WO2015177215A1 - A method for improving the water-use efficiency and drought tolerance in plants - Google Patents

Abstract

The current invention relates to the field of plant biology, breeding and agriculture. The invention also relates to methods of generating a drought resistant plant or improving water use efficiency in plants, in particular methods involving down regulating and up regulation of brassinosteroid signaling.

Description

Title: A method for improving the water-use efficiency and drought tolerance in plants Field of the invention

The current invention relates to the field of plant biology, breeding and agriculture. The invention also relates to methods of generating a drought resistant plant or improving water use efficiency in plants, in particular methods involving down regulating and/or up regulating brassino steroid signaling.

Background of the invention

Plant steroid hormones were named brassinosteroids (BRs) since they were discovered in the pollen of the plant Brassica napus, where they are very abundant. BRs are perceived by the plasma membrane- localized BRASSINO STEROID INSENSITIVE 1 (BRIl; (Li and Chory, 1997)). BRIl is one of the best-characterized Leucine-Rich Repeat Receptor-Like Kinase (LRR RLK) proteins in plants. Brassinolide (BL) binding occurs at the BRIl extracellular domain. This domain consists of 25 LRRs interrupted by a 70-amino-acid island domain (ID) between the 21^st and 22^nd LRR, which create a surface pocket for ligand binding (Wang et al, 2001; Kinoshita et al, 2005; Hothorn et al, 201 1; She et al, 201 1). Ligand-mediated BRIl receptor activation results in mutual transphosphorylation events with one or several of the SERK (SOMATIC EMBRYOGENESIS RECEPTOR KINASE) co-receptors, one of which is SERK3/BAK1 (Li et al, 2002; Russinova et al, 2004; Wang et al, 2005; Karlova et al, 2006; Wang et al, 2008). Recent evidence suggests that SERK co-receptors are essential for BRIl-mediated signaling (Gou et al., 2012). Downstream of BRIl and SERKs, members of the BSK (BRASSINOSTEROID SIGNALING KINASE) cytoplasmic kinase family are subject to BRIl-mediated phosphorylation (Tang et al, 2008) and subsequently the signal is transmitted to BESl (BRIl-EMS SUPPRESSOR 1) and BZR1 (BRASSINAZOLE-RESISTANT 1) transcription factors (Wang et al, 2002; Yin et al, 2005)

Many of the components of the BRIl pathway have been identified using forward or reverse genetic approaches (Wang et al, 2012), while structural studies of the extracellular domain of BRIl confirmed the behaviour of BRIl mutant alleles (Hothorn et al., 2011; She et al., 2011). As an alternative approach, the immunoprecipitation of the GFP-tagged SERK1 coreceptor has been previously employed (Karlova et al, 2006; Smaczniak et al, 2012). This resulted in the identification of BRIl as well as BAK1, suggesting that at least in part, protein-protein interactions mirror the genetic evidence.

In Arabidopsis, there are two closely related members of the small BRIl-Uke family, BRASSINOSTEROID RECEPTOR LIKE I and 3 (BRLI and BRL3 respectively), that share the overall structure of BRIl, including the ligand-binding ID, and can bind to BL with higher (BRLI) or similar (BRL3) binding affinity as the main BRIl receptor (Cano-Delgado et al, 2004; Kinoshita et al, 2005). While BRIl is expressed in most if not all cells (Friedrichsen et al, 2000), the expression of BRLI and BRL3 is enriched in the vascular tissues. The analysis of the bril brll brl3 mutant in the inflorescence stem suggested a redundant role with BRIl for these two receptors in regulating cell proliferation during vascular bundle patterning (Cano-Delgado et al, 2004). Since then, the discrete localization of BRLs together with the dramatic phenotype of triple BR- receptor mutants has hampered the identification of novel specific roles for BRL receptors in plant growth and development. Recently, the analysis of the BRL3 receptor complex composition in vivo showed that BRL3 physically interacts with the BRLI receptor and the BAK1 co-receptor, and reveals that these protein receptor interactions contribute to root growth and development in Arabidopsis (Fabregas et al, 2013).

Some plant mutants in the BR pathway have already been generated. Cano-Delgado et al, 2004 describes a triple mutant (bril-104 brllbrU) concerning the BRIl, BRLI and BRL3 genes, however this plant demonstrates a dramatic phenotype (extreme dwarfism).

Water scarcity has been established as a major limiting factor in agriculture, accounting for an estimated 70% potential yield loss worldwide. Moreover, agriculture is the largest consumer of water, with over 90% use of water in more arid areas (Boyer,

1982). The effects of water scarcity are expected to increase by global warming.

Therefore an increasingly interest exists in developing drought resistant crops.

Traditionally, breeding techniques have been used to generate more drought resistant crops, however generally this is a slow process limited by the availability of suitable genes for breeding. Therefore novel biotechno logical methods for generating drought resistant plants offer an interesting more rapid and efficient method of successfully generating crops with improved drought resistance. Detailed description

In a first aspect, the current invention provides a method for generating a drought tolerant plant, the method comprising modulating, preferably down regulating or up regulating the brassino steroid-signaling pathway in said plant.

Drought tolerant in this specification is meant to encompass a degree of adaptation to arid or drought conditions, reduced water availability or stress factors associated with reduced availability of water. Examples of stress factors associated with reduced water availability include sorbitol, mannitol, poly ethylenegly col (PEG), abscisic acid phytohormone (ABA) and salt or high salt (NaCl). High salt may be from 150 to 1000 mM NaCl. Sorbitol (or alternatively mannitol or PEG) can be provided to the plants at high concentrations in the medium, for example 400 mM, creating a high osmotic environment. The induced osmotic stress results in less efficient absorption of water by the plant, thus mimicking drought stress conditions. Likewise a high concentration of salt, for example 150-300 mM NaCl, can be used to achieve a similar effect. Exogenous provision of ABA, for example 5-10 μΜ, to plants previously germinated in standard growth media reduces root growth, among other physiological responses. The physiological responses activated by ABA are directly linked to water stress, as plants elicit a response similar to water stress in the presence of ABA. Improved drought tolerance can be determined by comparing the drought tolerance of a plant according to the invention with the drought tolerance of a wild-type plant during or after a drought period or during or after a period of reduced water availability. An adaptation can be seen as a change in a gene or protein expression or change in plant physiology in order to cope with a situation of reduced water availability.

Drought or water stress, for the purpose of this invention, is an extended period of time of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, or 13 days or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16 weeks or longer wherein a plant receives no water. In another preferred embodiment, drought is an extended period of time of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 days or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16 weeks or longer wherein a plant receives less water than normal, for example 80% less water, 70%, 60%>, 50%>, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1.5%, 1%, or 0.5% less water or less compared to normal or average conditions. Normal or average conditions may refer to average water condition received per plant. Average water condition per adult plant can range from 1 to 1000 mL, or 1 to 500 ml, or 1 to 200 ml or 1 to lOOmL, or 10 to 100 mL preferably from 10 to 80mL or 40 to 80 mL (per plant). Preferably, this average range is provided during a period of time ranging from 1 to 10 days, 1 to 7 days or 1 to 5 days or 1 to 3 days. Average soil content per plant/pot (1 plant is seeded in 1 pot) can range from 20 to 40g, preferably from 25 to 35g (per pot). Average water received by a plant will vary per plant species and plant size, and will be known to the person skilled in the art. For the purpose of the invention, an adult plant is defined as a plant of at least 3 weeks old. The person skilled in the art will be aware that the minimal age to reach adulthood may differ depending on the plant species.

Drought will be known to the person skilled in the art to vary in length depending on the plant species and the conditions it typically grows in.

A wild-type or normal or untreated or control or reference plant in this specification is meant to comprise a plant with normal brassino steroid synthesis and signaling, which has not been treated with a compound affecting brassinosteroid signaling or synthesis (i.e. treated plant) or has not been modified to induce a difference in a protein or gene expression affecting the brassinosteroid synthesis or signaling (i.e. modified plant), wherein the wild-type, or normal or untreated or control or reference plant is otherwise similar or identical to the treated or modified plant as envisioned by the invention. A wild-type, or normal or untreated or control or reference plant in this specification is also meant to comprise a plant related to the plant according to the invention wherein no genes or proteins within the brassinosteroid pathway have been modulated, preferably down regulated or up upregulated and has not otherwise been treated to modulate, preferably down regulate or upregulate brassinosteroid signaling. The words "wild-type" "normal" "untreated", "control" and "reference" in the context of a plant in this specification could be used interchangeably and are regarded in the context of this specification regarded as synonyms. A wild-type plant in this specification is also meant to comprise a plant known to the person skilled in the art to be drought sensitive. Typically, a drought sensitive plant has a decreased survival rate of at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or at least 90% or more during drought or after a drought period when compared to the survival rate of said plant when not exposed to drought. An example of a drought sensitive plant is Arabidopsis thaliana Columbia (Col-0 ecotype; N1092: NASC stock number). Drought has been earlier defined herein.

As an indication, Table 3 or Table 5 or Table 6 provides an overview of typical survival scoring (i.e. survival rate) of adult plant of species Arabidopsis thaliana after 12 days of drought period followed by 7 days of re-watering.

Within the context of the invention, a drought tolerant plant is a plant comprising a modification, preferably a down-regulation or up-regulation in brassinosteroid signaling achieved preferably at the gene or protein level (i.e. modified plant) and/or a change in physiology (i.e. treated plant) resulting in a plant with at least one of the following features:

a) a water stress resistant plant or a drought resistant plant,

b) a plant with increased water use efficiency,

c) a plant that survives longer during or after water stress or a plant with improved survival or growth during or after a drought period,

d) a plant that survives longer after re-watering,

e) a plant with improved root hydrotropism,

f) a plant with improved sorbitol/mannitol/PEG (polyethyleneglycol) or abscisic acid (ABA) response and

g) a plant wherein a drought stress marker gene has been down regulated.

A drought tolerant plant, a water stress resistant plant, and a drought resistant plant in the context of this specification are considered synonymous to each other and used interchangeably.

A plant that survives longer during or after water stress and a plant with improved survival or growth during or after a drought period in the context of this specification are considered synonymous to each other and used interchangeably.

Improved survival can be seen as the increased chance for a plant to survive a period of drought over a period of time compared to the chance of a normal or wild-type plant surviving over the same period of time and the same period of drought. For example the chance of survival of treated or modified plants as envisioned by the invention compared to wild-type plant may be higher by 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%), 70%), 80%), 90%) or more. The person skilled in the art will be aware that survival and improved survival can be determined by manually counting healthy green plants after a period of drought (such as in Figure 6A), or counting surviving plants after 7 days upon re-watering after a period of drought (such as in Figure 6B or Figure 16 or Table 3 or Table 5).

Within the context of this invention, a plant that survives longer during or after water stress may be defined as a plant with an increase of survival rate compared to the value of survival rate of a wild-type plant. Said increased survival rate is preferably increased by at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the one of the wild-type plant assessed under the same conditions (period of time and drought).

Within the context of the invention, a plant that survives longer during or after water stress is preferably defined as a plant that is able to survive a longer period of drought than its wild type counterpart.

In this context a period of time is preferably 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 days or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16 weeks or longer. A longer period of drought survived by a plant of the invention may be period of drought 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 days longer or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 weeks or longer.

Water stress for the purpose of this invention is defined as drought. Drought and water stress have been earlier defined herein

Improved growth can be seen as increased accumulated biomass, or increased average accumulated biomass. For example the biomass of treated or modified plants as envisioned by the invention compared to the biomass of wild-type plant is higher by 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. Biomass can be determined be weighing the entire plant or a specified part thereof, such as roots, stem, stalk, leafs, fruit, seeds, or a combination thereof. In this context a period of time is preferably 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, or 13 days longer or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 weeks or longer.

Within the context of this invention, a plant with increased water use efficiency is defined as a plant which uses 95%> of the water used by a wild type plant, or 90%>, 80%>, 70%, 60%, 50%, 40%, 30%, 20%, 10% or less water. Alternatively and/or in combination with the increased water efficiency of said plant, a plant may also exhibit decreased water loss. For example, water loss may be 98%> of the water loss of a wild type plant, or 95%, 90%, 85%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%. Preferably said increased water use efficiency and/or said decreased water loss is assessed over a period of time and under drought conditions, more preferably said period of time is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 days or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 weeks or longer. Drought has been earlier defined. Water loss and water use can be quantified by:

1. Short-term water loss: Monitor or compare the weight of a wild type and a mutant plant over a period of time once it is detached from the soil as has been shown in figure 14. Figure 14 depicts the results of such a quantification method: 14-day-old plants detached from soil are weight among time and result graph is provided in figure 14.

2. Long term water loss: Soil drying response. Compare a wild type and a mutant plant growth upon slow soil drying. The weight of such plants over a period of time also indicates the water use/loss of such plants. Such a method had been carried out in the experimental part and results are shown in figures 1, 2, 3, 4, 6: 3 week old plants are subjected to drought stress and followed among time. The curve shows weight of every pot containing the plant and soil every 24 hours.

3. Long term water loss: Soil drying response. Compare a wild type and a mutant plant growth upon slow soil drying over a period of time. Recovery of plants after re-watering after a period of drought may also indicate the water use of the drought stress plant. Such a method had been carried out in the experimental part and results are shown in figures 5 and 6: 3 week old plants are subjected to drought stress and rewatered for seven days.

4. Water soil content by measuring soil moisture/humidity over a period of time (Verslues et al, 2006).

Within the context of this invention, a plant that survives longer after re-watering is defined as a plant with an increased survival rate when water is provided after a period of drought compared to the survival of a wild type plant under the same conditions (period of time and conditions). Increased survival, increased survival rate, drought, drought period, longer drought period, period of time and water stress have been earlier defined herein.

Within the context of this invention, a plant with improved root hydrotropism is defined as a plant with an increase in average or mean root curvature distribution, or an increase in percentage of roots with a curvature close to 180 degrees. Preferably, a plant with improved root hydrotropism contains a root curvature distribution where the percentage of roots with an angle between 160 and 180 degrees is increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or higher when compared to the corresponding percentage of a normal or wild-type plant under the same conditions (period of time and drought). Alternatively, a plant with improved root hydrotropism contains a root curvature distribution where the percentage of roots with an angle between 120 and 150 degrees is decreased by 5%, 10%>, 15%, 20%>, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or higher when compared to the corresponding distribution of a normal or wild-type plant under the same conditions (time and drought). Root curvature can be measured by growing seedlings vertically on MS standard medium or ½ MS standard medium and treated during 24-48h or during 30 min, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours in a gradient concentration of sorbitol, subsequently measuring five-day-old seedling root curvature (or six-day-old or seven-day-old or eight-day-old or nine-day- old or ten-day-old) and analyzing the angle in Image J software. Period of time and drought have already been defined herein. ½ MS standard medium is MS standard medium, which has been, diluted ½. Within the context of this invention, a plant with improved sorbitol or abscisic acid response is defined as a plant with longer root length than the root length of a corresponding wild-type plant when grown in the presence of sorbitol or abscisic acid. Preferable, root length is increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%), 60%), 70%), 80%), 90%) or more when compared to the corresponding root length of a normal or wild-type plant under the same conditions (period of time and drought). Root length can be determined when transferring 5-day-old seedlings (or 1 -day-old, or 2-day-old, or 3-day-old or 4-day-old, or 6-day-old, or 7-day-old, or 8-day-old, or 9-day- old or older seedlings), which are germinated, on standard growing medium MS ½ to sorbitol (100-400 niM) or mannitol (100-400mM) or PEG (5-10%) or ABA (5 μΜ) containing plates and measuring the length of 10-day-old roots (or 1-day-old, or 2-day- old, or 3-day-old or 4-day-old, or 5-day-old, or 6-day-old, or 7-day-old, or 8-day-old, or 9-day-old or older roots). Roots can be compared to roots from control plants not grown on sorbitol or mannitol or PEG or ABA plates to determine a growth ratio or root growth performance (%). Period of time and drought have already be defined herein.

Within the context of this invention, a plant wherein a drought stress marker gene has been down regulated, is defined as a plant wherein expression of a drought stress marker gene is decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%), 80%), 90%), 95%) or more when compared to the expression of the corresponding marker gene in a normal or wild-type plant under the same conditions (time and drought). A drought stress marker gene for the purpose of the invention is defined as a gene, which is up regulated under drought conditions in a normal or wild-type plant. Up regulation and down-regulation can be determined by gene arrays, qPCR techniques or Western blot analysis. A gene and/or protein is said to be up regulated when the amount of mRNA transcribed from said gene and/or the amount of protein translated from said mRNA is increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%), 70%), 80%), 90, or more when compared to the expression of a corresponding marker in a normal or wild-type plant under the same conditions (time and drought). Accordingly, a gene and/or protein is said to be down regulated when the amount of mRNA transcribed from said gene and/or the amount of protein translated from said mRNA is decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90, or more when compared to the expression of a corresponding marker in a normal or wild-type plant under the same conditions (time and drought). A preferred drought stress marker gene is RD29A.

The brassinosteroid signaling pathway is known to a person skilled in the art as a signaling pathway common to presumably all vascular plants. Vascular plants may also called higher plants in the context of the invention. Brassinosteroids (BRs) are a class of steroid hormones, which regulate plant development and physiology. BRs are known to be present in all growing tissues of higher or vascular plants with the highest levels found in pollen. Unlike steroid hormones in animals, the BR hormones are perceived at the cell membrane by a trans-membrane receptor kinase BRAS SINO STEROID INSENSITIVE 1 (BRI1). This binding causes activation of the BRI1 kinase and subsequent recruitment and activation of the co-receptor BRIl -ASSOCIATED RECEPTOR KINASE 1 (BAK1), eventually leading to downstream signaling events and regulation of gene transcription. Therefore a method comprising down regulating or inhibiting the BR signaling pathway can be understood as a modulation of the expression at the gene and/or protein level of a component of the BR signaling pathway. Alternatively a method comprising up regulating or increasing the BR signaling pathway can be understood as a modulation of the expression at the gene and/or protein level of a component of the BR signaling pathway.

In a preferred embodiment, the method of modulation, preferably down regulation or up regulation of the BR signaling pathway according to the invention is achieved at the gene and/or at the protein level and wherein the expression of at least one gene and/or protein of the BR signaling pathway has been modulated.

Modulation as envisioned by the invention includes up and down regulation at the gene and/or protein level. Modulation preferably results in a change in expression of said gene and/or encoded protein. Modulation may also result in a change of activity of a given gene and/or protein.

Examples of components of the BR signaling pathway are BRIl , BRLl, BRL3, BAK1, BSK1, BIN2, PP2A, BSU1, BES1 and BZR1. Examples of enzymes of the BR synthesis pathway are DWARF4, DET2, CPD and BAS1. Examples of modulation at gene and/or protein level are modulation in expression of genes and/or proteins known to function in the brassino steroid pathway.

Such modulation may result in down regulation of the brassinosteroid pathway by a modulation of expression at the gene and/or protein level resulting in: a modulation at the gene and/or protein level leading to a decrease in synthesis of a steroid hormone, a decrease in brassinosteroid perception, a decrease in signaling associated with brassinosteroid and/or a decrease in gene transcription.

Such modulation may result in up regulation of the brassinosteroid pathway by a modulation of expression at the gene and/or protein level resulting in: a modulation at the gene and/or protein level leading to an increase in synthesis of a steroid hormone, an increase in brassino steroid perception, an increase in signaling associated with brassinosteroid and/or an increase in gene transcription.

It is also encompassed by the present invention to upregulate the expression at the gene and/or expression level of one component of the brassinosteroid signaling pathway and downregulate the expression at the gene and/or expression level of another component of the brassinosteroid signaling pathway. In this context, it is encompassed to downregulate the expression of at least one of BRI1, BRL1, BRL3, BSK1, BSK3, BAKl, PP2A, BSUl, BESl and BZRl genes and upregulate the expression of at least one of BKIl and BIN2. In this context, it is also encompassed to upregulate the expression of at least one of BRI1, BRLl, BRL3, BSK1, BSK3, BAKl, PP2A, BSUl, BESl and BZRl genes and downregulate the expression of at least one of BKIl and BIN2.

The expression of CPD, DET2 and/or DWARF4 genes may also be modulated.

The downregulation and upregulation of a gene may be carried out as explained earlier herein.

In one embodiment of the invention, synthesis of brassinosteroids is reduced (or decreased) to at least 80%, 70%, 60%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%), 3%), 2%>, 1.5%, 1%), 0.5%) or less, preferably over an extended period of time of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 days or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16 weeks or longer, when compared to the synthesis of brassinosteroids in a normal, untreated or wild type plant over the same period of time and under the same conditions.

In another embodiment of the invention, synthesis of brassinosteroids is upregulated (or increased) to at least 0.5%, 1%, 1.5%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%), 50%), 60%), 70%), 80%) or more, preferably over an extended period of time of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13 days or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16 weeks or longer, when compared to the synthesis of brassinosteroids in a normal, untreated or wild type plant over the same period of time and under the same conditions.

A reduction or an upregulation of synthesis can be determined by measuring the amount of brassinosteroids available in a tissue and comparing that amount to the amount synthesized in a comparable tissue of related normal, untreated or wild type plant. Preferred tissues are roots, stems, stalks, leaves, petals, fruits, seeds, tubers, pollen, meristems, callus, sepals, bulbs and flowers. The person skilled in the art will be aware that BR can be quantified using radioactivity labeling (Wang et al 2001, Cano- Delgado et al. 2009).

In another embodiment, brassmosteroid perception is reduced (or decreased) to 80%, 70%, 60%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1.5%, 1%, 0.5% or less, preferably over an extended period of time of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13 days or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 weeks or longer, when compared to the brassmosteroid perception of a normal, untreated or wild type plant over the same period of time and under the same conditions.

Perception of brassinosteroid hormone or modified perception of brassmosteroid hormone for the purpose of this invention in this embodiment can be seen as a reduced binding of brassinosteroid hormone to a receptor that normally binds such hormone while a similar amount of brassinosteroid is available for binding, or a reduced affinity of a receptor that normally binds brassinosteroid. Reduced binding for the purpose of this invention is meant to be that the amount of brassinosteroid hormone bound to a receptor is 80%, 70%, 60%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1.5%), 1%), 0.5%) or less when compared to the corresponding binding in a normal, untreated or wild type plant.

In another embodiment, the modification of the brassinosteroid perception is such that it is upregulated (or increased) to at least 0.5%, 1%, 1.5%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80% or more, preferably over an extended period of time of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13 days or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 weeks or longer, when compared to the brassinosteroid perception of a normal, untreated or wild type plant over the same period of time and under the same conditions.

Modified perception of brassinosteroid hormone for the purpose of this invention in this embodiment can be seen as an upregulated or increased binding of brassinosteroid hormone to a receptor that normally binds such hormone while a similar amount of brassinosteroid is available for binding, or an increased affinity of a receptor that normally binds brassinosteroid. Increased binding for the purpose of this invention is meant to be that the amount of brassinosteroid hormone bound to a receptor is at least 0.5%, 1%, 1.5%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80% or more when compared to the corresponding binding in a normal, untreated or wild type plant.

Examples of receptors that normally bind brassinosteroid are BRIl, BRLl and BRL3. Reduced perception may result from mutation, modification, deletion, conformational change of the ligand binding part of the receptor, or a miss- localization of the entire receptor. Increased perception or increased binding may result from the overexpression of a component of the brassinosteroid pathways and/or from an enzyme of the BR synthesis pathway as earlier defined.

The person skilled in the art will be aware that binding affinity can be measured by for example detecting ³H-labeled brassinolide (BL) and BES1-D and BZR1-D de- phosphorylation status using anti-BESl-D antibodies (Yin Y et al. 2005, Kinoshita T et al. 2005).

In another embodiment, brassinosteroid signaling is reduced (or decreased) to 80%>, 70%, 60%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1.5%, 1%, 0.5% or less, preferably over an extended period of time of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13 days or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 weeks or longer, when compared to a normal, untreated or wild type plant over the same period of time.

In another embodiment, brassinosteroid signaling is upregulated (or increased) to at least 0.5%, 1%, 1.5%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%), 80%) or more, preferably over an extended period of time of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 days or 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16 weeks or longer, when compared to a normal, untreated or wild type plant over the same period of time. A change in brassinosteroid signaling can encompass a change in any of the signaling components, such brassinosteroid signaling may refer to a kinase or enzyme activity, phosphorylation state, protein-protein interactions, cellular localization, regulation of transcription, DNA binding or RNA binding. The kinase or enzyme referred to may be the kinase or enzyme of a receptor bound by brassinosteroid. The person skilled in the art is aware of assays to assess signaling, such as measuring a kinase activity, phosphorylation of a key signaling component or gene transcription of a regulated gene. Examples of kinase activity that may be modulated (preferably upregulated or downregulated) include BRIl, BRLl, BRL3, BAKl, BIN2 or BSKl, examples of enzyme activity may include PP2A activity, examples of phosphorylation of proteins may include the phosphorylation of BRIl, BAKl , BZRl or BESl , examples of cellular localization may include the cellular localization of BZRl or BESl .

In a preferred embodiment, the method comprises preferably the modulation by down regulating or up regulating the brassino steroid signaling according to the invention. Said down or up regulation is achieved at the gene and/or protein level, and wherein at least one, preferably two, more preferably three, most preferably four genes and/or proteins of the brassinosteroid pathway has been modulated (preferably downregulated or up regulated), the genes and/or proteins being selected from the group consisting of: BRIl, BRLl, BRL3 and BAKl. Accordingly a plant obtainable by such a method is encompassed by the invention.

In a preferred method and accordingly a plant according to the invention, a BRIl is modulated at the gene and/or protein level. More preferably the modulation of BRIl is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BRIl is an upregulation at the gene and/or protein level. Such a transgenic plant with a regulated BRIl was prepared in the experimental part. Preferred plant expresses, more preferably overexpresses a chimeric BRIl-GFP gene. Such a plant may be advantageously used in a method as later defined herein. In another preferred method and accordingly a plant according to the invention, a BRLl is modulated at the gene and/or protein level. More preferably the modulation of BRLl is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BRLl is an upregulation at the gene and/or protein level. Such a transgenic plant with a regulated BRLl was prepared in the experimental part. Preferred plant expresses, more preferably overexpresses a chimeric BRL1-GFP gene. Such a plant may be advantageously used in a method as later defined herein. In another preferred method and accordingly a plant according to the invention, a BRL3 is modulated at the gene and/or protein level. More preferably the modulation of BRL3 is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BRL3 is an upregulation at the gene and/or protein level. Such a transgenic plant with a regulated BRL3 was prepared in the experimental part. Preferred plant expresses, more preferably overexpresses a chimeric BRL3-GFP gene. Such a plant may be advantageously used in a method as later defined herein. In another preferred method and accordingly a plant according to the invention, a BAKl is modulated at the gene and/or protein level. More preferably the modulation of BAKl is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BAKl is an upregulation at the gene and/or protein level.

In another preferred method and accordingly a plant according to the invention, a BRI1 and BRLl are modulated at the gene and/or protein level. More preferably the modulation of BRIl and BRLl is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BRIl and BRLl is an upregulation at the gene and/or protein level.

In another preferred method and accordingly a plant according to the invention, a BRIl and BRL3 are modulated at the gene and/or protein level. More preferably the modulation of BRIl and BRL3 is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BRIl and BRL3 is an upregulation at the gene and/or protein level.

In another preferred method and accordingly a plant according to the invention, a BRIl and BAKl are modulated at the gene and/or protein level. More preferably the modulation of BRIl and BAKl is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BRIl and BAKl is an upregulation at the gene and/or protein level.

In another preferred method and accordingly a plant according to the invention, a BRLl and BRL3 are modulated at the gene and/or protein level. More preferably the modulation of BRLl and BRL3 is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BRLl and BRL3 is an upregulation at the gene and/or protein level.

In another preferred method and accordingly a plant according to the invention, a BRLl and BAKl are modulated at the gene and/or protein level. More preferably the modulation of BRLl and BAKl is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BRLl and BAKl is an upregulation at the gene and/or protein level.

In another preferred method and accordingly a plant according to the invention, a BRL3 and BAKl are modulated at the gene and/or protein level. More preferably the modulation of BRL3 and BAKl is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BRL3 and BAKl is an upregulation at the gene and/or protein level.

In another preferred method and accordingly a plant according to the invention (preferably obtainable by a method of the invention is a plant wherein), a BRIl, BRLl and BRL3 are modulated at the gene and/or protein level. More preferably the modulation of BRIl, BRLl and BRL3 is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BRIl, BRLl and BRL3 is an upregulation at the gene and/or protein level. Such a drought tolerant plant has been generated in the examples.

In another preferred method and accordingly a plant according to the invention, a BRIl, BRLl and BAKl are modulated at the gene and/or protein level. More preferably the modulation of BRIl, BRLl and BAKl is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BRIl, BRLl and BAKl is an upregulation at the gene and/or protein level.

In another preferred method and accordingly a plant according to the invention, a BRIl, BRL3 and BAKl are modulated at the gene and/or protein level. More preferably the modulation of BRIl, BRL3 and BAKl is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BRIl, BRL3 and BAKl is an upregulation at the gene and/or protein level.

In another preferred method and accordingly a plant according to the invention, a BRLl, BRL3 and BAKl are modulated at the gene and/or protein level. More preferably the modulation of BRLl, BRL3 and BAKl is a downregulation at the gene and/or protein level. In another more preferred embodiment, the modulation of BRLl, BRL3 and BAKl is an upregulation at the gene and/or protein level.

In a most preferred method and accordingly a plant according to the invention (preferably obtainable by a method of the invention is a plant wherein), a BRIl, BRLl, BRL3 and BAKl are modulated (preferably downregulated or reduced) at the gene and/or protein level. Within the context of the invention, an aquad mutant is defined as a plant where a BRIl, BRLl, BRL3 and BAKl are modulated (preferably downregulated or reduced) at the gene and/or protein level. The aquad mutant displays the most drought resistant phenotype according to the examples provided and therefore is the most preferred embodiment of the invention. In another preferred method and accordingly a plant according to the invention, a BRI1 , BRL1 , BRL3 and BAK1 (aquad) are modulated (preferably upregulated or increased) at the gene and/or protein level.

In another preferred embodiment, the method comprising modulating preferably down regulating (or decreasing) the brassinosteroid signaling according to the invention is achieved at the gene and/or protein level in a plant:

Wherein at least one, preferably two, more preferably three, most preferably four genes and/or proteins of the brassinosteroid pathway has been modulated (preferably downregulated or decreased), the genes and/or proteins being selected from the group consisting of: BRI 1 , BRL 1 , BRL3 and BAK1.

More preferably, said plant further comprises a modulation (preferably a downregulation or decrease) of the expression of a gene and/or protein which is selected from the group consisting of: DWARF4, DET2, CPD, BAS 1 , BIN2, BSK1 , BSU1 , BES 1 , BZR1 and PP2A.

Accordingly a plant obtainable by such a method is encompassed by the invention.

In another preferred embodiment, the method comprising modulating preferably up regulating (or increasing) the brassinosteroid signaling according to the invention is achieved at the gene and/or protein level in a plant:

Wherein at least one, preferably two, more preferably three, most preferably four genes and/or proteins of the brassinosteroid pathway has been upregulated or increased, the genes and/or proteins being selected from the group consisting of: BRIl , BRLl , BRL3 and BAK1.

More preferably, said plant further comprises an upregulation or increase of the expression of a gene and/or protein which is selected from the group consisting of: DWARF4, DET2, CPD, BAS 1 , BIN2, BSK1 , BSU1 , BES1 , BZR1 and PP2A.

Accordingly a plant obtainable by such a method is encompassed by the invention.

Accordingly, a BRIl in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99%) or 100%) sequence identity with SEQ ID NO: l preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:2 preferably over its entire length, said protein being encoded by said gene, and said protein being a receptor kinase capable of binding a brassinosteroid and capable of dimerising with BAKl . The person skilled in the art will be aware of methods to assess BRll kinase activity, such as phosphorylation assays, or determining BRll auto-phosphorylation or BAKl trans-phosphorylation by antibody detection (Wang Z.Y. et al. 2001, Nam et al. 2002).

Accordingly, a BRL1 in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100%) sequence identity with SEQ ID NO: 9 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 10 preferably over its entire length, said protein being encoded by said gene, and said protein being a receptor kinase capable of binding a brassinosteroid and capable of dimerising with BAKl . The person skilled in the art will be aware of assays capable of assays for determining BRLl activity, such as antibodies recognizing BRLl-BAKl protein-protein interaction or transient interaction assays in protoplasts or Nicotiana benthamiana leaves (Cano-Delgado et al. 2004, Kinoshita et al. 2005, Fabregas et al. 2013).

Accordingly, a BRL3 in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99%) or 100%) sequence identity with SEQ ID NO: 11 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 12 preferably over its entire length, said protein being encoded by said gene, and said protein being capable of binding a brassinosteroid and capable of dimerising with BAKl . The person skilled in the art will be aware of assays capable of assays for determining BRL3 activity, such as antibodies recognizing BRL3- BAK1 protein-protein interaction or transient interaction assays in protoplasts or Nicotiana benthamiana leaves (Carlo -Delgado et al. 2004, Kinoshita et al. 2005, Fabregas et al. Plant Cell 2013). Accordingly, a BAKl in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99%) or 100%) sequence identity with SEQ ID NO: 13 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 14 preferably over its entire length, said protein being encoded by said gene, and said protein being encoded by the gene, being a receptor kinase capable of dimerising with BRIl , BRLl or BRL3. The person skilled in the art will be aware of assays for determining BAKl activity, such as phosphorylation assays, or determining auto-phosphorylation levels of BAKl using BAKl specific antibodies (Nam et al. 2002).

Accordingly, a CPD in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100%) sequence identity with SEQ ID NO: 15 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 16 preferably over its entire length, said protein being encoded by said gene, and said protein being a biosynthetic enzyme component for generating a active brassinosteroid hormone. The person skilled in the art will be aware that BR signaling affects CPD expression levels which can be determined using routine Real Time quantitative PCR (Bancos S et al. 2002).

Accordingly, a DWARF4 in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99%) or 100%) sequence identity with SEQ ID NO: 17 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 18 preferably over its entire length, said protein being encoded by said gene, and said protein being a biosynthetic enzyme component for generating active brassinosteroid hormone. The person skilled in the art will be aware that BR signaling affects DWARF4 expression levels, which can be determined using routine Real Time quantitative PCR (Kim H.B. et al, 2006).

Accordingly, a DET2 in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99%) or 100%) sequence identity with SEQ ID NO: 19 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:20 preferably over its entire length, said protein being encoded by said gene, and said protein being a biosynthetic enzyme component for generating a active brassinosteroid hormone. The person skilled in the art will be aware that BR signaling affects DET2 expression levels, which can be determined using routine Real Time quantitative PCR (Fujioka et al., 1997). Accordingly, a BIN2 in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100%) sequence identity with SEQ ID NO:21 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:22 preferably over its entire length, said protein being encoded by said gene, and said protein being a kinase capable of phosphorylating BZR1 and/or BES l . The person skilled in the art will be aware that BIN2 activity can be determined by looking at BZR1 and BES l phosphorylation levels using specific antibodies (Yin Y. et al, 2002, Mora-Garcia S.et al. 2004) Accordingly, a BSK in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99%) or 100%) sequence identity with SEQ ID NO:23 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:24 preferably over its entire length, said protein being encoded by said gene, and said protein being a kinase capable of binding to BRI1 cytoplasmic domain and to be phosphorylated by BRI1. The person skilled in the art will be aware that BSK activity can be determined by assessing its binding to BRI1 and/or by assessing its phosphorylation status as described in (Kim T.W. et al, 201 1). Accordingly, a BSUl in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99%) or 100%) sequence identity with SEQ ID NO:25 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:26 preferably over its entire length, said protein being encoded by said gene, and said protein being a phosphatase capable of de- phosphorylating BES l . The person skilled in the art will be aware that BSUl activity can be determined by looking at BES l phosphorylation levels using specific antibodies (Mora-Garcia S. et al, 2004). Accordingly, a BES 1 in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100%) sequence identity with SEQ ID NO:27 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:28 preferably over its entire length, said protein being encoded by said gene, and said protein being a transcription factor capable of translocating to the nucleus. The person skilled in the art will be aware that active (unphosphorylated) or inactive (phosphorylated) forms of BES 1 can be detected by phosphorylation-specific antibodies (Yin Y. et al., 2002).

Accordingly, a BZRl in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99%) or 100%) sequence identity with SEQ ID NO:29 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:30 preferably over its entire length, said protein being encoded by said gene, and said protein being a transcription factor capable of translocating to the nucleus. The person skilled in the art will be aware that the activity of BZRl is determined by the phosphorylation state, which can be distinguished using BZRl specific antibodies (Wang Z.Y. et al, 2002).

Accordingly, a PP2A in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99%) or 100%) sequence identity with SEQ ID NO:31 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:32 preferably over its entire length, said protein being encoded by said gene, and said protein being a phosphatase capable of de- phosphorylating BZRl . The person skilled in the art will be aware that PP2A activity can be determined by looking at BZRl phosphorylation levels using specific antibodies (Wu G. et al., 201 1).

Accordingly, a RD29A in the context of the invention is a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:33 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:34 preferably over its entire length, said protein being encoded by said gene, and said protein being a biosynthetic enzyme component for generating an active brassinosteroid hormone. The person skilled in the art will be aware that BR signaling affects RD29A expression levels, which can be determined using routine Real Time quantitative PCR, for example using the primers provided by SEQ ID NO:59 and SEQ ID NO:60. A modulation, preferably a downregulation or decrease at the gene and/or protein level of BRIl preferably results in a truncated protein, and/or a protein with reduced kinase activity, and/or a protein with reduced brassinosteroid binding capability, and/or a miss- localized protein, and/or a protein with reduced signaling capability and/or a reduced protein level. Protein level is synonymous of protein expression level. Preferably such modulation (preferably downregulation or decrease) results from a deletion, a substitution and/or an insertion at the gene level. Examples of deletions are deletions in the brassino steroids binding domain and/or the kinase domain and/or deletions resulting in a frame shift, preferably deletions are deletions of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 nucleotides or more. Examples of substitutions are substitutions resulting in a premature stop codon or substitutions leading to the mutation of a highly preserved amino acid of the protein sequence. Examples of highly conserved amino acids are amino acids in the catalytic kinase domain and brassinosteroid-binding domain. An example of a preferred mutant with a substitution in a highly conserved amino acid in the kinase domain is a mutant bri 1-301. An example of a preferred mutant with an substitution which disrupts the brassinosteroid binding domain is a mutant bril-116. Another example of a preferred substitution mutant is a mutant bril-5. Examples of insertions are insertions that lead to a frame shift, resulting in a truncated protein or insertions leading to miss folding of the protein or insertions disrupting the function of an essential domain such as the kinase domain or brassinosteroid domain.

Accordingly, a mutant bril-301 in the context of the invention is characterized by or comprises a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:5 preferably over its entire length, or a protein with at least 50%, 60%>, 70%>, 80%>, 90%>, 95%), 99%) or 100% sequence identity with SEQ ID NO:6 preferably over its entire length, said protein being encoded by said gene, and said protein having an inactivated kinase domain. Such a mutant as defined above preferably has GLY989 of BRI1 (i.e. SEQ ID NO:2 as amino acid sequence and SEQ ID NO: l as encoding nucleotide sequence) which has been replaced by another amino acid, more preferably ILE. Even more preferably the substitution of GLY989 into ILE has been realized with a simultaneous substitution of Guanidine2965 and Guanidine2966 of BRI1 (i.e. SEQ ID NO:2 as amino acid sequence and SEQ ID NO: l as encoding nucleotide sequence). Most preferably, Guanidine2965 has been replaced by Adenosine and/or Guanidine2966 by Thymine.

In a preferred embodiment, such a mutant bril-301 in the context of the invention is characterized by or comprises a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 5 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:6 preferably over its entire length, said protein being encoded by said gene, said protein having an inactivated kinase domain and:

the amino acid at position 989 of said mutant is no longer GLY as in BRI1 (i.e.

SEQ ID NO:2 as amino acid sequence and SEQ ID NO: l as encoding nucleotide sequence) and preferably

the nucleotide at position 2965 and 2966 is no longer Guanidine2965 and Guanidine2966 as in BRI1 (i.e. SEQ ID NO:2 as amino acid sequence and SEQ ID NO: l as encoding nucleotide sequence).

More preferably, said mutant is characterized by or comprises a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99%) or 100%) sequence identity with SEQ ID NO: 5 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:6 preferably over its entire length, said protein being encoded by said gene, said protein having an inactivated kinase domain and has ILE at position 989, and preferably resulting from an Adenosine at position 2965 and/or Thymidine at position 2966 of the gene sequence. Accordingly, a mutant bril-116 in the context of the invention is characterized by or comprises a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:3 preferably over its entire length, or a protein with at least 50%>, 60%>, 70%>, 80%>, 90%>, 95%, 99% or 100% sequence identity with SEQ ID NO:4 preferably over its entire length, said protein being encoded by said gene, and said protein having a non-sense mutation leading to a truncated protein by comparison to BRI1 (i.e. SEQ ID NO:2 as amino acid sequence and SEQ ID NO:l as encoding nucleotide sequence). Such a mutant preferably has the codon of GLU583 of BRI1 (i.e. SEQ ID NO:2 as amino acid sequence and SEQ ID NO: 1 as encoding nucleotide sequence) which has been replaced by a stop codon. Even more preferably the substitution of the codon of GLU583 into a stop codon has been realized in combination with a substitution of Cytosinel747 of BRI1 (i.e. SEQ ID NO:2 as amino acid sequence and SEQ ID NO: l as encoding nucleotide sequence). Most preferably, Cytosinel747 has been replaced by Adenine. A stop codon is preferably TAA, TAG or TGA.

In a preferred embodiment, such a mutant bril-116 in the context of the invention is characterized by or comprises a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 3 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:4 preferably over its entire length, said protein being encoded by said gene, said protein having a non-sense mutation leading to a truncated protein and:

the amino acid at position 583 of said mutant is no longer GLU as in BRI1 (i.e.

SEQ ID NO:2 as amino acid sequence and SEQ ID NO: l as encoding nucleotide sequence) and has been replaced by a stop codon and preferably the nucleotide at position 1747 is no longer Cytosine as in BRI1 (i.e. SEQ ID

NO:2 as amino acid sequence and SEQ ID NO: l as encoding nucleotide sequence).

More preferably, said mutant is characterized by or comprises a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99%) or 100%) sequence identity with SEQ ID NO: 3 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:4 preferably over its entire length, said protein being encoded by said gene, said protein having a non-sense mutation leading to a truncated protein and has a stop codon at position 583, and preferably said stop codon results from an Adenosine at position 1747. Accordingly, a mutant bril-5 in the context of the invention is characterized by or comprises a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:7 preferably over its entire length, or a protein with at least 50%>, 60%>, 70%>, 80%>, 90%>, 95%), 99%) or 100% sequence identity with SEQ ID NO:8 preferably over its entire length, said protein being encoded by said gene, and said protein having a reduced activity. Such a mutant preferably has CYS69 of BRI1 (i.e. SEQ ID NO:2 as amino acid sequence and SEQ ID NO:l as encoding nucleotide sequence) which has been replaced by another amino acid, more preferably TYR. Even more preferably the substitution of CYS69 into TYR has been realized in combination with a substitution of Guanidine206. Most preferably, Guanidine206 has been replaced by an Adenosine.

In a preferred embodiment, such a mutant bril-5 in the context of the invention is characterized by or comprises a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 7 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:8 preferably over its entire length, said protein being encoded by said gene, said protein having a reduced activity and:

the amino acid at position 69 of said mutant is no longer CYS as in BRIl (i.e. SEQ ID NO:2 as amino acid sequence and SEQ ID NO: l as encoding nucleotide sequence) and preferably

the nucleotide at position 206 is no longer Guanidine as in BRIl (i.e. SEQ ID NO:2 as amino acid sequence and SEQ ID NO: l as encoding nucleotide sequence).

More preferably, said mutant is characterized by or comprises a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99%) or 100%) sequence identity with SEQ ID NO: 7 preferably over its entire length, or a protein with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 8 preferably over its entire length, said protein being encoded by said gene, said protein having a reduced activity and has TYR at position 69, preferably resulting from an Adenosine at position 206 of the gene.

A modulation (preferably a downregulation or decrease) at the gene and/or protein level of BRL1 preferably results in a truncated protein, and/or a protein with reduced kinase activity, and/or a protein with reduced brassinosteroid binding capability, and/or a mis-localized protein, and/or a protein with reduced signaling capability and/or a reduced protein level. Preferably such modulation results from a deletion, a substitution and/or an insertion at the gene level. Examples of deletions are deletions in the brassinosteroid binding domain and/or the kinase domain and/or deletions resulting in a frame shift, preferably deletions are deletions of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 nucleotides or more. Examples of substitutions are substitutions resulting in a premature stop codon or substitutions leading to the mutation of a highly preserved amino acid of the protein sequence. Examples of highly conserved amino acids are amino acids in the catalytic kinase domain and brassinosteroid-binding domain. Examples of insertions are insertions that lead to a frame shift, resulting in a truncated protein or insertions leading to miss-folding of the protein or insertions disrupting the function of an essential domain such as the kinase domain or brassinosteroid domain. An example of a preferred mutant with an insertion leading to a frameshift and/or a premature stop codon is a mutant brll-2.

Accordingly, a mutant brll-2 in the context of the invention is characterized by or comprises a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO:9 preferably over its entire length with an insertion of 100 to 10 000 nucleotides within an exon, intron, UTR or promoter region of the gene. Preferably said inserted sequence comprises 500 to 8000 nucleotides or 1000 to 6000 or 2000 to 5000 or 4000 to 5000 or 4300 to 4600 nucleotides of a sequence with 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 35. Such a mutant with a TDNA insertion in its genome could be prepared as already described (Alonso JM. et al 2003).

A modulation (preferably a downregulation or a decrease) at the gene and/or protein level of BRL3 preferably results in a truncated protein, and/or a protein with reduced kinase activity, and/or a protein with reduced brassinosteroid binding capability, and/or a miss- localized protein, and/or a protein with reduced signaling capability and/or a reduced protein level. Preferably such modulation results from a deletion, a substitution and/or an insertion at the gene level. Examples of deletions are deletions in the brassinosteroid binding domain or the kinase domain or deletions resulting in a frame shift, preferably deletions are deletions of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 nucleotides or more. Examples of substitutions are substitutions resulting in a premature stop codon or substitutions leading to the mutation of a highly preserved amino acid of the protein sequence. Examples of highly conserved amino acids are amino acids in the catalytic kinase domain and brassinosteroid-binding domain. Examples of insertions are insertions that lead to a frame shift, resulting in a truncated protein or insertions leading to mis- folding of the protein or insertions disrupting the function of an essential domain such as the kinase domain or brassinosteroid domain. An example of a preferred mutant with an insertion leading to a frameshift and/or a premature stop codon is a mutant brl3-2.

Accordingly, a mutant brl3-2 in the context of the invention is characterized by or comprised a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 11 preferably over its entire length with an insertion of 100 to 10 000 nucleotides within an exon, intron, UTR or promoter region of the gene. Preferably said inserted sequence comprises 500 to 8000 nucleotides or 1000 to 6000 or 2000 to 5000 or 4000 to 5000 or 4300 to 4600 nucleotides of a sequence with 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 35. Such a mutant with a TDNA insertion in its genome could be prepared as already described (Alonso JM. Et al 2003). A modulation (preferably a downregulation or a decrease) at the gene and/or protein level of BAK1 preferably results in a truncated protein, and/or a protein with reduced kinase activity, and/or a protein with reduced BRI1 dimerisation capability, and/or a miss- localized protein, and/or a protein with reduced signaling capability and/or a reduced protein level. Preferably such modulation results from a deletion, a substitution and/or an insertion at the gene level. Examples of deletions are deletions in the brassinosteroid binding domain or the kinase domain or deletions resulting in a frame shift, preferably deletions are deletions of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 nucleotides or more. Examples of substitutions are substitutions resulting in a premature stop codon or substitutions leading to the mutation of a highly preserved amino acid of the protein sequence. Examples of highly conserved amino acids are amino acids in the catalytic kinase domain. Examples of insertions are insertions that lead to a frame shift, resulting in a truncated protein or insertions leading to mis- folding of the protein or insertions disrupting the function of an essential domain such as the kinase domain or brassinosteroid domain. An example of a preferred mutant with an insertion leading to a frameshift and/or a premature stop codon is a mutant bakl-3. Accordingly, a mutant bakl-3 in the context of the invention is characterized by or comprises a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 13 preferably over its entire length with an insertion of 100 to 10 000 nucleotides within an exon, intron, UTR or promoter region of the gene. Preferably said inserted sequence comprises 500 to 8000 nucleotides or 1000 to 6000 or 2000 to 5000 or 4000 to 5000 or 4300 to 4600 nucleotides of a sequence with 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 35. Such a mutant with a TDNA insertion in its genome could be prepared as already described (Alonso JM. Et al 2003).

A modulation (preferably a downregulation or a decrease) at the gene and/or protein level of CPD preferably results in a truncated protein, and/or a protein with reduced kinase activity, and/or a protein with reduced CPD dimerisation capability, and/or a miss- localized protein, and/or a protein with reduced signaling capability and/or a reduced protein level. Preferably such modulation results from a deletion, a substitution and/or an insertion at the gene level. Examples of deletions are deletions in the brassinosteroid binding domain or the kinase domain or deletions resulting in a frame shift, preferably deletions are deletions of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 nucleotides or more. Examples of substitutions are substitutions resulting in a premature stop codon or substitutions leading to the mutation of a highly preserved amino acid of the protein sequence. Examples of highly conserved amino acids are amino acids in the catalytic kinase domain. Examples of insertions are insertions that lead to a frame shift, resulting in a truncated protein or insertions leading to mis- folding of the protein or insertions disrupting the function of an essential domain such as the kinase domain or brassinosteroid domain. An example of a preferred mutant with an insertion leading to a frameshift and/or a premature stop codon is a mutant cpd. Accordingly, a mutant cpd in the context of the invention is characterized by or comprises a gene or part of a gene represented by a nucleotide sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 15 preferably over its entire length with an insertion of 100 to 10 000 nucleotides within an exon, intron, UTR or promoter region of the gene. Preferably said inserted sequence comprises 500 to 8000 nucleotides or 1000 to 6000 or 2000 to 5000 or 4000 to 5000 or 4300 to 4600 nucleotides of a sequence with 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 35. Such a mutant with a TDNA insertion in its genome could be prepared as already described (Alonso JM. Et al 2003).In a preferred embodiment, the method comprises the introduction of a mutation in a gene and/or protein in the brassmosteroid signaling pathway, said mutation being selected from the group consisting of: bril-301, bril-116, bril-5, bakl-3, brll-2 and brl3-2.

In another embodiment, the transcription of a gene regulated by brassmosteroid has been modulated, preferably transcription of a gene known to be regulated by brassmosteroid signaling has been up regulated by at least 5%, 10%>, 20%>, 30%>, 40%>, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more, or down regulated to 90%, 80%, 70%, 60%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1.5%, 1%, 0.5% or less. The person skilled in the art is aware of typical target genes of brassmosteroid signaling and how expression levels can be determined. Examples of genes whose transcription is regulated by brassmosteroid signaling are: ROT3, DWF4, CPD, BRU1, CycD3, Lin6, OPR3 and TRIP-1.

Within the context of the invention, when the brassmosteroid pathway is increased or upregulated via the increase or upregulation of the gene and/or protein and/or activity level as earlier defined herein, this may be reached by overexpressing the gene as earlier defined using techniques known to the skilled person. The upregulation of the expression of a gene has been further defined in detail in the general part entitled "definitions", which is present at the end of the description. The generation of transgenic plant expressing or overexpressing a gene may be done using the DNA clone reported in (Cano-Delgado et al, 2004). A construct may be used comprising a gene to be expressed or overexpressed in the transgenic plant. This gene may be cloned using a recombination Gateway Multisite Cloning system (Invitrogen, 12536-017). A promoter, preferably a constitutive promoter is used. A preferred constitutive promoter is 35S (pEN-L4-2-Rl). Gateway P4P1R vector containing constitutive promoter 35S (pEN-L4-2-Rl) and pDONRP2RP3® vector containing the tagged YFP (pEN-R2-Y- L3) is preferably used. Both constructs are available in http :// gateway.psb .ugent.be (Karimi, M., Bleys, A., Vanderhaeghen, R. and Hilson, P. (2007) Building blocks for plant gene assembly. Plant Physiol. 145, 1183-119). A recombination LR reaction is preferably performed using the three sequenced pENTRY® vectors containing promoter, gene and tag sequences in a three-component pDEST® vector, pB7m34GW. The LR clonase enzyme may facilitate this LR reaction (11791-100; Invitrogen™) and transferred to plants by floral dipping (Clough, and Bent, 1998). In the experimental part of the invention, a preferred method is disclosed for obtaining transgenic plants.

Accordingly in a preferred method of the invention and plant hence obtainable by this method:

- the modulation is a downregulation and the genes and/or proteins downregulated are selected from the group consisting of BRIl, BAK1, BRLl and BRL3, preferably each of the genes and/or proteins BRIl, BAK1, BRLl and BRL3 have been downregulated or

- the modulation is an upregulation and the genes and/or proteins upregulated are selected from the group consisting of BRIl, BRLl and BRL3, preferably

BRIl, BRLl or BRL3 has been upregulated, or two of them or each of the genes and/or proteins BRIl, BRLl and BRL3 have been upregulated.

In this invention, transgenic plant expressing or overexpressing BRL3 or BRL3-GFP (also called gain-of- function BR receptor mutant 35S:BRL3-GFP), overexpressing BRLl or BRLl-GFP (also called gain-of- function BR receptor mutant 35S:BRL1- GFP), overexpressing BRIl or BRIl-GFP (also called gain-of- function BR receptor mutant 35S:BRI1-GFP), and plants downregulating BRIl, BAK1, BRLl and BRL3 (also called aquad) exhibit each attractive adaptive response to drought. The first transgenic plants (35S:BRL3-GFP, 35S:BRL1-GFP and 35S:BRI1-GFP), show an hypersensitive hydrotropic root curvature, which can avoid sorbitol media and search for water rich zones in the media or in the field. The second mutant plants aquad roots can grow in the high sorbitol media even if their roots do not curve. This seems to suggest that there might be more than one possible response to drought tolerance that has been developed by plant roots.

In a further embodiment, the method according to the invention is achieved by administering a compound for inhibiting or down-regulating the brassmosteroid pathway in a plant. This embodiment could be carried out as an alternative to each previous embodiment leading to the obtention of a genetically modified plant or in combination with at least one of each of these previous embodiments.

"Administering" in the context of the invention comprises providing the compound to the plant be way of spraying or otherwise applying directly on or to the plant, providing the compound to the plant dissolved in water provided to the plant, providing the compound to the plant by applying to the soil or support on which the plant is growing or providing to the plant by dissolving it in the agar medium provided for plant germination.

A compound for inhibiting the brassmosteroid pathway as envisioned by the invention comprises any compound that can be used to down regulate brassmosteroid signaling. Down regulation of the brassmosteroid pathways has already been defined herein. A plant obtainable by such method (i.e. a treated plant) has also been earlier defined herein. Examples of compounds that down regulate brassmosteroid signaling are compounds that inhibit synthesis of a brassmosteroid, compounds that prevent a brassmosteroid from binding to its receptor, compounds that inhibit brassmosteroid signaling and/or compounds that inhibit modulation of gene transcription regulated by brassmosteroid signaling. Preferred compounds for inhibiting brassmosteroid synthesis are Brassinazole and/or Propiconazole and/or BZR220 and/or YCZ-18 and/or an azole derivative.

Brassinazole is also known as 4-(4-Chloro-phenyl)-2-phenyl-3-[l,2,4]triazol-l-yl- butan-2-ol and as CAS 224047-41-0. Brassinazole can be purchased from Santa Cruz Biotechnology, Santa Cruz, CA, USA with product number sc-293954. The chemical formula is C18H18CI 3O. A concentration range for use of Brassinazole as envisioned by the invention may be in the range of 0.1 μΜ to 50 μΜ, or 0.5 μΜ to 40 μΜ or 1 μΜ to 30 μΜ or 5 μΜ to 25 μΜ.

BRZ₂₂o is also known as 2RS, 4i?5'-l-[4-(2-allyloxyphenoxymethyl)-2-(4- chlorophenyl)-[l,3]dioxolan-2-ylmethyl]-lH-[l,2,4]triazole. BRZ₂₂o is referred to in Yamada et al, 2013. The chemical formula is Ci₆Hi₈F₃N₃0₂. . A concentration range for use of BRZ₂₂₀ as envisioned by the invention may be in the range of 0.05 μΜ to 10 μΜ, or 0.1 μΜ to 7.5 μΜ or 0.5 μΜ to 6 μΜ or 1 μΜ to 5 μΜ.

Propiconazole is a triazole fungicide also known as dimethylation inhibiting fungicide (DMI). Propiconazole is also known as l-[ [2-(2,4-dichlorophenyl)-4-propyl-l,3- dioxolan-2-yl]methyl]-l,2,4-triazole, or with CAS number 60207-90-1 and has the chemical formula C15H17CI2N3O2. It is widely available for purchase. A concentration range for use of Propiconazole as envisioned by the invention may be in the range of 0.1 μΜ to 30 μΜ, or 0.5 μΜ to 25 μΜ or 1 μΜ to 20 μΜ or 5 μΜ to 20 μΜ.

Alternatively, YCZ-18 or other azole derivatives could be used for the inhibition of BR signaling as envisioned by the invention (Yamada et al. 2013). A concentration range for use of YCZ-18 as envisioned by the invention may be in the range of 0.1 μΜ to 100 μΜ, or 0.5 μΜ to 75 μΜ or 1 μΜ to 50 μΜ or 5 μΜ to 50 μΜ or 10 μΜ to 40 μΜ. In a further aspect, the invention provides for the use of a brassinosteroid inhibitor for generating a drought resistant plant. Examples of preferred inhibitors are Brassinazole and Propiconazole and/or BZR₂₂₀ and/or YCZ-18 and/or an azole derivative.

In a further aspect, the invention provides for a composition comprising a compound for inhibiting the brassinosteroid pathway for obtaining a drought tolerant plant. Examples of preferred inhibitors are Brassinazole and/or Propiconazole and/or BZR₂₂₀ and/or YCZ-18 and/or an azole derivative.

In a further aspect, there is a provided a plant obtainable by any of the methods of the invention (i.e. a treated plant or a modified plant). This plant may be modified compared to a wild type plant:

the plant may have a mutation in a gene and/or protein of the brassinosteroid signaling pathway, said gene and/or protein being selected from the group consisting of: bril, bakl, brll and brl3 and said mutation results in a plant having increased drought tolerance, and/or

the plant may have an overexpressed gene of the brassinosteroid signaling pathway, said gene being preferably selected from the group consisting of: BRI1, BRL1 and BRL3.

Preferably a plant comprises at least one mutation selected from the group consisting of bril-301, bril-116, bril-5, bakl-3, brll-2 and brl3-2.

A preferred modified plant: has a mutation in each of the following genes and/or proteins of the brassinosteroid signaling pathway: bril, bakl, brll and brl3 and said mutations results in a plant having a reduced brassinosteroid signaling pathway and an increased drought tolerance or

- has each of the following genes of the brassinosteroid signaling pathway which is overexpressed, said genes being BRI1, BRL1 and BRL3.

More preferably, a plant further comprises a mutation in a gene and/or protein selected from the group consisting of: DWARF, DET2, CPD, BIN2, BSK, BSU1, BES1 , BZR1 and PP2A. Each feature of said plant has been defined earlier herein.

A plant of the invention may have been modified according to the invention and simultaneously or subsequently treated.

In a further aspect, there is provided a method for identification of a brassinosteroid modulator for generating a drought tolerant plant, the method comprising the steps of:

(a) Providing a plant cell population capable of expressing a BRL3-GFP, BRL1-GFP and/or BRI1-GFP gene;

(b) Contacting or incubating the cell population with the substance to be tested preferably under water stress conditions;

(c) Determining the expression level of said BRL3-GFP, BRL1-GFP and/or BRI1-GFP or one of their activities,

(d) Comparing the expression level or activities as determined in (c) with the expression level or activities of the same genes in a similar cell population that has not been contacted with the substance; and,

(e) Identifying a brassinosteroid modulator that produces a modulation, preferably dowregulation and/or upregulation in expression level or activities of at least one of the three genes identified in step (c) between the cell population that has been contacted with the substance and the test cell population that has not been contacted with the substance.

Within the context of this method, a "brassinosteroid modulator " may be any compound or substance or a microorganism or a virus. A brassinosteroid modulator may be a brassinosteroid inhibitor or activator. A brassinosteroid modulator may induce the upregulation of at least one gene and/or the downregulation of at least another gene. Most features of said method have already been defined in earlier parts of the description or in the general part at the end of the description comprising definitions: " a drought tolerant plant", BRL3, BRL1, BRI1 genes, "water stress conditions' ' , ' 'do wnregulation' ' .

BRL3-GFP, BRL1-GFP and BRI1-GFP are chimeric genes as defined in the part dedicated to definitions at the end of the description. The BRL3, BRL1 and the BRI1 genes have been earlier defined herein. GFP stands for green fluorescent protein and is gene marker or gene reporter known to the skilled person.

In the context of step (a) of this method, the cell expresses, preferably overexpresses at least one of the three chimeric genes identified. More preferably two of these chimeric genes (BRL3 and BRL1, BRL3 and BRIl or BRLl and BRI1) are expressed, even more preferably overexpressed, even more preferably all three chimeric genes are expressed, even more preferably overexpressed. The term "expresses" defined in the part entitled definition located at the end of the description. The term "overexpresses" has already been defined herein.

The step b) of contact or incubation could be an in vitro step in the form of a cell culture or an in vivo step wherein the cell population may be a part of a plant such as a cell, tissue, organ, seed, fruit, product, progeny, propagation material or root. Step b) is preferably carried out under water stress conditions.

In step e) a brassinosteroid modulator has been identified when it produces or induces a modulation, preferably a downregulation and/or an upregulation in expression level or activities of at least one of the three genes identified in step (c) (more preferably a downregulation and/or an upregulation of two of these three genes or of all three genes is detected) between the cell population that has been contacted with the substance and the test cell population that has not been contacted with the substance.

Once such a brassinosteroid modulator has been identified, depending on its structure and mode of action, it could be used to generate a drought tolerant plant by generating a new modified plant (genetic modification) or by administrating this inhibitor to a plant (treatment).

The invention (methods, plant, use or composition) may be applied to any higher or vascular plant. A preferred plant is a monocotyledonous or a dicotyledonous as later defined herein. A more preferred plant is selected from Arabidopsis, Solarium, Glycine, Zea, Cucumis, Phaseolus, Succharum, Vicia, Oryza, Triticum and Sorghum. Preferred Solanum species include Solarium lycopersicum and Solarium pimpinellifollium.

The invention (methods, plant, use or composition) could be applied to a cell, tissue, organ, part, seed, fruit, product, progeny, or propagation material of the plant as defined herein. A preferred part of the plant for the purpose of the invention is the root.

Definitions

The phrase "nucleic acid" as used herein refers to a naturally occurring or

synthetic oligonucleotide or polynucleotide, whether DNA or RNA or DNA-RNA hybrid, single-stranded or double-stranded, sense or antisense, which is capable of hybridization to a complementary nucleic acid by Watson-Crick base-pairing. Nucleic acids of the invention can also include nucleotide analogs (e.g., BrdU), and nonphosphodiester internucleoside linkages (e.g., peptide nucleic acid (PNA) or thiodiester linkages). In particular, nucleic acids can include, without limitation, DNA, RNA, cDNA, gDNA, ssDNA, dsDNA, ssRNA, dsRNA, non-coding RNAs, hnRNA, premRNA, matured mRNA or any combination thereof. The terms "nucleic acid sequence" and "nucleotide sequence" as used herein are interchangeable, and have their usual meaning in the art. The term refers to a DNA or RNA molecule in single or double stranded form. An "isolated nucleic acid sequence" refers to a nucleic acid sequence which is no longer in the natural environment from which it was isolated.

The term "gene" means a DNA sequence comprising a region (transcribed

region), which is transcribed into an RNA molecule (e.g. an mRNA) in a cell, operably linked to suitable transcription regulating regions (e.g. a promoter, and/or a translation enhancing element of the present invention). A gene may thus comprise several operably linked sequences, such as a promoter, a 5 ' non-translated sequence (also referred to as 5'UTR, which corresponds to the transcribed mRNA sequence upstream of the translation start codon) comprising, for example, sequences involved in translation initiation, a (protein) coding region (cDNA or genomic DNA) and a 3'non translated sequence (also referred to as 3' untranslated region, or 3'UTR) comprising e.g. transcription termination sites and polyadenylation site (such as e.g. AAUAAA or variants thereof). A "chimeric gene" (or recombinant gene) refers to any gene, which is not

normally found in nature in a species, in particular a gene in which one or more parts of the nucleic acid sequence are present that are not associated with each other in nature. For example, the promoter is not associated in nature with part or all of the transcribed region or with another regulating region. The term "chimeric gene" is understood to include expression constructs in which a promoter or transcription regulating sequence is operably linked to one or more sense sequences (e.g. coding sequences) or to an antisense (reverse complement of the sense strand) or inverted repeat sequence (sense and antisense, whereby the RNA transcript forms double stranded RNA upon transcription).

A "nucleic acid construct" or "vector" or "plasmid" is herein understood to mean a man-made (usually circular) nucleic acid molecule resulting from the use of recombinant DNA technology and which is used to deliver exogenous DNA into a host cell. Vectors usually comprise further genetic elements to facilitate their use in molecular cloning, such as e.g. selectable markers, multiple cloning sites and the like (see below). A nucleic acid construct may also be part of a recombinant viral vector for expression of a protein in a plant or plant cell (e.g. a vector derived from cauliflower mosaic virus, CaMV, or tobacco mosaic virus, TMV).

A "host cell" or a "recombinant host cell" or "transformed cell" are terms

referring to a new individual cell (or organism), arising as a result of the introduction into said cell of at least one nucleic acid molecule, especially comprising a chimeric gene encoding a desired protein or a nucleic acid sequence which upon transcription yields an antisense RNA for silencing of a target gene/gene family. The host cell may be a plant cell. The host cell may contain the nucleic acid construct as an extra- chromosomally (episomal) replicating molecule, as a non-replicating molecule or comprises the chimeric gene integrated in the nuclear or organellar DNA of the host cell. The term "organism" as used herein, encompasses all organisms consisting of more than one cell, i.e., multicellular organisms as plant.

"Transformation" and "transformed" refers to the transfer of a nucleic acid

sequence, generally a nucleic acid sequence comprising a chimeric gene of interest 30 (GOI), into the nuclear genome of a cell to create a "transgenic" cell or organism comprising a transgene. The introduced nucleic acid sequence is generally, but not always, integrated in the host genome. When the introduced nucleic acid sequence is not integrated in the host genome, one may speak of "transfection", "transiently transfected", and "transfected". For the purposes of the present patent specification, the terms "transformation", "transiently transfected", and "transfection" are used interchangeably, and refer to stable or transient presence of a nucleic acid sequence into a cell or organism. As used herein, the term "operably linked" refers to two or more nucleic acid sequence elements that are physically linked and are in a functional relationship with each other. For instance, a promoter is operably linked to a coding sequence if the promoter is able to initiate or regulate the transcription or expression of a coding sequence, in which case the coding sequence should be understood as being "under the control of the promoter. Generally, when two nucleic acid sequences are operably linked, they will be in the same orientation and usually also in the same reading frame. They usually will be essentially contiguous, although this may not be required.

As used herein, the term "promoter" refers to a nucleic acid fragment that

functions to control the transcription of one or more genes, located upstream with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one skilled in the art to act directly or indirectly to regulate the amount of transcription from the promoter. The promoter does not include the transcription start site (TSS) but rather ends at nucleotide -1 of the transcription site, and does not include nucleotide sequences that become untranslated regions in the transcribed mRNA such as the 5'UTR. The "5'UTR" is the sequence starting with nucleotide 1 of the mRNA and ending with nucleotide -1 of the start codon. It is possible that a regulating part of the promoter is comprised within the nucleotide sequence becoming a 5 'UTR; however, in such case, the 5 'UTR is still not part of the promoter as herein defined. As used throughout, "modulation" is meant to refer to an increase (or up regulation) or a decrease (or down regulation) in the indicated phenomenon (e.g., modulation of a biological activity refers to an increase in a biological activity or a decrease in a biological activity) or in a gene and/or protein expression or activity level. Accordingly, a "modulator" in reference to a receptor, may refer to a compound that facilitates an increase or decrease in activity of the recited receptor.

Within the context of the invention, "Expression" refers to the process by which a gene's coded information is converted into the molecules that support the structures and functions of a cell, such as a protein, transfer R A, or ribosomal R A. Expressed genes include those that are transcribed into mRNA and then translated into protein and those that are transcribed into RNA but not translated into protein (for example, transfer and ribosomal RNAs). Expression can also refer to expression at the protein level. Expression at the protein level relates to proteins translated from mRNA.

Within the context of the invention, "Up regulation" refers to any state in which a gene is caused to be transcribed at an elevated rate as compared to the endogenous transcription rate for that gene. In some examples, up regulation additionally includes an elevated rate of translation of the gene compared to the endogenous translation rate for that gene and/or an elevated rate of secretion of the encoded protein compared to the endogenous secretion rate for that protein.

Methods of testing for up regulation are well known in the art, for example transcribed RNA levels can be assessed using reverse transcriptase polymerase chain reaction (RT- PCR) and protein levels can be assessed using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis.

Furthermore, a gene is considered to be up regulated when it exhibits elevated activity compared to its endogenous activity, which may occur, for example, through reduction in concentration or activity of its inhibitor or via expression of mutant version with elevated activity. In preferred embodiments, when the host cell encodes an endogenous gene with a desired biochemical activity, it is useful to up regulate an exogenous gene, which allows for more explicit regulatory control in the bioprocessing and a means to potentially mitigate the effects of central metabolism regulation, which is focused around the native genes explicitly. Furthermore, up regulation can also refer to expression at the protein level, wherein an up regulated protein refers to any state in which a protein is present at an elevated amount as compared to the endogenous amount for that protein. An elevated amount of protein can result from an increase rate of translation or a decreased rate of degradation or a decreased rate of secretion.

An up regulation of a gene and/or protein expression and/or gene and/or protein activity level may be an up regulation of at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%), 80%), 90%), 100%) or more compared to the corresponding level of a control plant assessed under the same conditions using methods known to the skilled person.

Down regulation: Down regulation refers to any state in which a gene is caused to be transcribed at a reduced rate compared to the endogenous gene transcription rate for that gene. In certain embodiments, gene expression is down regulated via expression of nucleic acids, such as antisense oligonucleotides, double-stranded R A, small interfering RNA, small hairpin RNA, microRNAs, ribozymes, and the like. In some examples, down regulation additionally includes a reduced level of translation of the gene compared to the endogenous translation rate for that gene. Furthermore, a gene is considered to be down regulated when it exhibits decreased activity compared to its endogenous activity, which may occur, for example, through an increase in concentration or activity of its inhibitor, or via expression of mutant version with reduced activity.

Methods of testing for down regulation are well known to those in the art, for example the transcribed RNA levels can be assessed using RT-PCR and proteins levels can be assessed using SDSPAGE analysis.

A down regulation of a gene and/or protein expression and/or gene and/or protein activity level may be a down regulation of at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% compared to the corresponding level of a control plant assessed under the same conditions using methods known to the skilled person. Furthermore, down regulation can also refer to expression at the protein level, wherein an down regulated protein refers to any state in which a protein is present at an decreased amount as compared to the endogenous amount for that protein. An decreased amount of protein can result from an decreased rate of translation or a elevated rate of degradation or a elevated rate of secretion. Modulation of expression according to the invention comprises mutation of a gene, deletion of the gene, knock out of a gene, expression of an exogenous gene construct, expression of an antisense nucleotide targeting a gene, targeting a protein with an antibody.

A mutation according to the invention comprises a deletion, insertion or nucleotide substitution within the coding sequence of a gene, an intron or the promoter region. "Antisense nucleic acid" as used herein refers to a R A, DNA or PNA molecule that is complementary to all or part of a target primary transcript or mR A and that blocks the translation of a target nucleotide sequence. An antisense nucleotide may be a microRNA, a siRNA.

Knock-out: A gene whose level of expression or activity has been reduced to a level not detectable by PCR. In some examples, a gene is knocked-out via deletion or replacement of some or all of its coding sequence. In other examples, a gene is knocked-out via introduction or removal of one or more nucleotides into its open- reading frame, which results in translation of a nonsense or otherwise non-functional protein product.

As used herein, the term "plant" refers to either a whole plant, including in general the class of higher plants amenable to transformation techniques, including both monocotyledonous and dicotyledonous plants or a part of a plant such as e.g. roots, stems, stalks, leaves, petals, fruits, seeds, tubers, pollen, meristems, callus, sepals, bulbs and flowers. The term plant as used herein further refers, without limitations, to plant cells in seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytic and sporophytic tissue, pollen, protoplasts and microspores. Furthermore, all plant tissues in all organs are included in the definition of the term plant as used herein. Plant tissues include, but is not limited to, differentiated and undifferentiated tissues of a plant, including pollen, pollen tubes, pollen grains, roots, shoots, shoot meristems, coleoptilar nodes, tassels, leaves, cotyledonous petals, ovules, tubers, seeds, kernels. Tissues of plants may be in planta, or in organ, tissue or cell culture. As used herein, monocotyledonous plant refers to a plant whose seeds have only one cotyledon, or organ of the embryo that stores and absorbs food. As used herein, dicotyledonous plant refers to a plant whose seeds have two cotyledons. Plants included in the invention are all plants amenable to transformation. The term "plant" as used herein includes algae and micro-algae.

Endogenous: As used herein with reference to a nucleic acid molecule and a particular cell or microorganism refers to a nucleic acid sequence or peptide that is in the cell and was not introduced into the cell using recombinant engineering techniques. For example, a gene that was present in the cell when the cell was originally isolated from nature is considered to be endogenous. A gene is no longer considered endogenous if the control sequences, such as a promoter or enhancer sequences that activate transcription or translation have been altered through recombinant techniques. Endogenous nucleic acid molecule or gene is synonymous of wild type or reference in the context of the invention when one refers to a control plant or a wild type plant or a reference plant. Exogenous: As used herein with reference to a nucleic acid molecule and a particular cell or microorganism refers to a nucleic acid sequence or peptide that was not present in the cell when the cell was originally isolated from nature. For example, a nucleic acid that originated in a different microorganism and was engineered into an alternate cell using recombinant DNA techniques or other methods for delivering said nucleic acid is considered to be exogenous. A gene is also considered exogenous if the control sequences, such as a promoter or enhancer sequences that activate transcription or translation have been altered through recombinant techniques.

Exogenous nucleic acid molecule or gene is synonymous of modified in the context of the invention when one refers to a plant that has been modified according to a method of the invention.

The indefinite article "a" or "an" thus usually means "at least one". In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. The word "consist" may be replaced by the expression "essentially consist of indicating that the main components of the invention are present but that additional trivial elements may be present. The word "about" or "approximately" when used in association with a numerical value (e.g. about 10) preferably means that the value may be the given value (of 10) more or less 0.1% of the value. Polymorphism refers to the occurrence of two or more genetically determined alternative sequences or alleles in a population. A polymorphic marker or site is the locus at which divergence occurs. Preferred markers have at least two alleles, each occurring at frequency of greater than 1%, and more preferably greater than 10% or 20% of a selected population. A polymorphic locus may be as small as one base pair. Polymorphic markers include restriction fragment length polymorphisms, variable number of tandem repeats (VNTR's), hypervariable regions, minisatellites, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, simple sequence repeats, and insertion elements such as Alu. The allelic form occurring most frequently in a selected population is sometimes referred to as the wildtype form. Diploid organisms may be homozygous or heterozygous for allelic forms. A diallelic polymorphism has two forms. A triallelic polymorphism has three forms.

A single nucleotide polymorphism or SNP occurs at a polymorphic site occupied by a single nucleotide, which is the site of variation between allelic sequences. The site is usually preceded by and followed by highly conserved sequences of the allele (e.g., sequences that vary in less than 1/100 or 1/1000 members of the populations). SNPs are most frequently diallelic. A single nucleotide polymorphism usually arises due to substitution of one nucleotide for another at the polymorphic site. A transition is the replacement of one purine by another purine or one pyrimidine by another pyrimidine. A transversion is the replacement of a purine by a pyrimidine or vice versa. Single nucleotide polymorphisms can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele.

The term "reporter" (or reporter gene or protein) is mainly used to refer to nucleotide sequence encoding visible marker proteins, such as green fluorescent protein (GFP), eGFP, other fluorescent proteins, luciferase, secreted alkaline phosphatase (SEAP), GUS and the like, as well as nptll markers and the like. It is further understood that, when referring to "sequences" herein, generally the actual physical molecules with a certain sequence of units or subunits (e.g. nucleic acids or amino acids) are referred to.

The sequence information as provided herein should not be so narrowly construed as to require inclusion of erroneously identified bases. The skilled person is capable of identifying such erroneously identified bases and knows how to correct for such errors. In case of sequence errors, the sequence of the polypeptide obtainable by expression of the gene present in Arabidopsis thaliana containing the nucleic acid sequence coding for the polypeptide should prevail.

"Sequence identity" and "sequence similarity" can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms, depending on the length of the two sequences. Preferably, the alignment and therefore the identity or similarity is assessed over the whole length of a SEQ ID NO. However, the alignment and therefore the identity or similarity may be assessed over a part of a given SEQ ID NO. In this context a part may mean at least 50% of the length, at least 60%, at least 70%>, at least 80%>, at least 90%>. Sequences of similar lengths are preferably aligned using a global alignment algorithms (e.g. Needleman Wunsch) which aligns the sequences optimally over the entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g. Smith Waterman). Sequences may then be referred to as "substantially identical" or "essentially similar" when they (when optimally aligned by for example the programs GAP or BESTFIT using default parameters) share at least a certain minimal percentage of sequence identity (as defined below). GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length (full length), maximizing the number of matches and minimizing the number of gaps. A global alignment is suitably used to determine sequence identity when the two sequences have similar lengths. Generally, the GAP default parameters are used, with a gap creation penalty = 50 (nucleotides) / 8 (proteins) and gap extension penalty = 3 (nucleotides) / 2 (proteins). For nucleotides the default scoring matrix used is nwsgapdna and for proteins the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignments and scores for percentage sequence identity may be determined using computer programs, such as the GCG Wisconsin Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA, or using open source software, such as the program "needle" (using the global Needleman Wunsch algorithm) or "water" (using the local Smith Waterman algorithm) in EmbossWIN version 2.10.0, using the same parameters as for GAP above, or using the default settings (both for 'needle' and for 'water' and both for protein and for DNA alignments, the default Gap opening penalty is 10.0 and the default gap extension penalty is 0.5; default scoring matrices are Blossum62 for proteins and DNAFull for DNA). When sequences have a substantially different overall lengths, local alignments, such as those using the Smith Waterman algorithm, are preferred. Alternatively percentage similarity or identity may be determined by searching against public databases, using algorithms such as FASTA, BLAST, etc.

Any nucleotide sequences capable of hybridising to the nucleotide sequences of the invention are defined as being part of the invention.

Stringent hybridisation conditions are herein defined as conditions that allow a nucleic acid sequence of at least 25, preferably 50, 75 or 100, and most preferably 150 or more nucleotides, to hybridise at a temperature of about 65°C or of 65°C in a solution comprising about 1 M salt or 1 M salt, preferably 6 x SSC or any other solution having 10 a comparable ionic strength, and washing at 65°C in a solution comprising about 0.1M salt, or 0.1 M salt or less, preferably 0.2 x SSC or any other solution having a comparable ionic strength. Preferably, the hybridisation is performed overnight, i.e. at least for 10 hours and preferably washing is performed for at least one hour with at least two changes of the washing solution. These conditions will usually allow the 15 specific hybridisation of sequences having about 90% or more sequence identity or at least 90% sequence identity. Moderate hybridization conditions are herein defined as conditions that allow a nucleic acid sequence of at least 50, preferably 150 or more nucleotides, to hybridise at a temperature of about 45°C or of 45°C in a solution comprising about 1 M salt or 1 M salt, preferably 6 x SSC or any other solution having a comparable ionic strength, and washing at room temperature in a solution comprising about 1 M salt, or 1 M salt preferably 6 x SSC or any other solution having a comparable ionic strength. Preferably, the hybridisation is performed overnight, i.e. at least for 10 hours, and preferably washing is performed for at least one hour with at least two changes of the washing solution. These conditions will usually allow the specific hybridisation of sequences having up to 50%> sequence identity. The person skilled in the art will be able to modify these hybridisation conditions in order to specifically identify sequences varying in identity between 50% and 90%.

The term "homologous" when used to indicate the relation between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, is understood to mean that in nature the nucleic acid or polypeptide molecule is produced by a host cell or organisms of the same species, preferably of the same variety or strain. If homologous to a host cell, a nucleic acid sequence encoding a polypeptide will typically be operably linked to another promoter sequence or, if applicable, another secretory signal sequence and/or terminator sequence than in its natural environment.

When used to indicate the relatedness of two nucleic acid sequences the term "homologous" means that one single-stranded nucleic acid sequence may hybridise to a complementary single-stranded nucleic acid sequence. The degree of hybridisation may depend on a number of factors including the extent of identity between the sequences and the hybridisation conditions such as temperature and salt concentration as discussed later. Preferably the region of identity is greater than 5 bp, more preferably the region of identity is greater than 10 bp. The term "heterologous" when used with respect to a nucleic acid or polypeptide molecule refers to a nucleic acid or polypeptide from a foreign cell which does not occur naturally as part of the organism, cell, genome or DNA or R A sequence in which it is present, or which is found in a cell or location or locations in the genome or DNA or RNA sequence that differ from that in which it is found in nature. Heterologous nucleic acids or proteins are not endogenous to the cell into which they are introduced, but have been obtained from another cell or synthetically or recombinantly produced. Generally, though not necessarily, such nucleic acids encode proteins that are not normally produced by the cell in which the DNA is transcribed or expressed, similarly exogenous RNA codes for proteins not normally expressed in the cell in which the exogenous RNA is present. Furthermore, it is known that a heterologous protein or polypeptide can be composed of homologous elements arranged in an order and/or orientation not normally found in the host organism, tissue or cell thereof in which it is transferred, i.e. the nucleotide sequence encoding said protein or polypeptide originates from the same species but is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. Heterologous nucleic acids and proteins may also be referred to as foreign nucleic acids or proteins. Any nucleic acid or protein that one of skill in the art would recognise as heterologous or foreign to the cell in which it is expressed is herein encompassed by the term heterologous nucleic acid or protein. The term heterologous also applies to non-natural combinations of nucleic acid or amino acid sequences, i.e. combinations where at least two of the combined sequences are foreign with respect to each other.

All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety. The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

FIGURE LEGENDS

Figure 1. BR loss-of- function perception mutants are tolerant to drought stress.

Three- week-old well watered plants phenotypes (left column) vs four-week-old plants that have been subjected to drought stress (with-holding water) during 10 days. From top to bottom, rosette phenotypes for Col-0 WT, bakl-3, brllbrB, bril-301, bakl- 3brllbrl3, bril-301brllbrl3 and bril-301bakl-3brllbrl3.

Figure 2. BR loss-of-function perception mutants show reduced water loss content. Time course of water-loss content in Col-0 WT plants is represented as indicated. Other BR genotypes were analyzed during the drought stress experiment and represented as indicated. Each of the pots containing one plant was weight individually and followed along time at 0, 3, 5, 7, 10 and 12 days of drought stress. Results are average of n=16 plants +/- S.E. Asterisks show statistically significant results of quadruple bril- 301bakl-3brllbrl3 mutants compared to Col-0 WT plants (pvalue<0.05).

Figure 3. BR gain-of-function perception mutants are sensible to drought stress: response to severe drought stress is visualised in aerial rosettes. Three- week-old well watered plants phenotypes (left column) in comparison to the four-week-old plants, which have been subjected to drought stress (with-holding water) during 10 days. Top to bottom, rosette phenotypes for Co 1-0 WT, 35S:BRI1-GFP, 35S:BRL3-GFP and 35S:BRL1-GFP.

Figure 4. BR gain-of-function perception mutants show similar water loss as the WT plants.

Time course of water-loss content for Col-0 WT plants is represented as indicated. Other BR genotypes were analyzed during the drought stress experiment and represented in as indicated in the figure legend. Each of the pots containing one plant was weight individually and followed along time at 0, 3, 5, 7, 10 and 12 days of moderate and severe drought stress. Results are average of n=16 plants +/- S.E.

Figure 5. BR perception mutants show higher survival rates after drought stress. Three- week-old well watered plants phenotypes (left column) vs four- week-old plants that have been subjected to drought stress (with-holding water) during 12 days (middle column). Plants survival phenotype at seven days of re-watering after the drought stress assay plants. From top to bottom, rosette phenotypes for Col-0 WT, bakl-3, brllbrB, bril-301, bakl-3brllbrl3, bril-301brllbrl3 and bril-301bakl-3brllbrl3.

Figure 6. BR perception mutants show higher survival rates after drought stress.

Figure 6 A: Graphic on the top shows survival rate of five-week-old plants that have been subjected to drought stress (with-holding water) during 10 days. The relative proportion of plants with drought stress symptoms was scored after the 10 days of drought stress.

Figure 6 B: Graphic on the bottom shows survival rate of five-week-old plants that have been subjected to drought stress (with-holding water) during 10 days and re- watered during 7 days. The relative proportion of plants with drought stress symptoms was scored after the 7 days of re-watering by comparing with the initial number of plants (before the drought assay).

Figure 7. Loss-of-function BR synthesis mutants are tolerant to drought stress. Plants of BR synthesis mutant cpd are tolerant to hydric stress compared to the Col-0 WT plants. Time course of water-loss content in Col-0 WT plants and cpd mutants is represented as indicated. Each of the pots containing one plant was weight individually and followed along time at 0, 3, 5, 7, 10 and 12 days of drought stress. Results are average of n=16 plants cpd mutants compared to Col-0 WT plants (pvalue<0.05).

Figure 8. BR perception loss-of-function mutant roots are tolerant to hydric stress.

BR receptor mutant brllbrU, bril-301, bril-301brllbrl3 and bril-301baklbrllbrl3 (aquad) roots are tolerant to hydric stress compared to the Col-0 WT roots. All genotypes were germinated in normal media (i.e. standard MS ½ media) and 3-day-old seedlings were transferred to either control or sorbitol containing plates (400mM, IMPa). 7-day-old root length was measured in control and sorbitol stressed plants and ratios calculated for each genotype. Root growth performance of bril-301, bril- 301brllbrl3 and bril-301bakl-3brllbrl3 is improved compared to the WT roots. Results are average of n=30 plants +/- S.E.

Figure 9. BR mutant roots hydrotropism monitored at different time points after hydric stress induction.

Experimental design used in the hydrotropic response characterization assays. Square petri dishes were used to germinate (in the upper part) and growth the plant seedlings during six days. The lower part of the agar plates were cut half following a 45° angle and standard MS media was removed. The empty please was next replenished with standard MS media 400mM sorbitol to generate a water deficit gradient. Root hydrotropic responses were monitored at 18h, 24h and 48h.

Figure 10. BR receptor levels promote root hydrotropism.

Col-0 WT plants show a particular angle curvature response as shown in the figure. The Col-0 WT roots in average show curvature angles around 30° (see middle column figure). BRL3 overexpressor roots (35S:BRL3-GFP) show a higher curvature angle after the hydric stress induction (35° average) than their respective WT controls (see root curvature within the right column of the figure). In contrast, the roots of modified plants wherein the expression of BR receptors has been decreased and/or lacking all BR receptors and co-receptors (aquad, bril-301, bril-301brllbrl3), are less sensible to sorbitol induction, as shown in the distribution graph (left column) and average angle curvature (15, 20 and 25°).

Figure 11. Root hydrotropic response is altered in BR loss-of- function and gain-of- function receptor mutants.

BR receptor mutant bril-301, brllbrU, bril-301brllbrl3 and bril-301baklbrllbrl3 roots are tolerant to hydrotropism induced by drought when compared to the Col-0 WT roots as explained below. Col-0 WT plants show a particular angle curvature distribution as shown in the graph, near 65% of roots are in between 10-30°. BR receptor mutant bril-301, brllbrU, bril-301brllbrl3 and bril-301baklbrllbrl3 roots are tolerant to hydrotropism induced by drought when compared to the Col-0 WT roots. bril-301 mutants show a decreased root angle curvature (75% of roots are in between 10-30°), brllbrU show near 75% of roots in between 0-30°, bril-301brllbrl3 show near 80% of roots in between 0-30° and bril-301baklbrllbrl3 show near 90% of roots in between 0-30°. In contrast, gain-of- function BR receptor mutant 35S:BRL3-GFP roots are hypersensitive to hydrotropic sorbitol-induced response showing near 70%> of roots in between 0-40°). All genotypes were germinated in normal media (i.e. standard MS media) and 6-day-old seedlings were induced by the sorbitol gradient as described in Figure 9. 24 hour after induction, root angle curvature was measured for control and treated plants and distribution graph represented. Notice that in the bar graph is represented the big angle of the root curvature (180° of the big angle is equivalent to 0° of the small angle for a total of the 180° root plane growth). Results are average of n=30 plants. Figure 12. BR perception loss-of-function mutant roots show altered ABA response.

BR receptor mutant bril-301, bakl-3brllbrl3, bril-301brllbrl3 and bril- 301baklbrllbrl3 roots are tolerant to ABA treatment when compared to the Col-0 WT roots. All genotypes were germinated in normal media (i.e. standard MS media) and 5- day-old seedlings were transferred to control (i.e. standard MS) or ABA containing media plates (5μΜ). 10-day-old roots were measured for control and treated plants for each genotype. Ratios for ABA treated root length divided by control root lengths are represented. Results are average of n=20 plants. Figure 13. BR perception loss-of-function mutant roots show down-regulation of drought stress marker gene RD29A.

Three- week-old plants of Col-0 WT, 35S:BRL3-GFP and brilbaklbrllbrB aquad mutant plants previously subjected to drought stress during 2, 4, and 6 days were collected. RT-qPCR of RD29A gene expression show reduced levels of RD29A in the quadruple mutant brilbaklbrllbrB while induced RD29A expression in the 35S:BRL3- GFP background.

Figure 14. BR perception loss-of-function mutant roots show reduced water loss content in 14-day-old seedlings.

14-day-old seedlings of plants (i.e. Quadruple mutant brilbaklbrllbrB) dried during 0, 20 and 40 min were collected and weight in each time point (n=8). 14-day-old seedlings dried during 0, 20 and 40 min show less water loss that the Col-0 WT plants at 20 and 40 min. In contrast, 35S.BRI1-GFP plants show slightly increases in the water loss content at 40 min of drying (n=8).

Figure 15: Unbalanced BR levels produce drought resistant plants.

Three- week-old well-watered plants phenotypes (left column) compared to four-week- old plants that have been subjected to drought stress (with-holding water) during 12 days (middle column). Both, BR loss-of- function and BR gain-of- function perception mutant plants show a tolerant phenotype to drought stress after 7 days of re-watering after the drought stress assay (right column). From top to bottom, rosette phenotypes for Col-0 WT, bril-301, bakl-3brllbrl3, bril-301bakl-3brllbrB, 35S:BRI1-GFP, 35S:BRL1-GFP and 35S:BRL3-GFP plants.

Figure 16. Survival scores of BR loss-of-function and gain-of-function mutant plants are higher than in the WT plants after a strict drought period of 12 days followed by 7 days of re-watering.

Graph bar shows survival rate % of four-week-old plants subjected to drought stress (with-holding water) during 10 days and re- watering during 7 days. The relative proportion of plants that die after the drought stress was scored after the 7 days of re- watering. All the BR signaling mutant genotypes analyzed show higher survival rates upon drought, with exception of the triple mutant bakl-3brllbrl3. Two mutants of the BR synthesis pathway, cpd and DWF4ox show drought resistance as well. Result averages of three independent biological replicates +/- S.E. are shown (number of samples n is indicated in the table for each genotype analyzed). Figure 17. BR perception gain-of- function and loss-of- function mutant roots are tolerant to hydric stress.

Col-0 WT roots show a growth performance of 60% after growing 4 days in sorbitol containing media (IMPa). BR receptor mutant bril-301, bril-116 and bril- 301baklbrllbrl3 (aquad) roots are tolerant to hydric stress compared to the Col-0 WT roots as all of them show better root growth performance (74%, 86% and 78% respectively). Three BR receptor overexpression lines 35S:BRI1-GFP, 35S:BRL1-GFP and 35S:BRL3-GFP plants show greater root growth performance than the WT roots as well (68%o, 70%) and 73% respectively). This reflects that unbalanced BR levels is linked to resistance to the drought mediated root shortening. Notice that aquad and bril mutant roots show the highest resistance. All genotypes were germinated in standard MS media and 3-day-old seedlings were transferred to either control or sorbitol containing plates (400mM, IMPa). 7-day-old root length was measured in control and sorbitol stressed plants and ratios calculated for each genotype. Result averages of four independent biological replicates +/- S.E. are shown (n>200). One-Way Analysis of Variance ANOVA test followed by a multiple all-pairwise comparison procedure (Holm-Sidak method) was applied to the mean ratios values (p-value<0.05). As indicated with a, b, c, d characters in the graph, all the BR mutant genotypes analysed are more resistant to sorbitol root mediated shortening than the Col-0 WT root except for the 35S:BRI1-GFP, which is not statistically significant.

Figure 18. DWARF loss-of- function mutants tomato plants (dx) are resistant to drought.

Mutations in DWARF BR biosynthetic enzyme produce drought resistant plants in Solanum lycopersicum (tomato). Phenotype of three- week-old WT tomato plants after a 12 days drought period (up left panel). Phenotype of recovery for WT tomato plants after 7 days of re-watering (low left panel) show that all the WT plants are dead. Phenotype of three- week-old deficient BR synthesis mutant tomato plants (dx) displays drought resistance for 100% of the plants after withholding water for 12 days (up right panel). To confirm these results plants were monitored during 4 days of re-watering, showing 100% of resistance to drought (low right panel). Both WT and mutant tomato plants are Solarium lycopersicum var. Ailsa Craig. Figure 19. BRI1 loss-of- function mutants tomato plants (cu3) are resistant to drought.

BRI1 receptor loss-of- function mutations in Solarium pimpinellifollium plants (wild tomato) confer drought stress resistance. Phenotype of three- week-old WT tomato plants after a 12 days drought period (up left panel). Phenotype of recovery for WT tomato plants after 7 days of re-watering (low left panel) show that all plants dead. Phenotype of three- week-old deficient BR signaling mutant tomato plants (cu3) displays drought resistance for 100% of the plants after withholding water for 12 days (up right panel). To confirm these results plants were visualized after 4 days of re- watering, showing 100%) of resistance to drought (low right panel). Both WT and mutant tomato plants are Solarium pimpinellifollium.

Figure 20. Overexpression of BRL3, BRL1 and BRIl shows an increased root hydrotropic response.

Root curvature hydrotropic response in Col-0 WT root after 24h of sorbitol induced stress. Root curvature angle is traceable by eye (Figure 20 a, left panel) while it can be quantified as shown in the distribution graph (middle panne 1). GFP green fluorescence shows the localization of the BR receptors in Arabidopsis roots before and after the sorbitol induced hydrotropic response (Figure 20a, right panel). Propidium iodide staining of the plant cell walls is displayed in red fluorescence (Figure 20a, right panel). Col-0 WT plants show a particular angle curvature distribution as shown in the graph, near 60% of roots are in between 0-25° while 40% are curved more than 25° (Figure 20b). bril-301 mutants show a similar root angle curvature than the WT plants. In contrast, all other BR receptor mutant genotypes bakl-3, brllbr , bakl-3brllbrl3, bril-301brllbrl3 and bril-301baklbrllbrl3 roots are tolerant to hydrotropism induced by drought when compared to the Col-0 WT roots (Figure 20b). All of them show most of the roots curvature in between 0-25°. In contrast, gain-of- function (overexpression) for the BR receptor mutant 35S:BRL3-GFP, 35S.BRI1-GFP and 35S:BRL1-GFP roots are hypersensitive to the hydrotropic sorbitol-induced response showing root curvature over 25° in a 60%, 75% and 80% respectively (Figure 20b). All genotypes were germinated in standard MS media and 6-day-old seedlings were induced by the sorbitol gradient generated as described in Figure 9. 24 hour after induction, root angle curvature was measured for control and treated plants and distribution graph represented. Graph plot in the (Figure 20c) represents the mean values of the root curvature angles for each genotype represented in (Figure 20b). Result averages of four independent biological replicates +/- S.E. are shown (n>100).

Figure 21. Brassinazole exogenous application (ΙμΜ) reverts the sorbitol root- mediated shortening.

Col-0 WT roots show a growth performance of 65% after growing 4 days in sorbitol containing media (IMPa) while Col-0 WT roots treated with both sorbitol (IMPa) and brassinazole (BRZ ΙμΜ) show a slight increase in root growth performance (70%). This reversion of the root shortening is much more stronger in the 35S.BRI1-GFP background, where BRZ increases growth performance up to 90% compared to the 60%) displayed by sorbitol treated roots. bril-301baklbrllbrl3 aquad mutant roots are used as a positive control of root shortening resistance (80%>).

Figure 22. Brassinazole exogenous application (ΙμΜ) reverts the BR gain-of- function mutants root hypersensitive hydrotropic response in Arabidopsis.

Col-0 WT plants control (no sorbitol added) show near 90%> of the roots between 0-10°, as expected. Col-0 WT plants treated with sorbitol show a particular angle curvature distribution as shown in the graph, near 65%> of roots are in between 0-30° while 25% are curved more than 30°. Brassinazole (BRZ Ι μΜ) exogenous treatment reverts the Col-0 WT plants treated with sorbitol response to bril-301baklbrllbrl3 tolerant roots showing near 90% of the roots below 30°. All of them show most of the roots curvature in between 0-25°. brllbrB, bril-301 and bril-301brllbrl3 roots were used as a positive control confirming results reported in Figure 20. In addition, gain-of- function (overexpression) for the BR receptor mutant 35S:BRL3-GFP roots are hypersensitive to the hydrotropic sorbitol-induced response showing root curvature. All genotypes were germinated in standard MS media and 6-day-old seedlings were induced by the sorbitol gradient generated as described in Figure 9. 24 hour after induction, root angle curvature was measured for control and treated plants and distribution graph represented. Result averages of two independent biological replicates +/- S.E. are shown (n>30).

Figure 23. Brassinazole exogenous application (5μΜ) reverts the BR gain-of- function mutants root hypersensitive hydrotropic response in tomato.

Solanum lycopersicum Ailsa Craig WT plants treated with sorbitol show near 55% of roots are in between 0-35° while other 45% are curved more than 35°. Brassinazole (BRZ, 5μΜ) exogenous treatment reverts the WT tomato roots treated with sorbitol showing near 80% of the roots between 0-35° while only the 20% are curved more than 35°.

Examples

MATERIAL AND METHODS

Arabidopsis thaliana plant materials

All plant seeds used in this study were sterilized using 35% sodium hypochlorite sterile solution for 5 minute and then washed 5 times with sterile dH₂0 during 5 minute each wash. All sterile seeds were subsequently vernalized for 48 h at 4°C and grown for 3, 4, 5 or 6 days in agar Murashige and Skoog (MS 1/2) standard medium without sucrose, under normal long day conditions (16 h of light / 8 h of dark; 20-23°C). MS ½ standard medium is MS standard medium diluted ½.

Transgenic 35S:BRL3-GFP and 35S:BRL1-GFP lines in the Col-0 WT background were generated using the DNA clone reported in (Cano-Delgado et al, 2004). 35S.BRI1-GFP construct was cloned using a recombination Gateway Multisite Cloning system (Invitrogen). DNA sequences were amplified from respective BAC clones with a proofreading DNA polymerase Pfx (Platinum pfx polymerase, 11708-013; Invitrogen™). The purified BRI1, BRL1 or BRL3 gene PCR product was placed by directional cloning into the Gateway pDONR221® donor vector (12536-017; Invitrogen™) by a recombination BP reaction mixing both, the amplified PCR product and the pDONR221 vector, in a 3: 1 ratio. The BP clonase enzyme facilitates this BP reaction (11789-020; Invitrogen™). Gateway P4P1R vector containing constitutive promoter 35S (pEN-L4-2-Rl) and pDONRP2RP3® vector containing the tagged YFP (pEN-R2-Y-L3) were used. Both constructs are available in http :// gateway.psb .ugent.be (Karimi, M., Bleys, A., Vanderhaeghen, R. and Hilson, P. (2007) Building blocks for plant gene assembly. Plant Physiol. 145, 1183-119). A recombination LR reaction was performed using the three sequenced pENTRY® vectors containing promoter, gene and tag sequences in a three-component pDEST® vector, pB7m34GW. The LR clonase enzyme facilitates this LR reaction (11791-100; Invitrogen™) and transferred to plants by floral dipping (Clough, and Bent, 1998). All inserts were fully sequenced to verify that no cloning errors occurred. Wild-type Co 1-0 seedlings were used as a control (N1092: NASC (Nottingham Arabidopsis Stock Center number)). All the BR receptor mutant combinations were generated by genetic crossings of different single knock out mutants created by T-DNA insertion mutagenesis. Detailed information for these T- DNA lines is available in the NASC (Nottingham Arabidopsis Stock Centre) webpage. See Table 1 for a more detailed list of all the mutants ordered or generated.

Table 1. Brassinosteroid signaling mutants analyzed in this study

Name of mutant Gene Description Type Reference

BR-signaling mutant

Loss-of-function mutant

bril-116*** At4g39400 BRIl strong mutant allele Punctual substitution (Li and Chory, 1997)

BR-signaling mutant

Loss-of-function mutant

bril-301** At4g39400 BRIl weak mutant allele Punctual substitution (Nam and Li, 2002)

Cloning Ectopically Ana Cano lab

BR-signaling overexpression expressed under CaMV Cano-Delgado et al

35S:BRL3-GFP At3gl3380 mutant 35S promoter 2004

Cloning Ectopically Ana Cano lab

Atlg55610 BR-signaling overexpression expressed under CaMV Cano-Delgado et al

35S:BRL1-GFP mutant 35S promoter 2004

Cloning Ectopically

BR-signaling overexpression expressed under CaMV Ana Cano lab,

35S.BRI1-GFP At4g39400 mutant 35S promoter published.

BR-signaling mutant

Loss-of-function mutant

T-DNA insertion line Ana Cano lab, brl3-2 At3gl3380 single Salk_006024 Not published

BR-signaling mutant

Loss-of-function mutant

T-DNA insertion line Ana Cano lab, brll-2 Atlg55610 single Salk_005982 Not published

BR-signaling mutant

Loss-of-function mutant Cano-Delgado et al brllbrB At3gl3380 double Genetic cross 2004

BR-signaling mutant

Loss-of-function mutant T-DNA insertion line Kemmerling bakl-3 At4g33430 single Salk 034523 2007

At4g33430 BR-signaling mutant

Atlg55610 Loss-of-function mutant

bakl-3 brllbrB At3gl3380 Triple Genetic cross Fabregas et al. 2013

At4g39400 BR-signaling mutant

Atlg55610 Loss-of-function mutant

bril-116brllbrl3 At3gl3380 Triple Genetic cross Irani et al 2012

At4g39400 BR-signaling mutant

Atlg55610 Loss-of-function mutant Ana Cano lab, bril-301brllbrl3 At3gl3380 Triple Genetic cross Not published At4. g39400 BR-signaling

At4£ ;33430 Loss-of-function mutant

bril-301bakl-3brll Atlj ;55610 Triple Genetic cross Not published

At4. g39400 BR-signaling

At4^ ;33430 Loss-of-function mutant

bril-301bakl-3brl3 At3j ;13380 Triple Genetic cross Not published

At4^ ;39400

At4^ ;33430 BR-signaling

bril-301bakl-3 Atlj ;55610 Loss-of-function mutant

brllbrl3 (aquad) At3j ;13380 Quadruple Genetic cross Not published

Besl transcription

factor is

constituveley

BR-signaling depho sphorylated

Besl-D* Atlj ;19350 Gain-of- function (active form) Gonzalez et al 2011

T-DNA

BR-synthesis Insertion line

cpd At5£ ;05690 Loss-of-function mutant Salk_006024 Szekeres et al 1996

Ectopically

BR-synthesis

expressed under Choe et al 2001 Overexpression mutant

DWF4ox At3j ;50660 CaMV 35S promoter

*The besl-D mutant (En-2 background) was introgressed by 7 genetic back-crossings into the Col-0 ecotype **Punctual substitution GG AT; Converts Gly989 lie; Mutation in kinase domain inactivates kinase activity) *** Point substitution C-^T nonsense mutation; truncated protein

Solanum lycopersicum and Solanum pimpinelifolium plant materials.

Sterilization process of tomato seeds started with a first incubation of 30 min in sterilized water, 30 min incubation with a 40% sodium hypochlorite with Tween 20 few drops and 3 final washes with distilled water. Tomato seeds were plated just after sterilization and grown on LD conditions at 24°C. BR synthesis loss-of-function mutant tomato plants dx or dwf are Solanum lycopersicum var. Ailsa Craig and they have been previously described (Bishop et al, Plant Cell 1996). Deficient BR signaling loss-of- function mutant cu3 (bril) are Solanum pimpinelifolium and have been previously described in Montoya et al, Plant Cell 2002. cu3 is a strong allele mutation of the BRIl receptor in tomato and displays extremely dwarf and non fertile plants. cu3(abs) is a weak allele mutation of the BRIl receptor in tomato and displays bigger and fertile plants. cu3(abs) mutants have been described in Montoya et al, Plant Cell 2002. Table 2. Primers used in this study

SEQ

ID

primer Sequence (5' - 3') use NO:

brll-2

36 bri2.1 1 5 '-gtgagaaacgaaggtggaacagactgcag-3 ' genotyping

brll-2

37 2.12 5 '-cttcttggcatggatacgggaggtaatgg-3 ' genotyping

brll-2

38

JMLB 5' ggcaatcagctgttgcccgtctcactggtg 3' genotyping

brl3-2

39 bri4.2 5 '-tttagggtgagcatgagatctcgtgggccg-3 ' genotyping

brl3-2

40 bri4.3 5 '-gaaatccctgtaggaatcggaaagcttgag-3¹ genotyping

brl3-2

41

JMRB 5' gctcatgatcagattgtcgtttcccgcctt 3' genotyping

bril-116

42

BRI1 F 5' caatcttaactggatttctctgtc 3' genotyping*

bril-116

43

BRI1 R 5' catcggaaccattgttatcaaacgtc 3' genotyping*

NF-pBRL3 Cloning 44 ggggacaactttgtatagaaaagttgccgagctctaaaagatatgttj 'agtccatattcct F P4P1R

NF-pBRL3 Cloning 45 ggggactgcttttttgtacaaacttgccccggggttattagcccacaaagtgttcgat

R P4P1R

NF-pBRLl Cloning 46 ggggacaactttgtatagaaaagttgcccctaatattattaaattgatt

F P4P1R

NF-pBRLl Cloning 47 ggggactgcttttttgtacaaacttgcttggcacagcaagagttcgct

R P4P1R

NF-BRL3 48 ggggacaagtttgtacaaaaaagcaggctccatgaaacaacaatgj ¾cagttcttgatc F Cloning P221

NF-BRL3 49 ggggaccactttgtacaagaaagctgggtcaggctccttatctcgtg ;attcttc

R Cloning P221

NF-BRLl 50 ggggacaagtttgtacaaaaaagcaggctccatgaagcagagatg gctgttagtgttg F Cloning P221

NF-BRLl 51 ggggaccactttgtacaagaaagctgggtcaggctccttatctcgci ^attcttcgac

R Cloning P221

YFP 52

YFP F 5' atggtgagcaagggcgag 3' genotyping

YFP 53

YFP R 5' ttacttgtacagctcgtccatgc 3' genotyping bakl-3

54 bakl-3 F 5' gcactgaaaaacagtttagc 3' genotyping

bakl-3

55 bakl-3 R 5' gatgcaggaaggggagtcaacttggtg 3' genotyping bakl-3 bakl-3

56

TDNARev 5' gcgtggaccgcttgctgcaact 3' genotyping

BRIl-301 bril-301

57

F 5' ggaaaccattgggaagatca '3 genotyping**

BRIl-301 bril-301

58

R 5' gctgtttcacccatccaa 3' genotyping**

RD29A RT qPCR

RD29A F 5' tggatacg gtgaggcatcag 3' 59

RD29A RT qPCR

RD29A R 5' ccgtctttg ;ggtctcttccc 3' 60

* PCR product was digested by Mssl (Pmel) enzyme (ER1341,

Fermentas)

** PCR product was digested by DpnII enzyme (R0543, New England

Biolabs)

Genotyping

DNA rapid extraction protocol (Aljanabi S.M. et al 1997) was used for all the plant genotyping experiments. In short, standard PCR conditions were used to genotype all the mutant plants reported in this study. Standard PCR conditions: 55°C during 30 seconds for the annealing of the primers and 72°C during 1 minute for the polymerase extension step. GoTaq® Green Mastermix DNA polymerase (M712, Promega) was used. Design of WT primers and knock out primers for mapping the presence or absence of the T-DNA insertion was done by using the htt ://signal salk.edu/cgi- bin tdnaexprcss webpage.

Drought stress

Genotypes used: Col-0 WT, 35S:BRL3-GFP, 35S:BRL1-GFP, 35S:BRI1-GFP, cpd, brllbrU, bril-116, bril-301, bakl-3, bakl-3brllbrl3 and bril-301bakl-3brllbrl3, Besl-D, DWF4ox mutants and other plants identified in Table 5. For the drought assays, at least 20 one-week-old seedlings grown on standard MS plates were transferred individually to flowerpots containing 29±1 g. of substrate (plus 1 :8 v/v vermiculite and 1 :8 v/v perlite). Seedlings were grown under long day conditions for three weeks (16 h of light / 8 h of dark; 20-23°C). Three- week-old plants were subjected to severe drought by water-holding them during 12 days followed by a 7 days of re-watering recovery period. After the 7 days of recovery period, the surviving plants were pictured and manually counted. Plants were pictured and weighted for monitoring the moisture loss every two days.

Water loss quantification

1. Short term water loss: Monitoring the weight of the plant among time once it is detached from soil.

2. Long term water loss: Soil drying response. Compare wild type and mutant plant growth upon slow soil drying. Weight of plants upon time also indicate the water use/loss of the plants

3. Long term water loss: Soil drying response. Compare wild type and mutant plant growth upon slow soil drying. Recovery of plants after re-watering after a period of drought also indicates the water use of the drought stress plant.

4. Water soil content by measuring soil moisture/humidity among time.

For a more detailed description see Verslues et al. 2006.

Root hydrotropism

All genotypes were germinated in standard MS media and five-day-old-seedlings (Figure 11) or six-day-old seedlings (Figure 20) were induced by the sorbitol gradient generated as described in Figure 9. 24 hour after induction, root angle curvature was measured for control and treated plants and distribution graph represented. Notice that in the bar graph of Figure 11 is represented the big angle of the root curvature (180° of the big angle is equivalent to 0° of the small angle for a total of the 180° root plane growth). The root curvature of six-day-old seedlings (Figure 11) or of seven-day-old seedlings (Figure 20) grown vertically on 1/2 MS - and 24h/48h in sorbitol was measured and the data were analyzed with Image J software (http://rsb.info.nih.gov/ij/). All experiments were repeated at least three times. To show the differences of root angle curvature among all the genotypes, distribution graph was done. Genotypes used: Col-0 WT, 35S:BRL3-GFP, brllbrU, bril-301, bakl-3, bakl-3brllbrl3 and bril- 301bakl-3brllbrl3 mutants.

Root length in sorbitol sensitivity and ABA sensitivity assays The root length of six-day-old seedlings grown vertically on 1/2 MS agar without sucrose was measured and the data were analyzed with Image J software (http ://rsb .info .nih. gov/ij7) . All experiments were repeated at least three times. Student's t-test was used to show statistical differences of root lengths between Col-0, brllbrU, bril-301, bakl-3, baklSbrllbrl, brilSOlbrllbrl and bril-301bakl-3brllbrl3 mutants.

For sorbitol response assays, all genotypes were germinated in standard MS media and 3-day-old seedlings were transferred to either control or sorbitol containing plates (400mM, IMPa). 7-day-old root length was measured in control and sorbitol stressed plants and ratios were calculated for each genotype. Result averages of four independent biological replicates +/- S.E. are shown (n>200). One-Way Analysis of Variance ANOVA test followed by a multiple all-pairwise comparison procedure (Holm-Sidak method) was applied to the mean ratios values (p-value<0.05).

For brassinazole treatment experiments, all genotypes were germinated in standard MS media and 3-day-old seedlings were transferred to either sorbitol containing plates (400mM, IMPa) or plates containing both, sorbitol (400mM, IMPa) and brassinazole (BRZ ΙμΜ). For ABA root response assays, all genotypes were germinated in standard MS media and 5-day-old seedlings were transferred to either control or ABA containing plates (5mM). 10-day-old root length was measured in control and ABA treated plants and ratios calculated for each genotype. All the root lengths were measured and the data was analyzed with the Image J software (http ://rsb .info .nih. gov/ij/) .

Example 1

RESULTS ABSTRACT

Our laboratory investigates the role of phytohormones Brassinosteroids (BRs) in plant growth and development.

In the present study, different mutant with several combinations for the BR receptor and co-receptor BAK1 protein have been generated. For a detailed description of the nature of the mutations and the mutant alleles used here see Table 1. Our results show that both, loss-of- function mutants and overexpression (gain-of- function) of proteins members of the LRR-RLK family of receptors, the BRIl-like family (BRIl, BRLl and BRL3) and in the co-receptor BAK1 result in adult plants or in plants that are able to survive to drought stress conditions or even to severe drought conditions (no watering or up to 12 days without watering) in contrast to the Co 1-0 WT plants that dry and die. To observe the plant phenotypes and detailed statistic analysis of these BR mutants see Figures 1-5 and 15-16 and Tables 3, 5 and 6.

Table 3. Survival score of BR mutants after drought stress

7 days re-watered plants % survival

Col-0 0

brllbrl3 23

bakl-3brllbrl3 6.3

bri 1-301 68.8

bril -301 bakl -3brll brl3 (aquad) 81.3

bril-116 100

bril-116brllbrl3 50

cpd ho 83.4

35S.BRI1-GFP 6.3

35S:BRL1-GFP 38.5

35S:BRL3-GFP 12.5 Next, adult plants that are resistant to drought stress on soil (in vivo) were further analyzed in previous developmental stages. Strikingly, the roots of all the BR-receptor mutants analyzed in the study, showed resistance to induced drought stress. The methods used to evaluate the root response to hydric stress are detailed in the materials and methods section.

Unbalanced BR perception (such as loss-of-function and gain-of-function BR signaling and perception) and unbalanced biosynthesis levels produce drought stress resistance plants

The entire analysis reported in this patent includes at least two of the following genotypes: Columbia-0 WT (Col-0 WT), 35S:BRL1-GFP, 35S:BRL3-GFP, 35S:BRI1- YFP, bril-301, bril-116, bakl-3, brllbrB, bakl-3brllbrl3, bril-301brllbrl3, bril- H6brllbrl3 and bril-301 bakl -3brllbrl3 (aquad), Besl-D, cpd, DWF4ox.

The multiple BR mutant combinations were generated by genetic crossings of different single knockout mutants, see Table 1 for more information. To assess the sensitivity of the BR mutants to drought stress, all the plants were grown in individual pots during three weeks and aerial rosette phenotypes pictures were taken as shown in the left column of Figure 1. These three- week-old plants were subjected to hydric stress by water holding of all these plants during ten days. By weighting each individual plant genotype every two days the water-loss content was monitored. Plants with lower water loss % are bril-301 (weak allele) and bril-116 (strong allele) as well as the quadruple mutants aquad (bril-301 bakl brll brl3), all of them are significantly resistant to water loss as shown in Figure 2.

To assess the sensitivity of plants overexpressing any of the three receptors, 35S:BRL1- GFP, 35S:BRL3-GFP and 35S.BR11-GFP three-week-old plants were treated exactly in the same conditions previously described.

Upon ten days of water holding, plants start to dry and die in the same way or even faster than the Col-0 WT plants (Figure 3). In contrast to BR loss of function mutants, overexpressors for the BR receptors mutants showed a water loss content similar to the WT plants (Figure 4).

Pictures for all the aerial rosette phenotypes were taken after ten days of drought, as shown in Figure 1, right column. At this stage, all Col-0 WT plants analyzed were already partially or completely dried. In contrast, BR loss-of- function mutants showed partially (brllbrl3, bakl-3) or total (bril-301, bril-116, aquad) resistance to drought stress (Figure 1). These differences became even clearer at ten days of drought stress (Figures 5 and 15, middle column). Moreover, this phenotype is confirmed by scoring survival of plants after re-watering them during 7 days (Figures 5 and 15, right column). After re-watering, a strong >60% of survival for all bri I mutant combinations showed up in sharp contrast to the 0% of survival for Col-0 WT (Table 3). Note that only the plants that really survived to the water stress are alive after the re-watering. Note that some plants counted as survivors were dried and died later on (Figure 6, compare graph results in panel A to graph results in panel B). By analysing more number of plants in new drought stress assays, we observed that Col-0 WT plants survival rate was around 25% (Table 6 and Figures 15 and 16) after 12 days of drought stress followed by 7 days of re-watering. Initially, BR gain-of- function mutants (35S:BRL1-GFP, 35S:BRL3-GFP and 35S:BRI1-GFP) showed a similar behave than the Col-0 WT plants in those experimental conditions (Figure 1). However, this phenotype must be confirmed by scoring survival of plants after re- watering them during 7 days. Strikingly, when 35S:BRL1-GFP, 35S:BRL3-GFP and 35S.BRI1-GFP were re-watered and plant survival scored, the three overexpression mutant plants show better survival rates than the WT (Figure 15, right column). After re-watering, a strong 60%> of survival was observed in the 35S:BRL1-GFP plants, and 60% in the 35S. BRI1-GFP plants as well, compared to the 20% of survival in the Col-0 WT ones was observed (Table 6 and Figures 15 and 16). In addition, 35S:BRL3-GFP plants show a 45% of survival (Table 6 and Figures 15 and 16), confirming that increasing the BR signaling/perception confers drought resistance in Arabidopsis.

In summary, all the BR perception gain- and loss-of-function mutants analyzed were partially resistant to the water stress, showing a higher % of plant survival after the drought stress (See Tables 3, 5 and 6). This resistance was found to be dose dependent, being the quadruple mutants aquad {bril-301bakl-3brllbrl3) the highest drought resistant plant analyzed in this study. In addition, BR loss-of-function synthesis mutant cpd also showed resistance to drought stress (Figure 16 and Tables 3, 5 and 6) and decreased water loss content along drought assay (Figure 7). DWF4ox mutants overexpress the DWF4 biosynthetic enzyme of the BR synthesis pathway resulting in drought resistance as well (Figure 16 and Tables 3, 5 and 6). These results support that modulating the BR pathway (either by reducing or by increasing BR signaling and synthesis components is a way to confer drought tolerance.

BR loss-of-function and gain-of-function perception mutant roots are resistant to drought stress.

In order to test the root sensitivity of all these mutants to induced drought stress in plate, two different experimental methods were carried out. First approach consisted in growing the Col-0 WT roots in MS ½ - media and after 3 days they were transferred to MS ½ - with water resistance IMPa (by adding sorbitol 400mM). Sorbitol saturating media does not allow the water to enter to the plant roots normally, since high concentration of this sugar in the media causes osmotic stress (Zhu 2002). Our results show that root growth in plants with modified BRI1, BRL1 and BRL3 receptors is greater than WT roots growht in a low available water media. As shown in Figure 8, bril-301 and bril-301brllbrl3 root growth is higher than the one of WT plants in hydric stress conditions. Strikingly, the aquad mutant roots (bril-301baklbrllbrl3) showed the greatest response among all the mutants analyzed.

By analysing a higher number of roots, we observed that Col-0 WT roots show a growth performance of 60% after growing 4 days in sorbitol containing media (IMPa). BR receptor mutant bril-301, bril-116 and bril-301baklbrllbrl3 {aquad) roots are tolerant to hydric stress compared to the Col-0 WT roots as all of them show better root growth performance (74%, 86%> and 78% respectively). In addition, three BR receptor overexpression lines 35S:BRI1-GFP, 35S:BRL1-GFP and 35S:BRL3-GFP root growth performance are greater than the WT roots as well (68%, 70% and 73% respectively, Figure 17) Notice that aquad and bril mutant roots show the highest resistance (Figure 17). The aquad and bril mutant roots show the highest resistance. Strikingly, the aquad mutant roots (bril-301baklbrllbrl3) showed the greatest response among all the mutants analyzed. As indicated with a, b, c, d characters in the graph, all the BR mutant genotypes analysed are more resistant to sorbitol root mediated shortening than the Col-0 WT root except for the 35S:BRI1-GFP, which is not statistically significant. These results are new and reveal that both reduced BR levels but increased BR levels confer drought resistance.

To test whether this root drought tolerance phenotype can be mimicked by brassinazole (BRZ), which is a chemical that inhibits the BR synthesis pathway, we next analyzed BRZ exogenous application effect on roots exposed to sorbitol IMPa. Col-0 WT roots show a growth performance of 65% after growing 4 days in sorbitol containing media (IMPa) while Col-0 WT roots treated with both sorbitol (IMPa) and BRZ ΙμΜ show a slight increase in root growth performance (70%, Figure 21). This reversion of the root shortening is much more stronger in the 35S.BRI1-GFP background, where BRZ increases growth performance up to 90% compared to the 60% displayed by sorbitol treated roots. bril-301baklbrllbrl3 aquad mutant roots are used as a positive control of root shortening resistance (80%). These results indicate that bril and quad drought resistant roots can be mimicked by exogenous BRZ application on WT roots, confirming that by reducing the BR pathway plants are resistant to drought.

Hydrotropism responses of BR perception mutants

Second approach to measure the ability of the roots to migrate to the moist soil in search of water was also done. We have established a method that allows phenotypic quantification of root hydrotropism. It is expected that roots tolerant to drought may have a greater capacity for growth in search for water in deeper soil layers. In order to register our results, it is important to specify this type of qualities that makes the plant more tolerant to water stress. We have measured the capability to respond to the drought conditions and migration towards the water containing media (named hydrotropism). We carried experiment using a set up in which half of the plates contain the standard medium (no water stress) while the lower half contains a medium that simulates drought (Figure 9). This media was placed in 45-degree angle to scape gravitropism effect (Takahashi et al, 2002). First, seedlings were germinated in normal plates for five-six days. At five-six days we split those plates in half and sorbitol has been added to the other half, to simulate a situation with reduced water availability (see image in Figure 9).

After 24 hours, the roots begin to bend towards the water in the control plants. Instead, the roots of the quadruple mutants aquad are less sensitive to drought and continue to grow straight without rotate. The hydrotropic response shown by the aquad roots and plants with increased levels of BRL3, 35S:BRL3-GFP plants (Fabregas et al, 2013) in comparison to the Col-0 WT, is shown in Figures 9 and 10.

These roots were also analyzed 48 hours after the transfer to the IMPa Sorbitol media. The results obtained further validate the difference between the mutants and the wild- type plants. The detailed results show that the quadruple aquad mutants are tolerant and are able to grow in medium with low water availability (Figure 10). It was observed that the quadruple mutant roots continue to grow in middle- sorbitol while the WT and 35S:BRL3:GFP roots run away of the water-stressed medium. Furthermore, we quantified the curvature of all roots BRs in different mutants. As shown in Figure 11, the WT plants and 35S:BRL3:GFP (i.e. BRL3 overexpressor) show a larger angle of curvature than bril and aquad mutant roots. These results are statistically significant, confirming the differences we observe in the images. Furthermore, we show that the roots of the quadruple (i.e. aquad) mutants are able to grow in media with low water availability.

In addition, exogenous application of ΙμΜ of BRZ, reverts the BR gain-of- function mutants root hypersensitive hydrotropic response in Arabidopsis (Figure 22). Co 1-0 WT plants control (no sorbitol added) show near 90% of the roots between 0-10°, as expected. Col-0 WT plants treated with sorbitol show a particular angle curvature distribution as shown in the graph, near 65% of roots are in between 0-30° while 25% are curved more than 30°. Brassinazole (BRZ) exogenous treatment revert the Col-0 WT plants treated with sorbitol response to bril-301baklbrllbrl3 tolerant roots showing near 90% of the roots below 30°. All of them show most of the roots curvature in between 0-25°. brllbrB, bril-301 and bril-301brllbrl3 roots were used as a positive control confirming results reported in Figure 20. In addition, gain-of- function (overexpression) for the BR receptor mutant 35S:BRL3-GFP roots are hypersensitive to the hydrotropic sorbitol-induced response showing root curvature, biological replicates +/- S.E. are shown (n>30).

BR loss-of-function perception mutant roots show resistance to ABA.

The abscisic acid (ABA) is a phytohormone that controls biological response to drought in plants. Thus, water stress is closely related to ABA signaling. Because ABA plays a positive role in hydrotropic response of roots we decided to test the sensitivity of our mutants to this hormone. Plants were germinated and growth for five days and then transferred to ΙμΜ ABA containing plates for additional 5 days. Thus, the ABA sensitivity of the BR-mutants was analyzed in 10-day-old roots. In Figure 12 we depicted the mutant analysis showing the resistance of the BR loss-of- function mutants to root shortening by the ABA hormone, in agreement with previous results and simulated drought demonstrated by sorbitol. The analysis of three independent biological replicas confirmed that the loss-of- function BR mutants are both resistant to drought and tolerant to ABA hormone.

Example 2: PROOF OF CONCEPT RESULTS Arabidopsis results are transferable to other plant species such as tomato crop plants: BR loss-of-function tomato mutant plants show resistance to severe drought stress.

In one hand, we have observed that mutations in DWF BR bio synthetic enzyme produce drought resistant plants in Solanum lycopersicum (tomato) (Figure 18). Three- week-old WT tomato plants were dried after a 12 days drought period (Figure 18, up left panel). To test whether the drying affected the plant viability, a recovery experiment of 7 days of re-watering was done (Figure 18, low left panel) and showed that all the WT plants are dead. In contrast, three- week-old deficient BR synthesis mutant tomato plants (dx) are drought resistant after withholding water for 12 days, as they remained green and healthy (Figure 18, up right panel). To confirm these results, dx plants were followed after 4 days of re-watering, showing 100% of resistance to drought (Figure 18, low right panel). Both WT and dx mutant tomato plants are in Solanum lycopersicum var. Ailsa Craig. Importantly these results suggest that bril and aquad mutants would probably show drought tolerance in other crop species as well.

In the other hand, BRI1 receptor loss-of- function mutants in Solanum pimpinellifollium plants (wild tomato) are resistant to drought stress. Three- week-old WT tomato plants were dried after a 12 days drought period (Figure 19 up left panel). To test whether the drying affected the plant viability, a recovery experiment of 7 days of re- watering was done (Figure 19, low left panel) and showed that all the WT plants are dead. Phenotype of three- week-old deficient BR signaling mutant tomato plants (cu3) show that all plants are drought resistant after withholding water for 12 days (Figure 19, up right panel). To confirm the results plants were followed after 4 days of re-watering, showing 100% of resistance to drought (Figure 19, low right panel). Both WT and mutant tomato plants are Solanum pimpinellifollium. Notice that the cu3 mutant described above is a BRI1 strong mutant allele of the S1BRI1 gene. We have also observed that the BRI1 weak mutant allele cu3abs tomato plants are also resistant to drought. In addition to the drought resistance phenotype this cu3ab shows a less compromised phenotype of growth and is able to produce tomato fruits while the strong allele was extremely dwarf and sterile.

Finally, Solanum lycopersicum Ailsa Craig WT 4-day-old seedlings treated with sorbitol show near 55% of roots are in between 0-35° while other 45% are curved more than 35° (Figure 23). Brassinazole (BRZ, 5μΜ) exogenous treatment reverts the WT tomato roots treated with sorbitol showing near 80% of the roots between 0-35° while only the 20%> are curved more than 35° (Figure 23). In conclusion, exogenous application of brassinazole reverts the mutants roots hydrotropic response in tomato, confirming results we have shown in Arabidopsis and suggesting that this would be transferable to other crop plant species of agronomical interest.

Example 3:

A NEW METHOD FOR SCREENING NEW CHEMICALS AND NATURAL COMPOUNDS AND MICROBIOME (INCLUDING MICROORGANISMS AND VIRUSSES) CONFERING DROUGHT RESISTANCE TO PLANTS.

We have analyzed a vast number of Col-0 WT plants to standardize the particular angle curvature distribution of the root hydrotropic response in the WT plants. Quantification of angle curvature upon sorbitol treatment in 5 biological replicates, reveal that near to the 60%) of Col-0 WT roots are curved in between 0-25° while 40%> are curved more than 25° (Figure 20, middle and lower panels), bril-301 mutants show a similar root angle curvature than the WT plants (Figure 20, middle and lower panels). In contrast, all other BR receptor mutant genotypes bakl-3, brllbrB, bakl-3brllbrl3, bril301brllbrl3 and bril-301baklbrllbrl3 roots are tolerant to hydrotropism induced by drought when compared to the Col-0 WT roots. All of them show most of the roots curvature (>80%>) in between 0-25° (Figure 20, middle and lower panels). In addition, gain-of- function (overexpression) for the BR receptor mutant 35S:BRL3-GFP, 35S.BRI1-GFP and 35S:BRL1-GFP roots are hypersensitive to the hydrotropic sorbitol-induced response showing root curvature over 25° in a 60%>, 75% and 80%>, respectively (Figure 20, middle and lower panels). All genotypes were germinated in standard MS media and 6-day-old seedlings were induced by the sorbitol gradient generated as described in Figure 9. 24 hour after induction, root angle curvature was measured for control and treated plants and distribution graph represented.

As described above, osmotic stress enhance the sensitivity of 35S:BRL3-GFP, 35S.BRI1-GFP and 35S:BRL1-GFP root hydrotropic responses whereas dramatically reduce the BRL3 receptors levels from the root meristem (Figure 20, upper panel). This lead to optimized water consumption and stress tolerance by promoting root growth and other protective responses. Notice that root curvature hydrotropic response in Col-0 WT root after 24h of sorbitol induced stress. Root curvature angle is traceable by eye (Figure 20 upper panel) while it can be quantified as shown in the distribution graph (Figure 20 middle panel). GFP green fluorescence shows the localization of the BR receptors in Arabidopsis roots before and after the sorbitol induced hydrotropic response (Figure 20 upper panel). Propidium iodide staining of the plant cell walls is displayed in red fluorescence (Figure 20 upper panel). Given the structural and mechanistic insights available for the BR receptors we propose a new screening method using overexpression lines 35S:BRL3-GFP, 35S:BRL1-GFP and 35S.BRI1-GFP as reporter lines where the BRIl-like receptors are fused to a fluorescent reporter protein (GFP) to identify agrochemical compounds able to reduce their activity in drought conditions. Alternatively, the search of genetic suppressors in root using the 35S:BRL3- GFP, 35S:BRL1-GFP and 35S.BRI1-GFP lines that exhibit increased sensitivity to drought will let to the identification of molecular key regulators in the process. To break through these goals we will make use of a root phenotyping facility, able to perform a systematic analysis of root morphology under stress conditions. This facility will set important possibilities for the analysis of roots, beyond the state-of-the art in the field. The overexpression lines 35S:BRL3-GFP, 35S:BRL1-GFP and 35S:BRI1- GFP are reporter lines where the BRIl-like receptors are fused to a fluorescent reporter protein (GFP) (Figure 20, upper panel). Thus, we can monitor the fluorescence changes of these BR receptor proteins upon drought. In summary, by using overexpression of the BRIl l-like family members we have designed a unique screening method using these lines uncoupled the growth responses from the drought stress associated to addition of a chemical.

Table 4, overview of sequences and corresponding SEQ ID NOs.

Name DNA or Protein SEQ ID NO:

BRI1 DNA SEQ ID NO:l

BRI1 Protein SEQ ID NO:2

BRI1-116 DNA SEQ ID NO:3

BRI1-116 Protein SEQ ID NO:4

BRI1-301 DNA SEQ ID NO:5

BRI1-301 Protein SEQ ID NO:6 BRI1-5 DNA SEQ ID NO:7

BRI1-5 Protein SEQ ID NO:8

BRL1 DNA SEQ ID NO:9

BRL1 Protein SEQ ID NO:10

BRL3 DNA SEQ ID NO:ll

BRL3 Protein SEQ ID NO:12

BAK1 DNA SEQ ID NO:13

BAK1 Protein SEQ ID NO:14

CPD DNA SEQ ID NO:15

CPD Protein SEQ ID NO:16

DWARF4 DNA SEQ ID NO:17

DWARF4 Protein SEQ ID NO:18

DET2 DNA SEQ ID NO:19

DET2 Protein SEQ ID NO:20

BIN2 DNA SEQ ID NO:21

BIN2 Protein SEQ ID NO:22

BSK1 DNA SEQ ID NO:23

BSK1 Protein SEQ ID NO:24

BSU1 DNA SEQ ID NO:25

BSU1 Protein SEQ ID NO:26

BES1 DNA SEQ ID NO:27

BES1 Protein SEQ ID NO:28

BZR1 DNA SEQ ID NO:29

BZR1 Protein SEQ ID NO:30

PP2A DNA SEQ ID NO:31

PP2A Protein SEQ ID NO:32

RD29A DNA SEQ ID NO:33

RD29A Protein SEQ ID NO:34

TDNA DNA SEQ ID NO:35 Table 5: Survival scoring of three-week-old Arabidopsis thaliana plants after 12 days of drought period followed by 7 days of re-watering:

Total number

of plants Alive % Survival

Col-0 16 0 0

brllbrB 13 3 23

bakl-3brllbrl3 16 1 6.3

bril-301 16 11 68.8

bril-301bakl-3brllbrl3 16 13 81.3

bril-116 5 5 100

bril-ll6brllbrl3 6 3 50

35S.BRI1-GFP 16 1 6.3

35S:BRL1-GFP 13 5 38.5

35S:BRL3-GFP 16 2 12.5

Table 6. Survival quantification of three-week-old Arabidopsis thaliana BR mutant plants after a strict drought period of 12 days followed by 7 days of re-watering.

Total number

Genotype % Survival of pla

Col-0 WT 26.26 78

bakl-3 47.27 62

brllbrB 34.09 66

bakl-3biilbrl3 26.62 69

bril-301 67.12 72

bril-301brllbrl3 94.44 59

aquad 97.62 84

bril-116 93.75 12

bril-116brllbrl3 81.25 30

cpd 91.67 20

35S:BRI1-GFP 57.14 45

35S:BRL1-GFP 57.50 51

35S:BRL3-GFP 44.41 76

Besl-D 62.50 8

DWF4ox 36.36 15 REFERENCES

Alonso J.M. et al., (2003) Science., Aug l ;301(5633):653-7.

Aljanabi S.M. et al., (1997) Nucl. Ac. Res., 25(22):4692-4693.

AlBancos S. et al, (2002) Plant Physiol. Sep; 130(l):504-13.

Bishop G. et al., (1996) Plant Cell. Jun;8(6):959-69.

Boyer J. S. et al, (1982) Science 218: 443-448.

Cano-Delgado A. et al, (2004) Development 131, 5341-5351.

Cano-Delgado A., et al, (2009) Methods Mol Biol. 495:81-8.

Choe S. et al., (2001) Plant J. Jun;26(6):573-82.

Clough, and Bent, (1998) Plant J. 1998 Dec;16(6):735-43.

Fabregas N. et al., (2013) Plant Cell 25:3377-3388.

Friedrichsen et al, (2000) Plant Physiol. Aug; 123(4): 1247-56.

Fujioka S. et al., (1997) Plant Cell. Nov;9(l 1): 1951-62.

Gonzalez-Garcia et al, (2011) Development. Mar;138(5):849-59.

Gou et al., (2012) PLoS Genet. Jan;8(l):el002452.

Hao et al., (2013) Plant Cell Rep (2013) 32: 1017-1030

Hothorn et al., (2011) Nature. Jun 12;474(7352):467-71

Irani et al, (2012) Nature Chemical Biology. May 6;8(6):583-9.

Karimi, M. et al,. (2007) Plant Physiol. 145, 1 183-119).

Karlova et al., (2006) Plant Cell. 2006 Mar;18(3):626-38.

Kemmerlmg et al., (2007) Curr Biol. 2007 Jul 3; 17(13): 1 1 16-22.

Kim H.B. et al., (2006) Plant Physiol. Feb; 140(2):548-57.

Kim T.W. et al., (2011) Mol. Cell. Aug 19;43(4):561-71.

Kinoshita et al., (2005) Nature. 2005 Jan 13;433(7022): 167-71.

Li and Chory, (1997) Cell. 1997 Sep 5;90(5):929-38.

Li, J. et al, (2002) Cell 110, 213-222.

Montoya et al., (2002) Plant Cell. Dec;14(12):3163-76

Mora-Garcia S. et al., (2004). Genes Dev. Feb 15;18(4):448-60.

Nam KH. et al., (2002) Cell 110, 203-212.

Russinova et al., (2004) Plant Cell. Dec; 16(12):3216-29.

She et al, (201 1 ) Nature. 2011 Jun 12;474(7352):472-6.

Smaczniak et al., (2012) Proc Natl Acad Sci U S A. Jan 31;109(5): 1560-5. Szekeres et al, (1996) Cell. 1996 Apr 19;85(2): 171-82.

Takahashi N. et al, (2002) Planta 216: 203-211

Tang et al., (2008) Science. Jul 25;321(5888):557-60.

Verslues P.E. et al, (2006) Plant Journal Feb;45(4):523-39.

Wang Z.Y. et al, (2001) Nature. 2001 Mar 15;410(6826):380-3.

Wang et al, (2002) Dev Cell. 2002 Apr;2(4):505-13.

Wang et al, (2005) Plant Cell. 2005 Jun;17(6): 1685-703.

Wang et al., (2008) Dev Cell. 2008 Aug;15(2):220-35.

Wang et al., (2012) Annu Rev Genet. 2012;46:701-24.

Wu G. et al, (2011). Sci Signal. May 10;4(172):ra29.

Yamada et al, (2013) Bioorganic & Medicinal Chemistry Volume 21, Issue 9, 1 May

2013, Pages 2451-2461.

Yin Y. et al. (2002) Cell. Apr 19; 109(2): 181-91.

Yin Y et al., (2005) Cell. 2005 Jan 28; 120(2):249-59.

Zhu et al., (2002) Annual Review of Plant Biology, Vol. 53: 247-273,

Claims

Claims

1. A method for generating a drought tolerant plant, the method comprising modulating, preferably down regulating the brassmosteroid signaling pathway in said plant.

2. A method according to claim 1, wherein a drought tolerant plant is defined as a plant with at least one of the following features:

a) a water stress resistant plant,

b) a plant with increased water use efficiency,

c) a plant that survives longer during or after water stress,

d) a plant that survives longer after re-watering,

e) a plant with improved root hydrotropism,

f) a plant with improved sorbitol/mannitol/PEG (poly ethylenegly col) or abscisic acid (ABA) response and

g) a plant wherein a drought stress marker gene has been down regulated.

3. A method according to claim 1 or 2, wherein said modulation, preferably down regulation of signaling is achieved at the gene and/or at the protein level in said plant and wherein the expression of at least one gene and/or protein of the brassmosteroid signaling pathway has been modulated, preferably downregulated.

4. A method according to claim 3, wherein the expression of at least two genes and/or proteins has been modulated, preferably three, more preferably four.

5. A method according to claim 3 or 4, wherein said genes and/or proteins are selected from the group consisting of: BRI1, BAK1, BRL1 and BRL3.

6. A method according to claim 5, wherein:

- the modulation is a downregulation and the genes and/or proteins downregulated are selected from the group consisting of BRI1, BAK1, BRL1 and BRL3, preferably each of the genes and/or proteins BRI1, BAK1, BRLl and BRL3 have been downregulated or - the modulation is an upregulation and the genes and/or proteins upregulated are selected from the group consisting of BRIl, BRL1 and BRL3, preferably BRIl, BRLl or BRL3 has been upregulated or two of them or each of BRIl, BRL1 and BRL3 have been upregulated.

7. A method according to any one of claims 3-6, further comprising the modulation of the expression of a gene and/or protein which is selected from the group consisting of: DWARF4, DET2, CPD, BIN2, BSK1, BSU1, BES1, BZR1 and PP2A.

8. A method according to any one of claims 3-7 wherein said plant contains a mutation in a gene and/or protein of the brassinosteroid signaling pathway, said mutation being selected from the group consisting of: bril-301, bril-116, bril-5, bakl- 3, brll-2 and brl3-2.

9. A method according to any one of claims 1 to 8, wherein said down regulating of signaling is achieved by administering a compound for inhibiting the brassinosteroid pathway in a plant, preferably Brassinazole and/or Propiconazole and/or BZR₂₂₀ and/or YCZ-18 and/or an azole derivative.

10 A plant obtainable by the method of claim 6.

11. A plant with a mutation in a gene and/or protein of the brassinosteroid signaling pathway, said gene and/or protein being selected from the group consisting of: BRIl, BAK1, BRLl and BRL3 and wherein said plant has an increased drought tolerance.

12. A plant according to claim 11, wherein said plant comprises at least one mutation selected from the group consisting of bril-301, bril-116, bril-5, bakl-3, brll-2 and brl3-2.

13. A plant according to claim 11 or 12, wherein said plant further comprises a mutation in a gene and/or protein selected from the group consisting of: DWARF4ox, det2-l, cpd, bin2, bskl, bsul, besl-D, bzrl-D andpp2a.

14. Use of a brassino steroid inhibitor for generating a drought tolerant plant, preferably said brassinosteroid inhibitor being Brassinazole and/or Propiconazole and/or BZR₂₂0 and/or YCZ-18 and/or an azole derivative.

15. A composition comprising an inhibitor as defined in claim 9 or 14, for obtaining a drought tolerant plant.

16. A method for identification of a brassinosteroid regulator for generating a drought tolerant plant, the method comprising the steps of:

(a) providing a plant cell population capable of expressing a BRL3-GFP, BRLl-GFP and/or BRIl-GFP gene;

(b) contacting or incubating the cell population with the substance to be tested preferably under water stress conditions;

(c) determining the expression level of said BRL3-GFP, BRLl-GFP and/or BRIl-GFP or one of their activities,

(d) comparing the expression level or activities as determined in (c)

with the expression level or activities of the same genes in a similar cell population that has not been contacted with the substance; and,

(e) identifying a brassinosteroid modulator that produces a modulation, preferably dowregulation and/or upregulation in expression level or activities of at least one of the three genes identified in step (c) between the cell population that has been contacted with the substance and the test cell population that has not been contacted with the substance.

17. A method or plant or use or composition according to any one of the preceding claims, wherein the plant genus is selected from Arabidopsis, Solarium, Glycine, Zea, Cucumis, Phaseolus, Succharum, Vicia, Oryza, Triticum and Sorghum.

18. A cell, tissue, organ, part, seed, fruit, product, progeny or propagation material of the plant as defined any one of the preceding claims.