CN107858369B

CN107858369B - Gene for improving capability of plant to resist harmful insects and application thereof

Info

Publication number: CN107858369B
Application number: CN201610828138.XA
Authority: CN
Inventors: 戴争妍; 苗雪霞; 时振英
Original assignee: Center for Excellence in Molecular Plant Sciences of CAS
Current assignee: Center for Excellence in Molecular Plant Sciences of CAS
Priority date: 2016-09-18
Filing date: 2016-09-18
Publication date: 2021-03-02
Anticipated expiration: 2036-09-18
Also published as: CN107858369A

Abstract

The invention relates to a gene for improving the capability of plants to resist harmful insects and application thereof. It is proposed for the first time that flavanone 3-hydroxylase is closely related to insect resistance in plants, and promoting expression thereof can confer insect resistance to plants. Moreover, the anthocyanin content of the plant can be improved by promoting the expression of the gene. Therefore, flavanone 3-hydroxylase or substances that modulate it can be applied in plant breeding.

Description

Gene for improving capability of plant to resist harmful insects and application thereof

Technical Field

The invention belongs to the field of molecular biology and botany, and particularly relates to a gene for improving the capability of a plant to resist harmful insects and application thereof.

Background

Plants are threatened by various phytophagous insects during growth and development, so that the plants need a very complex defense system to resist the attack of the insects. At present, the research on the molecular mechanism of insect resistance of plants such as gramineae (such as insects in the family delphacidae) is in the primary stage, and the discovery of genes related to insect resistance and the enhancement of the understanding of the molecular mechanism of insect defense can help the control of insects in the field.

Metabolites in plants can be classified into Primary Metabolites (Primary Metabolites) and Secondary Metabolites (Secondary Metabolites) according to their biological functions. The synthesis of secondary metabolites is a series of complex biochemical reaction processes regulated by related genes in the cells, so related intracellular signal molecules and corresponding signal transduction mechanisms are inevitably present in plant cells to sense and transmit stimulation signals of external factors. Antioxidant flavonoids are a class of plant secondary metabolites that are commonly distributed in plants. They can be classified into 6 types according to their molecular structure and conformation of the heterocyclic pyran ring: flavones, flavanones, isoflavones, flavonols, flavanols, and anthocyanins. The isoflavone and anthocyanin are taken as the hot spots of the current research, and a large number of researches prove that the compounds have various medicinal values of resisting oxidation, removing free radicals, protecting heart and cerebral vessels, resisting tumors, resisting inflammation and the like. In plants, isoflavone products can increase the resistance of plants in disease resistance reaction, and are plant protection elements with broad-spectrum antibacterial activity; and is a signal molecule between leguminous plants and nitrogen-fixing bacteria. The flavonoid compounds are usually combined with saccharides to form glycosides, namely anthocyanin, in the plant body or exist in plant vacuole in a free form, so that organs such as flowers, stems, leaves, fruits and the like can present various colors, and the flavonoid compounds can attract insects to pollinate and prevent fruits from being damaged by ultraviolet light; and the anthocyanin enables the species or the variety to show different colors according to the difference of the species and the quantity, and has important effects on the growth and development of the plant, the flowering and the fruiting as well as the defense against the invasion.

Disclosure of Invention

The invention aims to provide a gene for improving the capability of a plant to resist harmful insects and application thereof.

In a first aspect of the invention there is provided a method of modulating the ability of a plant to combat insects or modulating the anthocyanin content of a plant, which method comprises: modulating the expression or activity of flavanone 3-hydroxylase (F3H) in plants.

In a preferred embodiment, the method comprises the following steps: up-regulating the expression or activity of a xanthone 3-hydroxylase in a plant, thereby increasing the ability of the plant to combat insects, or increasing the anthocyanin content of the plant.

In another preferred embodiment, said up-regulating expression or activity of a xanthone 3-hydroxylase in plants comprises: overexpression molecules of flavanone 3-hydroxylase are transferred into plant cells, tissues, organs or seeds, thereby up-regulating the expression or activity of flavanone 3-hydroxylase in plants.

In another preferred embodiment, the method comprises the following steps: downregulating expression or activity of a xanthone 3-hydroxylase in a plant, thereby reducing the plant's ability to combat insects, or reducing the plant's anthocyanin content.

In another preferred example, said down-regulating expression or activity of a xanthone 3-hydroxylase in a plant comprises: knocking out or silencing a flavanone 3-hydroxylase encoding gene in the genome of a plant; or transferring into a plant a down-regulator which down-regulates the transcription or expression of a gene encoding a flavanone 3-hydroxylase; preferably, said down-regulator which down-regulates the transcription or expression of the flavanone 3-hydroxylase encoding gene is an interfering molecule which specifically interferes with the expression of the flavanone 3-hydroxylase gene; more preferably, the interfering molecule is a dsRNA, antisense nucleic acid, or shRNA that is targeted for inhibition or silencing by the flavanone 3-hydroxylase gene or transcript thereof, or a construct that expresses or forms the dsRNA, antisense nucleic acid, or shRNA.

In another preferred embodiment, said interfering molecule specifically interfering with the expression of the gene encoding flavanone 3-hydroxylase targets the nucleic acid fragment at position 500-981 of the gene encoding flavanone 3-hydroxylase.

In another preferred embodiment, the plant includes dicotyledonous plants and monocotyledonous plants; preferably, the plant includes a graminaceous plant, a cruciferous plant, a solanaceous plant or an euphorbiaceae plant.

In another preferred embodiment, the cruciferous plants include: arabidopsis thaliana; or the gramineae comprises: rice, wheat, corn; or said solanaceous plant comprises: potatoes, tomatoes; or the Euphorbiaceae plant comprises: and (4) cassava.

In another preferred embodiment, the insect is a plant hopper, a homoptera, a diptera, or a lepidoptera pest.

In another preferred embodiment, said flavanone 3-hydroxylase is selected from the group consisting of:

(a) polypeptide of amino acid sequence shown as SEQ ID NO. 2;

(b) a protein derived from (a) and having the function of (a) a polypeptide, which is formed by substituting, deleting or adding one or more (e.g., 1 to 30, preferably 1 to 20, more preferably 1 to 10, e.g., 1 to 5, 1 to 3) amino acid residues to the amino acid sequence shown in SEQ ID NO. 2; or

(c) A protein derived from (a) having more than 80% (preferably more than 90%, more preferably more than 95%, such as more than 98% or 99%) homology with the protein sequence defined in (a) and having the function of (a) protein.

In another preferred embodiment, said flavanone 3-hydroxylase encoding gene is the following sequence or a variant thereof: 1 in SEQ ID NO.

In another aspect of the invention there is provided the use of a flavanone 3-hydroxylase, or a gene encoding same, to increase the ability of a plant to combat insects, or to increase the anthocyanin content of a plant.

In another aspect of the invention there is provided the use of a down-regulator of a flavanone 3-hydroxylase, or of a gene encoding same, for reducing the ability of a plant to combat insects, or for reducing the anthocyanin content of a plant; preferably, said down-regulator of flavanone 3-hydroxylase or the gene encoding it is an interfering molecule that specifically interferes with the expression of the flavanone 3-hydroxylase gene.

In another aspect of the invention, the use of flavanone 3-hydroxylase or the gene encoding the same is provided as a molecular marker for identifying high or low insect resistance in plants or as a molecular marker for identifying high or low plant anthocyanin content.

In a preferred embodiment, if the expression of the xanthone 3-hydroxylase in the tested plant tissue is above a certain value, the insect resistance of the plant is relatively high; if the expression of the xanthone 3-hydroxylase in the plant tissue is detected to be below a certain value, the plant is relatively low in insect resistance. Wherein, unless otherwise stated, the "specific value" means an average value of the expression amount of the xanthone 3-hydroxylase in a specific plant.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1, OsF3H transgenic plant root section.

A: t of OsF3H gene₀Performing Real-time quantitative expression detection on the generation overexpression transgenic plant;

b: t of OsF3H gene₀Carrying out Real-time quantitative expression detection on the transgenic plant of the RNAi;

c: transverse sections of roots of the OsF3H-OE transgenic plants;

d: OsF 3H-transverse section of root of RNAi transgenic plant;

e: transverse sections of roots of wild type ZH11 plants.

FIG. 2, OsF3H transgenic plant insect resistance ability identification

A：T₂Identifying the insect resistance of the generation over-expression plants;

B：T₂identifying the insect resistance of the RNAi plant;

C：T₂quantitative expression detection of OsF3H gene of generation over-expression plants;

D：T₂quantitative expression detection of OsF3H gene in the plant of the generation RNAi;

e: OsF3H transgenic plant T₂And (5) statistics of the identification result of the insect resistance.

FIG. 3, Arabidopsis OsF3H-OE transgenic plant phenotype.

A: arabidopsis thaliana wild-type plant phenotype;

b: arabidopsis OsF3H-OE transgenic plant T₁A representative type;

c: the apparent color of the extracted anthocyanin solution;

d: arabidopsis OsF3H-OE transgenic plant T₂The content of the proanthocyanidin.

FIG. 4 subcellular localization of protein encoded by OsF3H gene.

FIG. 5, map of overexpression vector p 130135S-Nos.

FIG. 6, map of p1301-RNAi vector.

Detailed Description

In the process of screening plant insect-resistant genes, the inventor finds that flavanone 3-hydroxylase (F3H) is closely related to insect resistance of plants, the plant resistance to insects can be endowed by promoting the expression of the flavanone 3-hydroxylase, and the plants are more sensitive to insects and are easier to be attacked by down regulating the expression of the flavanone 3-hydroxylase. Moreover, the expression of flavanone 3-hydroxylase is promoted, and the anthocyanin content of plants can also be increased. Therefore, the flavanone 3-hydroxylase (or the coding gene thereof) or the substance and the method for regulating the flavanone 3-hydroxylase (or the coding gene thereof) can be applied to plant breeding to breed plant varieties with changed insect resistance or plant varieties with changed anthocyanin content.

As used herein, the term "plant (crop)" includes, but is not limited to: cruciferae plant, Gramineae plant, Solanaceae plant, Euphorbiaceae plant, etc. The plant may be: dicotyledonous, monocotyledonous, or gymnosperm. For example, the term "plant" includes, but is not limited to: rice, wheat, corn, potato, tapioca, and the like. Preferably, the plant is a graminaceous plant or a cruciferous plant.

In the present invention, the harmful insects include: insects of the plant hopper family, insects of the homoptera, insects of the diptera order (such as chilo suppressalis) and the like.

As used herein, the "insects of the family planthopper" include, but are not limited to: brown Planthopper (BPH), White Back Planthopper (WBPH) and grey planthopper (SBPH). "plant hopper family" is 1 family belonging to the homoptera, and "plant hopper family insects" have more commonalities as follows: generally called plant hoppers, all of which are phytophagous, and many of which live in gramineae are piercing-sucking agricultural pests. Has migration habit and is the leading pest on the rice in China and many Asian countries. Wherein the brown planthopper is a monophagic pest and takes and breeds offspring on rice and common wild rice. The Sogatella furcifera and the Laodelphax striatellus have wide feeding habits and can damage gramineous plants such as rice, wheat, corn and the like.

The present invention also includes fragments, derivatives and analogs of each flavanone 3-hydroxylase. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity as the flavanone 3-hydroxylase of the present invention. The polypeptide fragment, derivative or analogue of the present invention may be (i) a protein in which one or more (e.g., 1 to 30; preferably 1 to 20; more preferably 1 to 10; e.g., 5, 3) conserved or non-conserved amino acid residues (preferably conserved amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a protein having a substituent group in one or more (e.g., 1 to 30; preferably 1 to 20; more preferably 1 to 10; e.g., 5, 3) amino acid residues, or (iii) a protein in which an additional amino acid sequence is fused to the sequence of the protein, etc. Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the definitions herein. For example, in the art, substitutions with amino acids of similar or similar properties will not generally alter the function of the protein. Also, for example, addition or deletion of one or several amino acids at the C-terminus and/or N-terminus does not generally alter the function of the protein. The term also includes active fragments and active derivatives of flavanone 3-hydroxylase.

Any biologically active fragment of flavanone 3-hydroxylase may be employed in the present invention. As used herein, the biologically active fragment of flavanone 3-hydroxylase is meant to be a protein that still retains all or part of the function of the full-length flavanone 3-hydroxylase. Typically, the biologically active fragment retains at least 50% of the activity of the full-length flavanone 3-hydroxylase. Under more preferred conditions, the active fragment is capable of retaining 60%, 70%, 80%, 90%, 95%, 99%, or 100% of the activity of the full-length flavanone 3-hydroxylase.

Polynucleotide sequences (coding sequences) encoding flavanone 3-hydroxylase or conservative variant proteins thereof may also be employed in the present invention. The sequence of the coding region encoding the mature flavanone 3-hydroxylase may be substantially identical to the sequence shown in SEQ ID NO. 1 or degenerate variants. As used herein, "degenerate variant" refers in the present invention to a nucleic acid sequence that encodes a polypeptide having the sequence set forth in SEQ ID NO. 2, but differs from the sequence set forth in SEQ ID NO. 1.

The term "encoding gene" may be a polynucleotide comprising a sequence encoding the protein, or may be a polynucleotide further comprising additional coding and/or non-coding sequences.

Variants of the above polynucleotides are also useful, encoding proteins having the same amino acid sequence as the present invention or fragments, analogs and derivatives of the proteins. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the protein encoded thereby.

It is to be understood that while the flavanone 3-hydroxylase encoding gene (F3H) of the present invention is preferably obtained from a plant of the family gramineae, other genes obtained from other plants that are highly homologous (e.g., have greater than 80%, such as 85%, 90%, 95%, or even 98% sequence identity) to the F3H gene are also within the contemplation of the present invention. Methods and means for aligning sequence identity are also well known in the art, for example BLAST. As known in the art, the cDNA of the F3H gene is originally cloned from snapdragon and has been cloned in various plants, such as apple, alfalfa, corn, ginkgo and the like, and the action substrate of the cDNA is naringenin, which indicates that the gene is conserved in many species.

The F3H of the present invention can be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. In addition, the related sequences can be synthesized by artificial synthesis.

Vectors comprising such coding sequences, as well as host cells genetically engineered with such vectors or flavanone 3-hydroxylase coding sequences, are also encompassed by the invention. Methods well known to those skilled in the art can be used to construct expression vectors containing the flavanone 3-hydroxylase coding sequence and appropriate transcription/translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The sequences may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. Vectors containing the appropriate coding sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell is typically a plant cell. Transformation of plants generally can be carried out by methods such as Agrobacterium transformation or gene gun transformation, for example, leaf disc method, immature embryo transformation; the Agrobacterium method is preferred. Transformed plant cells, tissues or organs can be regenerated into plants by conventional methods to obtain plants with altered traits relative to the wild type.

Based on the new discovery of the inventor, the invention provides the application of the flavanone 3-hydroxylase or the coding gene thereof, which is used for regulating (including up-regulating or down-regulating) the capability of a plant to resist insects or regulating the anthocyanin content of the plant. In one approach, overexpression of a sense flavanone 3-hydroxylase can increase the ability of a plant to combat insects, or increase the anthocyanin content of a plant. In another mode, upon downregulating flavanone 3-hydroxylase expression or activity, the plant's ability to combat insects can be reduced, or the plant's anthocyanin content can be reduced. The inventor finds that the pest sensitivity of the down-regulated plant is very obvious and has practical significance in basic research of rice. Thus, it is possible to modify plants based on the influence of flavanone 3-hydroxylase on plants for the purpose of improving the quality of plants according to the actual production needs, for example, to produce plants with strong insect resistance or plants with high anthocyanin content, or to produce plants sensitive to insects or plants with low anthocyanin content.

Anthocyanins are an important class of water-soluble natural plant pigments, belong to flavonoid substances, and are widely distributed in plants. The phenylalanine metabolic pathway is a biosynthetic pathway of anthocyanins. Precursors malonyl-CoA and coumaroyl-CoA form colorless naringenin catalyzed by chalcone synthase (CHS) and chalcone isomerase (CHI), naringenin is catalyzed by flavanone 3-hydroxylase (F3H) to form Dihydrokaempferol (DHK), DHK can form Dihydroquercitrin (DHQ) and Dihydromyricetin (DHM) catalyzed by F3 ' H and F3 ' 5 ' H, and F3 ' 5 ' H can also catalyze DHQ to DHM. The colorless DHK, DHQ and DHM can be further reduced into unstable colorless anthocyanidin under the catalysis of dihydroxyflavonol reductase (DFR), and then the colorless anthocyanidin is synthesized into various anthocyanins under the action of anthocyanin synthetase (ANS) and flavonoid 3-O-glycosyltransferase (UFGT) so as to synthesize various anthocyanins.

The invention also relates to up-regulators or down-regulators of flavanone 3-hydroxylase or genes encoding the same (such as antisense F3H genes or such as miRNA) and uses thereof. Because the up-regulator or the down-regulator can regulate the expression of F3H and/or regulate the activity of F3H and the like, the up-regulator or the down-regulator can regulate the plant traits through the influence on F3H, thereby achieving the aim of improving plants.

Any substance that can increase the activity of flavanone 3-hydroxylase, increase the stability of flavanone 3-hydroxylase, promote the expression of flavanone 3-hydroxylase, prolong the effective action time of flavanone 3-hydroxylase, or promote the transcription and translation of the F3H gene can be used in the present invention as an effective substance that can be used to increase the ability of a plant to fight insects, or increase the anthocyanin content of a plant.

Any substance that can decrease the activity of flavanone 3-hydroxylase, decrease the stability of flavanone 3-hydroxylase, inhibit the expression of flavanone 3-hydroxylase, decrease the effective duration of action of flavanone 3-hydroxylase, or decrease the transcription and translation of the F3H gene can be used in the present invention as an effective substance that can be used to decrease the ability of a plant to fight insects, or to decrease the anthocyanin content of a plant.

The present invention also relates to a method of modifying a plant, the method comprising modulating expression or activity of a xanthone 3-hydroxylase in said plant.

Once the use of the flavanone 3-hydroxylase is known, the expression of the flavanone 3-hydroxylase can be modulated using a variety of methods well known to those skilled in the art. For example, expression units (e.g., expression vectors or viruses) carrying the F3H gene can be delivered to the target site in a route that allows expression of the active flavanone 3-hydroxylase. In addition, various methods well known to those skilled in the art may also be employed to reduce or abolish the expression of flavanone 3-hydroxylase, such as delivering an expression unit (e.g., an expression vector or virus, etc.) carrying the antisense F3H gene to a target such that the cell or plant tissue does not express or reduce the expression of flavanone 3-hydroxylase; or the F3H gene is knocked out.

As an embodiment, the gene encoding flavanone 3-hydroxylase is cloned into an appropriate vector by a conventional method, and the recombinant vector carrying the foreign gene is introduced into a plant cell capable of expressing the flavanone 3-hydroxylase, so that the plant cell expresses the flavanone 3-hydroxylase. Plants overexpressing flavanone 3-hydroxylase can be obtained by regenerating the plant cells into plants. Preferably, the gene encoding flavanone 3-hydroxylase or the antisense gene is transferred into plants using Agrobacterium transformation.

The methods may be carried out using any suitable conventional means, including reagents, temperature, pressure conditions, and the like. Other methods of modulating the expression of flavanone 3-hydroxylase are known in the art. For example, expression of flavanone 3-hydroxylase can be enhanced by driving with a strong promoter. Or enhancing the expression of the flavanone 3-hydroxylase gene by an enhancer. Strong promoters suitable for use in the methods of the invention include, but are not limited to: 35s promoter, Ubi promoter of rice and corn, etc.

In addition, the invention also relates to a tracing mark for transforming the progeny of plants by using the flavanone 3-hydroxylase or the coding gene thereof as a gene. The invention also relates to a molecular marker for identifying the high and low insect resistance of the plant or for identifying the high and low anthocyanin content of the plant by detecting the expression condition of the flavanone 3-hydroxylase in the plant by using the flavanone 3-hydroxylase or the coding gene thereof as the molecular marker.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

The material and the method are as follows:

1. material

The rice material used in the invention is japonica rice variety (Oryza sativa L.subsp.japonica) Zhonghua 11, which is planted in a phytoecological research institute phytotron of Shanghai Life sciences institute of Chinese academy of sciences, and the growing environment is 29 ℃ plus or minus 1 ℃, the humidity is 50-70% + orminus 5%, and the illumination time is 7:00-19: 00.

2 method

2.1 construction of OsF3H overexpression vector and expression downregulation vector

To clone the OsF3H gene from rice, the present inventors designed the following primers based on the cDNA full sequence of ATG to TGA in the database (http:// rice. plant biology. msu. edu /):

a forward primer: 5' -CGGGATCCGCCAAGTTGTGTGTGTGTACC-3’(SEQ ID NO:3)；

Reverse primer: 5' -GGGGTACCCGAGAAACTACGGGGGTGTT-3’(SEQ ID NO:4)；

In the primers, the introduced BamHI and KpnI sites are underlined.

Total RNA of leaves of wild-type rice ZH11 at five-leaf stage was extracted with Trizol (purchased from Invitrogen), after removing possible DNA contamination by DNaseI digestion, cDNA was obtained by reverse transcription, the cDNA was used as a template, and the full-length cDNA sequence of OsF3H gene was obtained by PCR amplification, and cloned into the overexpression vector p 130135S-Nos (FIG. 5) by the above-mentioned double restriction enzymes.

The following primers are designed according to the specific sequence of the OsF3H gene:

is led in the forward directionAn object: 5' -GGGACTAGTGGTACCGAGCGATATCCGAGAGCCTG-3’(SEQ ID NO:5)；

Reverse primer: 5' -GGGAGCTCGGATCCTTGGTCGAGGTTTCTGCTCC-3’(SEQ ID NO:6)。

The restriction sites are underlined and are the SpeI and KpnI sites in the forward primer and the SacI and BamHI sites in the reverse primer, respectively.

The RNAi vector was constructed: using the OsF3H cDNA obtained above as a template, a specific fragment was amplified by PCR, and the forward and reverse fragments were cloned into the p1301-RNAi vector by KpnI and BamHI double-restriction and SacI and SpeI double-restriction, respectively (FIG. 6).

2.2 identification and detection of transformed Rice

The constructed overexpression and RNAi vector is used for transforming rice immature embryos by an agrobacterium-mediated method. Total RNA from the transformed plant and wild-type ZH11 at the same growth stage was extracted by Trizol method, digested and purified with a kit (purchased from Toyobo Co., Ltd.), and 2. mu.g of the purified total RNA was reverse transcribed.

The conditions of Real-time PCR are that the step 1 is 95 ℃ and the temperature is 3 min; step 2, 95 ℃ for 15 s;

step

3, 60 ℃ and 30 s; 2-3 steps for 40 cycles.

Whether the transformation is successful or not is detected by using primers, wherein the sequences of the primers are as follows:

forward primer 5'-AGGTGGATCGCCGTGAATC-3' (SEQ ID NO: 7);

reverse primer 5'-GCTCTTGTATCTTCCGTTGCTTAG-3' (SEQ ID NO: 8).

2.3 transgenic Rice slice Observation

The root of the transgenic plant and the root of the same part of the ZH11 are transversely cut by about 5mm at the same time, fixed by 50 percent FAA fixing solution, replaced by fresh fixing solution after being pumped by a vacuum centrifuge for 15min, stored overnight at 4 ℃, and sent to the center of the unit instrument for manufacturing resin slices. When the section is observed, the same parts on the cross section of the leaf are taken for comparison, and whether the change of the cell number occurs or not is observed.

2.4 identification of insect resistance of transgenic Rice

Taking wild type ZH11 as a control, taking transgenic plants about 35-40 days (d) for identifying the resistance of brown planthopper, and inoculating 10 insects of 2-3 years old to each seedling. And confirming the survival insect quantity of each seedling again on the 2 nd day after the inoculation, and observing the death rate of the plants after 5 to 6 days.

2.4 anthocyanin assay

Collecting tissue of the same part in the same period, grinding into powder with liquid nitrogen, adding into anthocyanin extractive solution, standing overnight at 4 deg.C, centrifuging at 4 deg.C the next day (16000g,10min), and collecting supernatant for observation and determination. In the anthocyanin extract, methanol is HCl H₂The O proportions were 85%, 5% and 15%, respectively.

2.5 subcellular localization

Amplifying to obtain a full-length sequence fragment of the OsF3H gene, cloning the full-length sequence fragment to a protein expression vector pA7 containing GFP in a protein fusion mode, and designing the following primers for amplification:

a forward primer: 5' -CCGCTCGAGATGGCGGACCAGCTCATCTC-3’(SEQ ID NO:9)；

Reverse primer: 5' -GGACTAGTGGAGATGTGTCTGTAGGTGTTG-3’(SEQ ID NO:10)；

In the above primers, the introduced XhoI and SpeI sites are underlined.

After preparation of rice protoplasts, 5-10. mu.g of fused plasmid DNA and pA7 empty vector were mixed with 100. mu.l of protoplasts, 110. mu.l of a newly prepared PEG solution mixture (40% PEG4000, 0.2M mannitol, 0.1M CaCl2) was added, and the mixture was left at room temperature in the dark for 10-20 min. The 440. mu. l W5 solution was added gently and slowly, the tube was gently inverted and mixed well, and centrifuged at 1500rpm for 3 min. The protoplasts were collected and resuspended gently with 1ml of WI solution (0.5M mannitol, 20mM KCl, 4mM MES pH 5.7). Finally, the protoplasts were transferred to a six-well plate and placed in the dark at room temperature for 6-16h before being observed in Confocol.

Example 1 cloning of OsF3H Gene

The common sequence number of the OsF3H gene is LOC _03g03034(http:// rice. plant biology. msu. edu /). The cDNA sequence is as follows (SEQ ID NO: 1): ATGGCGGACCAGCTCATCTCCACGGCAGACCACGACACGCTGCCGGGCAACTACGTGCGCCCCGAGGCGCAGCGCCCGCGCCTCGCCGACGTGCTCTCCGACGCCTCCATCCCCGTCGTCGACCTCGCCAACCCCGACCGCGCCAAGCTCGTCTCCCAGGTCGGCGCCGCCTGCCGCTCCCACGGCTTCTTCCAGGTGCTCAACCATGGGGTGCCAGTGGAGCTGACACTGTCGGTGCTGGCGGTGGCGCACGACTTCTTCCGGCTGCCGGCGGAGGAGAAGGCCAAGCTCTACTCCGACGACCCGGCCAAGAAGATCCGCCTCTCCACCAGCTTCAACGTCCGCAAGGAGACCGTGCACAACTGGCGCGACTACCTCCGCCTCCACTGCTACCCGCTTCACCGCTACCTCCCTGATTGGCCATCCAACCCCCCTTCCTTCAGGGAGATCATAAGCACATACTGCAAAGAAGTTCGGGAGCTCGGATTCAGACTGTACGGAGCGATATCCGAGAGCCTGGGCTTGGAACAGGACTACATCAAGAAGGTTCTTGGTGAGCAGGAGCAGCATATGGCGGTGAACTTCTACCCCAAGTGCCCGGAGCCAGAGCTGACGTTCGGACTGCCGGCGCACACCGACCCGAACGCCCTCACCATCCTCCTCATGGACCAGCAGGTGGCCGGCCTGCAAGTTCTCAAGGAAGGCAGGTGGATCGCCGTGAATCCACAGCCCAACGCGCTGGTGATCAACATTGGTGATCAGCTACAGGCGCTAAGCAACGGAAGATACAAGAGCGTGTGGCACCGTGCTGTCGTCAACTCTGACAAAGCGAGGATGTCCGTCGCATCGTTCCTGTGCCCCTGCAACGACGTGCTCATCGGCCCAGCTCAGAAGCTCATCACCGATGGCTCCCCGGCCGTCTACCGGAACTACACCTACGACGAGTACTACAAGAAGTTCTGGAGCAGAAACCTCGACCAAGAACACTGCTTGGAGCTCTTCAGAACAACACCTACAGACACATCTTGA

The amino acid sequence of the encoded protein is as follows (SEQ ID NO: 2):

MADQLISTAD HDTLPGNYVR PEAQRPRLAD VLSDASIPVV DLANPDRAKL VSQVGAACRSHGFFQVLNHG VPVELTLSVL AVAHDFFRLP AEEKAKLYSD DPAKKIRLST SFNVRKETVHNWRDYLRLHC YPLHRYLPDW PSNPPSFREI ISTYCKEVRE LGFRLYGAIS ESLGLEQDYIKKVLGEQEQH MAVNFYPKCP EPELTFGLPA HTDPNALTIL LMDQQVAGLQ VLKEGRWIAVNPQPNALVIN IGDQLQALSN GRYKSVWHRA VVNSDKARMS VASFLCPCND VLIGPAQKLI TDGSPAVYRN YTYDEYYKKF WSRNLDQEHC LELFRTTPTD TS

in the invention, the inventor clones the full length of the OsF3H gene and constructs the gene into a plasmid p1301-35SNos to obtain an over-expression plant.

The inventor also selects a specific fragment (namely 500-981 site in SEQ ID NO:1) of the OsF3H gene, constructs an RNAi vector of the OsF3H gene, and obtains a transgenic plant through genetic transformation.

Meanwhile, the inventor also constructs pA7-OsF3H-GFP plasmid by using the full-length sequence of the gene.

Example 2 overexpression of OsF3H Gene and phenotype of RNAi

The inventor clones rice OsF3H gene, constructs OsF3H-OE and OsF3H-RNAi plasmids, and genetically transforms the plasmids into wild rice ZH 11. Over-expressed transgenic plants and transgenic plants with OsF3H gene down-regulated were obtained by Real-time detection, as shown in FIGS. 1A and 1B.

Transgenic plants of OsF3H-RNAi showed significantly thicker roots, and sections showed thicker roots due to parenchyma increase, as shown in FIG. 1D and E control. In addition, no significant macroscopic developmental-related phenotypic changes were found in OsF3H-OE and OsF3H-RNAi transgenic plants.

Example 3 detection of insect resistance in OsF3H-OE and OsF3H-RNAi transgenic plants

Taking wild type ZH11 as control, and taking T of about 35-40d₂The identification of brown planthopper resistance is carried out on the generation positive transgenic plant, and the OsF3H-OE transgenic plant is found to present obvious resistance to the brown planthopper, as shown in figure 2A; and the OsF3H-RNAi transgenic plant presents an obvious pest-susceptible phenotype to brown planthopper, as shown in figure 2B.

According to the results of Real-time, the strength of the resistance of the transgenic plant is obviously related to the expression level of the OsF3H gene, as shown in FIGS. 2C-E.

Example 4 OsF3H-OE plasmid transformation of Arabidopsis thaliana

The OsF3H gene encodes flavanone 3-hydroxylase, which is a key enzyme in the known anthocyanin synthesis pathway (phenylalanine metabolism), regulates the synthesis of flavone and anthocyanin products, and is a central site of the whole flavonoid metabolic pathway. Because phenotypic changes caused by anthocyanin content changes in rice are difficult to observe, and the F3H gene of a plant has high homology, the inventor carries out phenotypic observation after transforming Arabidopsis thaliana with the overexpression plasmid of the OsF3H gene.

As a result, the color of the stem and the leaf of OsF3H-OE transgenic Arabidopsis is obviously darker than that of the wild type, as shown in FIG. 3B.

Anthocyanin content assay also revealed a significant increase in anthocyanin content in the over-expressed transgenic plants, as shown in fig. 3C and 3D.

Example 5 subcellular localization of OsF3H Gene

It has been reported that F3H in plants is localized mainly in the cytoplasm. The inventor amplifies a full-length sequence fragment of the OsF3H gene by a PCR method, clones the fragment to a protein expression vector pA7 containing GFP in a protein fusion mode, transforms the fragment to a rice protoplast, and detects the subcellular localization condition of the fusion protein by Confocol.

The results showed that the F3H-GFP fusion protein was indeed localized in the cytoplasm (FIG. 4).

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Claims

1. A method of modulating the ability of a plant to combat insects, said method comprising: modulating the expression or activity of flavanone 3-hydroxylase in plants; the flavanone 3-hydroxylase is polypeptide with an amino acid sequence shown as SEQ ID NO. 2.

2. The method of claim 1, wherein the method comprises: up-regulating the expression or activity of a xanthone 3-hydroxylase in a plant, thereby improving the ability of the plant to combat insects.

3. The method of claim 2, wherein up-regulating expression or activity of a xanthone 3-hydroxylase in a plant comprises:

overexpression molecules of flavanone 3-hydroxylase are transferred into plant cells, tissues, organs or seeds, thereby up-regulating the expression or activity of flavanone 3-hydroxylase in plants.

4. The method of claim 3, wherein the method comprises: downregulating expression or activity of a xanthone 3-hydroxylase in a plant, thereby reducing the plant's ability to combat insects.

5. The method of claim 4, wherein downregulating expression or activity of a xanthone 3-hydroxylase in a plant comprises: knocking out or silencing a flavanone 3-hydroxylase encoding gene in the genome of a plant; or transferring into a plant a down-regulator which down-regulates the transcription or expression of a gene encoding a flavanone 3-hydroxylase.

6. The method of claim 5, wherein said down-regulator that down-regulates the transcription or expression of a gene encoding a flavanone 3-hydroxylase is an interfering molecule that specifically interferes with the expression of the flavanone 3-hydroxylase gene.

7. The method of claim 6, wherein said interfering molecule is a dsRNA, antisense, or shRNA, or a construct capable of expressing or forming said dsRNA, antisense, or shRNA, that is the target of inhibition or silencing of the flavanone 3-hydroxylase gene or transcript thereof.

8. The method of claim 1, wherein the plant is a graminaceous plant.

9. The method of claim 1, wherein said insect is an insect of the family planthopper.

10. Use of flavanone 3-hydroxylase or a gene encoding the same for increasing the ability of a plant to combat insects.

11. Use of a down-regulator of a flavanone 3-hydroxylase or of a gene encoding same, for reducing the ability of a plant to combat insects.

12. The use of claim 11, wherein said down-regulator of flavanone 3-hydroxylase, or the gene encoding it, is an interfering molecule that specifically interferes with the expression of the flavanone 3-hydroxylase gene.

13. Use of flavanone 3-hydroxylase or a gene encoding the same as a molecular marker for identifying high or low insect resistance in plants.