mutation breeding exploits the concept of gene redundancy and mutation tolerance in polyploid crop improvement in two ways. First, polyploids are able to tolerate deleterious allele modifications post-mutation, and secondly, they have increased mutation frequency because of their large genomes resulting from duplicated condition of their genes. Another application in breeding is the doubled haploid technology, which is especially used in reverse breeding (Dirks, R. et al., 2009, Plant Biotechnol. J. 7, 837-845). Development of reverse breeding up till now was limited to those crops where double haploid formation (from achiasmatic meiosis) has been common practice, but now also the crops in which double haploids are not or rarely available, such as soybean, lettuce and tomato may be used in this technology.

The seedless trait of triploids has been desirable especially in fruits. Commercial use of triploid fruits can be found in crops such as watermelons. Tripoid plants are produced artificially by first developing tetraploids, which are then crossed with diploid watermelon, resulting in sterile triploid plants that sets seedless fruits when pollinated by a desirable diploid pollen donor. Plants that may be advantageously increased in ploidy are plants of which it has been established that an increase in ploidy also provides an increase in the production of primary and secondary

metabolites. This has been widely exploited in the breeding of narcotic plants such as Cannabis, Datura and Atropa (De Jesus-Gonzalez L.,

Weathers P. (2003) Plant Cell Rep. 21:809-813; Dhawan O., Lavania U. (1996) Euphytica 87:81-89; Levi A., (1983) American Naturalist 122: 1-25). In vitro secondary metabolite production systems that exploit polyploidism have also been developed. The production of the antimalarial sesquiterpene artemisinin has been enhanced six fold by inducing tetraploids of the wild diploid Artemisia annua L. (clone YUT16) (De Jesus-Gonzalez and

Weathers, 2003). In addition, commercial synthesis of sex hormones and corticosteroids has been improved significantly by artificial induction of tetraploids from diploid Dioscorea zingiber ensis, native to China (Heping H. et al., (2008) In Vitro Cellular & Developmental Biology-Plant 44:448-455). Attempts have been made to improve the production of pyrethrin, a botanical insecticide, by chromosome doubling of Chrysanthemum cinerariifolium (Liu Z., Gao S. (2007) In Vitro Cellular & Developmental Biology-Plant 43:404-408). Other plants whose production of terpenes has increased following artificial chromosome doubling include Carum cari, Ocimum kilmandscharicum and Mentha arvensis (Bose R., Choudhury J. (1962) Caryologia 15:435-453; Levi A., 1983). The enhanced production of secondary metabolites such as alkaloids and terpenes in polyploids may concurrently offer resistance to pests and pathogens. Experiments with diploid Glycine tabacina, a forage legume, and its tetraploid forms to measure resistance to leaf rust, Phakopsora pachyrhizi, established that 42% of the tetraploid plants were resistant compared to 14% of the diploid plants (Levi, A., 1983). Similar results were observed while comparing resistance to insects and the clover eel nematode between Trifolium pratense (red clover) tetraploids and diploids (Mehta R., Swaminathan M. (1957) Ind. J. Genet. PL Breed 17:27-57).

The above-mentioned methods are especially advantageous when the protein is selected from the list of AHL15, AHL16, AHL17, AHL18, AHL19, AHL20, AHL21, AHL22, AHL23, AHL24, AHL25, AHL26, AHL27 and AHL29. Preferred is an embodiment wherein the protein is AHL15. These proteins may be derived from Arabidopsis, but they may also be derived from ortholog sources, such as B. oleracea AT-hook DNA-binding protein BoHookl, M. trunculata AT-hook DNA-binding protein

XP_003616459.1 (Mtr_5g080580) and proteins that are more than 70% identical to said proteins.

Overexpression of this protein can be provided by making a plant transgenic for such a protein by introducing an expression vector in a plant tissue or plant cell and regenerating a transgenic plant from said cell or tissue, but it can also be achieved by putting a strong promoter in front of a naturally occurring coding sequence for an AHL15 clade protein. It may also be achieved by crossing of a plant that already is overexpressing an AHL15 clade protein and checking the offspring for overexpressors. This is especially useful to enable crossings between plants of different ploidy, which are then made of equal ploidy by the overexpression of the AHL15 clade protein. Transient presence be achieved by just introducing the protein by injection of the protein, by agro-injection (e.g. with

Agrobacterium or any other plant invading micro-organism which is capable of expressing the protein) or through any other means (e.g. protein translocation). It is also possible to enhance expression of the protein in a plant which already contains a gene that is capable of expression of the protein by chemical induction of gene expression. For specific expression of the protein it should be investigated which chemical compound is capable of enhancing expression. This can be performed in a chemical screening in which chemical compounds are tested on a fusion protein comprising the AHL promoter and a reporter gene. To check for specific gene induction in vivo it is possible to perform a transcriptome profiling study after treatment with the selected chemical.

The effects of the invention may be produced by expression constructs having a nucleotide sequence of the invention under the control of a suitable promoter/regulatory element. By regulatory element it is meant those that include developmentally regulated, tissue specific, inducible and constitutive regulatory elements/promoters.

A regulatory element that is developmentally regulated, or controls the differential expression of a gene/nucleotide under its control, is activated within certain organs or tissues of an organ at specific times during the development of that organ or tissue. However, some regulatory elements that are developmentally regulated may preferentially be active within certain organs or tissues at specific developmental stages, they may also be active in a developmentally regulated manner, or at a basal level in other organs or tissues within the plant as well, such regulatory elements are considered "tissue specific". Regulatory elements may be found either upstream, within, downstream, or a combination thereof, of the coding region of a gene.

An inducible regulatory element is one that is capable of directly or indirectly activating transcription of one or more nucleotide sequences or genes in response to an inducer. In the absence of an inducer the nucleotide sequences or genes will not be transcribed. Typically the protein factor that binds specifically to an inducible regulatory element to activate

transcription, is present in an inactive form which is then directly or indirectly converted to the active form by the inducer. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress imposed directly by heat, cold, salt, or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus. A plant cell containing an inducible

regulatory element may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or similar methods. A preferred inducible promoter element is the glucocorticoid receptor ligand (GR), which has been used in the experimental section of the present description. Preferably said fusion protein will then be induced by addition of dexamethasone (DEX).

A constitutive regulatory element directs the expression of a gene throughout the various parts of a plant and continuously throughout plant development. Examples of known constitutive regulatory elements include promoters such as promoters associated with the CaMV 35S transcript. (Odell et al., 1985, Nature, 313: 810-812), the rice actin 1 (Zhang et al, 1991, Plant Cell, 3: 1155-1165) and triosephosphate isomerase 1 (Xu et al, 1994, Plant Physiol. 106: 459-467) genes, the maize ubiquitin 1 gene (Cornejo et al, 1993, Plant Mol. Biol. 29: 637-646), the Arabidopsis ubiquitin 1 and 6 genes (Holtorf et al, 1995, Plant Mol. Biol. 29: 637-646), and the tobacco translational initiation factor 4A gene (Mandel et al, 1995 Plant Mol. Biol. 29: 995-1004), chimeric promoters like ferredoxin /RolD and the like, tissue specific promoters like root, shoot and epidermal, endosperm specific promoters (e.g. Rubisco (shoot specific), ferredoxin (shoot specific, RolD (root specific), lipid transfer protein (LTPl), Arabidopsis thaliana meristem layer 1 (ATML1; epidermis specific) and CycBi promoter, - or D-hordein promoter, UFO promoter (shoot meristem specific promoter) and the like. Also included are inducible and developmentally regulated promoters maize ubiquitin promoter, the cell division cycle promoter CDC2, ACT2 promoter from Arabidopsis thaliana, heat shock inducible promoter, pathogen inducible promoters, stress inducible promoters (like chitinase promoter) and the like.

A tissue specific promoter may be used to specifically generate expression in a specific tissue, meaning that in other tissues of the same plant no or hardly any expression of the proteinunder control of the specific promoter will be present. It is - for the various embodiments of the present invention - important to realize that using a constitutive promoter as defined above - will result in slow development during the early stages. Hence, an inducinble or a tissue specific promoter may be used to overcome this drawback.preferred tissue-specific promoters are the BRCl promoter from Arabidopis thaliana, which causes specific expression in axillary buds, or the LEAFY promoter of Arabidopsis thaliana which is active at the moment of transition to flowering.

Interesting promoters to combine with a AHL-GR fusion construct are the ML1 promoter of Arabidopsis thaliana (AtMLl), which is specific for the LI layer (epidermis) of the shoot apex, the WUS promoter and the CLV3 promoter of Arabidopsis thaliana which are both specific for the shoot apical meristem (SAM) stem cells.

In all cases when using gene constructs for expression of the protein, at the other end of the construct a terminator is provided which causes transcription to cease. This can be any terminator which functions in plants. Particularly preferred are the NOS, OCS and 35S terminator or the potato protease inhibitor II (potpill) terminator. Methods which are well known to those skilled in the art can be used to construct expression vectors containing a nucleotide sequence of the invention, and appropriate transcriptional and translational controls. These methods include in-vitro recombinant techniques. Such techniques are described in Sambrook et al., 1989. Molecular cloning a laboratory manual, cold spring Harbour press, Plain view, NY and Ausubel FM et al., (1989) Current protocols in molecular biology, John Wiley and Sons, New York, NY.

The recombinant gene constructs may be inserted into vectors, which may be commercially available, suitable for transforming into plants and suitable for the expression of the gene product in transformed (plant) cells.

For example in order to express a biologically active polypeptide, or functional equivalents or fragments thereof, the nucleotide sequence encoding the polypeptide, is inserted into the appropriate expression vector (i.e. a vector that contains the necessary elements for the transcription or translation of the inserted coding sequence). Specific initiation signals may also be required for efficient translation of the polypeptides of the invention. These signals include the ATG initiation codon and adjacent sequences. In cases where the polypeptides, their initiation codons and upstream sequences are inserted into the appropriate expression vector, no additional translational control systems including the ATG initiation codon must be provided. Furthermore, the initiation codon must be in the correct reading frame to ensure transcription of the entire insert. Exogenous transcriptional elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of enhancers appropriate to the cell system in use (Scharf D et al (1994) Results Prob Cell Differ 20: 125-62; Bittner et al. (1987) Methods in Enzymol 153: 516-544).

In developing the expression cassette, the various fragments comprising the regulatory regions and open reading frame may be subjected to different processing conditions, such as ligation, restriction enzyme digestion, resection, in-vitro mutagenesis, primer repair, use of linkers and adapters and the like. Thus, nucleotide transitions, transversions,

insertions, deletions and the like, may be performed on the DNA which is employed in the regulatory regions and/or open reading frame. The expression cassette may be wholly or partially derived from natural sources endogenous to the host cell.

The nucleotide sequences of the present invention can be

engineered in order to alter the coding sequence for a variety of reasons, including but not limited to, alterations which modify the cloning,

processing, and/or expression of the gene product. For example mutations may be introduced using techniques which are well known in the state of the art, e.g. site directed mutagenesis to insert new restriction sites, to alter glycosylation patterns, to change codon usage, to produce splice variants etc. Codons may be selected to increase the rate at which expression of the peptide occurs in a particular expression hosts in accordance with the frequency with which particular codons are utilised by the host (Murray E et al. (1989) Nuc Acids Res 17: 477-508). Other reasons for substantially altering the nucleotide sequence(s) of the invention and their derivatives, without altering the encoded amino acid sequences include the production of RNA transcripts having more desirable properties, such as a greater half life, than transcripts produced from naturally occurring sequences.

As will be further outlined below there are multiple ways in which a nucleic acid of the invention can be transferred to a plant. One suitable means of transfer is mediated by Agrobacterium in which the nucleic acid to be transferred is part of a vector, preferably a binary vector. Another suitable means is by crossing a plant which contains a gene encoding for an AHL15 clade protein or a homologue thereof with a plant that does not contain such a gene and to identify those progeny of the cross that have inherited the gene coding for the AHL15 clade protein or homologue thereof.

Besides by Agrobacterium -mediated transformation, there are other means to effectively deliver DNA to recipient plant cells when one wishes to practice the invention. Suitable methods for delivering DNA to plant cells are believed to include virtually any method by which DNA can be introduced into a cell, such as by direct delivery of DNA such as by PEG- mediated transformation of protoplasts, by desiccation/inhibition-mediated DNA uptake (Potrykus, L, et al., Mol. Gen. Genet., 199: 183- 188, 1985), by electroporation (U.S. Pat. No. 5,384,253), by agitation with silicon carbide fibers (Kaeppler, H.F., et al., Plant Cell Reports, 9:415-418, 1990; U.S. Pat. No. 5,302,523; U.S. Pat. No. 5,464,765), and by acceleration of DNA coated particles (U.S. Pat. No. 5,550,318; U.S. Pat. No. 5,538,877; U.S. Pat. No. 5,538,880). Through the application of techniques such as these, cells from virtually any plant species may be stably transformed, and these cells may be developed into transgenic plants.

In case Agrobacterium-mediated transfer is used, it is preferred to use a substantially virulent Agrobacterium species, such as A. tumefaciens, as exemplified by strain A281 or a strain derived thereof or another virulent strain available in the art. These Agrobacterium strains carry a DNA region originating from the virulence region of the Ti plasmid pTiBo542, which coordinates the processing of the T-DNA and its transfer into plant cells. Agrobacterium-based plant transformation is well known in the art (as e.g. described in, for example by Komari, T., et al., Plant Transformation

Technology: Agrobacterium-Mediated Transformation, in: Handbook of Plant Biotechnology, Eds. Christou, P., and Klee, H., John Wiley & Sons, Ltd, Chichester, UK 2004, pp. 233-262).

To aid in identification of transformed plant cells, the constructs may be further manipulated to include plant selectable markers. Useful selectable markers include enzymes which provide for resistance to an antibiotic such as gentamycin, hygromycin, kanamycin, and the like.

Similarly, enzymes providing for production of a compound identifiable by colour change such as GUS (beta-glucuronidase), fluorescence or

luminescence, such as luciferase or green fluorescent protein are useful. To overcome regulatory obstacles, a marker-free transformation protocol may be used, such as described in WO 03/010319.

Alternatively, the gene encoding an AHL15 clade protein or a functional homolog thereof may be introduced into a plant by crossing. Such a crossing scheme starts off with the selection of a suitable parent plant. This can be a plant that has been provided with a gene encoding the AHL15 clade protein as described above, or it may be a plant that already in nature contains a gene encoding an AHL15 clade protein.

Selection of suitable parent plants that can be used for breeding varieties is based on the herein provided nucleic acid sequences. Selection then can be performed with probes and primers (i.e. oligonucleotide sequences complementary to one of the (complementary) DNA strands of the nucleotide sequence encoding the AHL15 clade protein or a functional homolog thereof. Probes are for example useful in Southern or Northern analysis and primers are for example useful in PCR analysis. Primers based on nucleic acid sequences are very useful to assist plant breeders active in the field of classical breeding and/or breeding by genetic modification of the nucleic acid content of a plant in selecting a plant that is capable of expressing an AHL15 clade protein or a functional fragment or functional homolog thereof.

Hence, in a further embodiment, the invention provides a method for selecting a plant or plant material or progeny thereof for its ability to produce an AHL15 clade protein, said method comprising the steps of testing at least part of said plant or plant material or progeny thereof for the presence or absence of a nucleic acid as provided herein. One can for example use a PCR analysis to test plants for the presence of absence of the AHL15 gene in the plant genome. Such a method would be especially preferable in marker-free transformation protocols, such as described in WO 03/010319. Any suitable method known in the art for crossing selected plants may be applied in the method according to the invention. This includes both in vivo and in vitro methods. A person skilled in the art will appreciate that in vitro techniques such as protoplast fusion or embryo rescue may be applied when deemed suitable.

Selected plants that are used for crossing purposes in the methods according to the invention may have any type of ploidy. For example, selected plants may be haploid, diploid or tetraploid. It may be the purpose of the present invention to provide a plant with an AHL15 clade protein which causes polyploidy in a plant in order to cross such a plant with a plant that already has such a higher ploidy. This would automatically select for plants having an equal ploidy, since in most cases crossing of plants with an unequal ploidy results in sterile offspring. E.g. crossing a diploid plant with a tetraploid plant will result in triploid offspring that is sterile.

One of the effects of (over)expression of an AHL15 clade protein is an increase in the ploidy of the plant. Thus, when plants are taken that are diploid, their ploidy can be increased to tetraploid level by introducing an AHL15 clade protein of the invention in order that they may be crossed with another tetraploid plant

Plants of higher ploidy are generally preferred, since they have a larger vigour than plants of the same genus but with a lower ploidy. Most polyploids display heterosis relative to their parental species, and may display novel variation or morphologies that may contribute to the processes of speciation and eco-niche exploitation. Preferably, selected plants are crossed with each other using classical in vivo crossing methods that comprise one or more crossing steps including selfing. By applying such classical crossing steps characteristics of both the parents can be combined in the progeny. For example, a plant that provides a high yield can be crossed with a plant that contains large amounts of a certain nutrient. Such a crossing would provide progeny comprising both characteristics, i.e. plants that not only comprise large amounts of the nutrient but also provide high yields.

When applying backcrossing, Fl progeny is crossed with one of its high-yielding parents P to ensure that the characteristics of the F2 progeny resemble those of the high-yielding parent. For example, a selected diploid potato with bacterial resistance is made tetraploid by providing an AHL15 clade protein and then crossed with a selected high-yielding tetraploid potato cultivar, with the purpose of ultimately providing a high-yielding tetraploid progeny having bacterial resistance. Also selfing may be applied. Selected plants, either parent or progeny, are then crossed with themselves to produce inbred varieties for breeding. For example, selected specimens from the above mentioned Fl progeny are crossed with themselves to provide an F2 progeny from which specimens can be selected that have an increased level of resistance.

After transfer of a nucleic acid into a plant or plant cell, it must be determined which plants or plant cells have been provided with said nucleic acid. When selecting and crossing a parental genotype in a method according to the invention, a marker is used to assist selection in at least one selection step. It is known in the art that markers, indicative for a certain trait or condition, can be found in vivo and in vitro at different biological levels. For example, markers can be found at peptide level or at gene level. At gene level, a marker can be detected at RNA level or DNA level. Preferably, in the present invention the presence of such a marker is detected at DNA level or peptide level, using primers and/or probes recognizing and binding to the nucleic acids encoding the AHL15 clade protein. Alternatively, presence of AHL15 clade protein or a functional homolog thereof can be assessed in plant parts by performing an

immunoassay with an antibody that specifically binds the protein. In case of transgenic approaches selecting a transformed plant may be accomplished by using a selectable marker or a reporter gene. Examples of suitable markers include genes that provide antibiotic or herbicide resistance. Thus anti-metabolite, antibiotic or herbicide resistance can be used as the basis of selection; for example, dhfr which confers resistance to methotrextate (Wiger M. et al. (1980) Proc Natl Acad Sci 77: 3567-70), npt, which confers resistance to the aminoglycosides neomycin and G-418 (Colbere-Garapin F. et al. (1981), J Mol Biol 150: 1-14) and als and pat, which confer resistance to chlorsulfuron and phosphinotricin, respectively (Murry supra). Additional selectable genes have been described, for example, trpB, which allows cells utilise indole in place of tryptophan, or His D, which allows cells to utilise histinol in place of histidine (Hartman SC and RC Mulligan (1988) Proc Natl Acad Sci 85: 8047-51). Alternatively one could use visible markers such as anthocyanins, beta-glucuronidase (GUS) and its substrates e.g. X-gluc, , GFP and variants, and luciferase and its substrate, luciferin, which are widely used to identify transformants, but also to quantify the amount of stable protein expression attributable to a specific vector system (Rhodes CA et al. (1995) Methods Mol Biol 55: 121-131.

The procedure or method for preparing a transformant can be performed according to the conventional technique used in the fields of molecular biology, biotechnology and genetic engineering. Manipulation of DNA sequences in plant cells may be carried out using the Cre/loxP site specific recombination system as outlined in patent application W09109957. An entire plant can be generated from a single transformed plant cell through culturing techniques known to those skilled in the art.

Regeneration of plants from transformed material can be accomplished through somatic embryogenesis (the structures formed are bipolar with cotyledons and roots) or organogenesis (formation of shoots or roots).

Some plant species as yet remain recalcitrant in culture, not forming shoots or embryos even under a multitude of different culture conditions, the practising of the invention in such plant species is merely a matter of time and not a matter of principle, because the amenability to genetic transformation as such is of no relevance to the underlying concept of the invention.

Efficient transformation and regeneration methods are a priority for successful application of genetic engineering to the improvement of vegetative propagated plants. Transformation of plant species is now routine for an impressive number of plant species, including both the

Dicotyledoneae as well as the Monocotyledoneae. In principle any transformation method may be used to introduce chimeric DNA according to the invention into a suitable ancestor cell. Methods may suitably be selected from the calcium/polyethylene glycol method for protoplasts (Krens, F.A. et al., 1982, Nature 296, 72-74; Negrutiu I. et al, June 1987, Plant Mol. Biol. 8, 363-373), electroporation of protoplasts (Shillito R.D. et al., 1985

Bio/Technol. 3, 1099-1102), microinjection into plant material (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179- 185), (DNA or RNA-coated) particle bombardment of various plant material (Klein T.M. et al., 1987, Nature 327, 70), infection with (non-integrative) viruses, in planta Agrobacterium tumefaciens mediated gene transfer by infiltration of adult plants or transformation of mature pollen or microspores (EP 0 301 316) and the like. A preferred method according to the invention comprises Agrobacterium- mediated DNA transfer. Especially preferred is the use of the so-called binary vector technology as disclosed in EP A 120 516 and U.S. Patent 4,940,838).

Although considered somewhat more recalcitrant towards genetic transformation, monocotyledonous plants are amenable to transformation and fertile transgenic plants can be regenerated from transformed cells or embryos, or other plant material. Presently, preferred methods for

transformation of monocots are microprojectile bombardment of embryos, explants or suspension cells, and direct DNA uptake or (tissue)

electroporation (Shimamoto, et al, 1989, Nature 338. 274-276). Transgenic maize plants have been obtained by introducing the Streptomyces

hygroscopicus bar-gene, which encodes phosphinothricin acetyltransferase (an enzyme which inactivates the herbicide phosphinothricin), into embryogenic cells of a maize suspension culture by microprojectile

bombardment (Gordon-Kamm, 1990, Plant Cell, 2, 603-618). The

introduction of genetic material into aleurone protoplasts of other monocot crops such as wheat and barley has been reported (Lee, 1989, Plant Mol. Biol. 13, 21-30). Wheat plants have been regenerated from embryogenic suspension culture by selecting embryogenic callus for the establishment of the embryogenic suspension cultures (Vasil, 1990 Bio/Technol. 8, 429-434). The combination with transformation systems for these crops enables the application of the present invention to monocots.

Monocotyledonous plants, including commercially important crops such as rice, wheat and corn are also amenable to DNA transfer by

Agrobacterium strains (vide WO 94/00977; EP 0 159 418 Bl; EP 0 856 060; Gould J, Michael D, Hasegawa O, Ulian EC, Peterson G, Smith RH, (1991) Plant. Physiol. 95, 426-434).

Further, a protein of the invention can be introduced/translocated into a plant or plant cell as outlined in PCT/NL01/00388, herein

encompassed by reference.

Generally after transformation, plant cells or cell groupings are selected for the transfer with the nucleic acid sequence encoding the protein according to the invention, following which the transformed material is regenerated into a whole plant.

Following DNA transfer and regeneration, putatively transformed plants may be evaluated, for instance using Southern analysis, for the presence of the recombinant DNA according to the invention, copy number and/or genomic organization. In addition, or alternatively, expression levels of the newly introduced DNA may be undertaken, using Northern and/or Western analysis, and other techniques well known to persons having ordinary skill in the art. Examples Example 1:

Plant material and growth conditions

All Arabidopsis thaliana mutant- and transgenic lines used in this study are in the Columbia background. The pSPL9::SPL9-GUS,

pSPL9::rSPL9-GUS, pSPL3::GUS-SPL3, and _PSPL3::GUS-rSPL3 lines were generously provided by Scott Poethig (Yang et al., 2011, Development 138: 245-249). 35S::miR156, 35S::MIM156, pSPL9::rSPL9, and spl9 spll5 were obtained from the Nottingham Arabidopsis Stock Centre (NASC). The ahll5-l mutant containing a T-DNA insertion in the start of coding region of AH.L15 (SALK_040729C; Zhou et al., 2013), and ahll9-l mutant containing a T-DNA insertion in the middle part of coding region of AH. L 15

(SALK_070123) were obtained from the Nottingham Arabidopsis Stock

Centre (NASC). Seeds were surface sterilized (1 minute in 70% ethanol, 10 minutes 1% chlorine, several washes with water) cold-incubated for 3 days at 4°C on MA medium (Masson, J., Paszkowski, J. (1992) The Plant

Journal, 2(5), 829-833) containing 1 % sucrose, and 0.7 % agar, after which the plates were transferred to 21°C, 16 hours photoperiod for germination. Seedlings were transferred to soil and grown at 21°C under 16 hours photoperiod. To score for phenotypes such as maintenance of juvenility, rejuvenation, and longevity, wild type, mutant and overexpression plants were transferred to bigger pots about 3 weeks after flowering and

infloresences with ripened siliques were cut off. Vegetative changes and flowering time were determined under long-day (LD; 16 hours photoperiod at 21°C) or short-day (SD; 12 hours photoperiod at 21°C) conditions. Plasmid construction and plant transformation

Full length cDNA clones from Arabidopsis thaliana cv Columbia were obtained from RIKEN (Tsukuba, Japan). The generation of the

35S::AHL15 construct has been described previously ((Hooykaas and van der Zaal, 2004, US Patent, WO2004/066985). . The ORF was cloned as SmallBalll fragment (partial digests)into the expression cassette of pART7 under CaMV 35 S promoter and this cassettes was cloned as Noil fragment into the binary vector pART27 (Gleave, A.P., 1992, Plant Mol. Biol.

20(6): 1203-1207). To construct 35S::AHL19, the ORF was PCR amplified using the full-length cDNA oiAHL19 (AT3G04570) with PCR primers described in Table 1, and inserted into the entry vector pDONR207

(Gateway, Invitrogen) via a BP reaction. LR reactions were carried out to transfer the ORFs from the entry vector to the expression cassette of a Gateway-compatible pART7 vector, and then this cassette was cloned a NotI fragment into pART27. To generate the other overexpression constructs, the full-length cDNA clones oiAHL20 (AT4G14465), AHL27 (AT1G20900), AHL29 (AT1G76500) from Arabidopsis thaliana, AC 129090

(MTR_5g080580) from Medicago trunculata cv Jemalong (obtained from RIKEN) were used to amplify the ORFs using primers indicated in Table 1. The sequence of the Bo-Hook 1 cDNA clone was obtained by combining ESTs AM057906 and AM059071 from Brassica oleracea cv Alboglabra. The cDNA was subsequently PCR amplified from RNA generated cDNA using primers indicated in Table lORFs were cloned downstream of the CaMV 35S promoter in the binary vector pGPTV35S-FLAG-tagged?. To construct

35S::AHL15-GR, a synthetic Pstl-Xhol fragment was generated containing the AHL15-GR fusion

(CTCGAGCTCATTTCTCTATTACTTCAGCCATAACAAAAGAACTCTTTTC TCTTCTTATTAAACCAAAACCATGGCGAATCCTTGGTGGGTAGGGAATG TTGCGATCGGTGGAGTTGAGAGTCCAGTGACGTCATCAGCTCCTTCTTT GC AC C AC AG AAAC AGT AAC AAC AAC AAC C C AC C G ACT AT G ACT C GTT C GGATC C AAGATTGGAC C ATGACTTC AC C AC C AAC AAC AGTGGAAGC C C TAATAC C C AGACTC AGAGC C AAGAAGAAC AGAAC AGC AGAGAC GAGC A ACCAGCTGTTGAACCCGGATCCGGATCCGGGTCTACGGGTCGTCGTCC TAGAGGTAGAC CTC CTGGTTC C AAGAAC AAAC C AAAGAGTC C AGTTGTT GTTACCAAAGAAAGCCCTAACTCTCTCCAGAGCCATGTTCTTGAGATTG CTACGGGAGCTGACGTGGCGGAAAGCTTAAACGCCTTTGCTCGTAGAC GCGGCCGGGGCGTTTCGGTGCTGAGCGGTAGTGGTTTGGTTACTAATG TTACTCTGCGTCAGCCTGCTGCATCCGGTGGAGTTGTTAGTTTACGTGG TCAGTTTGAGATCTTGTCTATGTGTGGGGCTTTTCTTCCTACGTCTGGC TCTCCTGCTGCTGCCGCTGGTTTAACCATTTACTTAGCTGGAGCTCAAG GTCAAGTTGTGGGAGGTGGAGTTGCTGGCCCGCTTATTGCCTCTGGAC CCGTTATTGTGATAGCTGCTACGTTTTGCAATGCCACTTATGAGAGGTT ACCGATTGAGGAAGAACAACAGCAAGAGCAGCCGCTTCAACTAGAAGA TGGGAAGAAGCAGAAAGAAGAGAATGATGATAACGAGAGTGGGAATAA CGGAAACGAAGGATCGATGCAGCCGCCGATGTATAATATGCCTCCTAA TTTTATCCCAAATGGTCATCAAATGGCTCAACACGACGTGTATTGGGGT GGTCCTCCGCCTCGTGCTCCTCCTTCGTATGGATCTACAAAGAAAAAAA TC AAAGGGATTC AGC AAGC C ACTGC AG) ,

and this fragment was used to replace the BBM-GR fragment in binary vector pSRS031 (Passarinho, P. et al., 2008, Plant Mol. Biol. 68(3):225-237) downstream of the CaMV 35 S promoter. To generate the pAHL15::AHL15- GUS translational fusion, a 4 kb fragment containing the promoter and exon-intron sequences of AHL15 was amplified using PCR primers in Table 1, and inserted into the pDONR207 (Gateway, Invitrogen) via a BP reaction. LR reactions were carried out to fuse the 4 kb fragment upstream of GUS in the destination vector pMDC l63. The artificial microRNA construct targeting AHL20 (amiRAHL20) was obtained as described (Schwab et al. , 2006, Plant Cell 18: 1121) by introducing the PCR amplified amiRAHL20 precursor using (PCR primers listed in Table 1) into pDONR207 via a BP reaction. The amiRAHL20 precursor was subsequently recombined downstream of the 35S promotor in pMDC32 via a LR reaction. All the binary vectors were introduced into Agrobacterium tumefaciens by electroporation (Dulk-Ras, A .de and Hooykaas, P. J., 1995, Methods in Molecular Biology,55: 63-720 and Agrobacterium -mediated transformation to Arabidopsis thaliana was carried out using the floral dip protocol

(Clough, S.J. and Bent, A.F.„ 1998, Plant J. 16:735-743).

GUS staining and DEX induction

Histochemical staining oipAHL15-AHL15:GUS, pSPL9::SPL9- GUS and pSPL3::GUS-SPL3 tissues or seedling for GUS activity was performed as described by Anandalakshmi et al. (Anandalakshmi, R. et al., 199, Proc. Natl. Acad. Sci. USA 95:13079-130848) for 3 hours at 37°C, followed by destaining and fixation in 70 % ethanol. For DEX induction, 35S::AHL15-GR seeds were germinated on MA medium containing 20 μΜ dexamethasone (DEX) or soil grown plants of this line were sprayed with 20 μΜ DEX. Quantitative real-time PCR analysis

RNA isolation was performed using a NucleoSpin® RNA Plant kit (MACHEREY-NAGEL). For qRT-PCR, 1 μg of total RNA was used for cDNA synthesis with the iScript™ cDNA Synthesis Kit (BioRad). PCR was performed using the SYBR-Green PCR master mix and amplification was run on a CHOROMO 4 Peltier Thermal Cycler (MJ RESEARCH). The Pfaffl method was used to determine relative expression levels (Pfaffl, M.W.

(2001), Nucleic Acids Res. 29: e45-e45). Expression was normalized using the -TUBULIN-6 as reference gene. Two biological replicates were performed, with tree technical replicates each. The primers used are described in Table 1. Table 1: Sequences of the primers used for PCR or QRT-PCR (F: forward; R:

reverse)

Name Sequence (5' to 3') Purpose

35S: AHL29-F ATAAGAATGCGGCCGCGACGGTGGTTACGATCAATC 35S::AHL29 construct

35S: AHL29-R ATAGTTTAGCGGCCGCCTAAAAGGCTGGTCTTGGTG

35S: AHL20 -F ATAAGAATGCGGCCGCGCAAACCCTTGGTGGACGAAC 35S::AHL20 construct

35S: AHL20-R ATAGTTTAGCGGCCGCTCAGTAAGGTGGTCTTGCGT

35S: AHL27-F ATAAGAATGCGGCCGCGAAGGCGGTTACGAGCAAGG 35S::AHL27 construct

35S: AHL27-R ATAGTTTAGCGGCCGCTTAAAAAGGTGGTCTTGAAG

35S: Bo-Hook- 1-F ATAAGAATGCGGCCGCGCGAATCCTTGGTGGGTAGA 35 S:: Bo -Hook- 1 construct

35S: Bo-Hook- 1-R ATAGTTTAGCGGCCGCTCAATATGAAGGAGGACCAC

35S: AC129090-F ATAAGAATGCGGCCGCTCGAATCGATGGTGGAGTGG 35S::AC129090 construct

35S: AC129090-R ATAGTTTAGCGGCCGCTCAATATGGAGGTGGATGTG

35S: AHL19-F GGGGACAAGTTTGTACAAAAAAGCAGGCTCGATGGCGAAT 35S::AHL19 construct

CCATGGTGGAC

35S: AHL19-R GGGGACCACTTTGTACAAGAAAGCTGGGTAAACAAGTAGC

AACTGACTGG

AHL15-GUS-F GGGGACAAGTTTGTACAAAAAAGCAGGCTCGACACTCCTC pAHL15::AHL15-GUS

TGTGCCACATT construct

AHL15-GUS-R GGGGACCACTTTGTACAAGAAAGCTGGGTAATACGAAGGA

GGAGCACGAG

I miR-s AHL20 GATTAGACTACCTCAAATTGCTATCTCTCTTTTGTATTCC

II miR-a AHL20 GATAGCAATTTGAGGTAGTCTAATCAAAGAGAATCAATGA

III miR*s AHL20 GATAACAATTTGAGGAAGTCTATTCACAGGTCGTGATATG 35S::amiRAHL20constract

IV miR*a AHL20 GAATAGACTTCCTCAAATTGTTATCTACATATATATTCCT

amiRNA AHL20-F GGGGACAAGTTTGTACAAAAAAGCAGGCTCGCGACGGTAT

CGATAAGCTTG

amiRNA AHL20-R GGGGACCACTTTGTACAAGAAAGCTGGGTACCCATGGCGA

TGCCTTAAAT

SALK_040729-F GTCGGAGAGCCATCAACACCA ahll5 genotyping

SALK_040729-R C G AC G AC C C GTAG AC C C GG ATC

SALK_070123-F GGCGAATCCATGGTGGACAGG ahll9 genotyping

SALK_070123-R GGCCGCTCATCTGTCCTCCTC

qAHL15-F AAGAGCAGCCGCTTCAACTA qRT-PCR AHL15 qAHL15-R TGTTGAGCCATTTGATGACC

qAHL20-F CAAGGCAGGTTTGAAATCTTATCT qRT-PCR AHL120 qAHL20-R TAGCGTTAGAGAAAGTAGCAGCAA

qAHL19-F CTCTAACGCGACTTACGAGAGATT qRT-PCR AHL19 qAHL19-R ATATTATACACCGGAAGTCCTTGGT

qAHL29-F ATACTAATGGCTGCATCGTTCTCTA qRT-PCR AHL29 qAHL29-R TGATCATAACCACTCATGTTACCTC

qSPL3-F CTCATGTTCGGATCTCTGGTC qRT-PCR SPL3 qSPL3-R TTTCCGCCTTCTCTCGTTGTG

qSPL9-F AACAATACATGGCGAGCTTCTT qRT-PCR SPL9 qSPL9-R ATTGCCGTGCCACTACTTATCT

qSPLlO-F GTAATGGCTCTGAGGACCAACT qRT-PCR SPL10 qSPLlO-R TCCCTTGTGAATCCGAAGTAGT

qSPL15-F AATCCAGTTAGGGAAACCCATC qRT-PCR SPL15 qSPL15-R GAGTCGAAACCAGAAGATGGTC Microscopy

For scanning electron microscopy, fresh leaves were fixed in 0.1 M sodium cacodylate buffer (pH 7.2) containing 2.5% glutaraldehyde and 2% formaldehyde. After fixation, samples were dehydrated by a successive ethanol series (25, 50, 70, 95, and 100%), and subsequently critical -point dried in liquid CO2. Dried specimens were gold-coated and examined using a JEOL SEM-6400 scanning electron microscope (Tokyo, Japan). GUS stained tissues were observed and photographed using a LEICA MZ12 microscopy (Wetzlar, Germany) equipped with a LEICA DC500 camera. Inflorescence stems from wild type and 35S::AHL15 plants were fixed overnight in 5% acetic acid, 45% ethanol, and 5% formaldehyde at 4°C. After washing specimens were dehydrated in a successive ethanol series (25, 50, 70, 95, and 100%) and were embedded in EPON for 24h at 65 °C. Sections (6-7 μιη) were made using a Reichert-Jung Ultracut E microtome (Depew, USA), stained in 0.1% toluidine blue, and observed and photographed using a LEICA MZ12 microscope equipped with a LEICA DC500 camera.

Ploidy analysis

The ploidy level of plants derived from 35S::AHL 15-iriduced embryonic structures was determined by flowcytometry following 4', 6- diamidino-2-phenylindole (DAPI) staining (Iribov BV, Enkhuizen,

Netherlands), and confirmed by counting the number of chloroplasts in stomatal guard cells (approx. 8 for 2n and approx. 16 for 4n), and by comparing flower size and the size of the nucleus in root epidermal cells. The red fluorescence of chloroplasts in stomatal guard cells, or DAPI stained root nuclei were visualized using a ZEISS-003- 18532 confocal microscope system . Dynamic changes in chromosome number in germinating

35S::AHL15 seedlings during somatic embryo induction were monitored with a ZEISS-003- 18532 confocal microscope using the centromere-specific histone H3 GFP fusion (35S::CENH3-GFP; Fang and Spector,2005). AHL genes affect vegetative phase changes and flowering time

Ectopic expression oiAHL15 under control of the constitutive CaMV 35S promoter resulted in strong seedling phenotypes. Seedlings developed slowly, and frequently formed ectopic embryo structures on the shoot apical meristem and cotyledons in the absence of 2,4-D treatment (Hooykaas and van der Zaal, 2004, US Patent, WO2004/066985)). These initial observations suggested that AHL 15 overexpression might delay or even revert the transition from the embryonic phase into the seedling phase. In contrast to their slow and aberrant early development, 35S::AHL15 seedlings recovered and eventually formed relatively normal looking rosettes. During Arabidopsis rosette development a change from juvenile to adult phase can be distinguished, which is marked by the absence or presence of trichomes on the abaxial side of the leaf, respectively (Telfer et al., 1997, Development 124:645-654). When we studied the 35S::AHL15 rosettes in more detail, they showed significantly more juvenile leaves lacking abaxial trichomes (15 to 17) compared to wild type (5) (Table 2). In contrast, loss-of -function ahll5-l plants showed accelerated abaxial trichome production by about two plastochrons under short day (SD) conditions (Table 2), but this effect was not observed under long day (LD) conditions, and the mutation had no clear effect on leaf morphology.

The absence of a strong leaf phenotype in the single ahll5-l mutant suggested that AHL 15 is functionally redundant with other members of the AHL gene family. To test this possibility, we combined AHL15 loss-of-function with that of the two closest homologs AHL 19 and AHL20 (Fujimoto et al., 2004; Plant Mol. Biol. 56: 225-39; Matsushita et al., 2007, Plant Physiol. 143: 1152-62; Zhao et al., 2013, Proc. Natl. Acad. Sci. 110: 4688-97). First, we generated the ahll5-l ahll9-l double mutant and Table 2. AHL15 and close homologs act redundantly in maintenance of leaf juvenility and suppression of flowering.

Long days (LD) Short days (SD)

# leaves w/o # of rosette # leaves w/o # of rosette

Genotype ab. leaves² ab. trichom.¹ leaves² trichom.¹

Col 5.85 ± 0.36 16.48 ± 1.32 6.70 ± 0.68 34.03 ± 1.95

35S::AHL15-1 16.7 ± 1.92 44.36 ± 3.40 18.30 ± 2.00 77.34 ± 5.39

35S::AHL15-2 14.9 ± 1.68 40.28 ± 3.15 16.80 ± 1.92 69.65 ± 5.07 ahll5 5.05 ± 0.22^¾ 16.12 ± 1.23^a 5.13 ± 0.50^b 32.17 ± 1.66 ^a ahll9 5.75 ± 0.44^a 16.16 ± 1.51^a 6.15 ± 0.48= 34.80 ± 2.20= ahll5 ahll9 5.15 ± 0.36^¾ 15.80 ± 0.95= 5.16 ± 0.53^¾ 32.77 ± 1.79^a ahll5 ahll9 35S::amiRAHL20-l 4.90 ± 0.6^b 13.92 ± 1.15^c 5.10 ± 0.71= 25.65 ± 1.47^c ahll5 ahll9 35S::amiRAHL20-2 5.25 ± 0.63^b 12.08 ± 0.81^c 5.53 ± 0.50= 22.13 ± 1.62=

_PAHL15::AHL15-GUS-1 3.90 ± 0.36 10.28 ±1.95 4.10 ± 0.44 25.18 ± 2.12= pAHLl 5.-.-AHL15-G US- 2 4.00 ± 0.28^c 9.20 ± 1.70 4.13 ± 0.22 27.90 ± 1.56= ahll5 pAHL15::AHL15-GUS 4.00 ± 1.26^b 9.80 ± 3.25 4.32 ± 1.50 18.12 ± 2.62

Shown is the mean ± SD. n= 20 for all genotypes.

No statistically significant difference (Student's t test, p > 0.4) was detected from wild type Statistically significant difference (Student's t test, p < 0.05) was detected from wild type. c Statistically significant difference (Student's t test, p < 0.01) was detected from wild type.

1 Number of rosette leaves without abaxial trichomes, ² Total number of rosette leaves. transformed this background with an artificial microRNA construct directed against AHL20 (35S::amiRAHL20). The ahll5-l ahll9-l double mutant and the two selected ahll5 ahll9 amiRAHL20 triple mutant lines showed the same early development of abaxial trichomes under SD conditions as the single ahll5-l mutant (Table 2). The triple mutant lines, however, also showed precocious development of adult leaf morphology, such as serration and an increased length/width ratio (Fig 1A-B). This data shows that the three related AHL genes indeed act redundantly in delaying the phase transition from juvenile to adult leaf development.

Previous overexpression and loss-of -function studies have implied AHL genes (AHL 18, AHL22, AHL27/ESC and AHL29/SOB3) in delaying flowering (Weigel, D. et al., 2000, Nature 377:495-500; Xiao et al., 2009,

Plant Mol. Biol. 71 : 39-50. Yun et al. 2012, Biol. Chem. 287: 15307-16.). For the AHL 15 overexpression lines we also observed a significant delay in flowering time, based on the number of rosette leaves developing before flowering, both under long day (LD) and SD conditions (Table 2). In contrast, the single ahll5 and ahll9 loss-of-function mutants only showed slightly earlier flowering and had no significant effect on the number of leaves at flowering time, whereas ahll5 ahll9 double and ahll5 ahll9 amiRAHL20 triple mutant background significantly reduced flowering time, and the number of leaves developing until flowering (Table 2). Previous studies have shown that the reproductive competence in plants is tightly associated with the juvenile-to-adult transition (Weigel, D. and Nilsson, O., 1995, Nature 377:495-500; Wu and Poethig., 2006, Development

133(18):3539-3547; Smith, M.R. et al., 2009, Proc. Natl. Acad. Sci. USA 106(13):5424-5429; Willmann, M.R. and Poethig, R.S., 2011, Development 138(4):677-685), and the maintenance of juvenility by AHL genes is likely to be an important determinant in their effect on flowering time. In conclusion, AHL15 acts redundantly with its closest homologs, and possibly also with other AHL genes, in delaying phase changes in Arabidopsis development, e.g. from embryo to juvenile, from juvenile to adult and from adult to flowering, by maintaining embryonic or juvenile traits in meristems and tissues

Expression of nuclear AHL15 is tightly linked to juvenile development

To study if AHL 15 expression can be correlated to the above mentioned phase transitions, we generated plant lines carrying a

complementing gene-, GUS fusion (pAHL15::AHL15-GUS). Selected pAHL15::AHL15-GUS lines showed that AHL15 is expressed throughout embryo development, from the early globular stage on, and in root and shoot meristems (results not shown). Moreover, by staining pAHL15::AHL15-GUS plants for GUS activity and by qRT-PCR analysis we found that AHL15 is significantly expressed in juvenile shoots and leaves, but that its expression declines as soon as these shoots and leaves start to show adult traits (Fig. 1C,D). Assessment of the close homologs AHL 19, AHL20, and AHL29/SOB3 by qRT-PCR showed that the expression of these genes is also negatively correlated with the age of shoots (Fig. ID). These results show that AHL 15 expression coincides with embryonic and juvenile stages, and that the transition of juvenile to adult leaf morphology is accompanied by down regulation oiAHL gene expression. The data further supports the role of AHL15 and close homologs in juvenility maintenance during embryo and vegetative development of Arabidopsis.

Similar to ahll5 ahll9 amiRAHL20 plants, remarkable leaf elongation was also observed in pAHL15::AHL15-GUS plants (Fig. 1A, B). The abaxial trichome production was accelerated by about 3 plastochrons in pAHL15::AHL15-GUS plants (Table 2). Moreover, when the

pAHL15::AHL15-GUS construct was introduced in the ahll5 loss-of- function mutant background, this led to even more severe elongation of leaves (Fig. 1A, B) and delay in leaf initiation. It has been previously shown that abolishment of the C-terminal PPC domain in close AHL15 homologs produces dominant-negative alleles in Arabidopsis (Zhao et al., 2013, Proc. Natl. Acad. Sci. 110: 4688-97), This indicates that the chimeric AHL15-GUS protein act as dominant negative repressor of AHL function, and that the strong phenotypes observed are the effect of repression of AHL15 function and that of its homologous family members (Fig. 12).

Ectopic AHL15 expression induces juvenile traits during the adult phase

Wild type Arabidopsis plants switch from juvenile to adult phase approximately 20 days after germination, and during this switch the shoot meristem loses its juvenile characteristics. By contrast, plants

overexpressing AHL15 keep on producing juvenile-like leaves on basal and aerial axillary meristems for a long time period during flowering (Fig. 2D), eventually leading to inflorescence stems with ectopic aerial rosettes (Fig. 2B). The first bract produced on wild type inflorescences is still very similar to an adult rosette leaf (Fig. 2A), while in the ahll5 ahll9 amiRAHL20 triple loss-of-function mutant this leaf already has bract -like features (Fig. 2C). Compared to wild type Arabidopsis, 35S::AHL15 plants produced many rosette leaves and branched inflorescences with juvenile-like or rosette leaves at the basal parts (Fig. 3A,B). When flowering was delayed under SD conditions 35S::AHL15 plants produced even more rosette leaves and inflorescences with areal rosettes (Fig. 3C).

Since juvenile-like leaves reappeared on axils of cauline leaves of 35S::AHL15 plants following the production of adult leaves and

inflorescences, this suggested that AHL15 not only maintains juvenility traits, but also induces rejuvenation. To test the capacity oiAHL15 to rejuvenate tissues we generated plant lines that express a fusion protein between AHL15 and the glucocorticoid receptor (35S::AHL15-GR).

Untreated 35S::AHL15-GR plants showed a wild type phenotype (Fig. 2E). However, when we sprayed 40- to45 days-old 35S::AHL15-GR plants with DEX, most of the basal and aerial axillary meristems developed into small rosettes, initially producing leaves that resemble the small serrated first leaves of 35S::AHL15 plants, and later producing juvenile leaves that lack abaxial trichomes. (Fig. 2F, I). DEX treated plants kept on producing juvenile leaves for 2-3 weeks, after which the meristems gradually shifted back to the adult phase. A second DEX application (4 weeks after the first one) again reverted many reproductive axillary meristems to vegetative meristems, resulting in abundant production of aerial rosettes (Fig. 3E), whereas non-treated plants just produced a few aerial leaves (Fig. 3D).

The transition of juvenile to adult traits in Arabidopsis leaves is accompanied by a decrease in epidermal cell size (Usami, T. et al., 2009, Development 136:955-964). To confirm rejuvenation, we compared the cell size among early juvenile, adult and rejuvenated leaves in 35S::AHL15-GR plants after DEX treatment. The cell size in rejuvenated leaves was significantly bigger than that in adult leaves, and strikingly similar to primary juvenile leaves produced directly after germination (Fig. 2G). Ectopic expression of AHL15 switches herbaceous

monocarpic Arabidopsis into a woody polycarpic plant

Arabidopsis thaliana is a typical herbaceous annual plant species with a life cycle of 3 months. Following the vegetative growth, the plants bolt and produce several inflorescences with bracts and flowers. Depending on the flowering time, and following production of a certain number of fruits and seeds, the activity of the inflorescence meristems is arrested and the plant senesces to release the seeds (Bleecker, A.B. and Patterson, S.E.,

1997, Plant Cell 9 (7):1169-1179). This lifestyle, referred to as monocarpic, is characterized by a single reproductive event during the plant's life history. Several related species, such as Arabis alpine, are woody perennials that flower and produce seeds multiple times (polycarpic). In contrast to the monocarpic life style of wild type Arabidopsis, plants overexpressing AHL15 continued to grow for several months after the first cycle of fruit- and seed set, through the production of new aerial rosettes (Fig. 4 A). These rosettes gave rise to new inflorescences, which resulted in enhanced shoot branching (Fig. 4D) and a significant increase in seed yield (Fig. 4C). Removal of the first inflorescences after the siliques had ripened, efficiently induced the production of new aerial rosettes (Fig. 4B) that again produced

inflorescences with bracts and flowers (Fig. 4E). By continuous removal of the terminated inflorescences and by providing a continuous supply of fertilizer, the plants survived for many months, producing new

inflorescences and new seeds following each cutting. Next to AHL15 we tested overexpression of several Arabidopsis AHL family members (AHL19, AHL20, AHL27 and AHL29), and AHL15 orthologs from other plant species (Brassica oleracea and Medicago trunculata). In all these overexpression lines we observed the same morphological changes, i.e. a shift from the annual monocarpic to a polycarpic life style that is common for perennial plants. Polycarpy occurred through the continuous production of aerial rosettes (Fig. 5 A and B ). DEX treatment of 35S::AHL15-GR plants during flowering also induced aerial vegetative growth, leading to the production of new inflorescences, even during ripening of the first batch of siliques, and resulting in increased shoot branching (Fig. 5 F).

The long life span of perennial plants is concomitant with prolonged meristematic activity of vascular cambium, often leading to induction of secondary xylem (i.e. wood formation). Arabidopsis is a herbaceous species that does not show a continuous ring of xylem indicative of secondary xylem formation. (Fig. 6A, B). In 35S::AHL 15 inflorescence stems the establishment of a cylindrical cambium, which is linked to secondary vascular development, could already be observed as early as 15 days after flowering (Fig. 8C). In the main inflorescence stem of a 4 months old plant, a solid wood cylinder had formed (Fig. 6D), and even in lateral inflorescences strong secondary growth could be detected.

AHL15 represses SPL gene expression in a miR156- independent manner

Recent studies have demonstrated that the juvenile to adult transition during vegetative development can be predominantly attributed to the down-regulation of microRNA156 (miR156) and the subsequently up- regulation of its targets, the SQUAMOSA PROMOTER BINDING-LIKE (SPL) transcription factor encoding genes in several plant species (Wu, G. and Poethig, R.S. ,2006, Development 133: 3539-3547; Xie et al., 2006, Plant Physiol. 142: 280-93; Chuck et al., 2007, Nat Genet. 39: 544-9; Wu et al., 2009, Cell 138: 750-9; Wang et al., 2011, PLoS Genet. 7:el002012;

Zhang et al, 2011, FEBS Lett. 585: 435-9; Fu et al., 2012, Plant Biotechnol J. 10: 443-52; Xie et al., 2012, Plant Physiol. 158: 1382-94).

To investigate whether the prolongation of the juvenile phase and keeping the juvenility of axillary meristems in the adult phase in

35S::AHL15 plants was associated with expression level of SPL genes, the activity of four SPL genes (SPL3, SPL9, SPL10, and SPL15) was analyzed in 35S::AHL15-GR seedlings without and with DEX treatment, and in rosette base regions of flowering wild type and 35S::AHL15 plants. QRT- PCR analysis showed that SPL gene expression was down-regulated in DEX-treated 35S::AHL15-GR seedlings (Fig. 7A). Similar results were also obtained when untreated or DEX-treated SPL3::GUS-SPL3 seedlings were stained for GUS activity (Fig. 7B). QRT-PCR (Fig. 7C) and GUS activity (Fig. 7D, E) analysis also showed that SPL genes were significantly down- regulated in rosette base regions of 35S::AHL15 plants. These results indicate that ectopic AHL15 expression represses SPL genes during both the vegetative and the reproductive phase.

To determine whether down-regulation of SPL genes in

35S::AHL15 plants used the miR156 pathway, we crossed 35S::AHL15 plants with 35S::MIM156 plants, in which the activity of miR156 was knocked down by overexpression of a non-cleavable miR156 target site (a target-site mimic, MIM156) (Franco-Zorrilla et al., 2007, Nature Genetics 39, 1033-7). The phenotypic analysis showed that AHL15 overexpression is able to negate the effect of MIM156 on the precocious appearance of adult vegetative traits, including the emergence of trichomes on the abaxial side of the first leaf (Fig. 7F) and the first two leaves being large and elongated (Fig. 7H).

Furthermore, we crossed 35S::AHL15-GR plants with reporter plants that express miR156-insensitive versions of SPL 9- and SPL3-GUS fusions (pSPL9::rSPL9-GUS and _PSPL3::GUS-rSPL3, Yang et al., 2011, Development 138: 245-9). DEX- induction oiAHL15 activity in 35S::AHL15- GR seedlings significantly represses the expression of rSPL9-GUS and GUS-rSPL3 reporters (Fig. 7I,J). Moreover, untreated plants containing both 35S::AHL15-GR and pSPL9::rSPL9 constucts almost skipped the juvenile phase and produced inflorescences with axillary meristem that only produced bract leaves (Fig. 7F). In contrast, DEX-treated plants produced juvenile-like leaves, and inflorescences with aerial rosettes (Fig. 7G). Taken together, these data indicated that, surprisingly, ectopic AHL 15 expression represses the SPL genes independently of miR156.

To further confirm of the rejuvenation by induction oiAHL15 overexpression, we assayed the expression of the GUS-SPL3 protein in juvenile, adult and bract leaves of 35S::AHL15-GR pSPL3::GUS-SPL9 without DEX treatment (Fig. 2H, I) and juvenile like leaves produced after DEX treated. As shown in Fig. 21, the expression of GUS-SPL3 in rejuvenated leaves on axillary meristems is similar to early juveniles leaves produced after germination (Fig. 2H).

AHL15 acts downstream of SPL genes

To determine if upregulation of SPL genes and downregulation of AHL15 are causally associated, we examined the expression oiAHL15-GUS in 35S::MIM156 seedlings. A significant lower expression oiAHL15 was detected in 35S::MIM156 seedlings than in wild type (Fig. 8A). This indicates an inversion expression pattern between AHLs and SPLs.

Overexpression of miR156 significantly extend juvenile phase in

Arabidopsis (Wu and Poethig, 2006; Wu et al., 2009). Similar to 35S::AHL15 plants, the axillary meristems on 35S::miR 156 inflorescences produced rosette leaves (Fig. 8D).

Interestingly, 35S::miR156 plants showed a polycarpic behaviour (Fig. 8E). To determine whether prolongation of juvenility, aerial rosette induction and polycarpic induction by miR156 is mediated by enhanced AHL15 expression, pAHL15::AHL15-GUS plants were crossed with

35S::miR156 plants. The dominat negative AHL15-GUS protein overcame the 35S:: iR156 effects, such as juvenility prolongation (Fig. 8B,C), aerial rosette formation (Fig. 8D), and polycarpic behaviour . By contrast, combining both AHL 15 and miR156 overexpression led to enhanced polycarpic behaviour (Fig. 8E). These results show that the effect of miR156 overexpression on Arabidopsis growth requires AHL15.

On the other hand, spl9 spll5 loss-of -function also led to plants inflorecences producing aerial rosettes from the axillary mersitems (Fig. 8D). QRT-PCR analysis showed that expression of several AHL genes is upregulated in this back ground (Fig. 8F), confirming the repressive effect of SPL proteins on the expression of AHL 15 and its close homologs in axillary meristems. Taken together, the results indicate that SPL proteins promote the juvenile-to-adult transition and prevent vegetative activity in axillary inflorescence meristems by repressing the expression of AHL 15 and close homologs. In turn, AHL proteins act independently from miRNAl56 in controlling SPL abdunance, and thereby provide an unexpected new key switch in the control of a plant's life history strategy (e.g. flowering time, mono- versus polycarpy; annual versus perennial, Fig. 9).

Ectopic AHL15 expression induces juvenile traits and polycarpic behaviour in tobacco

Transgenic Nicotiana tabacum SRI plants containing the 35S::AHL15-GR construct were obtained by leaf disc

transformation (Burrow et al., 1990, Plant Mol. Biol. Rep. 8, 124-139) using Agrobacterium strain LBA1100. Transgenic lines containing a single locus T-DNA insertion were selected based on phosphinotricin resistance and their seedling and plant phenotypes before (wild type) and after DEX treatment (Fig. 13A-D). Two weeks old 35S::AHL15-GR plants transferred for 1 week on DEX-containing medium developed juvenile-like leaves (Fig. 13D), Seven weeks old SRI wild type and 35S::AHL15-GR plants showed comparable phenotypes at the onset of flowering (Fig. 13C,D). When these plants were sprayed with DEX (4 times in 8 hours intervals using 30 uM DEX and 0.01% Tween 20), the SRI plants continued their normal annual/moncarpic life cycle of flowering, setting seeds and dying off. In contrast, the 35S::AHL15-GR plants remained green, and started to show polycarpic characteristics, as they formed branches with new leaves that eventually flowered and produced seeds (Fig. 13E). AHL15 overexpression induces embryonic callus containing polyploid cells.

Another unexpected observation relates to the somatic embryos that are induced when either immature zygotic embryos or seedlings of a strong 35S::AHL15 overexpression line are cultured on hormone free medium (Hooykaas and van der Zaal, 2004, US Patent, WO2004/066985)). Such embryos can be germinated and allowed to develop into plants that set seeds. Unexpectedly, these plants developed bigger leaves and flowers, and root cells with large nuclei, all characteristics of polyploid Arabidopsis plants (Fig.9). By counting the number of chloroplasts in guard cells, and by flowcytometric analysis of the nuclear DNA content we could show that these plants are tetraploid, or in some cases even octoploid (Table 3, Fig. 9).

Table 3: Plants derived from 35S::AHL15-induced somatic embryos show polyploidy

35S::AHL15 Number of embryo-derived Ploidy level of embryo-derived

lines plants plants

2n 4n Sn

2 16 5 11 -

4 6 4 1 1

13 11 7 4 -

14 17 14 2 1

15 15 11 4 -

Polyploidy was never observed among progeny of diploid

35S::AHL 15 lines, strongly suggesting that polyploidisation occurred during tissue culture of IZEs or seedlings. Moreover, somatic embryogenesis induced by the synthtetic auxin 2,4-D did not give rise to polyploidy regenerants (results not shown), suggesting that this is specific for the action of the AHL15 gene. We used a centromere-specific histon 3-GFP fusion (35S::CENH3-GFP) to monitor possible polyploidisation events during tissue culture. When embryogenic callus was induced by 2,4-D treatment on wild type IZEs, all cells showed a normal chromosome number (Fig. 10A). However, when 35S::AHL15 IZEs or seedlings were incubated on hormone free medium, several cells in the embryonic calli showed signs of polyploidisation (Fig 10B). Our results suggest that overexpression of AHL15, next to allowing the formation of somatic embryos in tissue culture, also induces genome duplication, which opens up the possibility to use AHL15, or manipulation of its expression, for the efficient production of doubled haploid plants from egg cells or microspores. Doubled haploid technology is much used in breeding programs to propagate a newly selected hybrid variety, by obtaining two parental lines that recreate the hybrid genotype after cross pollination.

The induction of somatic embryos on germinating seedlings was only observed for the 35S::AHL15 line, however, we were also able to induce somatic embryos on IZEs in the absence of 2,4-D by overexpressing homologs and orthologs oiAHL15 (O. Karami and R. Offringa., unpublished data). This not only suggests that AHL15 is most effective in inducing the somatic embryogenesis program, but also that, like with rejuvenation, other AHL genes show similar functionalities as AHL15 and thus will most likely induce polyploidisation in tissue culture when overexpressed.

Claims

Claims

1. A method to change an annual plant into a perennial plant, characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said annual plant.

2. A method to increase the ploidy level in a plant or plant cell, characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said plant or plant cell.

3. A method to change a monocarpic plant into a polycarpic plant, characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said monocarpic plant.

4. A method to change a herbaceous plant into a woody plant, characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said herbaceous plant.

5. A method to enhance branching in a plant, characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said plant.

6. A method for keeping a plant cell in a juvenile state, characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said plant cell.

7. A method for preventing flowering in a plant, preferable a leaf vegetable such as lettuce, cabbage or endive,, characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said plant.

8. A method for providing a plant with an enhanced production of secondary metabolites in a plant characterised in that a protein selected from the A clade of Arabidopsis thaliana AHL proteins or an ortholog of such a protein is introduced or overexpressed into said plant, preferably wherein said secondary metabolite is a pharmaceutically active compound,

9. A method according to any of claims 1 - 8, characterised in that said protein is selected from the group of Arabidopsis AHL 15, AHL 16, AHL 17, AHL18, AHL19, AHL20, AHL21, AHL22, AHL23, AHL24, AHL25, AHL26, AH27, AHL28, AHL29, B. oleracea AT-hook DNA-binding protein BoHookl, M. trunculata AT-hook DNA-binding protein XP_003616459.1 (Mtr_5g080580) and proteins that are more than 70% identical to said proteins.

10. A method according to any of claims 1 - 9, characterised in that said protein is an ortholog of Arabidopsis thaliana clade A AHL proteins, having a single copy AT-Hook motif with a core sequence

RPRGR[P/A]GSKN[P/A]K followed by a PPC/DUF296 motif with a central G[R/T/Q/K] [F/Y][E/D]ILS sequence.

11. A method according to any of claims 1 - 10, characterized in that the introduction of the protein in the plant or plant cell is achieved via an expression vector.

12. A method according to claim 11, wherein said expression vector comprises a nucleotide sequence that encodes for said protein, wherein said nucleotide sequence is selected from the group of sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27 and 29 and sequences that have an identity of more than 70%, preferably more than 80%, more preferably more than 85%, more preferably more than 90%, more preferably more than 95%, more preferably more than 96%, more preferably more than 97%, more preferably more than 98%,, preferably more than 99% with said sequences.

13. A method according to any of claims 1 - 10, characterized in that the introduction of the protein in the plant or plant cell is achieved via protein translocation.

14. Use of a protein selected from the Arabidopsis thaliana A clade of AHL proteins or an ortholog of such a protein for increasing the ploidy levels in a plant or plant cell.

15. Use of a protein selected from the Arabidopsis thaliana A clade of AHL proteins or an ortholog of such a protein for changing an annual plant into a perennial plant, monocarpic to polycarpic

16. Use of a protein selected from the Arabidopsis thaliana A clade of AHL proteins or an ortholog of such a protein for increasing branching in a plant.

17. Use of a protein selected from the Arabidopsis thaliana A clade of AHL proteins or an ortholog of such a protein for maintaining a plant cell in a juvenile state.

18. Use of a protein selected from the Arabidopsis thaliana A clade of AHL proteins or an ortholog of such a protein for preventing flowering in a plant.

19. Use of a protein selected from the Arabidopsis thaliana A clade of AHL proteins or an ortholog of such a protein for enhancing production of secondary metabolites in a plant.