CN112553223A - Gene SlBSK1 participating in regulation and control of tomato fruit tip type and lycopene synthesis and application thereof - Google Patents
Gene SlBSK1 participating in regulation and control of tomato fruit tip type and lycopene synthesis and application thereof Download PDFInfo
- Publication number
- CN112553223A CN112553223A CN202011595625.9A CN202011595625A CN112553223A CN 112553223 A CN112553223 A CN 112553223A CN 202011595625 A CN202011595625 A CN 202011595625A CN 112553223 A CN112553223 A CN 112553223A
- Authority
- CN
- China
- Prior art keywords
- slbsk1
- gene
- tomato
- lycopene
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Abstract
The invention relates to the technical field of biology, in particular to a gene SlBSK1 participating in lycopene synthesis and application thereof, which are used for improving the content of lycopene and beta-carotene in tomato fruits and improving the shape of tomato fruit tips; the nucleotide sequence of the gene SlBSK1 is shown as SEQ ID No:1, the preparation method is as follows. And 35S, construction of SlBSK1, wherein the nucleotide sequence of the interference fragment is shown as SEQ ID No:2, the preparation method is as follows.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a function of a tomato SlBSK1 gene in lycopene synthesis and regulation of tomato fruit tip characters.
Background
Tomatoes (Solanum lycopersicum) are widely cultivated worldwide as an important fruit and vegetable plant. The product has bright color, good taste and high nutritive value, and is more and more popular with people. The color and shape of tomato fruit are important commodity indexes, and the cultivation of tomato variety with bright color and perfect shape is an important research topic of tomato breeding. The color of tomato fruit is mainly regulated by lycopene in carotenoid accumulated in large amount in vivo. Lycopene is a strong antioxidant, has the function of natural pigment, has important functions for preventing a plurality of diseases, and has important significance for researching the synthesis and regulation of lycopene and improving the fruit quality.
BSK1 is a receptor plasma membrane protein Kinase, and plays an important role in Brassinosteroid Signaling Kinase1 and BSK1 (Tang, Kim et al.2008). Studies have reported that BSK1 plays an important role in the plant immune system (Shi, Shen et al.2013, Yan, Zhao et al.2018, Zhao, Wu et al.2019). There are 12 families of BSK genes in arabidopsis that have a positive regulatory role in BR signaling (Sreeramulu, Mostizky et al 2013).
Reference documents:
1)Shi,H.,Q.Shen,Y.Qi,H.Yan,H.Nie,Y.Chen,T.Zhao,F.Katagiri and D.Tang(2013)."BR-SIGNALING KINASE1 physically associates with FLAGELLIN SENSING2 and regulates plant innate immunity in Arabidopsis."Plant Cell 25(3):1143-1157。
2)Sreeramulu,S.,Y.Mostizky,S.Sunitha,E.Shani,H.Nahum,D.Salomon,L.B.Hayun,C.Gruetter,D.Rauh,N.Ori and G.Sessa(2013)."BSKs are partially redundant positive regulators of brassinosteroid signaling in Arabidopsis."Plant J 74(6):905-919。
3)Tang,W.,T.W.Kim,J.A.Oses-Prieto,Y.Sun,Z.Deng,S.Zhu,R.Wang,A.L.Burlingame and Z.Y.Wang(2008)."BSKs mediate signal transduction from the receptor kinase BRI1 in Arabidopsis."Science 321(5888):557-560。
4)Yan,H.,Y.Zhao,H.Shi,J.Li,Y.Wang and D.Tang(2018)."BRASSINOSTEROID-SIGNALING KINASE1 Phosphorylates MAPKKK5 to Regulate Immunity in Arabidopsis."Plant Physiol 176(4):2991-3002。
5)Zhao,Y.,G.Wu,H.Shi and D.Tang(2019)."RECEPTOR-LIKE KINASE 902Associates with and Phosphorylates BRASSINOSTEROID-SIGNALING KINASE1 to Regulate Plant Immunity."Mol Plant 12(1):59-70。
disclosure of Invention
The technical problem to be solved by the invention is to provide a gene and a protein which are involved in the formation of tomato fruit tips and the synthesis of lycopene, and corresponding application.
In order to solve the technical problems, the invention provides a gene SlBSK1 involved in lycopene synthesis, and the nucleotide sequence of the gene SlBSK1 is shown as SEQ ID No:1, the preparation method is as follows. The amino acid sequence of the gene-encoded SlBSK1 protein is shown in SEQ ID NO. 3.
The improvement of the gene SlBSK1 participating in lycopene synthesis provided by the invention comprises the following steps: and 35S, construction of SlBSK1, wherein the nucleotide sequence of the interference fragment is shown as SEQ ID No:2, the preparation method is as follows.
The invention also provides a plasmid containing the gene and a plant interference vector.
The invention also provides the application of the gene SlBSK1: is used for increasing the content of lycopene and beta-carotene in tomato fruits and improving the shape of the fruit tips of the tomato fruits.
The invention also provides a method for constructing the transgenic tomato, which comprises the following steps: constructing a transgenic tomato by using 35S: SlBSK1: RNAi interference vector; the 35S comprises SlBSK1, wherein the nucleotide sequence of an interference fragment of the RNAi interference vector is shown in SEQ ID No:2, the transgenic tomato can improve the content of lycopene and beta-carotene and change the property of the fruit tip of the tomato.
In tomato, a proteomics method is used for finding that a homologous gene SlBSK1(Solyc04g082260) of BSK1(At4g35230) plays an important role in the tomato fruit development process. The transgenic tomato is obtained by constructing a SlBSK1 gene interference vector and adopting a transgenic technology, the lycopene content of a transgenic plant is increased, and the tip of a fruit is long, which shows that SlBSK1 is a receptor kinase gene which participates in lycopene synthesis and regulates the development of the tip of the fruit. In the future tomato breeding, the method has good application prospect in the aspects of increasing the content of lycopene and improving the appearance and properties of fruits. The invention can enrich the synthesis theory of mature pigments of fruits and provide a theoretical basis for improving the content of lycopene by a genetic engineering technology in the future. Has important significance for disclosing the metabolic mechanism of the carotenoid of the tomato fruits and improving the content of the lycopene by utilizing a molecular breeding technology.
In conclusion, the tomato SlBSK1 gene silencing transgenic plant is constructed for the first time and the function research is carried out. Through observing the color of tomato fruits of transgenic plants, the SlBSK1 gene is found to play an important role in the biosynthesis process of lycopene.
Drawings
In order to make the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention are described in detail below with reference to the accompanying drawings.
FIG. 1 is a 35S: SlBSK1: RNAi cloning vector map;
FIG. 2 is 35S: SlBSK1: RNAi interference vector map;
FIG. 3 is the phenotype of Micotom and 35S: SlBSK1: RNAi-8 transgenic tomato fruits.
FIG. 4 shows that the SlBSK1 gene silences the lycopene content of a transgenic plant, namely 35S:: SlBSK1:: the lycopene and beta-carotene content of fruits of RNAi-8 transgenic tomatoes in the stage BR +11 (initial extract).
Detailed Description
The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:
firstly, constructing SlBSK1 gene RNAi:
the vectors used for construction were pENTR from InvitrogenTM/SD/D-
The Cloning Kit, performed as described herein. Through the analysis of the full-length sequence (SEQ ID NO:1) of the SlBSK1 gene, a segment of sequence 237bp (SEQ ID NO:2) is selected as an interference target fragment, and primers are designed as follows:
SlBSK1::RNAi-L:5’-TTTACAAGGGGAGGTTGCAG-3’
SlBSK1::RNAi-R:5’-GGGTTTGATTCTCCCAGTGA-3’
the cDNA of tomato fruit is used as a template, and a sequence fragment (SEQ ID NO:2) is obtained by PCR amplification.
The PCR amplification system was 25 ul:
molecular Cloning laboratories high fidelity enzyme Mix: 12.5ul
Primer SlBSK1, RNAi-L: 1ul
Primer SlBSK1, RNAi-R: 1ul
Template tomato fruit cDNA: 1ul
Deionized and sterilized water: 9.5 ul;
the PCR amplification procedure was: 5 minutes at 95 ℃; 35 cycles: 95 ℃ for 45 seconds, 56 ℃ for 30 seconds, 72 ℃ for 20 seconds; 72 ℃ for 10 minutes;
the obtained gene-specific PCR product (sequence fragment shown in SEQ ID NO:2) is firstly inserted into a cloning vector pENTR, the obtained cloning vector 35S:: SlBSK1:: RNAi map is shown in figure 1, and the construction method of the vector refers to pENTRTM/SD/D-
Instructions for the Cloning Kit.
Then recombined into an RNAi vector pK7GWIWG2(II) (figure 2) through Gateway LR reaction exchange to obtain 35S:: SlBSK1:: RNAi interference vector. The Gateway LR reaction exchange recombination method comprises the following steps: the cloned plasmid pENTR comprises SLBSK1:0.5ul, the original plasmid pK7GWIWG2(II)1ul and 1 XTE buffer 1ul, is placed on ice for 2 minutes, 0.5ul of LR reaction enzyme (protease K) is added, the temperature is 25 ℃ overnight, then 0.3ul of protease K is added into an LR reaction system, the LR reaction system is incubated for 10 minutes at 37 ℃, the reaction is stopped, and finally all reaction liquid is used for transforming Escherichia coli DH5 alpha.
Second, construction and detection of transgenic tomato
The constructed binary vector infects agrobacterium tumefaciens through tomato cotyledons, induces callus, and performs resistance induced differentiation and rooting culture to obtain tissue culture seedlings. Screening transgenic seedlings growing on a culture medium containing antibiotic-kanamycin (50mg/L), primarily selecting the transgenic seedlings capable of growing on the culture medium containing the antibiotic as transgenic plants, and then performing PCR verification by extracting leaf DNA of the transgenic plants, wherein a primer used for PCR amplification is antibiotic Kan LP/RP;
PCR amplification primers:
Kan-LP：AAGAACTCGTCAAGAAGGCGA；
Kan-RP：GCACGCAGGTTCTCCGGCCGC
20ul of PCR amplification system was used,
enzyme Mix of PCR reaction: 10ul of
Kan-LP：1ul
Kan-RP：1ul
DNA template: 1ul
Deionized and sterilized water: 7 ul;
the PCR amplification procedure was: 5 minutes at 94 ℃; 35 cycles: 94 ℃, 45 seconds, 55 ℃, 30 seconds, 72 ℃,1 minute; 72 ℃ for 10 minutes. Thus, an RNAi transgenic line (35S:: SlBSK1:: RNAi transgenic line tomato) was obtained. The above method can be performed by referring to the construction and detection method of transgenic tomato published in Scientific reports, volume 7, stage 1, page 8594 by Tan et al 2017.
Third, content analysis of lycopene and beta-carotenoid in transgenic tomato
Wild type (Microtom) and 35S:: SlBSK1:: RNAi transgenic lines tomato plants were started by taking samples of fruit (epicarp) once every two days after the fruit had grown to the broke stage (Break, BR), BR +3, BR +5, BR +7, BR +9 and BR +11 (FIG. 3) for a total of 6 stages of samples, taking a certain amount of fruit tissue for grinding, extracting with acetone/n-hexane for 1h, and measuring the content of the anthocyanins in the primary extract by spectrophotometry (NAGATA and YAMASHITA, 1992).
According to 35S SlBSK1, the content change of lycopene and beta-carotene in RNAi transgenic tomato is analyzed, and the function of the transgenic tomato in lycopene (or carotenoid) biosynthesis is analyzed.
35S SlBSK1 shows that the content of lycopene and beta-carotene in fruits of RNAi-8 transgenic tomatoes in the stage of BR +11 is increased (primary extract) as shown in figure 4; from fig. 3 and 4, the following summary conclusions can be drawn: the SlBSK1 gene participates in the regulation of the development of the fruit tip type of the tomato fruit and the biosynthesis process of lycopene, and the silencing of the gene can lead to the increase of the content of lycopene and beta-carotene.
Therefore, the gene SlBSK1 participates in lycopene synthesis, 35S:: SlBSK1:: RNAi transgenic tomato fruit tip trait is sharpened, fruit is reddened, and lycopene content is increased.
Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.
Sequence listing
<110> Zhejiang province academy of agricultural sciences
<120> a gene SlBSK1 involved in regulation and control of tomato fruit tip type and lycopene synthesis and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1497
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
atgggttgtt gtcaatcttc aatcttgaag gagttgagct cagagaaaga tcagcgtcat 60
ggggtggtaa acgcacgagc ttctaacggc accggcgccg gagctgctgt cggagatggt 120
ggggttccgg tgttttctga gttttcgctt tctgagctca aagcagctac gaataacttc 180
agttcagaat ttattgtttc tgaaagtgga gaaaaggctc cgaatatggt ttacaagggg 240
aggttgcaga atcggcggtg gatcgctgtt aagaagttta ctaaatcggc atggcctgat 300
cctaaacagt ttgcggatga agcatcaggt gttggaaatt tgaggcataa aaggctggct 360
aatttaattg ggtactgctc tgatggggat gagaggttgc ttgtagctga gtacatgcca 420
aatgatacac ttgcaaagca tctatttcac tgggagaatc aaacccttga gtgggctatg 480
cgtttaagag tggctctata tattgctgaa gcattggact actgtagcag tgaaggtcga 540
ccactatacc atgacttgaa tgcatataga gttctctttg atgagagtgg cgatccccgt 600
ctttcttgtt ttgggctgat gaaaaatagc agggatggta aaagttatag cacgaacctt 660
gcgtatacac ctcctgagta tttaagaaat ggaagagtca ctcaagaaag tgttgttttc 720
agctatggaa ctgtcctttt ggacttgcta agtggaaaac atattcctcc tggtcatgca 780
ctcgatatga tacggggaaa aaacattctt ctattaatgg attcacattt ggagggaaat 840
ttctctacag aagaggcaac tgttgtattt gatctggctt cacgatgctt acagtatgaa 900
cccagggagc gaccaaatac caaagacctc gtttcaacac ttggtccatt gcaaagcaaa 960
cctgatgttg catctcatgt aatgttgggt attcccaaga gtgaggaagc tccaccaact 1020
ccacagcacc ctctttctgc aatgggtgat gcttgttcga gaatggatct cacagctatt 1080
catcagattt tggtaatgac acattataaa gacgatgaac tgacaaatga gttgtctttc 1140
caagagtgga ctcaacaaat gagggatatg ttagaggcaa gaaagcgtgg tgacttggca 1200
tttcgggaca aggactttaa aactgccata gattgctatt ctcagtttgt agatgtggga 1260
acgatggtgt ctccaactgt ttatgcacga agaagccttt gttatctcat gtgtgatcaa 1320
ccagatgctg cccttagaga tgcaatgcaa gcacaatgtg ttcacccaga ctggtcaact 1380
gcattttaca tgcaggcagt tgccctgtcg aagctagaca tgcacaaaga tgcagctgac 1440
atgttgaatg aggctgcaat tctagaagag aaaagacgcg gagggcgtgc atcttga 1497
<210> 2
<211> 237
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 2
tttacaaggg gaggttgcag aatcggcggt ggatcgctgt taagaagttt actaaatcgg 60
catggcctga tcctaaacag tttgcggatg aagcatcagg tgttggaaat ttgaggcata 120
aaaggctggc taatttaatt gggtactgct ctgatgggga tgagaggttg cttgtagctg 180
agtacatgcc aaatgataca cttgcaaagc atctatttca ctgggagaat caaaccc 237
<210> 3
<211> 498
<212> PRT
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 3
Met Gly Cys Cys Gln Ser Ser Ile Leu Lys Glu Leu Ser Ser Glu Lys
1 5 10 15
Asp Gln Arg His Gly Val Val Asn Ala Arg Ala Ser Asn Gly Thr Gly
20 25 30
Ala Gly Ala Ala Val Gly Asp Gly Gly Val Pro Val Phe Ser Glu Phe
35 40 45
Ser Leu Ser Glu Leu Lys Ala Ala Thr Asn Asn Phe Ser Ser Glu Phe
50 55 60
Ile Val Ser Glu Ser Gly Glu Lys Ala Pro Asn Met Val Tyr Lys Gly
65 70 75 80
Arg Leu Gln Asn Arg Arg Trp Ile Ala Val Lys Lys Phe Thr Lys Ser
85 90 95
Ala Trp Pro Asp Pro Lys Gln Phe Ala Asp Glu Ala Ser Gly Val Gly
100 105 110
Asn Leu Arg His Lys Arg Leu Ala Asn Leu Ile Gly Tyr Cys Ser Asp
115 120 125
Gly Asp Glu Arg Leu Leu Val Ala Glu Tyr Met Pro Asn Asp Thr Leu
130 135 140
Ala Lys His Leu Phe His Trp Glu Asn Gln Thr Leu Glu Trp Ala Met
145 150 155 160
Arg Leu Arg Val Ala Leu Tyr Ile Ala Glu Ala Leu Asp Tyr Cys Ser
165 170 175
Ser Glu Gly Arg Pro Leu Tyr His Asp Leu Asn Ala Tyr Arg Val Leu
180 185 190
Phe Asp Glu Ser Gly Asp Pro Arg Leu Ser Cys Phe Gly Leu Met Lys
195 200 205
Asn Ser Arg Asp Gly Lys Ser Tyr Ser Thr Asn Leu Ala Tyr Thr Pro
210 215 220
Pro Glu Tyr Leu Arg Asn Gly Arg Val Thr Gln Glu Ser Val Val Phe
225 230 235 240
Ser Tyr Gly Thr Val Leu Leu Asp Leu Leu Ser Gly Lys His Ile Pro
245 250 255
Pro Gly His Ala Leu Asp Met Ile Arg Gly Lys Asn Ile Leu Leu Leu
260 265 270
Met Asp Ser His Leu Glu Gly Asn Phe Ser Thr Glu Glu Ala Thr Val
275 280 285
Val Phe Asp Leu Ala Ser Arg Cys Leu Gln Tyr Glu Pro Arg Glu Arg
290 295 300
Pro Asn Thr Lys Asp Leu Val Ser Thr Leu Gly Pro Leu Gln Ser Lys
305 310 315 320
Pro Asp Val Ala Ser His Val Met Leu Gly Ile Pro Lys Ser Glu Glu
325 330 335
Ala Pro Pro Thr Pro Gln His Pro Leu Ser Ala Met Gly Asp Ala Cys
340 345 350
Ser Arg Met Asp Leu Thr Ala Ile His Gln Ile Leu Val Met Thr His
355 360 365
Tyr Lys Asp Asp Glu Leu Thr Asn Glu Leu Ser Phe Gln Glu Trp Thr
370 375 380
Gln Gln Met Arg Asp Met Leu Glu Ala Arg Lys Arg Gly Asp Leu Ala
385 390 395 400
Phe Arg Asp Lys Asp Phe Lys Thr Ala Ile Asp Cys Tyr Ser Gln Phe
405 410 415
Val Asp Val Gly Thr Met Val Ser Pro Thr Val Tyr Ala Arg Arg Ser
420 425 430
Leu Cys Tyr Leu Met Cys Asp Gln Pro Asp Ala Ala Leu Arg Asp Ala
435 440 445
Met Gln Ala Gln Cys Val His Pro Asp Trp Ser Thr Ala Phe Tyr Met
450 455 460
Gln Ala Val Ala Leu Ser Lys Leu Asp Met His Lys Asp Ala Ala Asp
465 470 475 480
Met Leu Asn Glu Ala Ala Ile Leu Glu Glu Lys Arg Arg Gly Gly Arg
485 490 495
Ala Ser
Claims (5)
1. The gene SlBSK1 involved in lycopene synthesis is characterized in that: the nucleotide sequence of the gene SlBSK1 is shown as SEQ ID No:1, the preparation method is as follows.
2. The gene SlBSK1 involved in lycopene synthesis according to claim 1, characterized in that: and 35S, construction of SlBSK1, wherein the nucleotide sequence of the interference fragment is shown as SEQ ID No:2, the preparation method is as follows.
3. Plasmids and plant interference vectors containing the gene of claim 1 or 2.
4. Use of the gene SlBSK1 according to claim 1 or 2, wherein: is used for increasing the content of lycopene and beta-carotene in tomato fruits and improving the shape of the fruit tips of the tomato fruits.
5. The method for constructing the transgenic tomato is characterized by comprising the following steps: constructing a transgenic tomato by using 35S: SlBSK1: RNAi interference vector; the 35S comprises SlBSK1, wherein the nucleotide sequence of an interference fragment of the RNAi interference vector is shown in SEQ ID No:2, the transgenic tomato can improve the content of lycopene and beta-carotene and change the property of the fruit tip of the tomato.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011595625.9A CN112553223B (en) | 2020-12-30 | 2020-12-30 | Gene SlBSK1 participating in regulation and control of tomato fruit tip type and lycopene synthesis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011595625.9A CN112553223B (en) | 2020-12-30 | 2020-12-30 | Gene SlBSK1 participating in regulation and control of tomato fruit tip type and lycopene synthesis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112553223A true CN112553223A (en) | 2021-03-26 |
| CN112553223B CN112553223B (en) | 2022-02-22 |
Family
ID=75032866
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011595625.9A Active CN112553223B (en) | 2020-12-30 | 2020-12-30 | Gene SlBSK1 participating in regulation and control of tomato fruit tip type and lycopene synthesis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112553223B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117844829A (en) * | 2024-03-05 | 2024-04-09 | 中国农业科学院作物科学研究所 | Application of soybean heat-resistant protein GmBSK1 and encoding gene thereof in regulation and control of plant stress resistance |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015177215A1 (en) * | 2014-05-20 | 2015-11-26 | Crag - Centre De Recerca En Agrigenòmica Csic Irta Uab Ub | A method for improving the water-use efficiency and drought tolerance in plants |
| CN109929923A (en) * | 2019-03-13 | 2019-06-25 | 西北农林科技大学 | Transcribe application of the sequencing technologies in screening jujube fruit-shrink disease disease-resistant gene |
-
2020
- 2020-12-30 CN CN202011595625.9A patent/CN112553223B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015177215A1 (en) * | 2014-05-20 | 2015-11-26 | Crag - Centre De Recerca En Agrigenòmica Csic Irta Uab Ub | A method for improving the water-use efficiency and drought tolerance in plants |
| CN109929923A (en) * | 2019-03-13 | 2019-06-25 | 西北农林科技大学 | Transcribe application of the sequencing technologies in screening jujube fruit-shrink disease disease-resistant gene |
Non-Patent Citations (1)
| Title |
|---|
| 无: "NCBI Reference Sequence: XM_004238365.4", 《GENEBANK》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117844829A (en) * | 2024-03-05 | 2024-04-09 | 中国农业科学院作物科学研究所 | Application of soybean heat-resistant protein GmBSK1 and encoding gene thereof in regulation and control of plant stress resistance |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112553223B (en) | 2022-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20130247242A1 (en) | Plant height regulatory gene and uses thereof | |
| CN107460199B (en) | Rice grain shape controlling gene GS9 and its application | |
| CN109628439B (en) | Gene for promoting synthesis and photosynthetic efficiency of tomato chlorophyll and application thereof | |
| US20070250945A1 (en) | Usage of Mad-Box Genes in Fruit & Seed Development by Regulating Active Gibberellin Synthesis | |
| CN104561025A (en) | Tomato slml1 gene and application | |
| CN107937413B (en) | Application of medicago truncatula MYB transcription factor MtMYB1 | |
| CN112553223B (en) | Gene SlBSK1 participating in regulation and control of tomato fruit tip type and lycopene synthesis and application thereof | |
| CN113372423B (en) | Application of wild soybean Bet _ v _1 family gene GsMLP328 | |
| CN109913473B (en) | Gene for improving size and quality of seeds and application thereof | |
| KR20110086203A (en) | Osmpt gene modifying plant architecture and uses theoreof | |
| CN101302523B (en) | Application of physiological clock regulation protein LHY to stress-tolerant plant cultivation | |
| CN110903366B (en) | Jujube TCP transcription factor ZjTCP15 and application thereof | |
| CN110295175B (en) | Application of soybean NAC transcription factor family gene Glyma08g41995 | |
| WO2014150879A1 (en) | Compositions and methods for increasing plant seed number and/or yield | |
| CN111235168A (en) | Receptor kinase SlSRK2B participating in lycopene synthesis and application thereof | |
| CN115466747A (en) | Glycosyltransferase ZmKOB1 gene and application thereof in regulating and controlling maize ear fructification character or development | |
| CN108977414B (en) | Artificially synthesized mutant of beta-carotene ketolase and coding sequence and application thereof | |
| JP2020141582A (en) | Mutant-type flowering-inducing gene, transformed plant having the mutant-type flowering-inducing gene, and flowering regulation method using the mutant-type flowering-inducing gene | |
| CN113416747B (en) | Method for creating temperature-sensitive male sterile plant | |
| CN113980977B (en) | Application of cotton Gh_A09G0075 gene in plant growth regulation | |
| WU et al. | Isolation of a plasmalemma aquaporin encoding gene StPIP1 from Solanum tuberosum L. and its expression in transgenic tobacco | |
| CN112430259B (en) | Wheat salt stress related protein TaCSN5, and coding gene and application thereof | |
| KR102448536B1 (en) | ABA receptor mutants and use thereof | |
| CN116970053B (en) | Plant carotenoid synthesis related protein DcAPRR2, and coding gene and application thereof | |
| CN112813074B (en) | Method for specifically regulating and controlling rice CYP78A11 gene expression and plant transformation vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |