WO2009061216A1

WO2009061216A1 - Compositions and methods for altering the production of pigment in plants

Info

Publication number: WO2009061216A1
Application number: PCT/NZ2008/000288
Authority: WO
Inventors: Andrew Charles Allan; Richard Victor Espley; Roger Paul Hellens
Original assignee: The New Zealand Institute For Plant And Food Research Limited
Priority date: 2007-11-05
Filing date: 2008-10-31
Publication date: 2009-05-14
Also published as: AR069202A1; CL2008003295A1

Abstract

The invention relates to polynucleotides encoding novel transcription factors, and to the encoded transcription factors, that are capable of regulating anthocyanin production in plants. The invention also relates to constructs comprising the polynucleotides, and to host cells, plant cells and plants transformed with the polynucleotides, constructs and vectors. The invention also relates methods of producing plants with altered anthocyanin production and plants produced by the methods.

Description

COMPOSITIONS AND METHODS FOR ALTERING THE PRODUCTION OF

PIGMENT IN PLANTS

TECHNICAL FIELD

The present invention relates to controlling pigment development in plants.

BACKGROUND ART

The accumulation of anthocyanin pigments in fruit is an important determinant of fruit quality. These pigments provide essential cultivar differentiation for consumers and are implicated in the health attributes. Anthocyanin belongs to the diverse group of ubiquitous secondary metabolites, collectively known as flavonoids. In plants, flavonoids are believed to have a variety of functions, including defence and protection against light stress, and the pigmented anthocyanin compounds play an important physiological role as attractants in plant/animal interactions (Harborne and Grayer, 1994; Koes et al, 1994).

One of the most common anthocyanin pigments is cyanidin which, in the form of cyanidin 3-0- galactoside, is the pigment primarily responsible for red colouration in apple skin (Lancaster, 1992; Tsao et al, 2003). Some of the biosynthetic genes responsible have been determined (e.g. Hoffmann et al., 2006).

The genus Actinidia (kiwifruit) is native to China and neighbouring countries and consists of over 70 species which form a polyploidy series from diploid to octoploid, with some species known to contain ploidy races. All species bear edible fruit, and display great diversity in fruit and vine characteristics. Colour is a significant consumer trait and data suggests that kiwifruit varieties with novel colour could command significant premiums (Jaeger and Harker 2005).

The control of anthocyanin accumulation in kiwifruit is a key question in understanding and manipulating fruit colour. Transcription factors may regulate expression of more than one gene in any given biosynthetic pathway and therefore can be useful tools for regulating production from such biosynthetic pathways. For example, the Arabidopsis gene PAPl, when overexpressed in transgenic Arabidopsis led to up-regulation of a number of genes in the anthocyanin biosynthesis pathway from PAL to CHS and DFR (Borevitz et at, 2000, Tohge et α/., 2005).

In order to manipulate anthocyanin production in kiwifruit species it is advantageous to have available sequences derived from kiwifruit species. Such sequences may be useful to alleviate public concerns about cross-species transformation in the genetic manipulation of anthocyanin production. In addition if down-regulation of such a kiwifruit sequence is sought, it may be necessary to transform the plant with a sequence that is identical, or at least highly similar, to the endogenous kiwifruit sequence. Kiwifruit sequences may also be useful to provide probes or primers for assessing expression of corresponding endogenous sequences in kiwifruit species during marker-assisted breeding.

To the applicant's knowledge, there are currently no known transcription factors from kiwifruit species that can be used to regulate anthocyanin production in kiwifruit and other plant species.

It is therefore an object of the invention to provide transcription factor sequence from kiwifruit which regulates anthocyanin production in kiwifruit and other plant species and/or at least to provide the public with a useful choice.

SUMMARY OF THE INVENTION

In the first aspect the invention provides an isolated polynucleotide comprising a sequence encoding a polypeptide with the amino acid sequences of SEQ ID NO:1 or 2 or a variant thereof, wherein the polypeptide or variant thereof is an R2R3 MYB transcription factor that regulates anthocyanin production in a plant.

In one embodiment the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 1 or 2.

In a further embodiment the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 1.

In a further embodiment the polypeptide comprises the amino acid sequence of SEQ ID NO: 1. In^' one embodiment the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 2.

In a further embodiment the polypeptide comprises the amino acid sequence of SEQ ID NO: 2.

Preferably the transcription factor positively regulates anthocyanin production.

In a further aspect the invention provides an isolated polynucleotide comprising a sequence encoding a polypeptide with the amino acid sequences of SEQ ID NO: 1 or 2 or a variant thereof, wherein the polypeptide or variant thereof is an R2R3 MYB transcription factor that regulates the promoter of at least one gene in the anthocyanin biosynthetic pathway in a plant.

In a further embodiment the polypeptide comprises the amino acid sequence of SEQ ID NO: 1.

In one embodiment the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 2.

Preferably the transcription factor positively regulates the promoter.

In one embodiment the gene in the anthocyanin biosynthetic pathway is selected from a group including genes encoding: chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), dihydroflavonol reductase (DFR), leucoanthocyanidin dioxygenase (LDOX), UDP glucose flavonoid glucosyl-transferase (UFGT), and glutathione S-transferase (GST). In one embodiment the gene in the anthocyanin biosynthetic pathway encodes chalcone synthase (CHS).

In a further embodiment the promoter has at least 70% identity to the sequence of SEQ ID NO: 7.

In a further embodiment the promoter has the sequence of SEQ ID NO: 7.

In one embodiment the gene in the anthocyanin biosynthetic pathway encodes flavanone 3- hydroxylase (F3H).

In a further embodiment the promoter has at least 70% identity to the sequence of SEQ ID NO: 8.

In a further embodiment the promoter has the sequence of SEQ ID NO: 8.

In one embodiment the gene in the anthocyanin biosynthetic pathway encodes dihydroflavonol 4-reductase (DFR).

In a further embodiment the promoter has at least 70% identity to the sequence of SEQ ID NO: 9.

In a further embodiment the promoter has the sequence of SEQ ID NO: 9.

In one embodiment the gene in the anthocyanin biosynthetic pathway encodes leucoanthocyanidin dioxygenase (LDOX).

In a further embodiment the promoter has at least 70% identity to the sequence of SEQ ID NO: 10.

In a further embodiment the promoter has the sequence of SEQ ID NO: 10. In one embodiment the gene in the anthocyanin biosynthetic pathway encodes UDP glucose flavonoid glucosyl-transferase (UFGT).

In a further embodiment the promoter has at least 70% identity to the sequence of SEQ ID NO:

5 11.

In a further embodiment the promoter has the sequence of SEQ ID NO: 1 1.

In one embodiment the gene in the anthocyanin biosynthetic pathway encodes glutathione S- 0 transferase (GST).

In a further embodiment the promoter has at least 70% identity to the sequence of SEQ ID NO: 12. 5 In a further embodiment the promoter has the sequence of SEQ ID NO: 12.

In a further aspect the invention provides an isolated polynucleotide comprising the sequence of any one of the sequences of SEQ ID NO: 3 to 6 or a variant thereof, wherein the polynucleotide or variant thereof encodes an R2R3 MYB transcription factor that regulates anthocyanin0 production in a plant.

In one embodiment the variant comprises a nucleic acid sequence with at least 70% identity to 15 the sequence of any one of SEQ ID NO: 3 to 6.

In one embodiment the variant comprises a nucleic acid sequence with at least 70% identity to the sequence of SEQ ID NO: 3.

!0 In a further embodiment the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 3. In one embodiment the variant comprises a nucleic acid sequence with at least 70% identity to the sequence of SEQ ID NO: 4.

In a further embodiment the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 4.

In one embodiment the variant comprises a nucleic acid sequence with at least 70% identity to the sequence of SEQ ID NO: 5.

In a further embodiment the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 5.

In one embodiment the variant comprises a nucleic acid sequence with at least 70% identity to the sequence of SEQ ID NO: 6.

In a further embodiment the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 6.

In a further aspect the invention provides an isolated polynucleotide comprising the sequence of any one of the sequences of SEQ ID NO: 3 to 6 or a variant thereof, wherein the polynucleotide or variant thereof encodes an R2R3 MYB transcription factor that regulates the promoter of at least one gene in the anthocyanin biosynthetic pathway in a plant.

Preferably the transcription factor positively regulates the promoter.

In one embodiment the variant comprises a nucleic acid sequence with at least 70% identity to the sequence of any one of SEQ ID NO: 3 to 6.

In one embodiment the variant comprises a nucleic acid sequence with at least 70% identity to the sequence of SEQ ID NO : 3.

In a further embodiment the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 3. In one embodiment the variant comprises a nucleic acid sequence with at least 70% identity to the sequence of SEQ ID NO: 4.

In a further embodiment the polynucleotide comprises the nucleic acid sequence of SEQ ID NO:

5.

In one embodiment the gene in the anthocyanin biosynthetic pathway is selected from a group including genes encoding: chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), dihydroflavonol reductase (DFR), leucoanthocyanidin dioxygenase (LDOX), UDP glucose flavonoid glucosyl-transferase (UFGT), and glutathione S-transferase (GST).

In one embodiment the gene in the anthocyanin biosynthetic pathway encodes chalcone synthase (CHS).

In a further embodiment the promoter has the sequence of SEQ ID NO: 7. In one embodiment the gene in the anthocyanin biosynthetic pathway encodes flavanone 3- hydroxylase (F3H).

In a further embodiment the promoter has the sequence of SEQ ID NO: 8.

In one embodiment the gene in the anthocyanin biosynthetic pathway encodes dihydroflavonol- 4-reductase (DFR).

In a further embodiment the promoter has the sequence of SEQ ID NO: 9.

In a further embodiment the promoter has the sequence of SEQ ID NO: 10.

In one embodiment the gene in the anthocyanin biosynthetic pathway encodes UDP glucose flavonoid glucosyl-transferase (UFGT).

In a further embodiment the promoter has at least 70% identity to the sequence of SEQ ID NO: 11.

In a further embodiment the promoter has the sequence of SEQ ID NO: 11. In one embodiment the gene in the anthocyanin biosynthetic pathway encodes glutathione S- transferase (GST).

In a further embodiment the promoter has at least 70% identity to the sequence of SEQ ID NO: 12.

In a further embodiment the promoter has the sequence of SEQ ID NO: 12.

In a further aspect the invention provides an isolated polypeptide comprising: a) the amino acid sequences of SEQ ID NO: 1 or 2 or a variant thereof, wherein the polypeptide or variant thereof is an R2R3 MYB transcription factor that regulates anthocyanin production in a plant; or b) a fragment, of at least 5 amino acids in length, of the sequence of a), capable of performing the same function as the polypeptide in a).

In one embodiment the transcription factor positively regulates anthocyanin production.

In one embodiment the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 1.

In one embodiment the polypeptide comprises the amino acid sequence of SEQ ID NO: 1.

In one embodiment the polypeptide comprises the amino acid sequence of SEQ ID NO: 2.

In one embodiment the fragment comprises the amino acid sequence of SEQ ID NO: 19.

In a further aspect the invention provides an isolated polypeptide comprising: a) the amino acid sequences of SEQ ID NO: 1 or 2 or a variant thereof, wherein the polypeptide or variant thereof is an R2R3 MYB transcription factor that regulates the promoter of at least one gene in the anthocyanin biosynthetic pathway in a plant; or b) a fragment, of at least 5 amino acids in length, of the sequence of a), capable of performing 5 the same function as the polypeptide in a).

Preferably the transcription factor positively regulates the promoter.

In one embodiment the variant comprises an amino acid sequence with at least 63% identity to 0 the sequence of SEQ ID NO: 1 or 2.

In one embodiment the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 1. 5 In one embodiment the polypeptide comprises the amino acid sequence of SEQ ID NO: 1.

JO In one embodiment the polypeptide comprises the amino acid sequence of SEQ ID NO: 2.

In one embodiment the gene in the anthocyanin biosynthetic pathway is selected from a group >5 including genes encoding: chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), dihydroflavonol reductase (DFR), leucoanthocyanidin dioxygenase (LDOX), UDP glucose flavonoid glucosyl-transferase (UFGT), and glutathione S-transferase (GST).

In one embodiment the gene in the anthocyanin biosynthetic pathway encodes chalcone synthase iO (CHS).

In a further embodiment the promoter has at least 70% identity to the sequence of SEQ ID NO: 7. In a further embodiment the promoter has the sequence of SEQ ID NO: 7.

In a further embodiment the promoter has the sequence of SEQ ID NO: 8.

In a further embodiment the promoter has the sequence of SEQ ID NO: 9.

In a further embodiment the promoter has the sequence of SEQ ID NO: 10.

In a further embodiment the promoter has at least 70% identity to the sequence of SEQ ID NO: 11. In a further embodiment the promoter has the sequence of SEQ ID NO: 11.

In one embodiment the gene in the anthocyanin biosynthetic pathway encodes glutathione S- transferase (GST).

In a further embodiment the promoter has the sequence of SEQ ID NO: 12.

In a further aspect the invention provides a polynucleotide encoding a polypeptide of the invention.

In a further aspect the invention provides an antibody raised against a polypeptide of the invention.

In a further aspect the invention provides a genetic construct comprising a polynucleotide of any one of the invention.

In a further aspect the invention provides a vector comprising a polynucleotide of the invention.

In a further aspect the invention provides a vector comprising a genetic construct of the invention.

In a further aspect the invention provides a host cell genetically modified to express a polynucleotide of any one of the invention.

In a further aspect the invention provides a host cell comprising a genetic construct of the invention.

In a further aspect the invention provides a host cell comprising a vector of the invention. In a further aspect the invention provides a plant cell genetically modified to express a polynucleotide of the invention.

In a further aspect the invention provides a plant cell or comprising the genetic construct of the invention.

In a further aspect the invention provides a plant which comprises the plant cell of the invention.

In a further aspect the invention provides a method for producing a polypeptide of the invention, the method comprising the step of culturing a host cell genetically modified to express a polynucleotide of the invention

In one embodiment the host cell comprises a genetic construct of the invention.

In a further aspect the provides a method for producing a plant cell or plant with altered anthocyanin production, the method comprising the step of transformation of a plant cell or plant with a genetic construct including: a) at least one polynucleotide encoding of a MYB polypeptide of the invention; b) at least one gene encoding of a MYB polypeptide of the invention c) at least one polynucleotide comprising a fragment, of at least 15 nucleotides in length, of the polynucleotide of a) or gene of b); d) at least one polynucleotide comprising a complement, of at least 15 nucleotides in length, of the polynucleotide of c); or e) at least one polynucleotide capable of hybridising under stringent conditions to the polynucleotide of a) or a gene of b).

In one embodiment the method is for producing a plant cell or plant with increased anthocyanin production.

In one embodiment the method is for producing a plant cell or plant with decreased anthocyanin production. In one embodiment the method includes the additional step of transforming the plant with a construct designed to express a bHLH transcription factor, such that the bHLH transcription factor is co-expressed with the MYB polypeptide of the invention.

In a further embodiment the bHLH transcription factor comprises an amino acid sequence with at least 70% identity to the sequence of any one of SEQ ID NO: 7.

In a further embodiment the bHLH transcription factor comprises an amino acid sequence with the sequence of SEQ ID NO: 7.

In a further aspect the invention provides a plant produced by the method of the invention.

In a further aspect the invention provides a method for selecting a plant altered in anthocyanin production, the method comprising testing of a plant for altered expression of a polynucleotide of the invention.

In one embodiment the plant has increased anthocyanin production.

In one embodiment the plant has decreased anthocyanin production.

In a further aspect the invention provides a method for selecting a plant altered in anthocyanin production, the method comprising testing of a plant for altered expression of a polypeptide of the invention.

In one embodiment the plant has increased anthocyanin production.

In one embodiment the plant has decreased anthocyanin production.

In a further aspect the invention provides a group or population of plants selected by the method of the invention.

In a further aspect the invention provides a method for selecting a plant cell or plant that has been transformed, the method comprising the steps a) transforming a plant cell or plant with a polynucleotide of the invention capable of regulating anthocyanin production in a plant; b) expressing the polynucleotide in the plant cell or plant; and c) selecting a plant cell or plant with increased anthocyanin pigmentation relative to other plant cells or plants, the increased anthocyanin pigmentation indicating that the plant cell or plant has been transformed.

In a further aspect the invention provides a transformed plant selected by the method of the invention.

Preferably the transcription factors and variants of the invention, that are capable of regulating anthocyanin production in plants, are capable of regulating the production of the anthocyanins selected from the group including but not limited to: cyanidin-3-glucoside, cyanidin-3-0- rutinoside, cyanidin-3-glucoside and cyanidin-3-pentoside; pelargonidin 3-glucoside and pelargonidin 3-rutinoside, delphinidin-3-glucoside and delphinidin-3-pentoside, malvidin-3- glucoside

Preferably the anthocyanins are cyanidin-3-glucoside and delphinidin-3-pentoside, malvidin-3- glucoside.

Preferably the plants or plant cells with altered production of anthocyanins, produced by or selected by the methods of the invention, are altered in production of anthocyanins selected from the group including but not limited to: cyanidin-3-glucoside, cyanidin-3-O-rutinoside, cyanadin- 3-glucoside and cyanadin-3-pentoside; pelargonidin 3-glucoside and pelargonidin 3-rutinoside.

The polynucleotides and polynucleotide variants, of the invention may be derived from any species or may be produced by recombinant or synthetic means.

In one embodiment the polynucleotide or variant, is derived from a plant species. In a further embodiment the polynucleotide or variant, is derived from a gymnosperm plant species.

In a further embodiment the polynucleotide or variant, is derived from an angiosperm plant species.

In a further embodiment the polynucleotide or variant, is derived from a from dicotyledonous plant species.

The polypeptides and polypeptide variants of the invention may be derived from any species, or may be produced by recombinant or synthetic means.

In one embodiment the polypeptides or variants of the invention are derived from plant species.

In a further embodiment the polypeptides or variants of the invention are derived from gymnosperm plant species.

In a further embodiment the polypeptides or variants of the invention are derived from angiosperm plant species.

In a further embodiment the polypeptides or variants of the invention are derived from dicotyledonous plant species.

In a further embodiment polypeptide or variant is derived from a monocotyledonous plant species.

The plant cells and plants of the invention may be from any species.

In one embodiment the plants cells and plants of the invention are from gymnosperm species.

In a further embodiment the plants cells and plants of the invention are from angiosperm species. In a further embodiment the plants cells and plants of the invention are from dicotyledonous species.

In a further embodiment the plants cells and plants of the invention are from monocotyledonous species.

Preferred plant species (for the polynucleotide and variants, polypeptides and variants and plant cells and plants of the invention) include fruit plant species selected from a group comprising but not limited to the following genera: Actinidia, Malus, Pyrus Prunis, Rubus, Rosa, Fr agar ia, Cydonia, Citrus, and Vaccinium.

Particularly preferred fruit plant species are: Actidinia deliciosa, A. chinensis, A. eriantha, A. arguta and hybrids of the four Actinidia species, Malus domestica, Prunis persica, Pyrus L, Rubus, Rosa, and Fragaria.

Preferred plants (for the polynucleotide and variants, polypeptides and variants and plant cells and plants of the invention) also include vegetable plant species selected from a group comprising but not limited to the following genera: Brassica, Lycopersicon and Solanum,

Particularly preferred vegetable plant species are: Lycopersicon esculentum and Solanum tuberosum

Preferred plants (for the polynucleotide and variants, polypeptides and variants and plant cells and plants of the invention) also include crop plant species selected from a group comprising but not limited to the following genera: Glycine, Zea, Hordeum and Oryza.

Particularly preferred crop plant species include Glycine max, Zea mays and Oryza sativa.

Preferred plants (for the polynucleotide and variants, polypeptides and variants and plant cells and plants of the invention) also include those of the Actinidaceae family.

Preferred Actinidaceae genera include: Actinidia, Clematoclethra and Saurauria. A preferred Actinidaceae genera is Actinidia.

Preferred Actinidia species include: Actidinia deliciosa, A. chinensis, A. eriantha, A. arguta and hybrids of the four Actinidia species.

Particularly preferred Actinidia species are Actididia chinensis and Actinidia deliciosa.

The term "plant" is intended to include a whole plant, any part of a plant, propagules and progeny of a plant.

The term 'propagule' means any part of a plant that may be used in reproduction or propagation, either sexual or asexual, including seeds and cuttings.

DETAILED DESCRIPTION

In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art.

The term "comprising" as used in this specification means "consisting at least in part of. When interpreting each statement in this specification that includes the term "comprising", features other than that or those prefaced by the term may also be present. Related terms such as "comprise" and "comprises" are to be interpreted in the same manner.

The term "transcription factor that regulates anthocyanin production" or grammatical equivalents thereof means that when a plant expresses, or expresses increased levels of the transciption factor, the result is an alteration in anthocyanin production in the plant to a relative suitable control plant. The increased level of expression of the transcription factor may be brought about by genetic manipulation such as transformation with a polynucleotide or genetic construct of the invention. Alternatively the increased expression may be naturally occuring in a plant selected from a non-genetically manipulated population. Preferably the alteration in anthocyanin production is an increase in anthocyanin production. Alternatively a reduction in anthocyanin production may be effected by reducing or silencing expression of a sequence of the invention using gene silencing methods discussed herein.

Suitable control plants include plants of the same species or variety that are not genetically modified to increase expression of the transcription factor, such as plants transformed with a control construct, for example an empty vector construct. Other control plants may include other members of the population from which plants with naturally occuring high expression of the transcription factor are selected.

Polynucleotides and fragments

The term "polynucleotide(s)," as used herein, means a single or double-stranded deoxyribonucleotide or ribonucleotide polymer of any length but preferably at least 15 nucleotides, and include as non-limiting examples, coding and non-coding sequences of a gene, sense and antisense sequences complements, exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozymes, recombinant polypeptides, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers and fragments.

A "fragment" of a polynucleotide sequence provided herein is a subsequence of contiguous nucleotides that is capable of specific hybridization to a target of interest, e.g., a sequence that is at least 15 nucleotides in length. The fragments of the invention comprise 15 nucleotides, preferably at least 20 nucleotides, more preferably at least 30 nucleotides, more preferably at least 50 nucleotides, more preferably at least 50 nucleotides and most preferably at least 60 nucleotides of contiguous nucleotides of a polynucleotide of the invention. A fragment of a polynucleotide sequence can be used in antisense, gene silencing, triple helix or ribozyme technology, or as a primer, a probe, included in a microarray, or used in polynucleotide-based selection methods of the invention. The term "primer" refers to a short polynucleotide, usually having a free 3 'OH group, that is hybridized to a template and used for priming polymerization of a polynucleotide complementary to the target.

The term "probe" refers to a short polynucleotide that is used to detect a polynucleotide sequence, that is complementary to the probe, in a hybridization-based assay. The probe may consist of a "fragment" of a polynucleotide as defined herein.

Polypeptides and fragments

The term "polypeptide", as used herein, encompasses amino acid chains of any length but preferably at least 5 amino acids, including full-length proteins, in which amino acid residues are linked by covalent peptide bonds. Polypeptides of the present invention may be purified natural products, or may be produced partially or wholly using recombinant or synthetic techniques. The term may refer to a polypeptide, an aggregate of a polypeptide such as a dimer or other multimer, a fusion polypeptide, a polypeptide fragment, a polypeptide variant, or derivative thereof.

A "fragment" of a polypeptide is a subsequence of the polypeptide that performs a function that is required for the biological activity and/or provides three dimensional structure of the polypeptide. The term may refer to a polypeptide, an aggregate of a polypeptide such as a dimer or other multimer, a fusion polypeptide, a polypeptide fragment, a polypeptide variant, or derivative thereof capable of performing the above enzymatic activity.

The term "isolated" as applied to the polynucleotide or polypeptide sequences disclosed herein is used to refer to sequences that are removed from their natural cellular environment. An isolated molecule may be obtained by any method or combination of methods including biochemical, recombinant, and synthetic techniques.

The term "recombinant" refers to a polynucleotide sequence that is removed from sequences that surround it in its natural context and/or is recombined with sequences that are not present in its natural context. A "recombinant" polypeptide sequence is produced by translation from a "recombinant" polynucleotide sequence.

The term "derived from" with respect to polynucleotides or polypeptides of the invention being derived from a particular genera or species, means that the polynucleotide or polypeptide has the same sequence as a polynucleotide or polypeptide found naturally in that genera or species. The polynucleotide or polypeptide, derived from a particular genera or species, may therefore be produced synthetically or recombinantly.

Variants

As used herein, the term "variant" refers to polynucleotide or polypeptide sequences different from the specifically identified sequences, wherein one or more nucleotides or amino acid residues is deleted, substituted, or added. Variants may be naturally occurring allelic variants, or non-naturally occurring variants. Variants may be from the same or from other species and may encompass homologues, paralogues and orthologues. In certain embodiments, variants of the inventive polypeptides and polypeptides possess biological activities that are the same or similar to those of the inventive polypeptides or polypeptides. The term "variant" with reference to polypeptides and polypeptides encompasses all forms of polypeptides and polypeptides as defined herein.

Polynucleotide variants

Variant polynucleotide sequences preferably exhibit at least 50%, more preferably at least 51%, more preferably at least 52%, more preferably at least 53%, more preferably at least 54%, more preferably at least 55%, more preferably at least 56%, more preferably at least 57%, more preferably at least 58%, more preferably at least 59%, more preferably at least 60%, more preferably at least 61%, more preferably at least 62%, more preferably at least 63%, more preferably at least 64%, more preferably at least 65%, more preferably at least 66%, more preferably at least 67%, more preferably at least 68%, more preferably at least 69%, more preferably at least 70%, more preferably at least 71%, more preferably at least 72%, more preferably at least 73%, more preferably at least 74%, more preferably at least 75%, more preferably at least 76%, more preferably at least 77%, more preferably at least 78%, more preferably at least 79%, more preferably at least 80%, more preferably at least 81%, more preferably at least 82%, more preferably at least 83%, more preferably at least 84%, more preferably at least 85%, more preferably at least 86%, more preferably at least 87%, more preferably at least 88%, more preferably at least 89%, more preferably at least 90%, more

5 preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, and most preferably at least 99% identity to a sequence of the present invention. Identity is found over a comparison window of at least 20 nucleotide positions, preferably at least 50 nucleotide positions, more preferably at least 100

10 nucleotide positions, and most preferably over the entire length of a polynucleotide of the invention.

Polynucleotide sequence identity can be determined in the following manner. The subject polynucleotide sequence is compared to a candidate polynucleotide sequence using BLASTN

15 (from the BLAST suite of programs, version 2.2.5 [Nov 2002]) in b!2seq (Tatiana A. Tatusova, Thomas L. Madden (1999), "Blast 2 sequences - a new tool for comparing protein and nucleotide sequences", FEMS Microbiol Lett. 174:247-250), which is publicly available from NCBI (ftp://ftp.ncbi.nih.gov/blast/). The default parameters of bl2seq are utilized except that filtering of low complexity parts should be turned off.

!0

The identity of polynucleotide sequences may be examined using the following unix command line parameters:

bl2seq -i nucleotideseql -j nucleotideseq2 -F F -p blastn •5

The parameter -F F turns off filtering of low complexity sections. The parameter -p selects the appropriate algorithm for the pair of sequences. The bl2seq program reports sequence identity as both the number and percentage of identical nucleotides in a line "Identities = ".

i0 Polynucleotide sequence identity may also be calculated over the entire length of the overlap between a candidate and subject polynucleotide sequences using global sequence alignment programs (e.g. Needleman, S. B. and Wunsch, C. D. (1970) J. MoI. Biol. 48, 443-453). A full implementation of the Needleman- Wunsch global alignment algorithm is found in the needle program in the EMBOSS package (Rice,P. Longden,I. and Bleasby,A. EMBOSS: The European Molecular Biology Open Software Suite, Trends in Genetics June 2000, vol 16, No 6. pp.276- 277) which can be obtained from http://www.hgmp.mrc.ac.uk/Software/EMBOSS/. The European Bioinformatics Institute server also provides the facility to perform EMBOSS-needle global alignments between two sequences on line at http:/www.ebi.ac.uk/emboss/align/.

Alternatively the GAP program may be used which computes an optimal global alignment of two sequences without penalizing terminal gaps. GAP is described in the following paper: Huang, X. (1994) On Global Sequence Alignment. Computer Applications in the Biosciences 10, 227-235.

Polynucleotide variants of the present invention also encompass those which exhibit a similarity to one or more of the specifically identified sequences that is likely to preserve the functional equivalence of those sequences and which could not reasonably be expected to have occurred by random chance. Such sequence similarity with respect to polypeptides may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.5 [Nov 2002]) from NCBI (ftp://ftp.ncbi.nih.gov/blastΛ.

The similarity of polynucleotide sequences may be examined using the following unix command line parameters:

bl2seq -i nucleotideseql -j nucleotideseq2 -F F -p tblastx

The parameter -F F turns off filtering of low complexity sections. The parameter -p selects the appropriate algorithm for the pair of sequences. This program finds regions of similarity between the sequences and for each such region reports an "E value" which is the expected number of times one could expect to see such a match by chance in a database of a fixed reference size containing random sequences. The size of this database is set by default in the bl2seq program.

For small E values, much less than one, the E value is approximately the probability of such a random match.

Variant polynucleotide sequences preferably exhibit an E value of less than 1 x 10 ^'6 more preferably less than 1 x 10 ^"9, more preferably less than 1 x 10 ^"12, more preferably less than 1 x 10 ^~15, more preferably less than 1 x 10 ^~18 more preferably less than 1 x 10 ^{"2 l} rnore preferably less than 1 x 10 ^"3^ more preferably less than 1 x 10 ^"4^ more preferably less than 1 x 10 ^"50 _; more preferably less than I x IO ^{" 0} _, more preferably less than 1 x 10 ^"70 more preferably less than 1 x 10 ^"80 _; more preferably less than 1 x 10 ^"90 and most preferably less than 1 x 10^"100 when compared with any one of the specifically identified sequences.

Alternatively, variant polynucleotides of the present invention hybridize to the specified polynucleotide sequences, or complements thereof under stringent conditions.

The term "hybridize under stringent conditions", and grammatical equivalents thereof, refers to the ability of a polynucleotide molecule to hybridize to a target polynucleotide molecule (such as a target polynucleotide molecule immobilized on a DNA or RNA blot, such as a Southern blot or Northern blot) under defined conditions of temperature and salt concentration. The ability to hybridize under stringent hybridization conditions can be determined by initially hybridizing under less stringent conditions then increasing the stringency to the desired stringency.

With respect to polynucleotide molecules greater than about 100 bases in length, typical stringent hybridization conditions are no more than 25 to 30° C (for example, 10° C) below the melting temperature (Tm) of the native duplex (see generally, Sambrook et al, Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Ausubel et al, 1987, Current Protocols in Molecular Biology, Greene Publishing,). Tm for polynucleotide molecules greater than about 100 bases can be calculated by the formula Tm = 81. 5 + 0. 41% (G + C-log (Na+). (Sambrook et al, Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Bolton and McCarthy, 1962, PNAS 84:1390). Typical stringent conditions for polynucleotide of greater than 100 bases in length would be hybridization conditions such as prewashing in a solution of 6X SSC, 0.2% SDS; hybridizing at 65⁰C, 6X SSC, 0.2% SDS overnight; followed by two washes of 30 minutes each in IX SSC, 0.1% SDS at 65⁰ C and two washes of 30 minutes each in 0.2X SSC, 0.1% SDS at 65⁰C.

With respect to polynucleotide molecules having a length less than 100 bases, exemplary stringent hybridization conditions are 5 to 10° C below Tm. On average, the Tm of a polynucleotide molecule of length less than 100 bp is reduced by approximately (500/oligonucleotide length)⁰ C. With respect to the DNA mimics known as peptide nucleic acids (PNAs) (Nielsen et al., Science. 1991 Dec 6;254(5037): 1497-500) Tm values are higher than those for DNA-DNA or DNA-RNA hybrids, and can be calculated using the formula described in Giesen et al., Nucleic Acids Res. 5 1998 Nov l ;26(21):5004-6. Exemplary stringent hybridization conditions for a DNA-PNA hybrid having a length less than 100 bases are 5 to 10° C below the Tm.

Variant polynucleotides of the present invention also encompasses polynucleotides that differ from the sequences of the invention but that, as a consequence of the degeneracy of the genetic 0 code, encode a polypeptide having similar activity to a polypeptide encoded by a polynucleotide of the present invention. A sequence alteration that does not change the amino acid sequence of the polypeptide is a "silent variation". Except for ATG (methionine) and TGG (tryptophan), other codons for the same amino acid may be changed by art recognized techniques, e.g., to optimize codon expression in a particular host organism.

15

Polynucleotide sequence alterations resulting in conservative substitutions of one or several amino acids in the encoded polypeptide sequence without significantly altering its biological activity are also included in the invention. A skilled artisan will be aware of methods for making phenotypically silent amino acid substitutions (see, e.g., Bowie et al, 1990, Science 247, 1306).

>0

Variant polynucleotides due to silent variations and conservative substitutions in the encoded polypeptide sequence may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.5 [Nov 2002]) from NCBI (ftp://ftp.ncbi.nih.gov/blastΛ via the tblastx algorithm as previously described.

>5

Polypeptide variants

The term "variant" with reference to polypeptides encompasses naturally occurring, recombinantly and synthetically produced polypeptides. Variant polypeptide sequences iO preferably exhibit at least 50%, more preferably at least 51%, more preferably at least 52%, more preferably at least 53%, more preferably at least 54%, more preferably at least 55%, more preferably at least 56%, more preferably at least 57%, more preferably at least 58%, more preferably at least 59%, more preferably at least 60%, more preferably at least 61%, more preferably at least 62%, more preferably at least 63%, more preferably at least 64%, more preferably at least 65%, more preferably at least 66%, more preferably at least 67%, more preferably at least 68%, more preferably at least 69%, more preferably at least 70%, more preferably at least 71%, more preferably at least 72%, more preferably at least 73%, more 5 preferably at least 74%, more preferably at least 75%, more preferably at least 76%, more preferably at least 77%, more preferably at least 78%, more preferably at least 79%, more preferably at least 80%, more preferably at least 81%, more preferably at least 82%, more preferably at least 83%, more preferably at least 84%, more preferably at least 85%, more preferably at least 86%, more preferably at least 87%, more preferably at least 88%, more 0 preferably at least 89%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, and most preferably at least 99% identity to a sequences of the present invention. Identity is found over a comparison window of at least 20 amino acid positions,

15 preferably at least 50 amino acid positions, more preferably at least 100 amino acid positions, and most preferably over the entire length of a polypeptide of the invention.

Polypeptide sequence identity can be determined in the following manner. The subject polypeptide sequence is compared to a candidate polypeptide sequence using BLASTP (from the -0 BLAST suite of programs, version 2.2.5 [Nov 2002]) in bl2seq, which is publicly available from NCBI (ftp://ftp.ncbi.nih.gov/blast/). The default parameters of bl2seq are utilized except that filtering of low complexity regions should be turned off.

Polypeptide sequence identity may also be calculated over the entire length of the overlap >5 between a candidate and subject polynucleotide sequences using global sequence alignment programs. EMBOSS-needle (available at http:/www.ebi. ac.uk/emboss/align/) and GAP (Huang, X. (1994) On Global Sequence Alignment. Computer Applications in the Biosciences 10, 227- 235.) as discussed above are also suitable global sequence alignment programs for calculating polypeptide sequence identity. SO

A preferred method for calculating polypeptide sequence identity is based on aligning sequences to be compared using Clustal W (Thompson et al 1994, Nucleic Acid Res 1 1 (22)4673-4680) Polypeptide variants of the present invention also encompass those which exhibit a similarity to one or more of the specifically identified sequences that is likely to preserve the functional equivalence of those sequences and which could not reasonably be expected to have occurred by random chance. Such sequence similarity with respect to polypeptides may be determined using 5 the publicly available bl2seq program from the BLAST suite of programs (version 2.2.5 [Nov 2002]) from NCBI (ftp://ftp.ncbi.nih.gov/blast/). The similarity of polypeptide sequences may be examined using the following unix command line parameters:

bl2seq -i peptideseql -j peptideseq2 -F F -p blastp 0

Variant polypeptide sequences preferably exhibit an E value of less than 1 x 10 ^"6 more preferably less than 1 x 10 ^"9, more preferably less than 1 x 10 ^~n, more preferably less than 1 x 10 ^"l5, more preferably less than 1 x 10 ^~18, more preferably less than 1 x 10 ^"21, more preferably less than 1 x 10 ^'30, more preferably less than 1 x 10 ^"40, more preferably less than 1 x 10 ^"50, more

15 preferably less than 1 x 10 ^"60, more preferably less than 1 x 10 ^"70, more preferably less than 1 x 10 ^"80, more preferably less than 1 x 10 ^"90 and most preferably IxIO^"100 when compared with any one of the specifically identified sequences.

The parameter -F F turns off filtering of low complexity sections. The parameter -p selects the -O appropriate algorithm for the pair of sequences. This program finds regions of similarity between the sequences and for each such region reports an "E value" which is the expected number of times one could expect to see such a match by chance in a database of a fixed reference size containing random sequences. For small E values, much less than one, this is approximately the probability of such a random match. >5

Conservative substitutions of one or several amino acids of a described polypeptide sequence without significantly altering its biological activity are also included in the invention. A skilled artisan will be aware of methods for making phenotypically silent amino acid substitutions (see, e.g., Bowie et ai, 1990, Science 247, 1306). Constructs, vectors and components thereof

The term "genetic construct" refers to a polynucleotide molecule, usually double-stranded DNA, which may have inserted into it another polynucleotide molecule (the insert polynucleotide molecule) such as, but not limited to, a cDNA molecule. A genetic construct may contain the necessary elements that permit transcribing the insert polynucleotide molecule, and, optionally, translating the transcript into a polypeptide. The insert polynucleotide molecule may be derived from the host cell, or may be derived from a different cell or organism and/or may be a recombinant polynucleotide. Once inside the host cell the genetic construct may become integrated in the host chromosomal DNA. The genetic construct may be linked to a vector.

The term "vector" refers to a polynucleotide molecule, usually double stranded DNA, which is used to transport the genetic construct into a host cell. The vector may be capable of replication in at least one additional host system, such as E. coli.

The term "expression construct" refers to a genetic construct that includes the necessary elements that permit transcribing the insert polynucleotide molecule, and, optionally, translating the transcript into a polypeptide. An expression construct typically comprises in a 5' to 3' direction: a) a promoter functional in the host cell into which the construct will be transformed, b) the polynucleotide to be expressed, and c) a terminator functional in the host cell into which the construct will be transformed.

The term "coding region" or "open reading frame" (ORF) refers to the sense strand of a genomic DNA sequence or a cDNA sequence that is capable of producing a transcription product and/or a polypeptide under the control of appropriate regulatory sequences. The coding sequence is identified by the presence of a 5' translation start codon and a 3' translation stop codon. When inserted into a genetic construct, a "coding sequence" is capable of being expressed when it is operably linked to promoter and terminator sequences. "Operably-linked" means that the sequenced to be expressed is placed under the control of regulatory elements that include promoters, tissue-specific regulatory elements, temporal regulatory elements, enhancers, repressors and terminators.

The term "noncoding region" refers to untranslated sequences that are upstream of the translational start site and downstream of the translational stop site. These sequences are also referred to respectively as the 5' UTR and the 3' UTR. These regions include elements required for transcription initiation and termination and for regulation of translation efficiency.

Terminators are sequences, which terminate transcription, and are found in the 3' untranslated ends of genes downstream of the translated sequence. Terminators are important determinants of mRNA stability and in some cases have been found to have spatial regulatory functions.

The term "promoter" refers to nontranscribed cis-regulatory elements upstream of the coding region that regulate gene transcription. Promoters comprise cis-initiator elements which specify the transcription initiation site and conserved boxes such as the TATA box, and motifs that are bound by transcription factors.

A "transgene" is a polynucleotide that is taken from one organism and introduced into a different organism by transformation. The transgene may be derived from the same species or from a different species as the species of the organism into which the transgene is introduced.

A "transgenic plant" refers to a plant which contains new genetic material as a result of genetic manipulation or transformation. The new genetic material may be derived from a plant of the same species as the resulting transgenic plant or from a different species.

An "inverted repeat" is a sequence that is repeated, where the second half of the repeat is in the complementary strand, e.g.,

(5')GATCTA TAGATC(3')

(3')CTAGAT ATCTAG(5') Read-through transcription will produce a transcript that undergoes complementary base-pairing to form a hairpin structure provided that there is a 3-5 bp spacer between the repeated regions.

The term "regulating anthocyanin production" is intended to include both increasing and decreasing anthocyanin production. Preferably the term refers to increasing anthocyanin production. Anthocyanins that may be regulated include but are not limited to. cyanidin-3- glucoside, cyanidin-3-O-rutinoside, cyanidin-3-galactoside, and cyanidin-3-pentoside; pelargonidin 3-glucoside and pelargonidin 3-rutinoside, delphinidin-3-glucoside and delphinidin- 3-pentoside, malvidin-3-glucoside.

The terms "to alter expression of and "altered expression" of a polynucleotide or polypeptide of the invention, are intended to encompass the situation where genomic DNA corresponding to a polynucleotide of the invention is modified thus leading to altered expression of a polynucleotide or polypeptide of the invention. Modification of the genomic DNA may be through genetic transformation or other methods known in the art for inducing mutations. The "altered expression" can be related to an increase or decrease in the amount of messenger RNA and/or polypeptide produced and may also result in altered activity of a polypeptide due to alterations in the sequence of a polynucleotide and polypeptide produced.

The applicants have identified polynucleotide cDNA sequences (SEQ ID NO: 3 and 4) and polynucleotide genomic sequences (SEQ ID NO: 5 and 6) which encode polypeptides (SEQ ID NO: 1 and 2) from the kiwifruit species Actinidia chinensis and Actinidia deliciosa respectively. The polypeptides are both MYB R2R3 transcription factors that regulate anthocyanin production in plants. The invention provides fragments and variants of the sequences. The polypeptides share 63% sequence identity and are thus variants of each other. The transcription factors also regulate the promoters of genes encoding enzymes in the anthocyanin biosynthetic pathway in plants. A summary of the relationship between the polynucleotides and polypeptides is found in Table 1 (Summary of Sequences).

The invention provides genetic constructs, vectors and plants comprising the polynucleotide sequences. The invention also provides plants comprising the genetic constructs and vectors of the invention. The invention provides plants altered, relative to suitable control plants, in production of anthocyanin pigments. The invention provides both plants with increased and decreased production of anthocyanin pigments. The invention also provides methods for the production of such plants and methods for the selection of such plants.

Suitable control plants may include non-transformed plants of the same species and variety, or plants of the same species or variety transformed with a control construct, such as an empty vector construct.

Uses of the compositions of the invention include the production of fruit, or other plant parts, with altered (increased or decreased) levels of anthocyanin pigmentation, for example production of kiwifruit with red skin and or red flesh.

The invention also provides methods for selecting transformed plant cells and plants by selecting plant cells and plants which have increased anthocyanin pigment, the increased anthocyanic pigment indicating that the plants are transformed to express a polynucleotide or polypeptide of the invention.

Methods for isolating or producing polynucleotides

The polynucleotide molecules of the invention can be isolated by using a variety of techniques known to those of ordinary skill in the art. By way of example, such polypeptides can be isolated through use of the polymerase chain reaction (PCR) described in Mullis et al, Eds. 1994 The Polymerase Chain Reaction, Birkhauser, incorporated herein by reference. The polypeptides of the invention can be amplified using primers, as defined herein, derived from the polynucleotide sequences of the invention.

Further methods for isolating polynucleotides of the invention include use of all, or portions of, the polypeptides having the sequence set forth herein as hybridization probes. The technique of hybridizing labelled polynucleotide probes to polynucleotides immobilized on solid supports such as nitrocellulose filters or nylon membranes, can be used to screen the genomic or cDNA libraries. Exemplary hybridization and wash conditions are: hybridization for 20 hours at 65°C in 5. 0 X SSC, 0. 5% sodium dodecyl sulfate, 1 X Denhardt's solution; washing (three washes of twenty minutes each at 55°C) in 1. 0 X SSC, 1% (w/v) sodium dodecyl sulfate, and optionally one wash (for twenty minutes) in 0. 5 X SSC, 1% (w/v) sodium dodecyl sulfate, at 60°C. An optional further wash (for twenty minutes) can be conducted under conditions of 0. 1 X SSC, 1% (w/v) sodium dodecyl sulfate, at 60°C.

The polynucleotide fragments of the invention may be produced by techniques well-known in the art such as restriction endonuclease digestion, oligonucleotide synthesis and PCR amplification.

A partial polynucleotide sequence may be used, in methods well-known in the art to identify the corresponding full length polynucleotide sequence. Such methods include PCR-based methods, 5'RACE (Frohman MA, 1993, Methods Enzymol. 218: 340-56) and hybridization- based method, computer/database -based methods. Further, by way of example, inverse PCR permits acquisition of unknown sequences, flanking the polynucleotide sequences disclosed herein, starting with primers based on a known region (Triglia et al., 1998, Nucleic Acids Res 16, 8186, incorporated herein by reference). The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template. Divergent primers are designed from the known region. In order to physically assemble full-length clones, standard molecular biology approaches can be utilized (Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987).

It may be beneficial, when producing a transgenic plant from a particular species, to transform such a plant with a sequence or sequences derived from that species. The benefit may be to alleviate public concerns regarding cross-species transformation in generating transgenic organisms. Additionally when down-regulation of a gene is the desired result, it may be necessary to utilise a sequence identical (or at least highly similar) to that in the plant, for which reduced expression is desired. For these reasons among others, it is desirable to be able to identify and isolate orthologues of a particular gene in several different plant species. Variants (including orthologues) may be identified by the methods described. Methods for identifying variants

Physical methods

Variant polypeptides may be identified using PCR-based methods (Mullis et al, Eds. 1994 The Polymerase Chain Reaction, Birkhauser). Typically, the polynucleotide sequence of a primer, useful to amplify variants of polynucleotide molecules of the invention by PCR, may be based on a sequence encoding a conserved region of the corresponding amino acid sequence.

Alternatively library screening methods, well known to those skilled in the art, may be employed (Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987). When identifying variants of the probe sequence, hybridization and/or wash stringency will typically be reduced relatively to when exact sequence matches are sought.

Polypeptide variants may also be identified by physical methods, for example by screening expression libraries using antibodies raised against polypeptides of the invention (Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987) or by identifying polypeptides from natural sources with the aid of such antibodies.

Computer-based methods

The variant sequences of the invention, including both polynucleotide and polypeptide variants, may also be identified by computer-based methods well-known to those skilled in the art, using public domain sequence alignment algorithms and sequence similarity search tools to search sequence databases (public domain databases include Genbank, EMBL, Swiss-Prot, PIR and others). See, e.g., Nucleic Acids Res. 29: 1-10 and 11-16, 2001 for examples of online resources. Similarity searches retrieve and align target sequences for comparison with a sequence to be analyzed (i.e., a query sequence). Sequence comparison algorithms use scoring matrices to assign an overall score to each of the alignments.

An exemplary family of programs useful for identifying variants in sequence databases is the BLAST suite of programs (version 2.2.5 [Nov 2002]) including BLASTN, BLASTP, BLASTX, tBLASTN and tBLASTX, which are publicly available from (ftp://ftp.ncbi.nih.gov/blast/) or from the National Center for Biotechnology Information (NCBI), National Library of Medicine, Building 38A, Room 8N805, Bethesda, MD 20894 USA. The NCBI server also provides the facility to use the programs to screen a number of publicly available sequence databases. BLASTN compares a nucleotide query sequence against a nucleotide sequence database. BLASTP compares an amino acid query sequence against a protein sequence database. BLASTX compares a nucleotide query sequence translated in all reading frames against a protein sequence database. tBLASTN compares a protein query sequence against a nucleotide sequence database dynamically translated in all reading frames. tBLASTX compares the six- frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database. The BLAST programs may be used with default parameters or the parameters may be altered as required to refine the screen.

The use of the BLAST family of algorithms, including BLASTN, BLASTP, and BLASTX, is described in the publication of Altschul et ai, Nucleic Acids Res. 25: 3389-3402, 1997.

The "hits" to one or more database sequences by a queried sequence produced by BLASTN, BLASTP, BLASTX, tBLASTN, tBLASTX, or a similar algorithm, align and identify similar portions of sequences. The hits are arranged in order of the degree of similarity and the length of sequence overlap. Hits to a database sequence generally represent an overlap over only a fraction of the sequence length of the queried sequence.

The BLASTN, BLASTP, BLASTX, tBLASTN and tBLASTX algorithms also produce "Expect" values for alignments. The Expect value (E) indicates the number of hits one can "expect" to see by chance when searching a database of the same size containing random contiguous sequences. The Expect value is used as a significance threshold for determining whether the hit to a database indicates true similarity. For example, an E value of 0.1 assigned to a polynucleotide hit is interpreted as meaning that in a database of the size of the database screened, one might expect to see 0.1 matches over the aligned portion of the sequence with a similar score simply by chance. For sequences having an E value of 0.01 or less over aligned and matched portions, the probability of finding a match by chance in that database is 1% or less using the BLASTN, BLASTP, BLASTX, tBLASTN or tBLASTX algorithm. Multiple sequence alignments of a group of related sequences can be carried out with CLUSTALW (Thompson, J.D., Higgins, D.G. and Gibson, TJ. (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22:4673- 4680, http://www-igbmc.u-strasbg.fr/BioInfo/ClustalW/Top.htmn or T-COFFEE (Cedric Notredame, Desmond G. Higgins, Jaap Heringa, T-Coffee: A novel method for fast and accurate multiple sequence alignment, J. MoI. Biol. (2000) 302: 205-217))or PILEUP, which uses progressive, pairwise alignments. (Feng and Doolittle, 1987, J. MoI. Evol. 25, 351).

Pattern recognition software applications are available for finding motifs or signature sequences. For example, MEME (Multiple Em for Motif Elicitation) finds motifs and signature sequences in a set of sequences, and MAST (Motif Alignment and Search Tool) uses these motifs to identify similar or the same motifs in query sequences. The MAST results are provided as a series of alignments with appropriate statistical data and a visual overview of the motifs found. MEME and MAST were developed at the University of California, San Diego.

PROSITE (Bairoch and Bucher, 1994, Nucleic Acids Res. 22, 3583; Hofmann et ai, 1999, Nucleic Acids Res. 27, 215) is a method of identifying the functions of uncharacterized proteins translated from genomic or cDNA sequences. The PROSITE database (www.expasy.org/prosite) contains biologically significant patterns and profiles and is designed so that it can be used with appropriate computational tools to assign a new sequence to a known family of proteins or to determine which known domain(s) are present in the sequence (Falquet et ah, 2002, Nucleic Acids Res. 30, 235). Prosearch is a tool that can search SWISS-PROT and EMBL databases with a given sequence pattern or signature.

The function of a variant polynucleotide of the invention can be tested for the ability to regulate expression of known anthocyanin biosynthesis genes (e.g. Example 4) or can be tested for the ability to regulate pigment production (e.g. Examples 5 and 6).

Methods for isolating polypeptides

The polypeptides of the invention, including variant polypeptides, may be prepared using peptide synthesis methods well known in the art such as direct peptide synthesis using solid phase techniques (e.g. Stewart et al., 1969, in Solid-Phase Peptide Synthesis, WH Freeman Co, San Francisco California, or automated synthesis, for example using an Applied Biosystems 43 IA Peptide Synthesizer (Foster City, California). Mutated forms of the polypeptides may also be produced during such syntheses. 5

The polypeptides and variant polypeptides of the invention may also be purified from natural sources using a variety of techniques that are well known in the art (e.g. Deutscher, 1990, Ed, Methods in Enzymology, Vol. 182, Guide to Protein Purification,).

10 Alternatively the polypeptides and variant polypeptides of the invention may be expressed recombinantly in suitable host cells and separated from the cells as discussed below.

Methods for producing constructs and vectors

15 The genetic constructs of the present invention comprise one or more polynucleotide sequences of the invention and/or polynycleotides encoding polypeptides of the invention, and may be useful for transforming, for example, bacterial, fungal, insect, mammalian or plant organisms. The genetic constructs of the invention are intended to include expression constructs as herein defined.

>0

Methods for producing and using genetic constructs and vectors are well known in the art and are described generally in Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987 ; Ausubel et al, Current Protocols in Molecular Biology, Greene Publishing, 1987).

>5

Methods for producing host cells comprising polynucleotides, constructs or vectors

The invention provides a host cell which comprises a genetic construct or vector of the invention. Host cells may be derived from, for example, bacterial, fungal, insect, mammalian or 50 plant organisms.

Host cells comprising genetic constructs, such as expression constructs, of the invention are useful in methods well known in the art (e.g. Sambrook et al, Molecular Cloning : A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987 ; Ausubel et al, Current .Protocols in Molecular Biology, Greene Publishing, 1987) for recombinant production of polypeptides of the invention. Such methods may involve the culture of host cells in an appropriate medium in conditions suitable for or conducive to expression of a polypeptide of the invention. The expressed recombinant polypeptide, which may optionally be secreted into the culture, may then be separated from the medium, host cells or culture medium by methods well known in the art (e.g. Deutscher, Ed, 1990, Methods in Enzymology, VoI 182, Guide to Protein Purification).

Methods for producing plant cells and plants comprising constructs and vectors

The invention further provides plant cells which comprise a genetic construct of the invention, and plant cells modified to alter expression of a polynucleotide or polypeptide of the invention. Plants comprising such cells also form an aspect of the invention.

Production of plants altered in pigment production may be achieved through methods of the invention. Such methods may involve the transformation of plant cells and plants, with a construct of the invention designed to alter expression of a polynucleotide or polypeptide capable of regulating pigment production in such plant cells and plants. Such methods also include the transformation of plant cells and plants with a combination of the construct of the invention and one or more other constructs designed to alter expression of one or more polypeptides or polypeptides capable of regulating pigment production in such plant cells and plants.

Methods for transforming plant cells, plants and portions thereof with polypeptides are described in Draper et al, 1988, Plant Genetic Transformation and Gene Expression. A Laboratory ManuaL Blackwell Sci. Pub. Oxford, p. 365; Potrykus and Spangenburg, 1995, Gene Transfer to Plants. Springer- Verlag, Berlin.; and Gelvin et al, 1993, Plant Molecular Biol. Manual. Kluwer Acad. Pub. Dordrecht. A review of transgenic plants, including transformation techniques, is provided in Galun and Breiman, 1997, Transgenic Plants. Imperial College Press, London.

Methods for genetic manipulation of plants

A number of plant transformation strategies are available (e.g. Birch, 1997, Ann Rev Plant Phys Plant MoI Biol, 48, 297). For example, strategies may be designed to increase expression of a polynucleotide/polypeptide in a plant- cell, organ and/or at a particular developmental stage where/when it is normally expressed or to ectopically express a polynucleotide/polypeptide in a cell, tissue, organ and/or at a particular developmental stage which/when it is not normally expressed. The expressed polynucleotide/polypeptide may be derived from the plant species to be transformed or may be derived from a different plant species.

Transformation strategies may be designed to reduce expression of a polynucleotide/polypeptide in a plant cell, tissue, organ or at a particular developmental stage which/when it is normally expressed. Such strategies are known as gene silencing strategies.

Genetic constructs for expression of genes in transgenic plants typically include promoters for driving the expression of one or more cloned polynucleotide, terminators and selectable marker sequences to detest presence of the genetic construct in the transformed plant.

The promoters suitable for use in the constructs of this invention are functional in a cell, tissue or organ of a monocot or dicot plant and include cell-, tissue- and organ-specific promoters, cell cycle specific promoters, temporal promoters, inducible promoters, constitutive promoters that are active in most plant tissues, and recombinant promoters. Choice of promoter will depend upon the temporal and spatial expression of the cloned polynucleotide, so desired. The promoters may be those normally associated with a transgene of interest, or promoters which are derived from genes of other plants, viruses, and plant pathogenic bacteria and fungi. Those skilled in the art will, without undue experimentation, be able to select promoters that are suitable for use in modifying and modulating plant traits using genetic constructs comprising the polynucleotide sequences of the invention. Examples of constitutive plant promoters include the CaMV 35S promoter, the nopaline synthase promoter and the octopine synthase promoter, and the Ubi 1 promoter from maize. Plant promoters which are active in specific tissues, respond to internal developmental signals or external abiotic or biotic stresses are described in the scientific literature. Exemplary promoters are described, e.g., in WO 02/00894, which is herein incorporated by reference.

Exemplary terminators that are commonly used in plant transformation genetic construct include, e.g., the cauliflower mosaic virus (CaMV) 35S terminator, the Agrobacterium tumefaciens nopaline synthase or octopine synthase terminators, the Zea mays zein gene terminator, the Oryza sativa ADP-glucose pyrophosphorylase terminator and the Solarium tuberosum PI-II terminator.

Selectable markers commonly used in plant transformation include the neomycin 5 phophotransferase II gene (NPT II) which confers kanamycin resistance, the aadA gene, which confers spectinomycin and streptomycin resistance, the phosphinothricin acetyl transferase {bar gene) for Ignite (AgrEvo) and Basta (Hoechst) resistance, and the hygromycin phosphotransferase gene ( hpt) for hygromycin resistance.

10 Use of genetic constructs comprising reporter genes (coding sequences which express an activity that is foreign to the host, usually an enzymatic activity and/or a visible signal (e.g., luciferase, GUS, GFP) which may be used for promoter expression analysis in plants and plant tissues are also contemplated. The reporter gene literature is reviewed in Herrera-Estrella et ah, 1993, Nature 303, 209, and Schrott, 1995, In: Gene Transfer to Plants (Potrykus, T., Spangenberg. Eds)

15 Springer Verlag. Berline, pp. 325-336.

Gene silencing strategies may be focused on the gene itself or regulatory elements which effect expression of the encoded polypeptide. "Regulatory elements" is used here in the widest possible sense and includes other genes which interact with the gene of interest.

>0

Genetic constructs designed to decrease or silence the expression of a polynucleotide/polypeptide of the invention may include an antisense copy of a polynucleotide of the invention. In such constructs the polynucleotide is placed in an antisense orientation with respect to the promoter and terminator.

>5

An "antisense" polynucleotide is obtained by inverting a polynucleotide or a segment of the polynucleotide so that the transcript produced will be complementary to the mRNA transcript of the gene, e.g., 5'GATCTA 3' (coding strand) 3'CTAGAT 5' (antisense strand)

JO 3'CUAGAU 5' mRNA 5'GAUCUCG 3' antisense RNA Genetic constructs designed for gene silencing may also include an inverted repeat. An 'inverted repeat' is a sequence that is repeated where the second half of the repeat is in the complementary strand, e.g.,

5'-GATCTA TAGATC-3'

3'-CTAGAT ATCTAG-5'

The transcript formed may undergo complementary base pairing to form a hairpin structure. Usually a spacer of at least 3-5 bp between the repeated region is required to allow hairpin formation.

Another silencing approach involves the use of a small antisense RNA targeted to the transcript equivalent to an miRNA (Llave et al, 2002, Science 297, 2053). Use of such small antisense RNA corresponding to polynucleotide of the invention is expressly contemplated.

The term genetic construct as used herein also includes small antisense RNAs and other such polypeptides effecting gene silencing.

Transformation with an expression construct, as herein defined, may also result in gene silencing through a process known as sense suppression (e.g. Napoli et al., 1990, Plant Cell 2, 279; de

Carvalho Niebel et al., 1995, Plant Cell, 7, 347). In some cases sense suppression may involve over-expression of the whole or a partial coding sequence but may also involve expression of non-coding region of the gene, such as an intron or a 5' or 3' untranslated region (UTR).

Chimeric partial sense constructs can be used to coordinately silence multiple genes (Abbott et al, 2002, Plant Physiol. 128(3): 844-53; Jones et al, 1998, Planta 204: 499-505). The use of such sense suppression strategies to silence the expression of a polynucleotide of the invention is also contemplated.

The polynucleotide inserts in genetic constructs designed for gene silencing may correspond to coding sequence and/or non-coding sequence, such as promoter and/or intron and/or 5' or 3' UTR sequence, or the corresponding gene. Other gene silencing strategies include dominant negative approaches and the use of ribozyme constructs (Mclntyre, 1996, Transgenic Res, 5, 257)

Pre-transcriptional silencing may be brought about through mutation of the gene itself or its regulatory elements. Such mutations may include point mutations, frameshifts, insertions, deletions and substitutions.

The following are representative publications disclosing genetic transformation protocols that can be used to genetically transform the following plant species: Rice (Alam et al, 1999, Plant Cell Rep. 18, 572); apple (Yao et al, 1995, Plant Cell Reports 14, 407-412); maize (US Patent Serial Nos. 5, 177, 010 and 5, 981, 840); wheat (Ortiz et al., 1996, Plant Cell Rep. 15, 1996, 877); tomato (US Patent Serial No. 5, 159, 135); potato (Kumar et al, 1996 Plant J. 9, : 821); cassava (Li et al, 1996 Nat. Biotechnology 14, 736); lettuce (Michelmore et al, 1987, Plant Cell Rep. 6, 439); tobacco (Horsch et al., 1985, Science 227, 1229); cotton (US Patent Serial Nos. 5, 846, 797 and 5, 004, 863); grasses (US Patent Nos. 5, 187, 073 and 6. 020, 539); peppermint (Niu et al, 1998, Plant Cell Rep. 17, 165); citrus plants (Pena et al, 1995, Plant Sci.104, 183); caraway (Krens et al., 1997, Plant Cell Rep, 17, 39); banana (US Patent Serial No. 5, 792, 935); soybean (US Patent Nos. 5, 416, 011 ; 5, 569, 834 ; 5, 824, 877 ; 5, 563, 04455 and 5, 968, 830); pineapple (US Patent Serial No. 5, 952, 543); poplar (US Patent No. 4, 795, 855); monocots in general (US Patent Nos. 5, 591, 616 and 6, 037, 522); brassica (US Patent Nos. 5, 188, 958 ; 5, 463, 174 and 5, 750, 871); cereals (US Patent No. 6, 074, 877); pear (Matsuda et al., 2005, Plant Cell Rep. 24(1):45-51); Prunus (Ramesh et al., 2006, Plant Cell Rep. 25(8):821-8; Song and Sink 2005, Plant Cell Rep. 2006; 25(2): 117-23; Gonzalez Padilla et al., 2003, Plant Cell Rep. 22(l):38-45); strawberry (Oosumi et al., 2006, Planta.; 223(6):1219-30; Folta et al., 2006, Planta. 2006 Apr 14; PMID: 16614818), rose (Li et al., 2003, Planta. 218(2):226-32), and Rubus (Graham et al., 1995, Methods MoI Biol. 1995;44: 129-33). Transformation of other species is also contemplated by the invention. Suitable methods and protocols for transformation of other species are available in the scientific literature.

Several further methods known in the art may be employed to alter expression of a nucleotide and/or polypeptide of the invention. Such methods include but are not limited to Tilling (Till et al, 2003, Methods MoI Biol, 2%, 205), so called "Deletagene" technology (Li et al, 2001, Plant Journal 27(3), 235) and the use of artificial transcription factors such as synthetic zinc finger transcription factors, (e.g. Jouvenot et al, 2003, Gene Therapy 10, 513). Additionally antibodies or fragments thereof, targeted to a particular polypeptide may also be expressed in plants to modulate the activity of that polypeptide (Jobling et al, 2003, Nat. Biotechnol., 21(1), 35). Transposon tagging approaches may also be applied. Additionally peptides interacting with a polypeptide of the invention may be identified through technologies such as phase-display (Dyax Corporation). Such interacting peptides may be expressed in or applied to a plant to affect activity of a polypeptide of the invention. Use of each of the above approaches in alteration of expression of a nucleotide and/or polypeptide of the invention is specifically contemplated.

Methods of selecting plants

Methods are also provided for selecting plants with altered pigment production. Such methods involve testing of plants for altered for the expression of a polynucleotide or polypeptide of the invention. Such methods may be applied at a young age or early developmental stage when the altered pigment production may not necessarily be visible, to accelerate breeding programs directed toward improving anthocyanin content.

The expression of a polynucleotide, such as a messenger RNA, is often used as an indicator of expression of a corresponding polypeptide. Exemplary methods for measuring the expression of a polynucleotide include but are not limited to Northern analysis, RT-PCR and dot-blot analysis (Sambrook et al. , Molecular Cloning : A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987). Polynucleotides or portions of the polynucleotides of the invention are thus useful as probes or primers, as herein defined, in methods for the identification of plants with altered levels of anthocyanin. The polypeptides of the invention may be used as probes in hybridization experiments, or as primers in PCR based experiments, designed to identify such plants.

Alternatively antibodies may be raised against polypeptides of the invention. Methods for raising and using antibodies are standard in the art (see for example: Antibodies, A Laboratory Manual, Harlow A Lane, Eds, Cold Spring Harbour Laboratory, 1998). Such antibodies may be used in methods to detect altered expression of polypeptides which modulate flower size in plants. Such methods may include ELISA (Kemeny, 1991, A Practical Guide to ELISA, NY Pergamon Press) and Western analysis (Towbin & Gordon, 1994, J Immunol Methods, 72, 313). These approaches for analysis of polynucleotide or polypeptide expression and the selection of plants with altered expression are useful in conventional breeding programs designed to produce varieties with altered pigment production.

Plants

The plants of the invention may be grown and either self-ed or crossed with a different plant strain and the resulting hybrids, with the desired phenotypic characteristics, may be identified. Two or more generations may be grown to ensure that the subject phenotypic characteristics are stably maintained and inherited. Plants resulting from such standard breeding approaches also form an aspect of the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS

The present invention will be better understood with reference to the accompanying drawings in which:

Figure 1 shows an alignment of the kiwifruit MYBlO protein sequences with other MYB sequences reported to be involved in anthocyanin production.

Figure 2 shows a bootstrap phylogenetic analysis of the kiwifruit MYBlO protein sequences with other MYB sequences involved in anthocyanin production.

Figure 3 shows % identity of kiwifruit MYBlO proteins with other anthocyanin related MYB transcription factors.

Figure 4 shows the results of transformation of constructs expressing the kiwifruit MYBlO protein (AcMYBlO) and AtMYB75 (PAPl) and a control (pHEX) in transgenic Arabidopsis (plant and seeds) and tobacco (leaves). Also shown are the results of transient transformation of tobacco with or without the Arabidopsis BHLH gene (AtbHLHl). Figure 5 shows that overexpression of AcMYBlO in kiwifruit plants {Actinidia eriantha) drives an elevation of anthocyanin. Both flowers (A), leaves (B) and the vine (C) are redder (due to elevated cyanidin glycoside) than wild type (WT).

Figure 6 shows trans-activation assays where the kiwifruit (AcMYBlO) or Arabidopsis (AtMYB75) MYB genes were infiltrated into N. benthamiana leaves either with or without the Arabidopsis AtBHLHl gene. Trans-activation of a promoter- LUC reporter cassettes was measured. The promoter used in each cassette fused to the LUC coding sequence were chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), dihydroflavonol reductase (DFR), leucoanthocyanidin dioxygenase (LDOX), UDP glucose flavonoid glucosyl-transferase (UFGT) and Glutathione- S -transferase (GST).

Figure 7 shows in A a schematic representation of fusion proteins F1-F6 between the kiwifruit AcMYBlO protein and the Arabidopsis AtMYB75 (PAPl) protein; B shows a hydrophobicity plot for each of AcMYBlO and AtMYB75 at pH 3.4.; C shows the results of transient expression of fusion protein Fl to F6 in tobacco.

Figure 8 shows primers designed to allelic differences in AcMYBlO segregate for skin colour in an Actinidia intraspecies cross (A). Red progeny always have the 419 allele, while this is missing in yellow skinned progeny (B and C). These primers can therefore be used for mapping of fruit colour.

Figure 9 shows that overexpression of AcMYBlO in kiwifruit plants (Actinidia chinesis) drives an elevation of anthocyanin. Both leaves (A), flowers (C) and the fruit (E) are redder (due to elevated cyanidin glycoside) than wild type (B, D, and F respectively). Leaf pigment was extracted and absorbance at 520 nm show massive elevation of anthocyanin.

EXAMPLES

The invention will now be illustrated with reference to the following non-limiting examples. Example 1: Isolation and characterisation of R2R3 MYB transcription factors of the invention.

An extensive collection of EST sequence from Actinidia species was developed by the applicants. The libraries were generated in a similar manner to the EST collection from Malus (Newcomb et al. 2006). BLAST analysis (Altschul et al. 1990) of the Actinida EST database revealed numerous tentative contigs with sequence similarity to the MYB class of transcription factor.

Of these, the applicants identified two sequence contigs from Actinidia chinensis and Actinidia deliciosa respectively potentially encoding MYB transcription factors involved in anthocyanin production. The sequences appear to encode R2R3 type MYB transcription factors. The sequence showed similarity to the subgroup 10 MYB genes (Stracke et al. 2001), previously reported to be associated with anthocyanin regulation.

The sequence of the A. chinensis cDNA is shown in SEQ ID NO: 3 and encodes the protein of SEQ ID NO: 1. The applicants designated this sequence AcMYBlO. The genomic sequence is shown in SEQ ID NO: 4.

The sequence of the A. deliciosa cDNA is shown in SEQ ID NO: 5 encodes the protein of SEQ ID NO: 2. The applicants designated this sequence AdMYBlO. The genomic sequence is shown in SEQ ID NO: 6.

Figure 1 shows the alignment of the amino acid sequences of the two kiwifruit MYB transcription factors from A. chinensis (AcMYBlO) and A. deliciosa (AdMYBlO) with other MYB sequences reported to be involved with anthocyanin biosynthesis in plants and highlights the position of the R2R3 domains. Phylogenic analysis was preformed using ClustalW in the Align-X (=0.15, =0.3).

Regions of homology that lie within the R2R3 domain were used to determine the phylogenetic relationship between these related MYB sequences. Figure 2 shows Minimum Evolutionary phylogeny reconstructions with bootstraps (with 1000 replicates) performed using MEGA 3.1 (Kumar, Tamura, Nei 2004). Regions of homology were extracted from full length amino acid sequences before phylogenic relationships were determined. Coding sequence of MYB genes Antirrhinum; AmROSEAl [ABB83826], AmR0SEA2 [ABB83827], Arabidopsis; AtMYB75 [NP176057], AtMYB90 [NP176813], AtMYBl 13 [NP176811], Grape; VvMYB-Al [BAD18977], VvMYB-A2 [BAD18978], Petunia; AN2 [AF146702] and Capsicum; CaA [CAE75745], MdMYBlO [DQ267896], AcMYBlO [SEQ ID NO: 3] and AdMYBlO [SEQ ID NO: 5] were used.

Figure 3 shows the % identity over the whole length of the proteins of the kiwifruit protein sequences compared with other MYB sequences involved in anthocyanin biosynthesis.Percent sequence identity was calculated after aligning the sequences with several other MYB sequences involved in anthocyanin regulation using Clustal W (Thompson et al 1994, Nucleic Acid Res 11 (22)4673-4680). Percent identity between the protein sequences is shown in Figure 3.

Example 2: Increase in anthocyanin production in plants by transient expression of the kiwifruit MYB transcription factor of the invention in tobacco plants.

To test the ability of the kiwifruit MYB gene; AcMYBlO, to regulate anthocyanin biosynthesis in plants, transient assays were performed in Nicotiana tobaccum

Vector construction

Sequences encoding AcMYBlO (SEQ ID NO: 3), AtMYB75 (SEQ ID NO: 20) and AtBHLHl (SEQ ID NO: 14) were cloned into pSAK7, pHEX2 or pGreenll as previously described (Hellens et al. 2005)

Transient transformation

The vectors were introduced into Agrbacterium GV3101MP90 (Koncz & Schell 1986) by electorporation and culturedon Lennox agar (Invitrogen) supplemented with 50 μg.ml-1 kanamycin (Sigma) and incubated at 28°C. A 10 μl loop of confluent bacterium were re- suspended in 10 ml of infiltration media (10 mM MgC12, 0.5 μM acetosyringone), to an OD600 of 0.2, and incubated at room temperature without shaking for 2 h before infiltration. Transient transformation of Nicotiana tobaccum and Nicotiana benthamiana were performed as previously described (Voinnet et al. 2003). Approximately 300 μl of this Agrobacterium mixture was infiltrated into a young leaf and transient expression was assayed from three to 14 days after inoculation.

Results

Figure 4 shows infiltrated patches photographed 7 days after infiltration. Expression of AcMYBlO alone resulted in infiltrated patches with significantly enhanced anthocyanin. By contrast, the corresponding Arabidopsis gene AtMYB75, only produces visible levels of anthocyanin when co-infiltrated with AtBHLHl [At5g41315]. Exogenous BHLH was also needed in tobacco transient infiltration assays for the apple MdMYBlO to produce anthocyanin pigmentation (Espley et al. 2007).

This data shows that the kiwifruit MYBlO sequence is able to positively regulate anthocyanin production in hetrologous plant species. The data also shows that the kiwifruit MYBlO can function independently of exogenously supplied BHLH in tobacco, and suggests that the kiwifruit gene may have an altered requirement or affinity for BHLH, relative to both Arabidopsis AtMYB75 and apple MdMYBlO.

Example 3: Increase in anthocyanin production in plants by stable transformation and expression of the kiwifruit MYB transcription factor of the invention in tobacco plants.

Vector construction

Sequences encoding AcMYBlO (SEQ ID NO: 3) and AtMYB75 (SEQ ID NO: 20) were cloned into pSAK7, pHEX2 or pGreenll as previously described (Hellens et al. 2005)

Transformation of Nicotiana tabacum

Seeds of Nicotiana tabacum cultivar 'Samsun' were surface sterilized and germinated on 1/2 MS basal salt and vitamins (Duchefa) + 2% sucrose + 0.7% agar (Germantown) (pH5.7) medium. Seedlings were subcultured onto fresh medium every four weeks. Agrobacterium tumefaciens strain GV3101 harbouring the binary plasmid pHex was used for transformation. Plasmid pHex contains a nopaline synthase promoter-driven neomycin phophotransferase II (nptll) gene that confers kanamycin resistance, and a CaMV 35D promoter driving AdMYBlO or AcMYBlO. Agrobacterium culture was grown in 30 ml of LB (Invitrogen) + 50mg/L Spectinomycin + 10mg/L Gentamycin + 25mg/L Rifampicin broth overnight at 28°C in an incubator-shaker. Overnight culture was centrifuged at 4500 rpm for 10 min and the pellet was resuspended in 20ml MS liquid medium.

Young leaves excised from in vitro grown shoots were cut into ~~lx2 mm leaf strips. Leaf strips were immerse in Agrobacterium culture for 10 min, then blotted dry with sterile filter paper. Inoculated leaf strips were transferred onto co-cultivation medium MS basal salts and vitamins (Duchefa) + 3% sucrose + 0.7% agar (Germantown) + lmg/L BAP (6-benzylaminopurine) + 0.1mg/L NAA (α-Naphtalene acetic acid) + lOOμM Acetosyringone, and incubated at 25°C for 2 days with 16h photoperiod. After co-cultivation, the leaf strips were transferred onto regeneration and selection medium MS basal salts and vitamins (Duchefa) + 3% sucrose + 0.7% agar (Germantown) + lmg/L BAP + 0.1mg/L NAA + 300mg/L Tinientin + 150mg/L Kanamycin. Adventitious buds were initiated from the calli formed on the leaf strips at four weeks post the inoculation. Only one adventitious bud was selected and isolated from each callus, and transferred onto elongation medium MS basal salts and vitamins (Duchefa) + 3% sucrose + 0.7% agar (Germantown) + 300mg/L Timentin + 150mg/L Kanamycin to ensure each shoot or transgenic line represent an independent transformation event. Three to four weeks later, elongated shoots were excised and transferred onto rooting medium MS basal salts and vitamins (Duchefa) + 3% sucrose + 0.7% agar (Germantown) + 300mg/L Timentin + 150mg/L Kanamycin. Once roots were established, rooted plants were transplanted to soil pots with full potting mix, and placed in a misting chamber for a week before moved to a non-misting room in a containment greenhouse under natural sunlight condition.

Results

Figure 4 shows that the resulting transgenic tobacco plants were highly pigmented. All parts of the transgenic tobacco plants, including roots, stems, leaves, flowers and seeds showed elevated levels of anthocyanin. Example 4: Increase in anthocyanin production in plants by stable transformation and expression of the kiwifruit MYB transcription factor of the invention in Arabidopsis plants.

Vector construction

The vectors described in Example 2 were also used for Arabidopsis transformation.

Transformation of Arabidopsis

Arabidopsis was transformed with the floral dip method (Clough & Bent 1998).

Results

Several independent lines of transgenic Arabidopsis expressing either the kiwifruit MYB gene AcMYBlO (SEQ ID NO: 1) or the Arabidopsis MYB gene AtMYB75 were generated. Expression of AcMYB 10 resulted in an increase in anthocyanin accumulation in the mid- veins of the rosette leaves. The seeds from these transgenic AcMYB 10-expressing lines were altered in their pigmentation in the testa, though to a lesser extent than the corresponding line over- expressing the Arabidopsis AtMYB75 gene.

Example 5: Increase in anthocyanin production in plants by stable transformation and expression of the kiwifruit MYB transcription factor of the invention in kiwifruit plants.

Vector construction

The vectors described in Example 2 were also used for kiwifruit transformation.

Transformation of kiwifruit

Kiwifruit was transformed according to Wang et. al 2006. Transgenic kiwifruit plants over-expression the AcMYBlO gene were generated and over 10 independent line analysed. The AcMYBlO gene was transformed into two Actinidia species: A. chinensis and A. eriantha.

Anthocyanin measurement

Plant issue was extracted (Ig sample) with 5ml of ethanol-1.5N HCl (85: 15), and ImI taken for reading on a spectrophotometer (Lees and Francis 1972). Absorbance at 535 nm = R Total anthocyanin = R / (98.2 * 0.2) mg of pigment / Ig of sample *The factor 98.2 is the Elcm, 535 value for the acid-ethanol solvent

Results

As exemplified in Figure 5, all transgenic A. chinensis plants showed altered levels of anthocyanin in leaves, roots and stems. A. eriantha plants also showed altered anthocyanin production noticeable as an increase in anthocyanin accumulation in the mid-rib and leaf veins.

As shown in Figure 9, overexpression of AcMYBlO in kiwifruit plants {Actinidia chinesis) drives an elevation of anthocyanin. Both leaves (A), flowers (C) and the fruit (E) are redder (due to elevated cyanidin glycoside) than wild type (B, D, and F respectively). Leaf pigment was extracted and absorbance at 520 nm show massive elevation of anthocyanin.

Example 6: Positive regulation of the promoters of anthocyanin biosynthetic genes by transient expression of the MYB transcription factors of the invention in plants.

The applicants isolated the promoters from all of the key biosynthetic steps in anthocyanin biosyntheses pathway in Arabidopsis, made promoter-LUC fusions and performed transient infiltration assays in N. benthamiana leaves.

Vector construction

A 1.26 kb fragment of sequence upstream of the AtDFR gene (At5g42800) was isolated from Arabidopsis ecotype Columbia by PCR with pwo polymerase (Roche) RPH-294 GAACGAGATTGGTACCACCTTCGCCTCTG (SEQ ID NO: 15) and RPH-295 CTGACTAACCATGGTTGTGGTTATATG (SEQ ID NO: 16), introducing a Kpnl site at the 5' and Ncol site at the ATG of the DFR promoter (SEQ ID NO: 9). The fragment was inserted into pGreenll 0800-LUC (Hellens et al 2005). In the same way promoters for the other biosynthetic gene (CHS [SEQ ID NO: 7], F3H [SEQ ID NO: 8], LDOX [SEQ ID NO: 10], UFGT [SEQ ID NO: 11] and GST [SEQ ID NO: 12]) were isolated from Arabidopsis and cloned into pGreenO8OO-LUC. EST' s and publically available GATEWAY compatible clones were fused to the 35S promoter in binary vectors as described previously (Hellens at al 2006).

Transient transformation and assays

Transcription factors and reporter constructs were electroporated into GV3101(MP90) and infiltrated into Nicotiana benthaniama leaves as previously described (Hellens at al. 2005). After 3 days, 3 mm leaf pieces were collected in 50 μl of PBS (137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, pH 7.4) and a translucent 96 well plate. Firefly luciferase (LUC) and renillia luciferase (REN) measurements were determined with the Duel Glow™ reagents (Promega) with the following settings of a ORIONII luminometer (Berthold) [(1) dispense 50 μl of LAR into each well, (2) shake for 10 seconds, (3) wait for 10 mins, (4) measure RLU in each well for 10 seconds, (5) dispense 50 μl of STOP & GLOW® into each well (6) shake for 10 seconds, (7) wait for 10 mins, (8) measure RLU in each well for 10 seconds]. Assays were performed with and without co-expression of the Arabidopsis gene AtBHLHl (SEQ ID NO: 13).

Results

As shown in Figure 6, all of the anthocyanin biosynthetic gene promoters tested were activated by expression of the kiwifruit sequence AcMYBlO (SEQ ID NO: 1). In addition, activation of all promoters except F3H was further enhanced by co-expression of the AtBHLHl gene.

In contrast expression of AtMYB75 activated all promoters except CHS. Co-expression of AtBHLHl (together with AtMYB75) resulted in enhanced activation of the CHS, DFR, UFGT and GST promoters; but no enhanced activation of the F3H or LDOX promoters. For three of the promoters: CHS, F3H and DFR, the level of activation by the kiwifruit AcMYBlO gene alone was higher then that of the AtMYB75 gene alone. This was most noticeable in the F3H promoter where the level to activation was almost 3 times higher with AcMYBlO then with AtMYB75. Only the LUC promoter showed a higher level of activation by AtMYB75 than the AcMYBlO.

These results demonstrate the function of AcMYBlO in activation of the promoters of anthocyanin biosynthetic genes. The results also demonstrate differences between the AcMYBlO and AtMYB75 sequences in the level activation and specificity for promoter activation, and differences combinational effects of co-expression of BHLH.

Example 7: Identification of sequence elements in the kiwifruit MYB transcription factor of the invention important for regulation of anthocyanin production in plants.

Example 2 showed that expression AcMYBlO alone resulted in accumulation of anthocyanin in tobacco, whereas expression of AtMYB75 did not unless AtMYB75 was co-expressed with AtBHLHl.

In order to identify sequence elements within the kiwifruit MYB important for anthocyanin production in transgenic plants, six fusion proteins were constructed that sequentially replaced regions of AcMYBlO protein with the corresponding sequence from AtMYB75, as shown in Figure 7A.

Production of fusion protein constructs

A binary vector containing a 35S-CaMV expression cassette and a tandem repeat of AtMYB75 and AcMYBlO was generated in two stages. Firstly, the NptW gene was excised from pGreenll 0029 62-AcMYBlO using a Kpnl/Sphl restriction digest to form the smaller gene construct pGreen II 0029 62-AcMYBlO (-NptII). Secondly a 743bp AtMYB75 fragment was isolated from cDNA clone (Hellens at al. 2005) with Platinum Taq DNA polymerase (Invitrogen) and KMBOOl 5' -GGTGTAGTGTAGG ATCCTGG A AAGTG-3' (SEQ ID NO: 12) and KMB002 5'- TTTTTGCAGACTGAATTCCATCTAATAT-3' (SEQ ID NO: 13), introducing a BamUl site 5 'of ATG of the AtMYB75 ORF and an EcoRl site 3 'of the AtMYB75 ORF. The fragment was inserted into BamUl/EcoRl cut pGreen II 0029 62-AcMYBlO {-nptlY) to form a tandem gene construct pGreen II 0029 62-AcMYB10(-«prtI)/AtMYB75. A series of 6 reverse primers Fl to F6 (see below) were designed at specific intervals between functional domains, along pGreen II 0029 62-AcMYB10-nptII/AtMYB75, with each oligonuceotide of the primer pair positioned at the same relative transcriptional position, but on the consecutive MYB genes. A series of 6 deletion products were amplified from pGreenll 0029 62 AcMYB 10(-nptII)/AtMYB75 using Primestar HS DNA Polymerase (TAKARA) and primers Fl to F6 were re-circularized to form the fusion MYB gene constructs Fl to F6 (Figure 8A).

Hydrophobicity indices for AdMYBlO and AtMYB75 at ph 3.4 determined by HPLC, were estimated according to Cowan and Whittaker (Weighted average: min=0, max=5 and a window size of 21), and visualised using AlignX (Invitrogen). Results are shown in Figure 8B.

Results

As shown in Example 2, in transient infiltrated patches in tobacco leaves, the AcMYBlO gene was able to up regulate the accumulation of anthocyanin in the absence of exogenous BHLH whereas AtMYB75 was not.

The Fl fusion that replaced a small N-terminal region prior to the R2R3 domain of the kiwifruit MYB with the corresponding region from the Arabidopsis gene (Figure 7A) is still able to up- regulate anthocyanin accumulation in tobacco leaves (Figure 7C). As is the F2 fusion that additionally contains further AtMYB75 sequence from the beginning of the R2 domain. For all subsequent fusions, F3 to F6, activation of anthocyanin productions ceases.

This data suggests that sequence elements required for anthocyanin production in tobacco are found in the AcMYBlO sequence present in F2 but removed in F3. This sequence region is shown in SEQ ID NO: 19. Example 8: Genetic evidence for association of the MYB transcription factor of the invention with anthocyanin production in the fruit of kiwifruit population segregating for fruit colour.

A cross between A. macrosperma and A. melanandra was analysed for the inheritance of the homologous MYBlO gene. These species of kiwifruit show highly pigmented skin (Figure 8A).

Plant material and DNA extraction

DNA was extracted from leaf tissue of the parents of an interspecific cross between A. macrosperma and A. melanandra, and each progeny genotype which showed segregation for fruit colour of red or yellow. Each sample was ground to powder in liquid nitrogen then processed through a DNeasy Plant Mini Kit (Qiagen™), according to the manufacturer's instructions. The volume of the eluate was 200μl, and 5μl of a one in ten dilution of each eluate was used in a PCR reaction.

PCR amplification and electrophoresis

A reaction mixture of 15μl containing 1 x PCR buffer (20 mM Tris-HCl, 50 mM KCl), MgCl₂ 5 mM (the buffer and MgCl₂ were those supplied with the polymerase), 0.2 mM each of dNTPs, 4.5 pmol of each primer, and 1.25 units of Platinum Taq polymerase (Invitrogen), was prepared for each DNA sample. About 12.5 ng of genomic DNA was added in 5 μl to bring the total PCR volume to 20 μl. PCRs were performed in a Techne™ Genius thermal cycler with a single cycle of 94°C for 3 min preceding 35 cycles of denaturing at 94°C for 30 sec, annealing at 57°C for 30 sec, and elongation at 72°C for 1 min. PCR reactions were carried out with the primers labelled with 6FAM, (Applied Biosystems). The allelic content of each genotype was determined by capillary electrophoresis in an ABI Prism® 3100 Genetic Analyzer (Filter Set D, ROX™ size standard), and analysed with GeneMapper™ Software Version 3.0 (Applied Biosystems).

Results

The MYB gene marker was found to segregate with fruit colour phenotype in the progeny (Figure 8B]. All the orange-coloured progeny (7 out of 30) had a single allele, 412, while the red-purple-coloured parent, A melanandra, and progeny carried two alleles; one allele 412 and a second allele, 419 (Figure 8B). When an individual carried either both alleles, or allele 419 alone, then the fruit were red. If only allele 412 was present, then the fruit were yellow. Allele 419 was a dominant allele conferring a red phenotype. Although this is a small population and not all of the individuals in this cross are available for molecular examination, the data from this strongly suggests that one of the AmeMYBlO alleles is responsible for red-skinned and red- fleshed phenotype. This data therefore provides genetic evidence for a correlation between the kiwifruit MYB transcription factor of the invention and anthocyanin production in the fruit of kiwifruit.

References

Aharoni A., De Vos C.H., Wein M., Sun Z., Greco R., Kroon A., MoI J.N., O/Connell A.P.

(2001) The strawberry FaMYBl transcription factor suppresses anthocyanin and flavonol accumulation in transgenic tobacco. Plant J. 28, 319-32 Altschul S.F., Gish W., Miller W., Meyers E.W., Lipman D. J. (1990) Basic Local Alignment

Search Tool. J. MoI Bio 215: 403-410 Baudry, A., Heim, M.A., Dubreucq, B., Caboche, M., Weisshaar, B. and Lepiniec, L.

(2004) TT2, TT8, and TTGl synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana. Plant J. 39, 366-380 Borevitz, J.O., Xia, Y., Blount, J., Dixon, R.A. and Lamb, C. (2000) Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell, 12,

2383-2394 Boss, P.K., Davies, C. and Robinson, S.P. (1996) Expression of anthocyanin biosynthesis pathway genes in red and white grapes. Plant MoI. Biol. 32, 565-569 Boyer, J. and Liu, R. (2004) Apple phytochemicals and their health benefits. Nutrition J. 3, 5 Brooks, R.M. and Olmo, H.P. 1972. Register of New Fruit and Nut Varieties. University of

California Press, London. Brouillard, R. (1988) Flavonoids and flower colour. In JB Harborne, ed, The Flavonoids:

Advances in Research since 1980. Chapman & Hall, London, pp 525-538 Chang, S., Puryear, J. and Cairney, J. (1993) A simple and efficient method for isolating

RNA from pine trees. Plant MoI. Biol. Rep. 11, 113-116. CIE. (1986) Colorimetry 2^nd edn. Publication CIE No. 15.2, Central Bureau of the Commission

Internationale de L'Eclairage, Vienna.

Clough S.J. and Bent A.F. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16: 735-743

Davies, K.M. and Schwinn, K.E. (2003) Transcriptional regulation of secondary metabolism.

Fund Plant. Biol. 30, 913-925 De Jong, W.S., Eannetta, N.T., De Jong, D.M. and Bodis, M. (2004) Candidate gene analysis of anthocyanin pigmentation loci in the Solanaceae. Theor. Appl. Genet. 108, 423 - 432 de Vetten, N., Quattrocchio, F., MoI, J. and Koes, R. (1997) The anil locus controlling flower pigmentation in petunia encodes a novel WD-repeat protein conserved in yeast, plants, and animals. Genes Dev. 11, 1422-1434 Dixon, R. A. and Steele, CL. (1999) Flavonoids and isoflavonoids - a gold mine for metabolic engineering. Trends Plant ScL 4, 394-400 Dong, Y.H., Mitra, D., Kootstra, A., Lister, C. and Lancaster, J. (1998) Postharvest stimulation of skin colour in Royal Gala apple. J. Am. Soc. Hortic. ScL 120, 95-100 Espley R. V., Hellens R.P., Putterill J., Stevenson D.E., Kutty-Amma S.,and Allan A.C.

(2007) Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYBlO. Plant J. 49: 414-427 Gleave, A. (1992) A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome. Plant MoI. Biol. 20, 1203-1207

Goff, S.A., Cone, K.C. and Chandler, V.L. (1992) Functional analysis of the transcriptional activator encoded by the maize B gene: evidence for a direct functional interaction between two classes of regulatory proteins. Genes Dev. 6, 864-875

Goodrich, J., Carpenter, R. and Coen, E.S. (1992) A common gene regulates pigmentation pattern in diverse plant species. Cell, 68, 955-964

Grotewold, E., Sainz, M.B., Tagliani, L., Hernandez, J.M., Bowen, B. and Chandler V.L.

(2000) Identification of the residues in the Myb domain of maize Cl that specify the interaction with the bHLH cofactor R. Proc. Natl Acad. ScL USA, 97, 13579-13584 Harborne, J.B. (1967) Comparative biochemistry of the flavonoids. Academic press, London Harborne, J.B. and Grayer, R. J. (1994) Flavonoids and insects. In JB Harborne, ed, The

Flavonoids: Advances in Research Since 1986. Chapman & Hall, London, p 589-618 Heim, M.A., Jakoby, M., Werber, M., Martin, C, Bailey, P.C. and Weisshaar, B. (2003)

The basic helix-loop-helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity. MoI. Biol. Evol. 20, 735-747 Hellens, R.P., Edwards, E.A., Leyland, N.R., Bean, S. and Mullineaux, P.M. (2000) pGreen: a versatile and flexible binary Ti vector for Agrobacterium-medϊated plant transformation. Plant MoI. Biol. 42, 819-832 Hellens, R.P., Allan, A.C, Friel, E.N., Bolitho, K., Grafton, K., Templeton, M.D.,

Karunairetnam, S. and Laing, W.A. (2005) Transient plant expression vectors for functional genomics, quantification of promoter activity and RNA silencing. Plant

Methods, 1:13 Hernandez, J.M., Heine, G.F., Irani, N.G., Feller, A., Kim, M-G., Matulnik, T., Chandler,

V.L. and Grotewold, E. (2004) Different mechanisms participate in the R-dependent activity of the R2R3 MYB transcription factor Cl. J. Biol. Chem. 279, 48205-48213 Hoffmann, T., Kalinowski, G., and Schwab, W. (2006) RNAi-induced silencing of gene expression in strawberry fruit (Fragaria x ananassa) by agroinfiltration: a rapid assay for gene function analysis. The Plant Journal 48 (5), 818-826. Holton, T.A. and Cornish, E.C. (1995) Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell, 7, 1071-1083

Honda, C, Kotoda, N., Wada, M., Kondo, S., Kobayashi, S., Soejima, J., Zhang, Z., Tsuda, T. and Moriguchi, T. (2002) Anthocyanin biosynthetic genes are coordinately expressed during red coloration in apple skin. Plant Physiol. Biochem. 40, 955-962 Jaeger, S.R. and Harker, FR (2005) Consumer evaluation of novel kiwifruit: willingness-to- pay JSci FoodAgric 85(15), 2519-2526

Jin, H. and Martin, C. (1999) Multifunctionality and diversity within the plant MYB-gene family. Plant MoI. Biol. 41, 577-585

Kim, S-H., Lee, J-R., Hong, S-T., Yoo, Y-K., An, G. and Kim, S-R (2003) Molecular cloning and analysis of anthocyanin biosynthesis genes preferentially expressed in apple skin. Plant ScL 165, 403-413

Koncz C. and Schell J . The promoter of TL-DNA gene 5 controles the tissue-specific expression of chimeric genes carried by a novel type of Agrobacterium binary vector.

Mol.Gen.Genet. 204, 383-396. 1986. Kobayashi, S., Ishimaru, M., Hiraoka, K. and Honda, C. (2002) Myb-related genes of the

Kyoho grape (Vitis labruscand) regulate anthocyanin biosynthesis. Planta 215, 924-933 Kobayashi, S., Goto-Yamamoto, N. and Hirochika, H. (2004) Retrotransposon-induced mutations in grape skin colour. Science, 304, 982

Koes, R.E., Quattrocchio, F. and MoI, J.N.M. (1994) The flavonoid biosynthetic pathway in plants: Function and evolution. BioEssays, 16, 123-132 Kumar S, Tamura K, and Nei, M. (2004) MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5, 150-63. Lancaster, J. (1992) Regulation of skin color in apples. Crit. Rev. Plant. ScL 10, 487-502 Lees and Francis (1972) Anthocyanins as Food Colors, Pericles Markakis. Page 193-195 Lister, CE. and Lancaster, J. E. (1996) Developmental changes in enzymes of flavonoid biosynthesis in the skins of red and green apple cultivars. J. ScL Food. Agric. 71, 313-320 Martin, C. and Paz-Ares, J. (1997) MYB transcription factors in plants. Trends in Genetics,

13, 67-73 Matsuo, N., Minami, M., Maeda, T. and Hiratsuka, K. (2001) Dual luciferase assay for monitoring transient gene expression in higher plants. Plant Biotechnol. 18, 71-75 MoI, J., Grotewold, E. and Koes, R. (1998) How genes paint flowers and seeds. Trends Plant.

ScL 3, 212-217 MoI, J. J., Schafer, E. and Weiss, D. (1996) Signal perception, transduction, and gene expression involved in anthocyanin biosynthesis. Crit. Rev. Plant. Sci. 15, 525-557 Montefiori, M., McGhie, T. K., Costa, G. and Ferguson, A. R. (2005) Pigments in the Fruit of Red-Fleshed Kiwifruit (Actinidia chinensis and Actinidia deliciosa).

J. Agric. Food Chem, 53, 9526-9530. Nesi, N., Debeaujon, L, Jond, C, Pelletier, G., Caboche, M. and Lepiniec, L. (2000) The

TT8 gene encodes a Basic Helix-Loop-Helix domain protein required for expression of

DFR and BAN genes in Arabidopsis siliques. Plant Cell, 12, 1863-1878 Newcomb, R.D., Crowhurst, R., Gleave, A.P., Rikkerink, E., Allan, A.C., Beuning, L.,

Bowen, J., Gera, E., Jamieson, K.R., Janssen, B., Laing, W.A., McArtney, S., Nain,

B., Ross, G., Snowden, K., Souleyre, E., Walton, E., Yauk, Y-C. (2006) Analyses of

Expressed Sequence Tags from Apple (Mains x domesticd) Plant Physiol. 141, 147-167 Noda, K-I., Glover, B. J., Linstead, P. and Martin, C. (1994) Flower colour intensity depends on specialized cell shape controlled by a Myb-related transcription factor. Nature, 369,

661-664 Ramsay, N.A. and Glover, B.J. (2005) MYB-bHLH-WD40 protein complex and the evolution of cellular diversity. Trends Plant Sci. 10, 63-70

Saito, K. and Yamazaki, M. (2002) Biochemistry and molecular biology of the late-stage of biosynthesis of anthocyanin: lessons from Perilla frutescens as a model plant. New

Phytol. 155, 9-23 Stevenson, D.E., Wibisono, R., Jensen, D.J., Stanley, R.A., and Cooney, J.M. (2006) Direct acylation of flavonoid glycosides with phenolic acids catalysed by Candida antarctica lipase B (Novozym 435^®). Enzyme Microb Technol, 39, 1236-1241 Stracke, R., Werber, M. and Weisshaar, B. (2001) The R2R3-MYB gene family in

Arabidopsis thaliana. Curr. Opin. Plant Biol. 4, 447-456 Schwinn, K.E., Venail, J., Shang, Y., Mackay, S., Aim, V., Butelli, E., Oyama, R., Bailey, P.,

Davies, K.M. and Martin, C. (2006) A small family of MKβ-regulatory genes controls floral pigmentation intensity and patterning in the genus Antirrhinum. Plant Cell, 18, 831-851

Tohge, T., Nishiyama, Y., Hirai, M. Y., Yano, M., Nakajima, J., Awazuhara, M., Inoue, E., Takahashi, H., Goodenowe, D.B., Kitayama, M., Noji, M., Yamazaki, M. and Saito, K. (2005) Functional genomics by integrated analysis of metabolome and transcriptome of Arabidopsis plants over-expressing an MYB transcription factor. Plant J. 42, 218-235 Takos AM, Jaffe FW, Jacob SR, Bogs J, Robinson SP, Walker AR. (2006) Light-Induced Expression of a MYB Gene Regulates Anthocyanin Biosynthesis in Red Apples. Plant Physiol. 142, 1216-1232 Tsao, R., Yang, R., Young, J.C. and Zhu, H. (2003) Polyphenolic profiles in eight apple cultivars using high-performance liquid chromatography (HPLC). J. Agric. Food Chem. 51, 6347-6353

Voinnet, O., Rivas, S., Mestre, P. and Baulcombe, D. (2003) An enhanced transient expression system in plants based on suppression of gene silencing by the pi 9 protein of tomato bushy stunt virus. Plant J. 33, 949-956

Walker, A.R., Davison, P.A., Bolognesi-Winfield, A.C., James, CM., Srinivasan, N.,

BIundell, T.L., Esch, J.J., Marks, M.D. and Gray, J.C. (1999) The TRANSPARENT

TESTA GLABRAl locus, which regulates trichome differentiation and anthocyanin biosynthesis in Arabidopsis, encodes a WD40 repeat protein. Plant Cell, 11, 1337-1350 Winkel-Shirley, B. (2001) Flavonoid biosynthesis. A colourful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 126, 485-493 Xie, D-Y., Sharma, S.B., Wright, E., Wang, Z-Y. and Dixon, R. A. (2006) Metabolic engineering of proanthocyanidins through co-expression of anthocyanidin reductase and the PAPl MYB transcription factor. Plant J. 45, 895-907. Yao, J-L., Cohen, D., Atkinson, R., Richardson, K. and Morris, B. (1995) Regeneration of transgenic plants from the commercial apple cultivar Royal Gala. Plant Cell Reports, 14, 407-412

Zhang, F., Gonzalez, A., Zhao, M., Payne, C.T., and Lloyd, A. (2003) A network of redundant bHLH proteins functions in all TTGl -dependent pathways of Arabidopsis. Development 130, 4859-4869

Zimmermann, I.M., Heim, M.A., Weisshaar, B. and Uhrig, J.F. (2004) Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-like BHLH proteins. Plant J. 40, 22-34 Table 3: SUMMARY OF SEQUENCES

Claims

CLAIMS:

1. An isolated polynucleotide comprising a sequence encoding a polypeptide with the amino acid sequences of SEQ ID NO:1 or 2 or a variant thereof, wherein the polypeptide or variant thereof is an R2R3 MYB transcription factor that regulates anthocyanin production in a plant.

2. The isolated polynucleotide of claim 1, wherein the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 1 or 2.

3. The isolated polynucleotide of claim 1, wherein the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 1.

4. The isolated polynucleotide of claim 1, wherein the polynucleotide encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 1.

5. The isolated polynucleotide of claim 1, wherein the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 2.

6. The isolated polynucleotide of claim 1, wherein the polynucleotide encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 2.

7. An isolated polynucleotide comprising a sequence encoding a polypeptide with the amino acid sequences of SEQ ID NO:1 or 2 or a variant thereof, wherein the polypeptide or variant thereof is an R2R3 MYB transcription factor that regulates the promoter of at least one gene in the anthocyanin biosynthetic pathway in a plant.

8. The isolated polynucleotide of claim 7, wherein the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 1 or 2.

9. The isolated polynucleotide of claim 7, wherein the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 1.

10. The isolated polynucleotide of claim 7, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 1.

11. The isolated polynucleotide of claim 7, wherein the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 2.

12. The isolated polynucleotide of claim 7, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 2.

13. The isolated polynucleotide of claim 7, wherein the gene in the anthocyanin biosynthetic pathway is selected from a group including genes encoding: chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), dihydroflavonol reductase (DFR), leucoanthocyanidin dioxygenase (LDOX), UDP glucose flavonoid glucosyl-transferase (UFGT), and glutathione S-transferase (GST).

14. An isolated polynucleotide comprising the sequence of any one of the sequences of SEQ ID NO: 3 to 6 or a variant thereof, wherein the polynucleotide or variant thereof encodes an R2R3 MYB transcription factor that regulates anthocyanin production in a plant.

15. The isolated polynucleotide of claim 14, wherein the variant comprises a nucleic acid sequence with at least 70% identity to the sequence of any one of SEQ ID NO: 3 to 6.

16. The isolated polynucleotide of claim 14, wherein the polynucleotide comprises the nucleic acid sequence of any one of SEQ ID NO: 3 to 6.

17. An isolated polynucleotide comprising the sequence of any one of the sequences of SEQ ID NO: 3 to 6 or a variant thereof, wherein the polynucleotide or variant thereof encodes an R2R3 MYB transcription factor that regulates the promoter of at least one gene in the anthocyanin biosynthetic pathway in a plant.

18. The isolated polynucleotide of claim 17, wherein the variant comprises a nucleic acid sequence with at least 70% identity to the sequence of any one of SEQ ID NO: 3 to 6.

19. The isolated polynucleotide of claim 18, wherein the polynucleotide comprises the nucleic acid sequence of any one of SEQ ID NO: 3 to 6.

20. The isolated polynucleotide of claim 17, wherein the gene in the anthocyanin biosynthetic pathway is selected from a group including genes encoding: chalcone synthase (CHS), flavanone

3-hydroxylase (F3H), dihydroflavonol reductase (DFR), leucoanthocyanidin dioxygenase (LDOX), UDP glucose flavonoid glucosyl-transferase (UFGT), and glutathione S-transferase (GST).

21. An isolated polypeptide comprising: a) the amino acid sequences of SEQ ID NO: 1 or 2 or a variant thereof, wherein the polypeptide or variant thereof is an R2R3 MYB transcription factor that regulates anthocyanin production in a plant; or b) a fragment, of at least 5 amino acids in length, of the sequence of a), capable of performing the same function as the polypeptide in a).

22. The isolated polypeptide of claim 21, wherein the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 1 or 2.

23. The isolated polypeptide of claim 21 comprising the amino acid sequence of SEQ ID NO: 1.

24. The isolated polypeptide of claim 21 comprising the amino acid sequence of SEQ ID NO: 2.

25. The isolated polypeptide of claim 21, wherein the fragment comprises the amino acid sequence of SEQ ID NO: 19.

26. An isolated polypeptide comprising: a) the amino acid sequences of SEQ ID NO: 1 or 2 or a variant thereof, wherein the polypeptide or variant thereof is an R2R3 MYB transcription factor that regulates the promoter of at least one gene in the anthocyanin biosynthetic pathway in a plant; or b) a fragment, of at least 5 amino acids in length, of the sequence of a), capable of performing the same function as the polypeptide in a).

27. The isolated polypeptide of claim 26, wherein the variant comprises an amino acid sequence with at least 63% identity to the sequence of SEQ ID NO: 1 or 2.

28. The isolated polypeptide of claim 26, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 1.

29. The isolated polypeptide of claim 26, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 2.

30. The isolated polypeptide of claim 26, wherein the fragment comprises the amino acid sequence of SEQ ID NO: 19.

31. An isolated polynucleotide encoding a polypeptide of any one of claims 21 to 30.

32. An antibody raised against a polypeptide of any one of claims 21 to 30.

33. A genetic construct comprising a polynucleotide of any one of claims 1 to 20 and 31.

34. A host cell genetically modified to express a polynucleotide of any one of claims 1 to 20 and 31.

35. A host cell comprising a genetic construct of claim 33.

36. A plant cell, or plant, genetically modified to express a polynucleotide of any one of claims 1 to 20 and 31.

37. A plant cell, or plant, comprising the genetic construct of claim 33.

38. A method for producing a plant cell or plant with altered anthocyanin production, the method comprising the step of transformation of a plant cell or plant with a genetic construct including: a) at least one polynucleotide of any one of claims 1 to 20 and 31 ; b) at least one polynucleotide, or gene, encoding of a MYB polypeptide of any one of claims 21 to 30; c) at least one polynucleotide comprising a fragment, of at least 15 nucleotides in length, of the polynucleotide of a) or gene of b); d) at least one polynucleotide comprising a complement, of at least 15 nucleotides in length, of the polynucleotide of c); or e) at least one polynucleotide capable of hybridising under stringent conditions to the polynucleotide of a) or a gene of b).

39. The method of claim 38 including the additional step of transforming the plant with a construct designed to express a bHLH transcription factor, such that the bHLH transcription factor is co-expressed with the MYB polypeptide.

40. The method of claim 38, wherein the bHLH transcription factor comprises an amino acid sequence with at least 70% identity to the sequence of any one of SEQ ID NO: 7.

41. The method of claim 38, wherein the bHLH transcription factor comprises an amino acid sequence with the sequence of SEQ ID NO: 7.

42. A plant produced by the method of any one of claims 38 to 41.

43. A method for selecting a plant altered in anthocyanin production, the method comprising testing of a plant for: a) altered expression of a polynucleotide of any one of claims 1 to 20 and 31; b) altered expression of a polypeptide of any one of claims 21 to 30, or c) the presence of a polymorphism associated with the altered expression in a) or b).

44. A group or population of plants selected by the method of claim 43.

45. A method for selecting a plant cell or plant that has been transformed, the method comprising the steps a) transforming a plant cell or plant with a polynucleotide any one of claims 1 to 20 and 31 capable of regulating anthocyanin production in a plant; b) expressing the polynucleotide in the plant cell or plant; and c) selecting a plant cell or plant with increased anthocyanin pigmentation relative to other plant cells or plants, the increased anthocyanin pigmentation indicating that the plant cell or plant has been transformed.

46. A transformed plant selected by the method of claim 45.