WO2016161429A1 - Compounds and methods for modulating tmprss6 expression - Google Patents

Compounds and methods for modulating tmprss6 expression Download PDF

Info

Publication number
WO2016161429A1
WO2016161429A1 PCT/US2016/025883 US2016025883W WO2016161429A1 WO 2016161429 A1 WO2016161429 A1 WO 2016161429A1 US 2016025883 W US2016025883 W US 2016025883W WO 2016161429 A1 WO2016161429 A1 WO 2016161429A1
Authority
WO
WIPO (PCT)
Prior art keywords
certain embodiments
compound
modified
antisense
modified oligonucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/025883
Other languages
English (en)
French (fr)
Inventor
Shuling Guo
Mariam Aghajan
Eric E. Swayze
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to JP2017546624A priority Critical patent/JP6833705B2/ja
Priority to US15/562,843 priority patent/US10415038B2/en
Priority to HK18108870.8A priority patent/HK1249140A1/zh
Priority to AU2016244106A priority patent/AU2016244106B2/en
Priority to BR112017015864-7A priority patent/BR112017015864B1/pt
Priority to KR1020177030957A priority patent/KR102539587B1/ko
Priority to CA2978100A priority patent/CA2978100C/en
Priority to MX2017012426A priority patent/MX2017012426A/es
Priority to CN201680015815.4A priority patent/CN107429250B/zh
Priority to RU2017137410A priority patent/RU2017137410A/ru
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Priority to EP16774409.3A priority patent/EP3277817A4/en
Publication of WO2016161429A1 publication Critical patent/WO2016161429A1/en
Priority to IL253509A priority patent/IL253509B2/en
Anticipated expiration legal-status Critical
Priority to US16/528,925 priority patent/US20200190522A1/en
Priority to US17/484,386 priority patent/US20220259600A1/en
Priority to IL286669A priority patent/IL286669A/en
Priority to US18/358,591 priority patent/US20240026364A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/711Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7115Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/712Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549Sugars, nucleosides, nucleotides or nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21109Matriptase (3.4.21.109)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525MOE, methoxyethoxy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3527Other alkyl chain
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)

Definitions

  • Sequence Listing is provided as a file entitled BIOL0271WOSEQ_ST25.txt created March 23, 2016, which is 148 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
  • the present invention provides methods, compounds, and compositions for modulating TMPRSS6 expression for the purpose of reducing iron accumulation in an animal.
  • Iron deficiency is a widespread disorder and results from any condition in which dietary iron intake does not meet the body's demands. Often, pathological blood loss contributes to negative iron balance. Iron overload is also a common condition, and may result from a genetic cause, for example, mutations of different genes of iron metabolism (Camaschella, C. Blood. 2005. 106: 3710-3717).
  • HFE hemochromatosis protein
  • transferrin receptor 2 Kerbata, H. et al., Blood 2005. 105: 376
  • hemojuvelin Paperanikolaou, G. et al., Nat. Genet. 2004. 36: 77
  • Transmembrane protease, serine 6 is a type II transmembrane serine protease and is expressed primarily in the liver (Velasco, G. et al., J. Biol. Chem. 2002. 277: 37637-37646). Mutations in TMPRSS6 have been implicated in iron deficiency anemia (Finberg, K. E. et al., Nat. Genet. 2008. 40: 569- 571), where the level of hepcidin was found to be unusually elevated.
  • TMPRSS6 Loss-of-function mutations in the TMPRSS6 gene lead to overproduction of hepcidin, which, in turn, lead to defective iron absorption and utilization (Melis, M.A. et al., Hematologica 2008. 93: 1473-1479).
  • TMPRSS6 participates in a transmembrane signaling pathway triggered by iron deficiency and suppresses diverse pathways of Hamp activation, the gene that encodes hepcidin (Du, X. et al., Science 2008. 320: 1088-1092).
  • Heterozygous loss of TMPRSS6 in HFE ⁇ ⁇ mice reduces systemic iron overload, while homozygous loss of TMPRSS6 in HFE ⁇ ⁇ mice causes systemic iron deficiency and elevated hepatic expression of hepcidin (Finberg, K.E. et al., Blood 2011. 117: 4590-4599).
  • An example of an iron overload disorder is Hemochromatosis.
  • Hemochromatosis e.g. hemochromatosis type 1 or hereditary hemochromatosis
  • TMPRSS6 The invention disclosed herein relates to the discovery of novel, highly potent inhibitors of TMPRSS6 expression and their use in treatment.
  • compositions, compounds and methods for modulating the levels of TMPRSS6 mRNA and/or protein in an animal are provided herein.
  • compositions, compounds and methods for lowering TMPRSS6 levels are provided herein.
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide targeting a nucleic acid sequence encoding TMPRSS6.
  • the compound targets a TMPRSS6 sequence as shown in the nucleobase sequences of any of SEQ ID NOs: 1-6.
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 3162 to 3184 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23, 36, 37, 63, 77.
  • 2'-0-methoxyethyl refers to an O-methoxy-ethyl modification of the 2' position of a furosyl ring.
  • a 2'-0-methoxyethyl modified sugar is a modified sugar.
  • 2'-0-methoxyethyl nucleotide means a nucleotide comprising a 2'-0-methoxyethyl modified sugar moiety.
  • 5-methylcytosine means a cytosine modified with a methyl group attached to the 5' position.
  • a 5- methylcytosine is a modified nucleobase.
  • ABSOR means within ⁇ 10 % of a value. For example, if it is stated, “a marker may be increased by about 50%”, it is implied that the marker may be increased between 45%-55%.
  • Active pharmaceutical agent or “Pharmaceutical agent” means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual.
  • an antisense oligonucleotide targeted to TMPRSS6 is an active pharmaceutical agent.
  • Active target region or “target region” means a region to which one or more active antisense compounds is targeted.
  • Active antisense compounds means antisense compounds that reduce target nucleic acid levels or protein levels.
  • administering refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.
  • administering means providing a pharmaceutical agent to an individual, and includes, but is not limited to administering by a medical professional and self-administering.
  • Agent means an active substance that can provide a therapeutic benefit when administered to an animal.
  • First Agent means a therapeutic compound provided herein.
  • a first agent is an antisense oligonucleotide targeting TMPRSS6.
  • Stecond agent means a second therapeutic compound described herein.
  • a second agent can be a second antisense oligonucleotide targeting TMPRSS6 or a non-TMPRSS6 target.
  • a second agent can be a compound other than an antisense oligonucleotide.
  • “Amelioration” or “ameliorate” refers to a lessening of at least one indicator, marker, sign, or symptom of an associated disease, disorder and/or condition.
  • amelioration includes a delay or slowing in the progression of one or more indicators of a condition, disorder and/or disease.
  • the severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
  • Anemia is a disease characterized by a lower than normal number of red blood cells (erythrocytes) in the blood, usually measured by a decrease in the amount of hemoglobin.
  • the cause of anemia can include chronic inflammation, chronic kidney disease, kidney dialysis treatment, genetic (hereditary) disorders, chronic infection, acute infection, cancer and cancer treatments. Altered iron homeostasis and/or
  • erythropoiesis in these diseases, disorders and/or conditions can also result in decreased erythrocyte production.
  • Clinical signs of anemia include low serum iron (hypoferremia), low hemoglobin levels, low hematocrit levels, decreased red blood cells, decreased reticulocytes, increased soluble transferrin receptor and iron restricted erythropoiesis.
  • Examples of anemia include thalassemias (i.e.
  • a-thalassemia a-thalassemia, ⁇ -thalassemia (minor, intermedia and major) and ⁇ -thalassemia), sickle cell anemia, aplastic anemia, Fanconi anemia, Diamond Blackfan anemia, Shwachman Diamond syndrome, red cell membrane disorders, glucose-6- phosphate dehydrogenase deficiency, hereditary hemorrhagic telangiectasia, hemolytic anemia, anemia of chronic disease and the like.
  • Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
  • Antibody refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region.
  • Antisense activity means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
  • Antisense compound means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • Antisense inhibition means reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • Antisense oligonucleotide means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.
  • Bicyclic sugar means a furosyl ring modified by the bridging of two non-geminal ring atoms.
  • a bicyclic sugar is a modified sugar.
  • BNA Bicyclic nucleic acid
  • BNA a nucleoside or nucleotide wherein the furanose portion of the nucleoside or nucleotide includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.
  • Blood transfusion refers to the process of receiving blood products into one's circulation intravenously. Transfusions are used in a variety of medical disease, disorder and/or conditions to replace lost blood components .
  • Cap structure or "terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
  • cEt or “constrained ethyl” means a bicyclic sugar moiety comprising a bridge connecting the 4'- carbon and the 2'-carbon, wherein the bridge has the formula: 4'-CH(CH 3 )-0-2'.
  • Consstrained ethyl nucleoside (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH 3 )-0-2' bridge.
  • “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'- O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2'-0- methoxyethyl modifications.
  • Chimeric antisense compound means an antisense compound that has at least two chemically distinct regions.
  • Co-administration means administration of two or more pharmaceutical agents to an individual.
  • the two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions.
  • Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration.
  • Co-administration encompasses concomitant, parallel or sequential administration.
  • “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
  • the first nucleic acid is an antisense compound and the second nucleic acid is a target nucleic acid.
  • Contiguous nucleobases means nucleobases immediately adjacent to each other.
  • Deoxyribonucleotide means a nucleotide having a hydrogen at the 2' position of the sugar portion of the nucleotide. Deoxyribonucleotides may be modified with any of a variety of substituents.
  • “Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable.
  • the diluent in an injected composition may be a liquid, e.g. phosphate buffered saline (PBS).
  • “Dosage unit” means a form in which a pharmaceutical agent is provided, e.g. pill, tablet, or other dosage unit known in the art.
  • a dosage unit is a vial containing lyophilized antisense oligonucleotide.
  • a dosage unit is a vial containing reconstituted antisense oligonucleotide.
  • Dose means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period.
  • a dose may be administered in one, two, or more boluses, tablets, or injections.
  • the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose.
  • the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.
  • Effective amount or “therapeutically effective amount” means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent.
  • the effective amount can vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
  • “Fully complementary” or “100% complementary” means that each nucleobase of a nucleobase sequence of a first nucleic acid has a complementary nucleobase in a second nucleobase sequence of a second nucleic acid.
  • the first nucleic acid is an antisense compound and the second nucleic acid is a target nucleic acid.
  • Gapmer means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as a "gap segment” and the external regions may be referred to as "wing segments.”
  • Gap-widened means a chimeric antisense compound having a gap segment of 12 or more contiguous 2'-deoxynucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from one to six nucleosides.
  • Hemochromatosis is a disorder of iron metabolism that results in excess iron being absorbed from the gastrointestinal tract, leading to excess iron accumulation and deposition in various tissues of the body.
  • Primary or hereditary or classic hemochromatosis is caused by a genetic mutation, for example, in the HFE gene. Subjects with this disease have excess amounts of iron, which is absorbed in the gastrointestinal tract and builds up in the body tissues, particularly in the liver.
  • Secondary or acquired hemochromatosis can be caused by frequent blood transfusions, high oral or parenteral intake of iron supplements, or a secondary effect of other diseases.
  • Hematopoiesis refers to the formation of cellular components of the blood, derived from hematopoietic stem cells. These stem cells reside in the medulla of the bone marrow and have the unique ability to give rise to all the different mature blood cell types.
  • Hemolysis refers to the rupturing of erythrocytes or red blood cells and the release of their contents into surrounding fluid. Hemolysis in an animal may occur due to a large number of medical conditions, including bacterial infection, parasitic infection, autoimmune disorders and genetic disorders.
  • Hepcidin refers to both an mRNA as well as a protein encoded by the mR A that is produced by hepatocytes in response to inflammation or to rising levels of iron in the blood.
  • the primary role of hepcidin is to regulate blood iron levels by facilitating a decrease in these blood iron levels. Hepcidin expression is increased in conditions of acute and chronic inflammation resulting in decreased iron availability for erythropoiesis.
  • Hepcidin is also referred to as hepcidin antimicrobial peptide; HAMP; HAMP1; HEPC; HFE2; LEAP-1; LEAP1; and liver-expressed antimicrobial peptide.
  • Hereditary anemia refers to anemia which is caused by a hereditary condition that causes red blood cells in the body to die faster than normal, be ineffective in transporting oxygen from the lungs to the different parts of the body, or not be created at all. Examples include, but are not limited to, sickle cell anemia, thalassemia, Fanconi anemia, Diamond Blackfan anemia, Shwachman Diamond syndrome, red cell membrane disorders, glucose-6-phosphate dehydrogenase deficiency, or hereditary hemorrhagic
  • HFE refers to the human hemochromatosis gene or protein.
  • HFE gene mutation refers to mutations in the HFE gene, which may result in hereditary hemochromatosis.
  • Hybridization means the annealing of complementary nucleic acid molecules.
  • complementary nucleic acid molecules include an antisense compound and a target nucleic acid.
  • Identifying an animal at risk for or having a disease, disorder and/or condition associated with excess accumulation of iron means identifying an animal having been diagnosed with a disease, disorder and/or condition or identifying an animal predisposed to develop a disease, disorder and/or condition associated with excess accumulation of iron. For example, an animal can be predisposed to develop a disease, disorder and/or condition associated with excess accumulation of iron if the animal has a family history of hemochromatosis. Such identification may be accomplished by any method including evaluating an animal's medical history and standard clinical tests or assessments.
  • “Individual” or “subject” or “animal” means a human or non-human animal selected for treatment or therapy. “Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity of a RNA or protein and does not necessarily indicate a total elimination of expression or activity.
  • Internucleoside linkage refers to the chemical bond between nucleosides.
  • Intravenous administration means administration into a vein.
  • Iron accumulation indicates accumulation and deposition of iron in the body from any cause.
  • the most common causes are hereditary causes, transfusional iron overload, which can result from repeated blood transfusions, or excessive dietary iron intake.
  • Iron supplements refer to supplements prescribed for a medical reason to treat iron deficiency in a patient. Iron can be supplemented by the oral route or given parenterally.
  • Linked nucleosides means adjacent nucleosides which are bonded together.
  • Marker or “biomarker” is any measurable and quantifiable biological parameter that serves as an index for health- or physiology-related assessments. For example, an increase in the percentage saturation of transferrin, an increase in iron levels, or a decrease in hepcidin levels can be considered markers of an iron overload disease, disorder and/or condition.
  • MCH refers to "mean corpuscular hemoglobin” or “mean cell hemoglobin”, a value to express the average mass of hemoglobin (Hb) per red blood cell in a sample of blood.
  • MCV refers to "mean corpuscular volume” or “mean cell volume”, a value to express the average red blood cell size.
  • mismatch or “non-complementary nucleobase” or “MM” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
  • Modified internucleoside linkage refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).
  • Modified nucleobase refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil.
  • a modified nucleobase can be 5-methylcytosine.
  • An "unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
  • Modified nucleoside means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.
  • Modified nucleotide means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, and/or modified nucleobase.
  • Modified oligonucleotide means an oligonucleotide comprising a modified internucleoside linkage, a modified sugar, and/or a modified nucleobase.
  • Modified sugar refers to a substitution or change from a natural sugar.
  • a modified sugar can be 2'-MOE.
  • Modulating refers to changing or adjusting a feature in a cell, tissue, organ or organism.
  • modulating TMPRSS6 level can mean to increase or decrease the level of TMPRSS6 mRNA or TMPRSS6 protein in a cell, tissue, organ or organism.
  • a “modulator” effects the change in the cell, tissue, organ or organism.
  • a TMPRSS6 antisense oligonucleotide can be a modulator that increases or decreases the amount of TMPRSS6 mRNA or TMPRSS6 protein in a cell, tissue, organ or organism.
  • “Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occuring or modified.
  • Microtif means the pattern of chemically distinct regions in an antisense compound.
  • Mutations refer to changes in a nucleic acid sequence. Mutations can be caused in a variety of ways including, but not limited to, radiation, viruses, transposons and mutagenic chemicals, as well as errors that occur during meiosis, DNA replication, RNA transcription and post-transcriptional processing. Mutations can result in several different changes in sequence; they can have either no effect, alter the product of a gene, or prevent the gene from functioning properly or completely. For example, HFE mutation can lead to the improper functioning of the gene product, leading to excess iron absorption in the intestines.
  • Myelodysplastic syndrome refers to a diverse collection of hematological medical disease, disorder and/or conditions that involve ineffective production of the myeloid class of blood cells.
  • the syndrome is caused by disorders of the stem cells in the bone marrow.
  • myelodysplastic syndrome hematopoiesis is ineffective and the number and quality of blood cells decline irreversibly, further impairing blood production.
  • patients with myelodysplastic syndrome develop severe anemia and require frequent blood transfusions.
  • Naturally occurring internucleoside linkage means a 3' to 5' phosphodiester linkage.
  • Natural sugar moiety means a sugar found in DNA (2 ' -H) or RNA (2 ' -OH) .
  • Nucleic acid refers to molecules composed of monomelic nucleotides.
  • a nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).
  • RNA ribonucleic acids
  • DNA deoxyribonucleic acids
  • siRNA small interfering ribonucleic acids
  • miRNA microRNAs
  • Nucleobase means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
  • Nucleobase sequence means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.
  • Nucleoside means a nucleobase linked to a sugar.
  • Nucleoside mimetic includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound; such as, for example, nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics e.g. non furanose sugar units.
  • Nucleotide means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
  • Oligomeric compound or oligomer refers to a polymeric structure comprising two or more substructures (monomers) and capable of hybridizing to a region of a nucleic acid molecule.
  • oligomeric compounds are oligonucleosides.
  • oligomeric compounds are oligonucleotides.
  • oligomeric compounds are antisense compounds.
  • oligomeric compounds are antisense oligonucleotides.
  • oligomeric compounds are chimeric oligonucleotides.
  • Oligonucleotide means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
  • Parenteral administration means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular
  • Administration can be continuous, or chronic, or short or intermittent.
  • Peptide refers to a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins.
  • Percentage saturation of transferrin refers to the ratio of serum iron to total iron binding capacity multiplied by 100. Of the transferrin molecules that are available to bind iron, this value tells a clinician how much serum iron are actually bound.
  • “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual.
  • a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.
  • “Pharmaceutically acceptable carrier” means a medium or diluent that does not interfere with the structure of the oligonucleotide. Certain of such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.
  • a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS.
  • “Pharmaceutically acceptable derivative” encompasses pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.
  • “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart unde sired toxicological effects thereto.
  • Phosphorothioate linkage means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom.
  • a phosphorothioate linkage is a modified internucleoside linkage.
  • Polycythemia refers to a condition of increased red blood cells (RBCs) in a specified volume due to either an increase in red blood cell numbers (absolute polycythemia) or a decrease in plasma volume (relative polycythemia). Blood volume to red blood cell proportions can be measured as Hematocrit (Hct) levels. The increased proportion of RBCs can make the blood viscous which can lead to slower blood flow through the circulatory system and potential formation of blood clots. Slower blood flow can decrease oxygen transport to cells, tissue and/or organs leading to diseases, disorders or conditions such as angina or heart failure.
  • RBCs red blood cells
  • Hct Hematocrit
  • polycythemia can progress into erythroid leukemia in a subject.
  • Portion means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
  • Prevent refers to delaying or forestalling the onset, development, or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.
  • Prodrug means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.
  • Side effects means physiological responses attributable to a treatment other than the desired effects.
  • side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise.
  • increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality.
  • Single-stranded oligonucleotide means an oligonucleotide which is not hybridized to a
  • Specifically hybridizable refers to an antisense compound having a sufficient degree of complementarity with a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays and therapeutic treatments.
  • Subcutaneous administration means administration just below the skin.
  • Targeting or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
  • Target nucleic acid “target R A,” and “target RNA transcript” all refer to a nucleic acid capable of being targeted by antisense compounds.
  • Target segment means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted.
  • 5' target site refers to the 5'-most nucleotide of a target segment.
  • 3' target site refers to the 3 '-most nucleotide of a target segment.
  • Thalassemia refers to a subgroup of anemias (e.g., a-thalassemia, ⁇ -thalassemia, ⁇ -thalassemia, non-transfusion dependent thalassemia (NTDT)) caused by the formation of abnormal hemoglobin molecules leading to the destruction or degradation of red blood cells.
  • Complications of thalassemia include excess iron (i.e. iron overload in the blood either from the thalassemia itself or from frequent transfusions to treat the thalassemia), increased risk of infection, bone deformities, enlarged spleens (i.e. splenomegaly), slowed growth rates and heart problems (e.g., congestive heart failure and arrhythmias).
  • “Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an animal.
  • TMPRSS6 (also known as “matriptase-2”) refers to any nucleic acid or protein of TMPRSS6.
  • TMPRSS6 nucleic acid means any nucleic acid encoding TMPRSS6.
  • a TMPRSS6 nucleic acid includes a DNA sequence encoding TMPRSS6, a RNA sequence transcribed from DNA encoding TMPRSS6 (including genomic DNA comprising introns and exons), and a mRNA sequence encoding TMPRSS6.
  • TMPRSS6 mRNA means a mRNA encoding a TMPRSS6 protein.
  • TMPRSS6 specific inhibitor refers to any agent capable of specifically inhibiting the expression of TMPRSS6 gene, TMPRSS6 RNA and/or TMPRSS6 protein at the molecular level.
  • TMPRSS6 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the level of TMPRSS6.
  • TMPRSS6 specific inhibitors may affect components of the iron accumulation pathway.
  • Treat refers to administering a pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.
  • one or more pharmaceutical compositions can be administered to the animal.
  • Unmodified nucleotide means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages.
  • an unmodified nucleotide is an RNA nucleotide (i.e. ⁇ -D-ribonucleotide) or a DNA nucleotide (i.e. ⁇ -D-deoxyribonucleotide).
  • TMPRSS6 has the sequence as set forth in: GenBank Accession No. NM_153609.2 (incorporated herein as SEQ ID NO: 1); the complement of GENBANK Accession NT_011520.12 truncated from 16850000 to 16897000 (incorporated herein as SEQ ID NO: 2); GENBANK Accession CR456446.1 (incorporated herein as SEQ ID NO: 3); GENBANK Accession No. BC039082.1 (incorporated herein as SEQ ID NO: 4); GENBANK Accession No. AY358398.1 (incorporated herein as SEQ ID NO: 5); and GENBANK Accession No. DB081153.1 (incorporated herein as SEQ ID NO: 6).
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide targeting a nucleic acid sequence encoding TMPRSS6.
  • the compound targets a TMPRSS6 sequence as shown in the nucleobase sequences of any of SEQ ID NOs: 1-6.
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8, least 9, least 10, least 11, at least 12, least 13, at least 14, at least 15, at least 16, least 17, least 18, least 19, or 20 contiguous nucleobases complementary to an equal length portion of SEQ ID NOs: 1-6.
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 3162 to 3184 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 1286 to 1305 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 3162 to 3184 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 1286 to 1305 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-85.
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23, 36, 37, 63, 77.
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of SEQ ID NO: 36.
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of SEQ ID NO: 77.
  • the nucleobase sequence of the modified oligonucleotide is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of any of SEQ ID NOs: 1-6.
  • the modified oligonucleotide comprises a nucleobase sequence 100% complementary to an equal length portion of any of SEQ ID NOs: 1-6.
  • the compound comprises a modified oligonucleotide consisting of 8 to 80, 20 to 80, 10 to 50, 20 to 35, 10 to 30, 12 to 30, 15 to 30, 16 to 30, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 15 to 25, 16 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 19 to 22, 16 to 21, 18 to 21 or 16 to 20 linked nucleobases.
  • the compound comprises a modified oligonucleotide consisting of 16 linked nucleosides.
  • the compound comprises a modified oligonucleotide consisting of 20 linked nucleosides.
  • the compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values.
  • the modified oligonucleotide is single -stranded.
  • the modified oligonucleotide comprises at least one modified
  • the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage. In certain embodiments, at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage. In certain embodiments, each modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • the modified oligonucleotide comprises at least one nucleoside comprising a modified sugar.
  • at least one modified sugar comprises a bicyclic sugar.
  • at least one modified sugar comprises a 2'-0-methoxyethyl, a constrained ethyl, a 3 '-fluoro- HNA or a 4'- (CH 2 ) n -0-2' bridge, wherein n is 1 or 2.
  • the modified oligonucleotide comprises at least one nucleoside comprising a modified nucleobase.
  • the modified nucleobase is a 5-methylcytosine.
  • the modified oligonucleotide comprises a conjugate group.
  • the conjugate is a carbohydrate moiety.
  • the conjugate is a GalNAc moiety.
  • the GalNAc is 5'-Trishexylamino-(THA)-C6 GalNAc 3 .
  • the conjugate has the formula
  • the compound comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides and targeted to or complementary to an equal length portion ofregion 3162 to 3184 of SEQ ID NO: 1, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5 ' wing segment consisting of linked nucleosides; and (c) a 3 ' wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5 ' wing segment and the 3 ' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
  • the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5 ' wing segment consisting of linked nucleosides; and (c) a 3 ' wing segment consisting of linked nucleosides; wherein the
  • the modified oligonucleotide further comprises at least one phosphorothioate internucleoside linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5'-Trishexylamino-(THA)-C6 GalNAc 3 conjugate.
  • the compound comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides and targeted to or complementary to an equal length portion of region 1286 to 1305 of SEQ ID NO: 1, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5 ' wing segment consisting of linked nucleosides; and (c) a 3 ' wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5 ' wing segment and the 3 ' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
  • the modified oligonucleotide comprises: (a) a gap segment consisting of linked deoxynucleosides; (b) a 5 ' wing segment consisting of linked nucleosides; and (c) a 3 ' wing segment consisting of linked nucleosides; wherein the
  • the modified oligonucleotide further comprises at least one phosphorothioate intemucleoside linkage. In certain embodiments, the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiments, the conjugate is a 5'-Trishexylamino-(THA)-C6 GalNAc 3 conjugate.
  • the compound comprises a modified oligonucleotide consisting of 20 linked nucleosides and targeted to or complementary to an equal length portion of region 3162 to 3181 of SEQ ID NO: 1, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of ten linked deoxynucleosides; (b) a 5' wing segment consisting of five linked nucleosides; and (c) a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5 ' wing segment and the 3 ' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, wherein at least one intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine.
  • the modified oligonucleotide further comprises a GalNAc conjug
  • the compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and targeted to or complementary to an equal length portion of region 3169 to 3184 of SEQ ID NO: 1, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of nine linked deoxynucleosides; (b) a 5' wing segment consisting of three linked nucleosides; and (c) a 3' wing segment consisting of four linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5 ' wing segment and the 3 ' wing segment, wherein each nucleoside of each wing segment comprises a modified sugar, wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine.
  • the modified oligonucleotide further comprises a GalNAc conjugate.
  • the conjugate is a
  • the compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of SEQ ID NO: 36, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of ten linked deoxynucleosides; (b) a 5' wing segment consisting of five linked nucleosides; and (c) a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5 ' wing segment and the 3 ' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar, wherein at least one intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine.
  • the modified oligonucleotide further comprises: (a) a
  • the compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of SEQ ID NO: 77, wherein the modified oligonucleotide comprises: (a) a gap segment consisting of nine linked deoxynucleosides; (b) a 5' wing segment consisting of three linked nucleosides; and (c) a 3' wing segment consisting of four linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5 ' wing segment and the 3 ' wing segment, wherein each nucleoside of each wing segment comprises a modified sugar, wherein each intemucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine.
  • the modified oligonucleotide further comprises a GalNAc conjugate. In certain embodiment
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide according to the following formula: mCes Teo Teo Teo Aeo Tds Tds mCds mCds Ads Ads Ads Gds Gds Gds mCeo Aeo Ges mCes Te (SEQ ID NO: 36); wherein, A is an adenine, mC is a 5-methylcytosine, G is a guanine, T is a thymine, e is a 2 '-O-methoxy ethyl modified nucleoside, d is a 2 '-deoxynucleoside, and s is a phosphorothioate intemucleoside linkage.
  • the modified oligonucleotide further comprises a GalNAc conjugate.
  • the conjugate is a 5'-Trishexylamino-(THA)
  • Certain embodiments disclosed herein provide a compound comprising a modified oligonucleotide according to the following formula: mCks Aes Gks mCds Tds Tds Tds Ads Tds Tds mCds mCds Aes Aes Aks Gk (SEQ ID NO: 77); wherein, A is an adenine, mC is a 5-methylcytosine, G is a guanine, T is a thymine, e is a 2 '-O-methoxyethyl modified nucleoside, d is a 2' -deoxynucleoside, s is a phosphorothioate internucleoside linkage, and k is a cEt.
  • the modified oligonucleotide further comprises a GalNAc conjugate.
  • the conjugate is a 5'-Trishexylamino-(THA
  • the compounds or compositions disclosed herein comprise a salt of the modified oligonucleotide.
  • the compounds or compositions disclosed herein further comprise a pharmaceutically acceptable carrier or diluent.
  • the animal is a human.
  • compositions or compounds comprising a modified oligonucleotide as described herein, wherein the viscosity level is less than 40 cP. In certain embodiments, the composition has a viscosity level less than 15 cP. In certain embodiments, the composition has a viscosity level less than 12 cP. In certain embodiments, the composition has a viscosity level less than 10 cP.
  • Certain embodiments disclosed herein provide compounds and compositions comprising a modified oligonucleotide targeting TMPRSS6 for use in reducing TMPRSS6 in a cell, tissue, organ or animal. Certain embodiments disclosed herein provide compounds and compositions comprising a modified oligonucleotide targeting TMPRSS6 for use in reducing iron levels in a cell, tissue, organ or animal. In certain embodiments, the compounds and compositions reduce serum iron levels. In certain embodiments, the compounds and compositions reduce liver iron levels. In certain embodiments, the compounds and compositions reduce iron absorption. In certain embodiments, the compounds and compositions reduce iron overload or accumulation. In certain embodiments, reducing iron overload/accumulation ameliorates, treats, prevents or delays a disease, disorder or condition related to iron overload.
  • Certain embodiments disclosed herein provide compounds and compositions comprising a modified oligonucleotide targeting TMPRSS6 for use in increasing hepcidin levels, such as mRNA or protein expression levels, in an animal.
  • Certain embodiments disclosed herein provide compounds and compositions comprising a modified oligonucleotide targeting TMPRSS6 for use in decreasing the percentage saturation of transferrin in an animal.
  • decreasing transferrin saturation leads to a decrease in iron supply for erythropoiesis.
  • the decrease in erythropoiesis treats, prevents, delays the onset of, ameliorates, and/or reduces polycythemia, or symptom thereof, in the animal.
  • the polycythemia is polycythemia vera.
  • treatment with the modified oligonucleotide targeting TMPRSS6 prevents or delays the polycythemia from progressing into erythroid leukemia.
  • Certain embodiments disclosed herein provide compounds and compositions comprising a modified oligonucleotide targeting TMPRSS6 for reducing iron accumulation in an animal.
  • compounds and compositions comprising a modified oligonucleotide targeting TMPRSS6 are used for treating, preventing, slowing the progression, delaying the onset of, ameliorating and/or reducing a disease, disorder and/or condition, or symptom thereof, associated with the excess accumulation of iron in an animal.
  • the iron accumulation is the result of, or cause of, a disease, disorder or condition in the animal. In certain embodiments, the disease, disorder or condition is ineffective
  • the hemochromatosis is hereditary hemochromatosis.
  • the anemia is hereditary anemia, myelodysplastic syndrome or severe chronic hemolysis.
  • the hereditary anemia is sickle cell anemia, thalassemia, Fanconi anemia, Diamond Blackfan anemia, Shwachman Diamond syndrome, red cell membrane disorders, glucose-6-phosphate dehydrogenase deficiency, or hereditary hemorrhagic
  • the thalassemia is ⁇ -thalassemia. In certain embodiments, the ⁇ - thalassemia is ⁇ -thalassemia major, ⁇ -thalassemia intermedia or ⁇ -thalassemia minor. In certain
  • the disease, disorder or condition is associated with mutations in the HFE gene. In other embodiments, the disease is associated with mutations in the hemojuvelin gene. In other embodiments, the disease is associated with mutations in the hepcidin gene.
  • the iron accumulation is the result of a therapy to treat a disease, disorder or condition in the animal.
  • the therapy is phlebotomy or transfusion therapy.
  • the disease, disorder and/or condition may be due to multiple blood transfusions.
  • multiple transfusions may lead to polycythemia.
  • multiple blood transfusions are associated with the animal having anemia. Examples of anemia requiring multiple blood transfusions are hereditary anemia, myelodysplastic syndrome and severe chronic hemolysis.
  • the disease, disorder and/or condition is associated with excess parenteral iron supplement intake or excess dietary iron intake.
  • the compounds and compositions comprising a modified oligonucleotide targeting TMPRSS6 are administered to an animal in a therapeutically effective amount.
  • the medicament is used for treating, preventing, slowing the progression, delaying the onset of, and/or reducing a disease, disorder and/or condition, or symptom thereof, associated with excess accumulation of iron in an animal.
  • the composition or compound comprising a modified oligonucleotide targeting TMPRSS6 is co-administered with one or more second agent(s).
  • the second agent is an iron chelator or a hepcidin agonist.
  • the iron chelator includes FBS0701 (FerroKin), Exjade, Desferal or Deferiprone (DFP).
  • the second agent is a second antisense compound.
  • the second antisense compound targets TMPRSS6.
  • the second antisense compound targets a non-TMPRSS6 compound.
  • the composition or compound comprising a modified oligonucleotide targeting TMPRSS6 is administered before, during or after phlebotomy or transfusion therapy.
  • Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs.
  • An oligomeric compound can be "antisense" to a target nucleic acid, meaning that it is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • an antisense compound has a nucleobase sequence that, when written in the
  • an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense compound targeted to TMPRSS6 nucleic acid is 10 to 30 nucleotides in length.
  • antisense compounds are from 10 to 30 linked nucleobases.
  • the antisense compound comprises a modified oligonucleotide consisting of 8 to 80, 10 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked nucleobases.
  • the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values.
  • the antisense compound is an antisense oligonucleotide.
  • the antisense compound comprises a shortened or truncated modified oligonucleotide.
  • the shortened or truncated modified oligonucleotide can have a single nucleoside deleted from the 5' end (5' truncation), the central portion or alternatively from the 3' end (3' truncation).
  • a shortened or truncated oligonucleotide can have two or more nucleosides deleted from the 5' end, two or more nucleosides deleted from the central portion or alternatively can have two or more nucleosides deleted from the 3' end.
  • the deleted nucleosides can be dispersed throughout the modified
  • oligonucleotide for example, in an antisense compound having one or more nucleoside deleted from the 5' end, one or more nucleoside deleted from the central portion and/or one or more nucleoside deleted from the 3' end.
  • the additional nucleoside can be located at the 5' end, 3' end or central portion of the oligonucleotide.
  • the added nucleosides can be adjacent to each other, for example, in an oligonucleotide having two nucleosides added to the 5' end (5' addition), to the 3' end (3' addition) or the central portion, of the oligonucleotide.
  • the added nucleoside can be dispersed throughout the antisense compound, for example, in an oligonucleotide having one or more nucleoside added to the 5' end, one or more nucleoside added to the 3' end, and/or one or more nucleoside added to the central portion.
  • an antisense compound such as an antisense oligonucleotide
  • an antisense oligonucleotide it is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity.
  • an antisense compound such as an antisense oligonucleotide
  • a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
  • Gautschi et al J. Natl. Cancer Inst. 93:463-471, March 2001
  • oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this
  • oligonucleotide demonstrated potent anti -tumor activity in vivo.
  • Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay.
  • Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.
  • antisense compounds have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
  • Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
  • a second region of a chimeric antisense compound may confer another desired property e.g., serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
  • Antisense activity may result from any mechanism involving the hybridization of the antisense compound (e.g., oligonucleotide) with a target nucleic acid, wherein the hybridization ultimately results in a biological effect.
  • the amount and/or activity of the target nucleic acid is modulated.
  • the amount and/or activity of the target nucleic acid is reduced.
  • hybridization of the antisense compound to the target nucleic acid ultimately results in target nucleic acid degradation.
  • hybridization of the antisense compound to the target nucleic acid does not result in target nucleic acid degradation.
  • the presence of the antisense compound hybridized with the target nucleic acid results in a modulation of antisense activity.
  • antisense compounds having a particular chemical motif or pattern of chemical modifications are particularly suited to exploit one or more mechanisms.
  • antisense compounds function through more than one mechanism and/or through mechanisms that have not been elucidated. Accordingly, the antisense compounds described herein are not limited by particular mechanism.
  • Antisense mechanisms include, without limitation, RNase H mediated antisense; RNAi mechanisms, which utilize the RISC pathway and include, without limitation, siRNA, ssRNA and microRNA mechanisms; and occupancy based mechanisms. Certain antisense compounds may act through more than one such mechanism and/or through additional mechanisms.
  • antisense activity results at least in part from degradation of target RNA by RNase H.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNase H activity in mammalian cells. Accordingly, antisense compounds comprising at least a portion of DNA or DNA-like nucleosides may activate RNase H, resulting in cleavage of the target nucleic acid.
  • antisense compounds that utilize RNase H comprise one or more modified nucleosides. In certain embodiments, such antisense compounds comprise at least one block of 1-8 modified nucleosides.
  • the modified nucleosides do not support RNase H activity.
  • such antisense compounds are gapmers, as described herein.
  • the gap of the gapmer comprises DNA nucleosides.
  • the gap of the gapmer comprises DNA-like nucleosides.
  • the gap of the gapmer comprises DNA nucleosides and DNA-like nucleosides.
  • Certain antisense compounds having a gapmer motif are considered chimeric antisense compounds.
  • a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region.
  • the gap segment In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides.
  • the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
  • sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include ⁇ -D-ribonucleosides, ⁇ -D-deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides may include 2'-MOE and 2'-0-CH 3 , among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a constrained ethyl).
  • nucleosides in the wings may include several modified sugar moieties, including, for example 2'-MOE and bicyclic sugar moieties such as constrained ethyl (cEt) or LNA.
  • wings may include several modified and unmodified sugar moieties.
  • wings may include various combinations of 2'-MOE nucleosides, bicyclic sugar moieties such as constrained ethyl nucleosides or LNA nucleosides, and 2'-deoxynucleosides.
  • Each distinct region may comprise uniform sugar moieties, variant, or alternating sugar moieties.
  • the wing-gap-wing motif is frequently described as "X-Y-Z", where "X” represents the length of the 5'- wing, "Y” represents the length of the gap, and “Z” represents the length of the 3 '-wing.
  • "X” and “Z” may comprise uniform, variant, or alternating sugar moieties.
  • "X" and ⁇ " may include one or more 2'-deoxynucleosides.
  • "Y” may comprise 2'-deoxynucleosides.
  • a gapmer described as "X-Y-Z” has a configuration such that the gap is positioned immediately adjacent to each of the 5'-wing and the 3' wing. Thus, no intervening nucleotides exist between the 5'-wing and gap, or the gap and the 3 '-wing.
  • Any of the antisense compounds described herein can have a gapmer motif.
  • "X” and “Z” are the same; in other embodiments they are different.
  • ' ⁇ " is between 8 and 15 nucleosides.
  • X, Y, or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleosides.
  • the antisense compound targeted to a TMPRSS6 nucleic acid has a gapmer motif in which the gap consists of 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, or 16 linked nucleosides.
  • the antisense oligonucleotide has a sugar motif described by Formula A as follows: (J) m -(B) n -(J) p -(B) r -(A) t -(D) g -(A) v -(B) w -(J) x -(B) y -(J) z
  • each A is independently a 2'-substituted nucleoside
  • each B is independently a bicyclic nucleoside
  • each J is independently either a 2' -substituted nucleoside or a 2'-deoxynucleoside;
  • each D is a 2'-deoxynucleoside
  • At least one of m, n, and r is other than 0;
  • At least one of w and y is other than 0;
  • antisense compounds are interfering R A compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single- stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). In certain embodiments, antisense compounds comprise modifications that make them particularly suited for such mechanisms.
  • RNAi interfering R A compounds
  • siRNA double-stranded RNA compounds
  • ssRNAi compounds single- stranded RNAi compounds
  • antisense compounds including those particularly suited for use as single- stranded RNAi compounds (ssRNA) comprise a modified 5 '-terminal end.
  • the 5 '-terminal end comprises a modified phosphate moiety.
  • such modified phosphate is stabilized (e.g., resistant to degradation/cleavage compared to unmodified 5 '-phosphate).
  • such 5 '-terminal nucleosides stabilize the 5 '-phosphorous moiety.
  • Certain modified 5 '- terminal nucleosides may be found in the art, for example in WO 201 1/139702.
  • the 5 '-nucleoside of an ssRNA compound has Formula lie:
  • Ti is an optionally protected phosphorus moiety
  • T 2 is an internucleoside linking group linking the compound of Formula lie to the olig
  • A has one of the formulas:
  • Qi and Q 2 are each, independently, H, halogen, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, Ci-C 6 alkoxy, substituted Ci-C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 2 -C 6 alkynyl or N(R 3 )(R 4 );
  • Q 3 is O, S, N(R 5 ) or CCReXRv);
  • each R 3 , R4 R 5 , 5 and R 7 is, independently, H, Ci-C 6 alkyl, substituted Ci-C 6 alkyl or Ci-C 6 alkoxy;
  • Ri4 is H, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, Ci-C 6 alkoxy, substituted Ci-C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • Ri5, Ri6, Ri7 and R i8 are each, independently, H, halogen, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, Ci-C 6 alkoxy, substituted Ci-C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C alkynyl;
  • Bxi is a heterocyclic base moiety
  • Bx 2 is a heterocyclic base moiety and Bxi is H, halogen, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, Ci-C 6 alkoxy, substituted Ci-C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 - C ⁇ 5 alkynyl or substituted C 2 -C 6 alkynyl;
  • J 4 , J 5 , J 6 and J 7 are each, independently, H, halogen, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, Ci-C 6 alkoxy, substituted Ci-C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C alkynyl;
  • each R 19 , R 20 and R 2i is, independently, H, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, Ci-C 6 alkoxy, substituted Ci-C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • each R g and R 9 is, independently, H, halogen, Ci-C 6 alkyl or substituted Ci-C 6 alkyl;
  • X ! is O, S or N(E ;
  • Z is H, halogen, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 2 -C 6 alkynyl or N(E 2 )(E 3 );
  • Ei, E 2 and E 3 are each, independently, H, Ci-C 6 alkyl or substituted Ci-C 6 alkyl;
  • n is from 1 to about 6;
  • n 0 or 1 ;
  • j is 0 or 1 ;
  • X 2 is O, S or NJ 3 ;
  • each Ji, J 2 and J 3 is, independently, H or Ci-C 6 alkyl
  • said oligomeric compound comprises from 8 to 40 monomelic subunits and is hybridizable to at least a portion of a target nucleic acid.
  • J 4 , J 5 , J 6 and J 7 are each H. In certain embodiments, J 4 forms a bridge with one of J 5 or J 7 .
  • Qi and Q 2 are each, independently, H, halogen, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, Ci-C 6 alkoxy or substituted Ci-C 6 alkoxy.
  • Qi and Q 2 are each H.
  • Qi and Q 2 are each, independently, H or halogen.
  • Qi and Q 2 is H and the other of Qi and Q 2 is F, CH 3 or OCH 3 .
  • Ti has the formula:
  • R a and R e are each, independently, protected hydroxyl, protected thiol, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, Ci-C 6 alkoxy, substituted Ci-C 6 alkoxy, protected amino or substituted amino; and
  • R is O or S.
  • R 3 ⁇ 4 is O and R a and R e are each, independently, OCH 3 , OCH 2 CH 3 or CH(CH 3 ) 2 .
  • G is F, OCH 3 or 0(CH 2 ) 2 -OCH 3 .
  • G is 0(CH 2 ) 2 -OCH 3 .
  • antisense compounds including those particularly suitable for ssRNA comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif.
  • Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.
  • the oligonucleotides comprise or consist of a region having uniform sugar modifications.
  • each nucleoside of the region comprises the same RNA-like sugar modification.
  • each nucleoside of the region is a 2'-F nucleoside.
  • each nucleoside of the region is a 2'-OMe nucleoside.
  • each nucleoside of the region is a 2'-MOE nucleoside.
  • each nucleoside of the region is a cEt nucleoside.
  • each nucleoside of the region is an LNA nucleoside.
  • the uniform region constitutes all or essentially all of the oligonucleotide. In certain embodiments, the region constitutes the entire oligonucleotide except for 1-4 terminal nucleosides. In certain embodiments, oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type. In certain embodiments, nucleosides of both types are R A-like nucleosides. In certain embodiments the alternating nucleosides are selected from: 2'-OMe, 2'-F, 2'-MOE, LNA, and cEt. In certain embodiments, the alternating modificatios are 2'-F and 2'- OMe. Such regions may be contiguous or may be interupted by differently modified nucleosides or conjugated nucleosides.
  • the alternating region of alternating modifications each consist of a single nucleoside (i.e., the patern is (AB) x A y wheren A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1).
  • one or more alternating regions in an alternating motif includes more than a single nucleoside of a type.
  • oligonucleotides may include one or more regions of any of the following nucleoside motifs:
  • A is a nucleoside of a first type and B is a nucleoside of a second type.
  • a and B are each selected from 2'-F, 2'-OMe, BNA, and MOE.
  • oligonucleotides having such an alternating motif also comprise a modified 5' terminal nucleoside, such as those of formula lie or He.
  • oligonucleotides comprise a region having a 2-2-3 motif. Such regions comprises the following motif:
  • A is a first type of modifed nucleosde
  • B and C are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another;
  • x and y are from 1 to 15.
  • A is a 2'-OMe modified nucleoside.
  • B and C are both 2'-F modified nucleosides.
  • A is a 2'-OMe modified nucleoside and B and C are both 2'-F modified nucleosides.
  • oligonucleosides have the following sugar motif:
  • Q is a nucleoside comprising a stabilized phosphate moiety.
  • Q is a nucleoside having Formula lie or He;
  • A is a first type of modifed nucleoside
  • B is a second type of modified nucleoside
  • D is a modified nucleoside comprising a modification different from the nucleoside adjacent to it. Thus, if y is 0, then D must be differently modified than B and if y is 1, then D must be differently modified than A. In certain embodiments, D differs from both A and B.
  • X is 5-15;
  • Y is O or l
  • Z is 0-4.
  • oligonucleosides have the following sugar motif:
  • Q is a nucleoside comprising a stabilized phosphate moiety.
  • Q is a nucleoside having Formula lie or He;
  • A is a first type of modifed nucleoside
  • D is a modified nucleoside comprising a modification different from A.
  • X is 11-30;
  • Z is 0-4.
  • A, B, C, and D in the above motifs are selected from: 2'-OMe, 2'-F, 2'- MOE, LNA, and cEt.
  • D represents terminal nucleosides. In certain embodiments, such terminal nucleosides are not designed to hybridize to the target nucleic acid (though one or more might hybridize by chance).
  • the nucleobase of each D nucleoside is adenine, regardless of the identity of the nucleobase at the corresponding position of the target nucleic acid. In certain embodiments the nucleobase of each D nucleoside is thymine.
  • antisense compounds comprising those particularly suited for use as ssRNA comprise modified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified intemucleoside linkage motif.
  • oligonucleotides comprise a region having an alternating intemucleoside linkage motif.
  • oligonucleotides comprise a region of uniformly modified intemucleoside linkages.
  • the oligonucleotide comprises a region that is uniformly linked by phosphorothioate intemucleoside linkages.
  • the oligonucleotide is uniformly linked by phosphorothioate intemucleoside linkages.
  • each intemucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate.
  • each intemucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one intemucleoside linkage is phosphorothioate.
  • the oligonucleotide comprises at least 6 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate intemucleoside linkages.
  • the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least one 12 consecutive phosphorothioate intemucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3' end of the oligonucleotide.
  • Oligonucleotides having any of the various sugar motifs described herein may have any linkage motif.
  • the oligonucleotides including but not limited to those described above, may have a linkage motif selected from non-limiting the table below:
  • antisense compounds are double-stranded R Ai compounds (siRNA).
  • one or both strands may comprise any modification motif described above for ssRNA.
  • ssRNA compounds may be unmodified R A.
  • siRNA compounds may comprise unmodified RNA nucleosides, but modified intemucleoside linkages.
  • compositions comprising a first and a second oligomeric compound that are fully or at least partially hybridized to form a duplex region and further comprising a region that is complementary to and hybridizes to a nucleic acid target. It is suitable that such a composition comprise a first oligomeric compound that is an antisense strand having full or partial complementarity to a nucleic acid target and a second oligomeric compound that is a sense strand having one or more regions of complementarity to and forming at least one duplex region with the first oligomeric compound.
  • compositions of several embodiments modulate gene expression by hybridizing to a nucleic acid target resulting in loss of its normal function.
  • the target nucleic acid is TMPRSS6.
  • the degradation of the targeted TMPRSS6 is facilitated by an activated RISC complex that is formed with compositions of the invention.
  • compositions of the present invention are directed to double-stranded compositions wherein one of the strands is useful in, for example, influencing the preferential loading of the opposite strand into the RISC (or cleavage) complex.
  • the compositions are useful for targeting selected nucleic acid molecules and modulating the expression of one or more genes.
  • the compositions of the present invention hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA.
  • compositions of the present invention can be modified to fulfil a particular role in for example the siRNA pathway.
  • Using a different motif in each strand or the same motif with different chemical modifications in each strand permits targeting the antisense strand for the RISC complex while inhibiting the incorporation of the sense strand.
  • each strand can be independently modified such that it is enhanced for its particular role.
  • the antisense strand can be modified at the 5 '-end to enhance its role in one region of the RISC while the 3'-end can be modified differentially to enhance its role in a different region of the RISC.
  • the double-stranded oligonucleotide molecules can be a double -stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the double-stranded oligonucleotide molecules can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e.
  • each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double-stranded structure, for example wherein the double-stranded region is about 15 to about 30, e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs; the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof (e.g., about 15 to about 25 or more nucleotides of the double -stranded oligonucleotide molecule are complementary to the target nucleic acid or a portion thereof).
  • the double -stranded oligonucleotide is assembled from a single oligonucleotide, where the self- complementary sense and antisense regions of the siRNA are linked by means of a nucleic acid based or non- nucleic acid-based linker(s).
  • the double -stranded oligonucleotide can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the double -stranded oligonucleotide can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNAi.
  • the double -stranded oligonucleotide comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non- nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic interactions, and/or stacking interactions.
  • the double-stranded oligonucleotide comprises nucleotide sequence that is complementary to nucleotide sequence of a target gene.
  • the double-stranded oligonucleotide interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.
  • double-stranded oligonucleotides need not be limited to those molecules containing only RNA, but further encompasses chemically modified nucleotides and non-nucleotides.
  • the short interfering nucleic acid molecules lack 2'-hydroxy (2'-OH) containing nucleotides.
  • short interfering nucleic acids optionally do not include any ribonucleotides (e.g., nucleotides having a 2'-OH group).
  • double -stranded oligonucleotides that do not require the presence of ribonucleotides within the molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2'-OH groups.
  • double -stranded oligonucleotides can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions.
  • siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others.
  • siRNA short interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • siRNA short interfering oligonucleotide
  • short interfering nucleic acid short interfering modified oligonucleotide
  • ptgsRNA post-transcriptional gene silencing RNA
  • RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • sequence specific RNA interference such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • double-stranded oligonucleotides can be used to epigenetically silence genes at both the post-transcriptional level and the pre -transcriptional level.
  • epigenetic regulation of gene expression by siR A molecules of the invention can result from siR A mediated modification of chromatin structure or methylation pattern to alter gene expression (see, for example, Verdel et al., 2004, Science, 303, 672-676; Pal-Bhadra et al., 2004, Science, 303, 669-672; Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237).
  • RNAi mechanism e.g., "hairpin” or stem-loop double -stranded RNA effector molecules in which a single RNA strand with self-complementary sequences is capable of assuming a double-stranded conformation, or duplex dsRNA effector molecules comprising two separate strands of RNA.
  • the dsRNA consists entirely of ribonucleotides or consists of a mixture of ribonucleotides and deoxynucleotides, such as the RNA/DNA hybrids disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.
  • the dsRNA or dsRNA effector molecule may be a single molecule with a region of self- complementarity such that nucleotides in one segment of the molecule base pair with nucleotides in another segment of the molecule.
  • a dsRNA that consists of a single molecule consists entirely of ribonucleotides or includes a region of ribonucleotides that is complementary to a region of deoxyribonucleotides.
  • the dsRNA may include two different strands that have a region of complementarity to each other.
  • both strands consist entirely of ribonucleotides, one strand consists entirely of ribonucleotides and one strand consists entirely of deoxyribonucleotides, or one or both strands contain a mixture of ribonucleotides and deoxyribonucleotides.
  • the regions of complementarity are at least 70, 80, 90, 95, 98, or 100% complementary to each other and to a target nucleic acid sequence.
  • the region of the dsRNA that is present in a double-stranded conformation includes at least 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 50, 75, 100, 200, 500, 1000, 2000 or 5000 nucleotides or includes all of the nucleotides in a cDNA or other target nucleic acid sequence being represented in the dsRNA.
  • the dsRNA does not contain any single stranded regions, such as single stranded ends, or the dsRNA is a hairpin.
  • the dsRNA has one or more single stranded regions or overhangs.
  • RNA/DNA hybrids include a DNA strand or region that is an antisense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid) and an RNA strand or region that is a sense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid), and vice versa.
  • an antisense strand or region e.g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid
  • RNA strand or region that is a sense strand or region e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid
  • the RNA/DNA hybrid is made in vitro using enzymatic or chemical synthetic methods such as those described herein or those described in WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.
  • a DNA strand synthesized in vitro is complexed with an RNA strand made in vivo or in vitro before, after, or concurrent with the transformation of the DNA strand into the cell.
  • the dsRNA is a single circular nucleic acid containing a sense and an antisense region, or the dsRNA includes a circular nucleic acid and either a second circular nucleic acid or a linear nucleic acid (see, for example, WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.)
  • Exemplary circular nucleic acids include lariat structures in which the free 5' phosphoryl group of a nucleotide becomes linked to the 2' hydroxyl group of another nucleotide in a loop back fashion.
  • the dsRNA includes one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group) or contains an alkoxy group (such as a methoxy group) which increases the half-life of the dsRNA in vitro or in vivo compared to the corresponding dsRNA in which the corresponding 2' position contains a hydrogen or an hydroxyl group.
  • the dsRNA includes one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages.
  • the dsRNAs may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661.
  • the dsRNA contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.
  • the dsRNA can be any of the at least partially dsRNA molecules disclosed in WO 00/63364, as well as any of the dsRNA molecules described in U.S. Provisional Application 60/399,998; and U.S. Provisional Application 60/419,532, and PCT/US2003/033466, the teaching of which is hereby incorporated by reference. Any of the dsRNAs may be expressed in vitro or in vivo using the methods described herein or standard methods, such as those described in WO 00/63364.
  • antisense compounds are not expected to result in cleavage or the target nucleic acid via RNase H or to result in cleavage or sequestration through the RISC pathway.
  • antisense activity may result from occupancy, wherein the presence of the hybridized antisense compound disrupts the activity of the target nucleic acid.
  • the antisense compound may be uniformly modified or may comprise a mix of modifications and/or modified and unmodified nucleosides.
  • Nucleotide sequences that encode TMPRSS6 include, without limitation, the following: GENBANK Accession NM_153609.2 (incorporated herein as SEQ ID NO: 1), the complement of GENBANK Accession NT_011520.12 truncated from 16850000 to 16897000 (incorporated herein as SEQ ID NO: 2), GENBANK Accession CR456446.1 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. BC039082.1 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No. AY358398.1 (incorporated herein as SEQ ID NO: 5), or GENBANK Accession No. DB081153.1 (incorporated herein as SEQ ID NO: 6).
  • an antisense compound described herein targets a nucleic acid sequence encoding TMPRSS6.
  • an antisense compound described herein targets the sequence of any of SEQ ID NOs: 1-6.
  • antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
  • a target region is a structurally defined region of the target nucleic acid.
  • a target region may encompass a 3' UTR, a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region.
  • the structurally defined regions for TMPRSS6 can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference.
  • a target region may encompass the sequence from a 5 ' target site of one target segment within the target region to a 3' target site of another target segment within the target region.
  • a target segment is a smaller, sub-portion of a target region within a nucleic acid.
  • a target segment can be the sequence of nucleotides of a target nucleic acid to which one or more antisense compound is targeted.
  • 5' target site refers to the 5'-most nucleotide of a target segment.
  • 3' target site refers to the 3 '-most nucleotide of a target segment.
  • Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs.
  • the desired effect is a reduction in mRNA target nucleic acid levels.
  • the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.
  • a target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values.
  • target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid.
  • target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein. Suitable target segments may be found within a 5 ' UTR, a coding region, a 3 ' UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.
  • the determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome.
  • the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).
  • TMPRSS6 mRNA levels are indicative of inhibition of TMPRSS6 expression.
  • Reductions in levels of a TMPRSS6 protein are also indicative of inhibition of TMPRSS6 expression.
  • phenotypic changes are indicative of inhibition of TMPRSS6 expression. For example, an increase in hepcidin expression levels can be indicative of inhibition of TMPRSS6 expression. In another example, a decrease in iron accumulation in tissues can be indicative of inhibition of TMPRSS6 expression. In another example, an increase in the percentage of saturation of transferrin can be indicative of inhibition of TMPRSS6 expression.
  • hybridization occurs between an antisense compound disclosed herein and a TMPRSS6 nucleic acid.
  • the most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
  • Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
  • the antisense compounds provided herein are specifically hybridizable with a target nucleic acid
  • An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a TMPRSS6 nucleic acid).
  • Non-complementary nucleobases between an antisense compound and a TMPRSS6 nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to the TMPRSS6 nucleic acid.
  • an antisense compound may hybridize over one or more segments of a TMPRSS6 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
  • the antisense compounds provided herein, or a specified portion thereof are, or are at least 70%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a TMPRSS6 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
  • an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
  • the antisense compounds provided herein, or specified portions thereof are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof.
  • antisense compound may be fully complementary to a TMPRSS6 nucleic acid, or a target region, or a target segment or target sequence thereof.
  • "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.
  • a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound.
  • Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid.
  • a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long.
  • the 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound.
  • the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
  • non-complementary nucleobase may be at the 5 ' end or 3 ' end of the antisense compound.
  • the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound.
  • two or more non-complementary nucleobases may be contiguous (i.e. linked) or non-contiguous.
  • a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
  • antisense compounds that are, or are up to, 12, 13, 14, 15, 16, 17, 18, 19, or
  • nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, such as a TMPRSS6 nucleic acid, or specified portion thereof.
  • antisense compounds that are, or are up to, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a TMPRSS6 nucleic acid, or specified portion thereof.
  • the antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid.
  • portion refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid.
  • a “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound.
  • the antisense compounds are complementary to at least an 8 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, at least a 10, at least an 1 1, at least a 12, at least a 13, at least a 14, at least a 15, at least a 16, at least a 17, at least an 18, at least a 19, at least a 20, or more nucleobase portion of a target segment, or a range defined by any two of these values. Identity
  • the antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof.
  • an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability.
  • a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine.
  • Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated.
  • the non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
  • the antisense compounds, or portions thereof are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein. Modifications
  • a nucleoside is a base-sugar combination.
  • the nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3 Or 5' hydroxyl moiety of the sugar.
  • Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
  • Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
  • Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
  • RNA and DNA The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing internucleoside linkages include, but are not limited to,
  • antisense compounds targeted to a TMPRSS6 nucleic acid comprise one or more modified internucleoside linkages.
  • at least one of the modified internucleoside linkages are phosphorothioate linkages.
  • each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
  • Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified.
  • Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds.
  • nucleosides comprise chemically modified ribofuranose ring moieties.
  • Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(Ri)(R 2 ) (R, Ri and R 2 are each independently H, C 1 -C 12 alkyl or a protecting group) and combinations thereof.
  • substitutent groups including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA)
  • BNA bicyclic nucleic acids
  • R, Ri and R 2 are each independently H, C 1 -C 12 alkyl or a protecting group
  • Examples of chemically modified sugars include 2'-F-5'- methyl substituted nucleoside (see PCT International Application WO 2008/101 157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5 '-substitution of a BNA (see PCT International Application WO 2007/134181 Published on 1 1/22/07 wherein LNA is substituted with for example a 5'-methyl or a 5'-vinyl group).
  • nucleosides having modified sugar moieties include without limitation nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH 3 , 2'-OCH 2 CH 3 , 2'-OCH 2 CH 2 F and 2'- 0(CH 2 ) 2 OCH 3 substituent groups.
  • bicyclic nucleosides refer to modified nucleosides comprising a bicyclic sugar moiety.
  • BNAs bicyclic nucleic acids
  • examples of bicyclic nucleic acids (BNAs) include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms.
  • antisense compounds provided herein include one or more BNA nucleosides wherein the bridge comprises one of the formulas: 4'-(CH 2 )-0- 2' (LNA); 4'-(CH 2 )-S-2'; 4'-(CH 2 ) 2 -0-2' (ENA); 4'-CH(CH 3 )-0-2' (cEt) and 4'-CH(CH 2 OCH 3 )-0-2' (and analogs thereof see U.S.
  • Patent 7,427,672 issued on September 23, 2008
  • 4'-CH 2 -C(H)(CH 3 )-2' see Zhou et al, J. Org. Chem., 2009, 74, 1 18-134
  • bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and ⁇ -D- ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).
  • nucleosides refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties.
  • sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
  • 4'-2' bicyclic nucleoside or “4' to 2' bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.
  • the bridge of a bicyclic sugar moiety is , -[C(R a )(R 3 ⁇ 4 ,)] n -, -[C(R a )(R 3 ⁇ 4 ,)] n -0- , -C(R a R b )-N(R)-0- or -C(R a R b )-0-N(R)-.
  • the bridge is 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'- (CH 2 ) 3 -2', 4'-CH 2 -0-2', 4'-(CH 2 ) 2 -0-2', 4'-CH 2 -0-N(R)-2' and 4'-CH 2 -N(R)-0-2'- wherein each Ris, independently, H, a protecting group or Ci-C 12 alkyl.
  • bicyclic nucleosides are further defined by isomeric configuration.
  • a nucleoside comprising a 4'-(CH 2 )-0-2' bridge may be in the a-L configuration or in the ⁇ -D configuration.
  • a-L-methyleneoxy (4'-CH 2 -0-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al, Nucleic Acids Research, 2003, 21, 6365- 6372).
  • bicyclic nucleosides include those having a 4' to 2' bridge wherein such bridges include without limitation, a-L-4'-(CH 2 )-0-2', -D-4'-CH 2 -0-2', 4'-(CH 2 ) 2 -0-2', 4'-CH 2 -0-N(R)-2', 4'- CH 2 -N(R)-0-2', 4'-CH(CH 3 )-0-2', 4'-CH 2 -S-2', 4'-CH 2 -N(R)-2', 4'-CH 2 -CH(CH 3 )-2', and 4'-(CH 2 ) 3 -2', wherein R is H, a protecting group or Ci-Ci 2 alkyl.
  • ce lic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • Rc is Ci-Ci 2 alkyl or an amino protecting group
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Z a is Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted Ci-C 6 alkyl, substituted C 2 -C 6 alkenyl, substituted C 2 -C 6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thiol.
  • bicyclic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • ce eosides have the formula:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • R d is Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • each q a , q b , q c and q d is, independently, H, halogen, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl, Ci-C 6 alkoxyl, substituted Ci- C ⁇ 5 alkoxyl, acyl, substituted acyl, Ci-C 6 aminoalkyl or substituted Ci-C 6 aminoalkyl;
  • bicyclic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • q g and q h are each, independently, H, halogen, Ci-C 12 alkyl or substituted Ci-C 12 alkyl.
  • oligodeoxyribonucleotide duplexes comprising bicyclic nucleosides for use as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226 ). Furthermore, synthesis of 2'-amino-BNA, a novel conformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem. , 1998, 63, 10035-10039). In addition, 2'-amino- and 2'-methylamino- BNA's have been prepared and the thermal stability of their duplexes with complementary R A and DNA strands has been previously reported.
  • ce eosides have the formula:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • bicyclic nucleosides include, but are not limited to, (A) a-L-methyleneoxy (4'-CH 2 -0-2') BNA , (B) ⁇ -D-methyleneoxy (4'-CH 2 -0-2') BNA , (C) ethyleneoxy (4'-(CH 2 ) 2 -0-2') BNA, (D) aminooxy (4'-CH 2 -0-N(R)-2') BNA, (E) oxyamino (4'-CH 2 -N(R)-0-2') BNA, (F)
  • methyl(methyleneoxy) (4'-CH(CH 3 )-0-2') BNA also referred to as constrained ethyl or cEt
  • G methylene- thio (4'-CH 2 -S-2') BNA
  • H methylene -amino (4'-CH 2 -N(R)-2') BNA
  • I methyl carbocyclic (4'-CH 2 - -2') BNA
  • J propylene carbocyclic (4'-(CH 2 ) 3 -2') BNA
  • K vinyl BNA as depicted below.
  • Bx is the base moiety and R is, independently, H, a protecting group, Ci-C 6 alkyl or Ci-C 6 alkoxy.
  • modified tetrahydropyran nucleoside or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran "sugar” substituted for the pentofuranosyl residue in normal nucleosides and can be referred to as a sugar surrogate.
  • Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854) or fluoro HNA (F- HNA)
  • ce urrogates are selected having the formula:
  • Bx is a heterocyclic base moiety
  • T 3 and T 4 are each, independently, an intemucleoside linking group linking the tetrahydropyran nucleoside analog to the oligomeric compound or one of T 3 and T 4 is an intemucleoside linking group linking the tetrahydropyran nucleoside analog to an oligomeric compound or oligonucleotide and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group or a 5' or 3'-terminal group;
  • qi, q2, q3, q4, ⁇ 5 , q 6 and q 7 are each independently, H, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl; and
  • qi, q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of qi, q 2 , q 3 , q , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of qi, q 2 , q 3 , q , q 5 , q 6 and q 7 is methyl.
  • THP nucleosides are provided wherein one of Ri and R 2 is F. In certain embodiments, Ri is fluoro and R 2 is H; Ri is methoxy and R 2 is H, and Ri is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Patents 5,698,685; 5,166,315; 5, 185,444; and 5,034,506).
  • morpholino means a sugar lowing formula:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are referred to herein as "modifed morpholinos.”
  • Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5 '-substitution of a bicyclic nucleic acid see PCT International Application WO 2007/134181, published on 11/22/07 wherein a 4'-CH 2 -0-2' bicyclic nucleoside is further substituted at the 5' position with a 5 '-methyl or a 5 '-vinyl group).
  • PCT International Application WO 2007/134181 published on 11/22/07 wherein a 4'-CH 2 -0-2' bicyclic nucleoside is further substituted at the 5' position with a 5 '-methyl or a 5 '-vinyl group.
  • carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava ei /., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
  • antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides.
  • Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on April 10, 2010, Robeyns et al, J. Am. Chem. Soc, 2008, 130(6), 1979-1984; Horvath et al, Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al, J.
  • Certain modified cyclohexenyl nucleosides have Formula X. wherein independently for each of said at least one cyclohexenyl nucleoside analog of Formula X: Bx is a heterocyclic base moiety;
  • T 3 and T 4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T 3 and T 4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'-or 3'-terminal group; and
  • qi, q 2 , q 3 , q 4 , qs, qe, q 7 , qs and q 9 are each, independently, H, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 - C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 2 -C 6 alkynyl or other sugar substituent group.
  • 2'-modified sugar means a furanosyl sugar modified at the 2' position.
  • modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl.
  • 2' modifications are selected from substituents including, but not limited to: 0[(CH 2 ) n O] m CH 3 , 0(CH 2 ) n NH 2 , 0(CH 2 ) n CH 3 , 0(CH 2 ) n F, 0(CH 2 ) n ONH 2 ,
  • OCH 2 C( 0)N(H)CH 3j and 0(CH 2 ) n ON[(CH 2 ) n CH 3 ] 2 , where n and m are from 1 to about 10.
  • Other 2'- substituent groups can also be selected from: Ci-Ci 2 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, F, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of
  • modifed nucleosides comprise a 2'-MOE side chain (Baker et al, J. Biol. Chem., 1997, 272, 11944-12000).
  • 2'-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O- methyl, O-propyl, and O-aminopropyl.
  • Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim.
  • 2'-modified or “2 '-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH.
  • 2'-F refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position of the sugar ring.
  • MOE or "2'-MOE” or “2'-OCH 2 CH 2 OCH 3 " or “2'-0-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a -OCH 2 CH 2 OCH 3 group at the 2' position of the sugar ring.
  • oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).
  • RNA ribonucleosides
  • DNA deoxyribonucleosides
  • nucleobase moieties In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
  • antisense compounds comprise one or more nucleosides having modified sugar moieties.
  • the modified sugar moiety is 2'-MOE.
  • the 2' -MOE modified nucleosides are arranged in a gapmer motif.
  • the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH 3 )-0-2') bridging group.
  • the (4'- CH(CH 3 )-0-2') modified nucleosides are arranged throughout the wings of a gapmer motif.
  • Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications may impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5- methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6- 1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications , CRC Press, Boca Raton, 1993, pp. 276-278).
  • Additional unmodified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C ⁇ C-CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5- substitute
  • Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5- substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2
  • antisense compounds targeted to a TMPRSS6 nucleic acid comprise one or more modified nucleobases.
  • gap-widened antisense oligonucleotides targeted to a TMPRSS6 nucleic acid comprise one or more modified nucleobases.
  • at least one of the modified nucleobases is 5-methylcytosine.
  • each cytosine is a 5-methylcytosine.
  • Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substance for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • Antisense compound targeted to a TMPRSS6 nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.
  • a pharmaceutically acceptable diluent includes water e.g., water-for-injection (WFI).
  • pharmaceutically acceptable diluent includes saline e.g., phosphate-buffered saline (PBS).
  • PBS phosphate-buffered saline
  • Water or saline is a diluent suitable for use in compositions to be delivered parenterally.
  • employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a TMPRSS6 nucleic acid and a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent is water or saline.
  • the antisense compound is an antisense oligonucleotide.
  • compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • the disclosure herein is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • compositions described herein may be prepared by methods well-known in the art.
  • pharmaceutically acceptable salts see Stahl and Wermuth, Handbook of Pharmaceutical Salts: Properties, Selection and Use (Wiley-VCH, Weinheim, Germany, 2002).
  • Sodium salts of antisense oligonucleotides are useful and are well accepted for therapeutic administration to humans. Accordingly, in one embodiment the compounds described herein are in the form of a sodium salt.
  • a prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
  • compositions are administered according to a dosing regimen (e.g., dose, dose frequency, and duration) wherein the dosing regimen can be selected to achieve a desired effect.
  • a dosing regimen e.g., dose, dose frequency, and duration
  • the desired effect can be, for example, reduction of TMPRSS6 or the prevention, reduction, amelioration or slowing the progression of a disease, disorder or condition associated with TMPRSS6.
  • the variables of the dosing regimen are adjusted to result in a desired concentration of pharmaceutical composition in a subject.
  • concentration of pharmaceutical composition can refer to the compound, oligonucleotide, or active ingredient of the pharmaceutical composition.
  • dose and dose frequency are adjusted to provide a tissue concentration or plasma concentration of a pharmaceutical composition at an amount sufficient to achieve a desired effect.
  • Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Dosing is also dependent on drug potency and metabolism. In certain embodiments, dosage is from O.O ⁇ g to lOOmg per kg of body weight, or within a range of 0.00 lmg to lOOOmg dosing, and may be given once or more daily, weekly, biweekly, monthly, quarterly, semi-annually or yearly, or even once every 2 to 20 years. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is
  • the compounds or pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be inhaled (i.e., pulmonary), enteral (i.e., enteric), parenteral or topical.
  • the compounds and compositions as described herein are administered parenterally.
  • Parenteral administration includes, but is not limited to, intravenous, intra-arterial,
  • Parenteral administration also includes intranasal administration.
  • parenteral administration is by infusion.
  • Infusion can be chronic or continuous or short or intermittent.
  • infused pharmaceutical agents are delivered with a pump.
  • parenteral administration is by injection.
  • the injection can be delivered with a syringe or a pump.
  • the injection is a bolus injection.
  • the injection is administered directly to a tissue or organ.
  • formulations for parenteral administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • the compounds and compositions as described herein are administered enterally.
  • Enteric administration includes, but is not limited to, oral, transmucosal, intestinal or rectal (e.g., suppository, enema).
  • formulations for enteral administration of the compounds or compositions can include, but is not limited to, pharmaceutical carriers, excipients, powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable.
  • enteral formulations are those in which compounds provided herein are administered in conjunction with one or more penetration enhancers, surfactants and chelators.
  • administration includes pulmonary administration.
  • pulmonary administration comprises delivery of aerosolized oligonucleotide to the lung of a subject by inhalation. Following inhalation by a subject of aerosolized oligonucleotide, oligonucleotide distributes to cells of both normal and inflamed lung tissue, including alveolar macrophages, eosinophils, epithelium, blood vessel endothelium, and bronchiolar epithelium.
  • a suitable device for the delivery of a pharmaceutical composition comprising a modified oligonucleotide includes, but is not limited to, a standard nebulizer device. Additional suitable devices include dry powder inhalers or metered dose inhalers.
  • compositions are administered to achieve local rather than systemic exposures.
  • pulmonary administration delivers a pharmaceutical composition to the lung, with minimal systemic exposure.
  • the oligonucleotides or oligomeric compounds as provided herein are modified by covalent attachment of one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligonucleotide or oligomeric compound including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance.
  • conjugate group means a radical group comprising a group of atoms that are attached to an oligonucleotide or oligomeric compound.
  • conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and/or clearance properties.
  • Conjugate groups are routinely used in the chemical arts and can include a conjugate linker that covalently links the conjugate group to an oligonucleotide or oligomeric compound.
  • conjugate groups include a cleavable moiety that covalently links the conjugate group to an oligonucleotide or oligomeric compound.
  • conjugate groups include a conjugate linker and a cleavable moiety to covalently link the conjugate group to an oligonucleotide or oligomeric compound.
  • a conjugate group has the general formula:
  • n is from 1 to about 3
  • m is 0 when n is 1 or m is 1 when n is 2 or 3
  • j is 1 or
  • k is 1 or 0 and the sum of j and k is at least one.
  • n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain
  • n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain
  • n is 3, j is 1 and k is 1.
  • Conjugate groups are shown herein as radicals, providing a bond for forming covalent attachment to an oligomeric compound such as an oligonucleotide.
  • the point of attachment on the oligomeric compound is at the 3 '-terminal nucleoside or modified nucleoside.
  • the point of attachment on the oligomeric compound is the 3'-oxygen atom of the 3'-hydroxyl group of the 3' terminal nucleoside or modified nucleoside.
  • the point of attachment on the oligomeric compound is at the 5 '-terminal nucleoside or modified nucleoside.
  • the point of attachment on the oligomeric compound is the 5'-oxygen atom of the 5'-hydroxyl group of the 5'- terminal nucleoside or modified nucleoside. In certain embodiments, the point of attachment on the oligomeric compound is at any reactive site on a nucleoside, a modified nucleoside or an internucleoside linkage.
  • cleavable moiety and "cleavable bond” mean a cleavable bond or group of atoms that is capable of being split or cleaved under certain physiological conditions.
  • a cleavable moiety is a cleavable bond.
  • a cleavable moiety comprises a cleavable bond.
  • a cleavable moiety is a group of atoms.
  • a cleavable moiety is selectively cleaved inside a cell or sub-cellular compartment, such as a lysosome.
  • a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
  • conjugate groups comprise a cleavable moiety.
  • the cleavable moiety covalently attaches the oligomeric compound to the conjugate linker. In certain such embodiments, the cleavable moiety covalently attaches the oligomeric compound to the cell- targeting moiety.
  • a cleavable bond is selected from among: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide.
  • a cleavable bond is one of the esters of a phosphodiester.
  • a cleavable bond is one or both esters of a phosphodiester.
  • the cleavable moiety is a phosphodiester linkage between an oligomeric compound and the remainder of the conjugate group.
  • the cleavable moiety comprises a phosphodiester linkage that is located between an oligomeric compound and the remainder of the conjugate group. In certain embodiments, the cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is attached to the conjugate linker by either a phosphodiester or a phosphorothioate linkage. In certain embodiments, the cleavable moiety is attached to the conjugate linker by a phosphodiester linkage. In certain embodiments, the conjugate group does not include a cleavable moiety.
  • the cleavable moiety is a cleavable nucleoside or a modified nucleoside.
  • the nucleoside or modified nucleoside comprises an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
  • the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N- benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine.
  • the cleavable moiety is 2'-deoxy nucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligomeric compound by a phosphodiester linkage and covalently attached to the remainder of the conjugate group by a phosphodiester or phosphorothioate linkage.
  • the cleavable moiety is 2'-deoxy adenosine that is attached to either the 3' or 5 '-terminal nucleoside of an oligomeric compound by a phosphodiester linkage and covalently attached to the remainder of the conjugate group by a phosphodiester or phosphorothioate linkage.
  • the cleavable moiety is 2'- deoxy adenosine that is attached to the 3 '-oxygen atom of the 3'-hydroxyl group of the 3 '-terminal nucleoside or modified nucleoside by a phosphodiester linkage. In certain embodiments, the cleavable moiety is 2'- deoxy adenosine that is attached to the 5 '-oxygen atom of the 5'-hydroxyl group of the 5 '-terminal nucleoside or modified nucleoside by a phosphodiester linkage. In certain embodiments, the cleavable moiety is attached to a 2'-position of a nucleoside or modified nucleoside of an oligomeric compound.
  • conjugate linker in the context of a conjugate group means a portion of a conjugate group comprising any atom or group of atoms that covalently link the cell-targeting moiety to the oligomeric compound either directly or through the cleavable moiety.
  • the conjugate linker comprises groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether (-S-) and hydroxylamino (-O-N(H)-).
  • the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups.
  • the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus linking group. In certain embodiments, the conjugate linker comprises at least one
  • the conjugate linker includes at least one neutral linking group.
  • the conjugate linker is covalently attached to the oligomeric compound. In certain embodiments, the conjugate linker is covalently attached to the oligomeric compound and the branching group. In certain embodiments, the conjugate linker is covalently attached to the oligomeric compound and a tethered ligand. In certain embodiments, the conjugate linker is covalently attached to the cleavable moiety. In certain embodiments, the conjugate linker is covalently attached to the cleavable moiety and the branching group. In certain embodiments, the conjugate linker is covalently attached to the cleavable moiety and a tethered ligand. In certain embodiments, the conjugate linker includes one or more cleavable bonds. In certain embodiments, the conjugate group does not include a conjugate linker.
  • branching group means a group of atoms having at least 3 positions that are capable of forming covalent linkages to two or more tether-ligands and the remainder of the conjugate group.
  • a branching group provides a plurality of reactive sites for connecting tethered ligands to the oligomeric compound through the conjugate linker and/or the cleavable moiety.
  • the branching group comprises groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups.
  • the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups.
  • the branched aliphatic group comprises groups selected from alkyl, amino, oxo, amide and ether groups.
  • the branched aliphatic group comprises groups selected from alkyl, amino and ether groups.
  • the branched aliphatic group comprises groups selected from alkyl and ether groups.
  • the branching group comprises a mono or polycyclic ring system.
  • the branching group is covalently attached to the conjugate linker. In certain embodiments, the branching group is covalently attached to the cleavable moiety. In certain embodiments, the branching group is covalently attached to the conjugate linker and each of the tethered ligands. In certain embodiments, the branching group comprises one or more cleavable bond. In certain embodiments, the conjugate group does not include a branching group.
  • conjugate groups as provided herein include a cell-targeting moiety that has at least one tethered ligand.
  • the cell-targeting moiety comprises two tethered ligands covalently attached to a branching group.
  • the cell -targeting moiety comprises three tethered ligands covalently attached to a branching group.
  • tether means a group of atoms that connect a ligand to the remainder of the conjugate group.
  • each tether is a linear aliphatic group comprising one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester and polyethylene glycol groups in any combination.
  • each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide and polyethylene glycol groups in any combination.
  • each tether is a linear aliphatic group comprising one or more groups selected from alkyl, substituted alkyl, phosphodiester, ether and amino, oxo, amide groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether and amino, oxo, amide groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino and oxo groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and oxo groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group.
  • tethers include one or more cleavable bond.
  • each tethered ligand is attached to a branching group.
  • each tethered ligand is attached to a branching group through an amide group.
  • each tethered ligand is attached to a branching group through an ether group.
  • each tethered ligand is attached to a branching group through a phosphorus linking group or neutral linking group.
  • each tethered ligand is attached to a branching group through a phosphodiester group.
  • each tether is attached to a ligand through either an amide or an ether group.
  • each tether is attached to a ligand through an ether group.
  • each tether comprises from about 8 to about 20 atoms in chain length between the ligand and the branching group. In certain embodiments, each tether comprises from about 10 to about 18 atoms in chain length between the ligand and the branching group. In certain embodiments, each tether comprises about 13 atoms in chain length.
  • each ligand is covalently attached to the remainder of the conjugate group through a tether.
  • each ligand is selected to have an affinity for at least one type of receptor on a target cell.
  • ligands are selected that have an affinity for at least one type of receptor on the surface of a mammalian liver cell.
  • ligands are selected that have an affinity for the hepatic asialoglycoprotein receptor (ASGP-R).
  • each ligand is a carbohydrate.
  • each ligand is, independently selected from galactose, N-acetyl galactoseamine, mannose, glucose, glucosamone and fucose. In certain embodiments, each ligand is N-acetyl galactoseamine (GalNAc).
  • the targeting moiety comprises 1 to 3 ligands. In certain embodiments, the targeting moiety comprises 3 ligands. In certain embodiments, the targeting moiety comprises 2 ligands. In certain embodiments, the targeting moiety comprises 1 ligand. In certain embodiments, the targeting moiety comprises 3 N-acetyl
  • the targeting moiety comprises 2 N-acetyl galactoseamine ligands. In certain embodiments, the targeting moiety comprises 1 N-acetyl galactoseamine ligand.
  • each ligand is a carbohydrate, carbohydrate derivative, modified carbohydrate, multivalent carbohydrate cluster, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain embodiments, each ligand is an amino sugar or a thio sugar.
  • amino sugars may be selected from any number of compounds known in the art, for example glucosamine, sialic acid, a-D-galactosamine, N-Acetylgalactosamine, 2-acetamido-2-deoxy-D-galactopyranose (GalNAc), 2- Amino-3-0-[(i?)-l-carboxyethyl]-2-deoxy- -D-glucopyranose ( ⁇ -muramic acid), 2-Deoxy-2-methylamino-L- glucopyranose, 4,6-Dideoxy-4-formamido-2,3-di-0-methyl-D-mannopyranose, 2-Deoxy-2-sulfoamino-D- glucopyranose and N-sulfo-D-glucosamine, and N-Glycoloyl-a-neuraminic acid.
  • glucosamine sialic acid
  • a-D-galactosamine N-Acetylgalact
  • thio sugars may be selected from the group consisting of 5-Thio- -D-glucopyranose, Methyl 2,3, 4-tri-0 -acetyl- l-thio-6- O-trityl-a-D-glucopyranoside, 4-Thio- -D-galactopyranose, and ethyl 3,4,6,7-tetra-0-acetyl-2-deoxy-l,5- dithio-a-D-g/wco-heptopyranoside.
  • conjugate groups as provided herein comprise a carbohydrate cluster.
  • carbohydrate cluster means a portion of a conjugate group wherein two or more carbohydrate residues are attached to a branching group through tether groups, (see, e.g., Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting," Bioconjugate Chemistry, 2003, (14): 18-29, which is incorporated herein by reference in its entirety, or Rensen et al., “Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor," J. Med. Chem. 2004, (47): 5798-5808, for examples of carbohydrate conjugate clusters).
  • modified carbohydrate means any carbohydrate having one or more chemical modifications relative to naturally occurring carbohydrates.
  • carbohydrate derivative means any compound which may be synthesized using a carbohydrate as a starting material or intermediate.
  • carbohydrate means a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative.
  • conjugate groups are provided wherein the cell-targeting moiety has the formula:
  • conjugate groups are provided wherein the cell-targeting moiety has the formula
  • conjugate groups are provided wherein the cell-targeting moiety has the formula:
  • conjugate groups have the formula:
  • conjugated oligomeric compounds such as antisense compounds comprising a conjugate group, tethers, conjugate linkers, branching groups, ligands, cleavable moieties as well as other modifications
  • BIESSEN et al. "The Cholesterol Derivative of a Triantennary Galactoside with High Affinity for the Hepatic Asialoglycoprotein Receptor: a Potent Cholesterol Lowering Agent" J. Med. Chem.
  • conjugate groups include without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols,
  • thiocholesterols cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes.
  • Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem.
  • a thioether e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309;
  • a phospholipid e.g., di-hexadecyl-rac -glycerol or triethyl-ammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
  • a conjugate group comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, ( ⁇ S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
  • active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, ( ⁇ S)-(+)-pranoprofen, carprofen, dansy
  • conjugate linkers include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-l-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • ADO 8-amino-3,6-dioxaoctanoic acid
  • SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane-l-carboxylate
  • AHEX or AHA 6-aminohexanoic acid
  • Other hair linkers include, but are not limited to, substituted Ci-Ci 0 alkyl, substituted or unsubstituted C 2 -Ci 0 alkenyl or substituted or unsubstituted C 2 -Ci 0 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
  • Conjugate groups may be attached to either or both ends of an oligonucleotide (terminal conjugate groups) and/or at any internal position.
  • conjugate groups are at the 3 '-end of an oligonucleotide of an oligomeric compound. In certain embodiments, conjugate groups are near the 3'-end. In certain embodiments, conjugates are attached at the 3 'end of an oligomeric compound, but before one or more terminal group nucleosides. In certain embodiments, conjugate groups are placed within a terminal group.
  • TMPRSS6 nucleic acids can be tested in vitro in a variety of cell types.
  • Cell types used for such analyses are available from commercial vendors (e.g., American Type Culture Collection, Manassas, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g., Invitrogen Life Technologies, Carlsbad, CA).
  • Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, Huh7 (hepatocellular carcinoma) cells, primary hepatocytes, A549 cells, GM04281 fibroblasts and LLC-MK2 cells.
  • Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
  • cells are treated with antisense oligonucleotides when the cells reach approximately 60- 80% confluence in culture.
  • One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN® (Invitrogen, Carlsbad, CA).
  • Antisense oligonucleotides are mixed with LIPOFECTIN® in OPTI-MEM® 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes
  • LIPOFECTAMINE 2000® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes Cytofectin® (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with Cytofectin® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a Cytofectin® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes OligofectamineTM (Invitrogen Life Technologies, Carlsbad, CA).
  • Antisense oligonucleotide is mixed with OligofectamineTM in Opti-MEMTM-l reduced serum medium (Invitrogen Life Technologies, Carlsbad, CA) to achieve the desired concentration of oligonucleotide with an OligofectamineTM to oligonucleotide ratio of approximately 0.2 to 0.8 per 100 nM.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes FuGENE 6 (Roche Diagnostics Corp., Indianapolis, IN). Antisense oligomeric compound was mixed with FuGENE 6 in 1 mL of serum-free RPMI to achieve the desired concentration of oligonucleotide with a FuGENE 6 to oligomeric compound ratio of 1 to 4 uL of FuGENE 6 per 100 nM.
  • Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation (Sambrook and Russell in Molecular Cloning. A Laboratory Manual . Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001).
  • Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16- 24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein (Sambrook and Russell in Molecular Cloning. A Laboratory Manual . Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001). In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
  • the concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art (Sambrook and Russell in Molecular Cloning. A Laboratory Manual . Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001). Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE2000®, Lipofectin or Cytofectin. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3 rd Ed., 2001). RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.
  • TMPRSS6 nucleic acid Inhibition of levels or expression of a TMPRSS6 nucleic acid can be assayed in a variety of ways known in the art (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3 rd Ed., 2001).
  • target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.
  • Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
  • RNA Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification.
  • RT reverse transcriptase
  • cDNA complementary DNA
  • the RT and real-time PCR reactions are performed sequentially in the same sample well.
  • RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, CA). RT, real-time-PCR reactions are carried out by methods well known to those skilled in the art.
  • Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN® (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN® RNA quantification reagent (Invitrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN® are taught in lones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A
  • CYTOFLUOR® 4000 instrument PE Applied Biosystems is used to measure RIBOGREEN® fluorescence.
  • Probes and primers are designed to hybridize to a TMPRSS6 nucleic acid.
  • Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS® Software (Applied Biosystems, Foster City, CA).
  • Antisense inhibition of TMPRSS6 nucleic acids can be assessed by measuring TMPRSS6 protein levels. Protein levels of TMPRSS6 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS) (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3 rd Ed., 2001).
  • immunoprecipitation Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS) (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3
  • Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. In Vivo Testing of Anti sense Compounds
  • Antisense compounds for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of TMPRSS6 and produce phenotypic changes, such as, reduced accumulation of iron in the body. Testing can be performed in normal animals, or in experimental disease models.
  • antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as sterile water-for-injection or phosphate -buffered saline.
  • Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Calculation of antisense
  • oligonucleotide dosage and dosing frequency depends upon factors such as route of administration and animal body weight.
  • RNA is isolated from liver tissue and changes in TMPRSS6 nucleic acid expression are measured. Changes in TMPRSS6 protein levels can also be measured. Changes in TMPRSS6 expression can be measured by determining the level of hepcidin expression, plasma levels of iron and percentage saturation of transferrin present in the animal.
  • compositions, compounds and methods for treating an individual comprising administering to the individual one or more compositions or compounds described herein.
  • compositions, compounds and methods are provided for reducing TMPRSS6 expression in the individual.
  • compositions, compounds and methods are provided for treating the individual by administering to the individual a therapeutically effective amount of a composition or compound comprising an antisense oligonucleotide targeted to a TMPRSS6 nucleic acid.
  • the antisense compound targeted to a TMPRSS6 reduces TMPRSS6.
  • the individual in need of TMRPSS6 reduction has, or is at risk for, an iron accumulation disease, disorder or condition.
  • compositions, compounds and methods described herein are provided herein for use in reducing iron levels in an individual.
  • the iron accumulation is the result of a therapy to treat a disease, disorder or condition in the individual.
  • the therapy is transfusion therapy.
  • multiple transfusions may lead to polycythemia.
  • multiple blood transfusions are associated with the animal having anemia.
  • anemia requiring multiple blood transfusions are hereditary anemia, myelodysplastic syndrome and severe chronic hemolysis.
  • hereditary anemia include, but are not limited to, sickle cell anemia, thalassemia, Fanconi anemia, Diamond Blackfan anemia, Shwachman Diamond syndrome, red cell membrane disorders, glucose-6-phosphate dehydrogenase deficiency, or hereditary hemorrhagic telangiectasia.
  • the thalassemia is ⁇ -thalassemia.
  • the ⁇ -thalassemia is HbE/ -thalassemia, ⁇ -thalassemia major, ⁇ - thalassemia intermedia or ⁇ -thalassemia minor.
  • the iron accumulation is due to a disease, disorder or condition in the individual.
  • the disease, disorder or condition is hereditary hemochromatosis or thalassemia.
  • the thalassemia is non-transfusion dependent thalassemia (NTDT) or ⁇ - thalassemia.
  • the ⁇ -thalassemia is HbE/ -thalassemia, ⁇ -thalassemia major, ⁇ - thalassemia intermedia or ⁇ -thalassemia minor.
  • the disease, disorder and/or condition is associated with excess parenteral iron supplement intake or excess dietary iron intake.
  • compositions, compounds and methods for increasing hepcidin levels such as mR A or protein expression levels.
  • compositions, compounds and methods for decreasing the percentage saturation of transferrin in an animal are provided herein.
  • decreasing transferrin saturation leads to a decrease in iron supply for erythropoiesis.
  • the decrease in erythropoiesis treats, prevents, delays the onset of, ameliorates, and/or reduces polycythemia, or symptom thereof, in the animal.
  • antisense compounds targeting TMPRSS6 as described herein for use in treating, preventing, delaying the onset of, ameliorating, and/or reducing polycythemia, or symptom thereof, in the animal.
  • the polycythemia is polycythemia vera.
  • treatment with the antisense compound targeting TMPRSS6 prevents or delays the polycythemia from progressing into erythroid leukemia.
  • administration of a therapeutically effective amount of an antisense compound targeted to a TMPRSS6 nucleic acid in an individual is accompanied by monitoring of TMPRSS6 levels to determine the individual's response to the antisense compound.
  • administration of a therapeutically effective amount of an antisense compound targeted to a TMPRSS6 nucleic acid in an individual is accompanied by monitoring the levels of hepcidin in the individual.
  • administration of a therapeutically effective amount of an antisense compound targeted to a TMPRSS6 nucleic acid in an individual is accompanied by monitoring the levels of iron in the individual.
  • administration of a therapeutically effective amount of an antisense compound targeted to a TMPRSS6 nucleic acid in an individual is accompanied by evaluating the percentage saturation of transferrin in the individual.
  • An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.
  • compositions comprising an antisense compound targeted to TMPRSS6 for use in the preparation of a medicament for treating a patient suffering from, or susceptible to, an iron accumulation disease, disorder or condition.
  • the methods described herein include administering an antisense compound comprising a modified oligonucleotide having at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobase portion complementary to a TMPRSS6 nucleic acid.
  • a first agent comprising a composition or compound provided herein is coadministered with one or more secondary agents.
  • such second agents are designed to treat the same iron accumulation disease, disorder or condition as the first agent described herein.
  • such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein.
  • such second agents are designed to treat an undesired side effect of one or more composition or compound as described herein.
  • such first agents are designed to treat an undesired side effect of a second agent.
  • second agents are co-administered with the first agent to treat an undesired effect of the first agent.
  • second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy. In certain embodiments, the dose of a co-administered second agent is the same as the dose that would be administered if the second agent was administered alone. In certain embodiments, the dose of a co- administered second agent is lower than the dose that would be administered if the second agent was administered alone. In certain embodiments, the dose of a co-administered second agent is greater than the dose that would be administered if the second agent was administered alone.
  • a first agent and one or more second agents are administered at the same time. In certain embodiments, the first agent and one or more second agents are administered at different times. In certain embodiments, the second agent is administered prior to administration of the first agent. In certain embodiments, the second agent is administered following administration of the first agent. In certain embodiments, the first agent and one or more second agents are prepared together in a single pharmaceutical formulation. In certain embodiments, the first agent and one or more second agents are prepared separately.
  • second agents include, but are not limited to, nucleic acid compounds.
  • nucleic acid compounds can include a siR A, a ribozyme or an antisense compound targeting TMPRSS6 or another target.
  • second agents include, but are not limited to, non-antisense compounds such as iron chelators, transferrin, bone morphogenetic proteins 6 (BMP6), hepcidin agonists, stem cells, antibodies targeting TMPRSS6 or fetal hemoglobin (HbF)-raising agents.
  • iron chelators are selected from, but not limited to, FBS0701 (FerroKin), Exjade, Desferal, and Deferiprone.
  • HBF-raising agents include 5-hydroxyl urea, short chain fatty acid (SCFA) derivatives (e.g., HQK1001), DNA methyltransferase inhibitors (e.g., decitabine) or histone deacetylase (HDAC) inhibitors (e.g., Zolina, Panobinostat).
  • SCFA short chain fatty acid
  • HDAC histone deacetylase
  • a second agent includes, but is not limited to, phlebotomy or transfusion therapy.
  • the first agent is administered at the same time as phlebotomy or transfusion therapy.
  • the first agent is administered prior to phlebotomy or transfusion therapy.
  • the first agent is administered following phlebotomy or transfusion therapy.
  • administration of a composition or compound provided herein decreases the frequency of phlebotomy or transfusion in an individual.
  • administration of a composition or compound provided herein increases the frequency of phlebotomy or transfusion in an individual.
  • administration of a composition or compound provided herein decreases the length of time required for phlebotomy or transfusion.
  • Example 1 shows representative single dose screening data for over 100 potent antisense compounds that were selected for further studies.
  • antisense compounds were further selected, based on their potency in dose response and/or single dose studies, for study in CD-I mice to determine tolerability (e.g., plasma chemistry markers, body weight and organ weight) of the antisense compound (Examples 3-4) in mice.
  • tolerability e.g., plasma chemistry markers, body weight and organ weight
  • Antisense compounds identified as potent and tolerable in mice studies were assessed for cross- reactivity to a rhesus monkey TMPRSS6 gene sequence (Example 7). Although the antisense compounds in the studies described herein were tested in cynomolgus monkeys (Example 11), the cynomolgus monkey
  • TMPRSS6 sequence was not available for comparison to the sequences of the antisense compounds, therefore the sequences of the antisense compounds were compared to that of the closely related rhesus monkey. About seven antisense compounds were found to have no mismatches with the rhesus TMPRSS6 gene sequence.
  • mice potency and tolerability studies Based on the results of the mice potency and tolerability studies, and homology to the rhesus monkey sequence, the sequences of seven antisense compounds (585774, 585683, 585775, 630718, 647477, 647449, 647420) from the prior studies were selected for further chemical modification to make them more potent in reducing TMPRSS6 levels.
  • Eight new antisense compounds with a GalNAc conjugate 702843, 705051, 705052, 705053, 706940, 706941, 706942, 706943) were designed based on the seven original antisense compounds (Example 7).
  • the eight GalNAc conjugated antisense compounds were tested in mice: for tolerability in CD-I mice (e.g., body weights, organ weights, liver metabolic markers (e.g., ALT, AST and bilirubin), kidney metabolic markers (e.g., BUN and creatinine), histology, hematology parameters (e.g., blood cell counts and hematocrit), and the like were measured (Example 8); and, for potency in human TMPRSS6 transgenic mice (Example 9).
  • CD-I mice e.g., body weights, organ weights, liver metabolic markers (e.g., ALT, AST and bilirubin), kidney metabolic markers (e.g., BUN and creatinine), histology, hematology parameters (e.g., blood cell counts and hematocrit), and the like were measured (Example 8); and, for potency in human TMPRSS6 transgenic mice (Example 9).
  • the eight GalNAc conjugated antisense compounds were also assessed for viscosity and seven of the eight were found to have a favorable viscosity level while one was found to have a borderline acceptable viscosity level (Example 10).
  • the eight GalNAc conjugated antisense compounds were further tested for potency in reducing TMPRSS6, tolerability and for their effect on iron parameters (e.g., hepcidin levels, serum iron and transferrin saturation ) in cynomolgus monkeys (Example 11).
  • the eight GalNAc conjugated antisense compounds were generally found to be potent and tolerable in cynomolgus monkeys.
  • Antisense compounds 705051, 702843, 706942 and 706943 were found to be especially potent in reducing TMRPSS6, serum iron and transferrin saturation.
  • antisense compounds with any one or more characteristics that are beneficial for their use as a therapeutic agent.
  • antisense compounds comprising a modified oligonucleotide as described herein targeted to, or specifically hybridizable with, a region of nucleotides selected from any of SEQ ID NOs: 1-6.
  • certain antisense compounds as described herein are efficacious by virtue of their potency in inhibiting TMPRSS6 expression.
  • the compounds or compositions inhibit TMPRSS6 by at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%.
  • certain antisense compounds as described herein are efficacious by virtue of an in vitro IC 50 of less than 20 ⁇ , less than 10 ⁇ , less than 8 ⁇ , less than 5 ⁇ , less than 2 ⁇ , less than 1 ⁇ , less than 0.9 ⁇ , less than 0.8 ⁇ , less than 0.7 ⁇ , less than 0.6 ⁇ , or less than 0.5 ⁇ when tested in human cells, for example, in the Hep3B cell line (as described in Example 2).
  • certain antisense compounds as described herein are efficacious by virtue of having a viscosity of less than 40 cP, less than 35 cP, less than 30 cP, less than 25 cP, less than 20 cP, less than 15 cP, or less than 10 cP as described in Example 9. Oligonucleotides having a viscosity greater than 40 cP would have less than optimal viscosity.
  • certain antisense compounds as described herein are highly tolerable, as demonstrated by the in vivo tolerability measurements described in the examples. In certain embodiments, the certain antisense compounds as described herein are highly tolerable, as demonstrated by having an increase in ALT and/or AST value of no more than 3 fold, 2 fold or 1.5 fold over saline treated animals.
  • certain antisense compounds as described herein are efficacious by virtue of having one or more of an inhibition potency of greater than 50%, an ED 50 ⁇ 1 mpk/wk, a viscosity of less than 40 cP, and no more than a 3 fold increase in ALT and/or AST in transgenic mice.
  • ISIS 702843 (SEQ ID NO: 36) is preferred. This compound was found to be a potent inhibitor in TMPRSS6 transgenic mice and a very tolerable antisense compound in CD-I mice. In mice it had less than a 3 fold increase in ALT and/or AST levels over saline treated animals. It had an acceptable viscosity of about 33 cP and an ED 50 ⁇ 1 mpk/wk in huTMPRSS6 transgenic mice. Also, in monkeys, it was among the most potent compounds in inhibiting TMPRSS6.
  • ISIS 705051 (SEQ ID NO: 36) is preferred. This compound was found to be a potent inhibitor in TMPRSS6 transgenic mice and a very tolerable antisense compound in CD-I mice. In mice it had less than a 3 fold increase in ALT and/or AST levels over saline treated animals. It had an acceptable viscosity of about 23 cP and an ED 50 ⁇ 3 mpk/wk in huTMPRSS6 transgenic mice. Also, in monkeys, it was among the most potent compounds in inhibiting TMPRSS6.
  • ISIS 706942 (SEQ ID NO: 77) is preferred.
  • This compound was found to be a potent inhibitor in TMPRSS6 transgenic mice and a very tolerable antisense compound in CD-I mice. In mice it had less than a 3 fold increase in ALT and/or AST levels over saline treated animals. It had an acceptable viscosity of about 20 cP and an ED 50 ⁇ 1 mpk/wk in huTMPRSS6 transgenic mice. Also, in monkeys, it was among the most potent compounds in inhibiting TMPRSS6.
  • ISIS 706943 (SEQ ID NO: 77) is preferred. This compound was found to be a potent inhibitor in TMPRSS6 transgenic mice and a very tolerable antisense compound in CD-I mice. In huTMPRSS6 transgenic mice it had less than a 3 fold increase in ALT and/or AST levels over saline treated animals. It had an acceptable viscosity of about 19 cP and an ED 50 ⁇ 1 mpk/wk in huTMPRSS6 transgenic mice. Also, in monkeys, it was among the most potent compounds in inhibiting TMPRSS6. EXAMPLES
  • Example 1 Antisense oligonucleotides targeting human type II transmembrane serine protease 6 (TMPRSS6)
  • the 5-10-5 MOE gapmers were designed as oligonucleotides 20 nucleosides in length, wherein the central gap segment comprises ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each.
  • Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification.
  • the cET containing gapmers were designed with varied deoxy, MOE, and (S)-cEt gapmer motifs.
  • the deoxy, MOE and (S)-cEt oligonucleotides are 16 nucleosides in length wherein the nucleosides have either a MOE sugar modification, an (S)-cEt sugar modification, or a deoxyribose.
  • the 'Chemistry' column in Table 3 describes the sugar modifications of each oligonucleotide, 'k' indicates an (S)-cEt sugar modification; 'd' indicates deoxyribose; and 'e' indicates a MOE modification.
  • “Start site” indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence.
  • “Stop site” indicates the 3'-most nucleoside to which the gapmer is targeted human gene sequence.
  • Each gapmer listed in the Tables below is targeted to either the human TMPRSS6 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_153609.2) or the human TMPRSS6 genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011520.12 truncated from nucleotide 16850000 to 16897000).
  • SEQ ID NO: 1 GenBANK Accession No. NM_153609.2
  • SEQ ID NO: 2 the complement of GENBANK Accession No. NT_011520.12 truncated from nucleotide 16850000 to 16897000.
  • 'n/a' indicates that the antisense
  • oligonucleotide does not target that particular gene sequence with 100% complementarity.
  • the 2200 chimeric antisense oligonucleotides were tested for their single dose effects on TMRPSS6 mRNA in vitro. Antisense oligonucleotides were tested at least once in a series of experiments that had similar culture conditions. A representative result for about 110 potent antisense oligonucleotides out of the 2200 tested is presented in Tables 1-3 shown below. These potent antisense oligonucleotides were selected for further studies as described below.
  • Table 1 shows the percent inhibition of TMPRSS6 mRNA by 5-10-5 MOE gapmers.
  • Cultured Hep3B cells at a density of about 20,000 cells per well were transfected using electroporation with 4,500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and TMPRSS6 mRNA levels were measured by quantitative real-time PCR.
  • Human primer probe set RTS3840 (forward sequence CAAAGCCCAGAAGATGCTCAA, designated herein as SEQ ID NO: 92; reverse sequence GGAATAGACGGAGCTGGAGTTG, designated herein as SEQ ID NO: 93; probe sequence ACCAGCACCCGCCTGGGAACTT, designated herein as SEQ ID NO: 94) was used to measure mRNA levels.
  • TMPRSS6 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN ® . Results are presented as percent inhibition of TMPRSS6, relative to untreated control cells.
  • Table 2 shows the percent inhibition of TMPRSS6 mRNA by additional 5-10-5 MOE gapmers.
  • Cultured Hep3B cells at a density of about 20,000 cells per well were transfected using electroporation with 5,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and TMPRSS6 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3840 was used to measure mRNA levels. TMPRSS6 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN ® . Results are presented as percent inhibition of TMPRSS6, relative to untreated control cells. Table 2
  • Table 3 shows the percent inhibition of TMPRSS6 mRNA by cEt containing gapmers from a series of experiments.
  • Cultured Hep3B cells at a density of about 20,000 cells per well were transfected using electroporation with 2,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and TMPRSS6 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3840 was used to measure mRNA levels. TMPRSS6 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN ® . Results are presented as percent inhibition of TMPRSS6, relative to untreated control cells.
  • Example 2 Dose response of antisense oligonucleotides targeting human TMPRSS6 in Hep3B cells
  • Antisense oligonucleotides selected from the about 2200 antisense oligonucleotides tested in single dose experiments described in Example 1 were also tested at various doses in Hep3B cells in studies of in vitro inhibition of human TMPRSS6 mRNA.
  • TMPRSS6 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3840 was used to measure mRNA levels. TMPRSS6 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN ® . Results are presented as percent inhibition of TMPRSS6, relative to untreated control cells. "0" indicate that the antisense oligonucleotide did not reduce TMPRSS6 mRNA levels.
  • IC 50 half maximal inhibitory concentration
  • TMPRSS6 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3840 was again used to measure mRNA levels. TMPRSS6 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN ® . Results are presented as percent inhibition of TMPRSS6, relative to untreated control cells.
  • IC 50 half maximal inhibitory concentration
  • TMPRSS6 mRNA levels were significantly reduced in a dose-dependent manner in antisense oligonucleotide treated cells.
  • TMPRSS6 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3840 was used to measure mRNA levels. TMPRSS6 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN ® . Results are presented as percent inhibition of TMPRSS6, relative to untreated control cells.
  • IC 50 half maximal inhibitory concentration
  • TMPRSS6 mRNA levels were significantly reduced in a dose-dependent manner in antisense oligonucleotide treated cells.
  • CDl® mice (Charles River, MA) are a multipurpose mice model, frequently utilized for safety and efficacy testing. The mice were treated with about 26 ISIS 5-10-5 MOE gapmer antisense oligonucleotides selected from the tables above and evaluated for changes in the levels of various plasma chemistry markers.
  • mice Groups of six week old male CDl mice were injected subcutaneously twice a week for six weeks with 50 mg/kg of ISIS oligonucleotides (100 mg/kg/week dose). One group of male CDl mice was injected subcutaneously twice a week for 6 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases (ALT and AST), total bilirubin (Tbil), albumin (Alb), creatinine (Creat), and BUN were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in Table 7. ISIS oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • mice Body weights of all the groups of mice were measured at the start of the experiment, and every week until the end of the study. Liver, spleen and kidney weights were also measured at the end of the study, and the change in body weight and organ weights relative to the PBS control group at baseline are presented in Table 8. ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.
  • CDl® mice (Charles River, MA) are a multipurpose mice model, frequently utilized for safety and efficacy testing. The mice were treated with about 51 cEt containing antisense oligonucleotides selected from the tables described above, and evaluated for changes in the levels of various plasma chemistry markers.
  • One group of male CDl mice was injected subcutaneously twice a week for 6 weeks with PBS.
  • Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis. Liver, kidney and spleen were collected for histology, and plasma was collected to measure levels of certain plasma chemistry markers.
  • oligonucleotides were split into two test groups with the same conditions and the results are presented to in the tables below.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases, bilirubin, albumin, creatinine, and BUN were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in Tables 9-10. ISIS oligonucleotides causing changes in the levels of any of the liver or kidney function markers outside the expected range for antisense oligonucleotides were excluded from further studies. Table 9
  • mice Body weights of all the groups of mice were measured at the start of the experiment, and every week until the end of the study. Liver, spleen and kidney weights were also measured at the end of the study, and the change in body weight and organ weights relative to the PBS control group at baseline are presented in Tables 11-12. ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.
  • Example 5 Tolerability of oligonucleotides targeting human TMPRSS6 in Sprague-Dawley rats
  • Sprague-Dawley rats are a multipurpose model used for safety and efficacy evaluations.
  • the rats were treated with about 48 antisense oligonucleotides, found potent in vitro and tolerable in mice from the studies described in the Examples above, and evaluated for changes in the levels of various plasma chemistry markers.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases (alanine transaminase (ALT) and aspartate transaminase (AST), total bilirubin (Tbil), albumin (Alb), creatinine (Creat), and BUN were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in Table 13. ISIS oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • transaminases alanine transaminase (ALT) and aspartate transaminase (AST), total bilirubin (Tbil), albumin (Alb), creatinine (Creat), and BUN were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e
  • Example 6 Effect of antisense inhibition of TMPRSS6 in transgenic mouse model

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Virology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Saccharide Compounds (AREA)
  • Steroid Compounds (AREA)
  • Liquid Crystal Substances (AREA)
PCT/US2016/025883 2015-04-03 2016-04-04 Compounds and methods for modulating tmprss6 expression Ceased WO2016161429A1 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
US15/562,843 US10415038B2 (en) 2015-04-03 2016-04-04 Compounds and methods for modulating TMPRSS6 expression
HK18108870.8A HK1249140A1 (zh) 2015-04-03 2016-04-04 用於调节tmprss6表达的化合物和方法
AU2016244106A AU2016244106B2 (en) 2015-04-03 2016-04-04 Compounds and methods for modulating TMPRSS6 expression
BR112017015864-7A BR112017015864B1 (pt) 2015-04-03 2016-04-04 Compostos e composições para modular a expressão de tmprss6, bem como uso dos referidos compostos
KR1020177030957A KR102539587B1 (ko) 2015-04-03 2016-04-04 Tmprss6 발현을 조절하기 위한 화합물 및 방법들
CA2978100A CA2978100C (en) 2015-04-03 2016-04-04 Compounds and methods for modulating tmprss6 expression
MX2017012426A MX2017012426A (es) 2015-04-03 2016-04-04 Composiciones y metodos para modular la expresion de tmprss6.
RU2017137410A RU2017137410A (ru) 2015-04-03 2016-04-04 Соединения и способы модулирования экспрессии tmprss6
CN201680015815.4A CN107429250B (zh) 2015-04-03 2016-04-04 用于调节tmprss6表达的化合物和方法
JP2017546624A JP6833705B2 (ja) 2015-04-03 2016-04-04 Tmprss6発現を調節するための化合物及び方法
EP16774409.3A EP3277817A4 (en) 2015-04-03 2016-04-04 Compounds and methods for modulating tmprss6 expression
IL253509A IL253509B2 (en) 2015-04-03 2017-07-16 Compounds and methods for modulating tmprss6 expression
US16/528,925 US20200190522A1 (en) 2015-04-03 2019-08-01 Compounds and methods for modulating tmprss6 expression
US17/484,386 US20220259600A1 (en) 2015-04-03 2021-09-24 Compounds and methods for modulating tmprss6 expression
IL286669A IL286669A (en) 2015-04-03 2021-09-26 Compounds and methods for modulating tmprss6 expression
US18/358,591 US20240026364A1 (en) 2015-04-03 2023-07-25 Compounds and methods for modulating tmprss6 expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562142986P 2015-04-03 2015-04-03
US62/142,986 2015-04-03

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/562,843 A-371-Of-International US10415038B2 (en) 2015-04-03 2016-04-04 Compounds and methods for modulating TMPRSS6 expression
US16/528,925 Continuation US20200190522A1 (en) 2015-04-03 2019-08-01 Compounds and methods for modulating tmprss6 expression

Publications (1)

Publication Number Publication Date
WO2016161429A1 true WO2016161429A1 (en) 2016-10-06

Family

ID=57007353

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/025883 Ceased WO2016161429A1 (en) 2015-04-03 2016-04-04 Compounds and methods for modulating tmprss6 expression

Country Status (12)

Country Link
US (4) US10415038B2 (enExample)
EP (1) EP3277817A4 (enExample)
JP (3) JP6833705B2 (enExample)
KR (1) KR102539587B1 (enExample)
CN (1) CN107429250B (enExample)
AU (1) AU2016244106B2 (enExample)
CA (1) CA2978100C (enExample)
HK (1) HK1249140A1 (enExample)
IL (2) IL253509B2 (enExample)
MX (1) MX2017012426A (enExample)
RU (1) RU2017137410A (enExample)
WO (1) WO2016161429A1 (enExample)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019213016A1 (en) 2018-04-30 2019-11-07 The Children's Hospital Of Philadelphia Methods of improving anemias by combining agents
US10538764B2 (en) 2014-06-16 2020-01-21 University Of Southampton Reducing intron retention
EP3598995A1 (en) * 2018-07-26 2020-01-29 Silence Therapeutics GmbH Products and compositions
US10683503B2 (en) 2017-08-25 2020-06-16 Stoke Therapeutics, Inc. Antisense oligomers for treatment of conditions and diseases
US10696969B2 (en) 2014-10-03 2020-06-30 Cold Spring Harbor Laboratory Targeted augmentation of nuclear gene output
US10941405B2 (en) 2015-10-09 2021-03-09 University Of Southampton Modulation of gene expression and screening for deregulated protein expression
US11083745B2 (en) 2015-12-14 2021-08-10 Cold Spring Harbor Laboratory Antisense oligomers for treatment of autosomal dominant mental retardation-5 and Dravet Syndrome
US11096956B2 (en) 2015-12-14 2021-08-24 Stoke Therapeutics, Inc. Antisense oligomers and uses thereof
US20220056455A1 (en) * 2018-12-20 2022-02-24 Praxis Precision Medicines, Inc. Compositions and methods for the treatment of kcnt1 related disorders
WO2022229150A1 (en) 2021-04-27 2022-11-03 Silence Therapeutics Gmbh Sirna targeting tmprss6 for the treawtment of myeloproliferative disorders
US11814622B2 (en) 2020-05-11 2023-11-14 Stoke Therapeutics, Inc. OPA1 antisense oligomers for treatment of conditions and diseases
US11952574B2 (en) 2022-06-24 2024-04-09 Novo Nordisk A/S Compositions and methods for inhibiting transmembrane serine protease 6 (TMPRSS6) expression
US12060558B2 (en) 2018-05-04 2024-08-13 Stoke Therapeutics, Inc. Methods and compositions for treatment of cholesteryl ester storage disease
WO2024200512A1 (en) 2023-03-27 2024-10-03 Silence Therapeutics Gmbh Compounds and compositions for use in stem cell transplantation
WO2025148896A1 (en) * 2024-01-08 2025-07-17 Shanghai Argo Biopharmaceutical Co., Ltd. Compositions and methods for inhibiting expression of transmembrane serine protease 6 (tmprss6)
US12503701B2 (en) 2022-11-23 2025-12-23 Novo Nordisk A/S Compositions and methods for inhibiting transmembrane serine protease 6 (TMPRSS6) expression

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2019218987B2 (en) 2018-02-12 2025-04-24 Ionis Pharmaceuticals, Inc. Modified compounds and uses thereof
TWI840345B (zh) * 2018-03-02 2024-05-01 美商Ionis製藥公司 Irf4表現之調節劑
JP2023130528A (ja) * 2020-06-24 2023-09-21 田辺三菱製薬株式会社 Plp1発現を調節するための化合物、方法及び医薬組成物
CA3195722A1 (en) 2020-09-17 2022-03-24 Q-State Biosciences, Inc. Therapeutic compositions for treating pain via multiple targets
WO2022232395A2 (en) * 2021-04-28 2022-11-03 Q-State Biosciences, Inc. Therapeutic compositions for treating pain via multiple targets
CN115247173B (zh) * 2021-11-11 2025-11-11 南京启真基因工程有限公司 构建tmprss6基因突变的缺铁性贫血猪核移植供体细胞的基因编辑系统及其应用
WO2024060649A1 (zh) * 2022-09-29 2024-03-28 广州必贝特医药股份有限公司 用于抑制TMPRSS6基因表达的siRNA或其盐、药物及其应用
CN117136236B (zh) * 2022-09-29 2024-03-15 广州必贝特医药股份有限公司 用于抑制TMPRSS6基因表达的siRNA或其盐、药物及其应用
WO2025206092A1 (ja) * 2024-03-27 2025-10-02 田辺三菱製薬株式会社 Myoregulin発現を調節するための化合物及び医薬組成物

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070134655A1 (en) * 2002-11-14 2007-06-14 Itzhak Bentwich Bioinformatically detectable group of novel regulatory genes and uses thereof
US20140194489A1 (en) * 2011-03-29 2014-07-10 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of tmprss6 gene
US20140309286A1 (en) * 2011-11-07 2014-10-16 Isis Pharmaceuticals, Inc. Modulation of tmprss6 expression
WO2014179625A1 (en) * 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. COMPOSITIONS AND METHODS FOR MODULATING APOLIPOPROTEIN (a) EXPRESSION

Family Cites Families (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
JP3756313B2 (ja) 1997-03-07 2006-03-15 武 今西 新規ビシクロヌクレオシド及びオリゴヌクレオチド類縁体
KR100414936B1 (ko) 1997-09-12 2004-01-13 엑시콘 에이/에스 이환 및 삼환 뉴클레오시드, 뉴클레오타이드 및올리고뉴클레오타이드 동족체
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
PT1178999E (pt) 1999-05-04 2007-06-26 Santaris Pharma As Análogos de l-ribo-lna
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US6906182B2 (en) 2000-12-01 2005-06-14 Cell Works Therapeutics, Inc. Conjugates of glycosylated/galactosylated peptide, bifunctional linker, and nucleotidic monomers/polymers, and related compositions and method of use
CA2452458A1 (en) 2001-07-03 2003-01-16 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
CA2504694C (en) 2002-11-05 2013-10-01 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
EP1560840B1 (en) 2002-11-05 2015-05-06 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2'-modified nucleosides for use in gene modulation
DK2284266T3 (da) 2002-11-14 2014-01-13 Thermo Fisher Scient Biosciences Inc sIRNA-MOLEKYLE MOD TP53
US7217807B2 (en) 2002-11-26 2007-05-15 Rosetta Genomics Ltd Bioinformatically detectable group of novel HIV regulatory genes and uses thereof
WO2004106356A1 (en) 2003-05-27 2004-12-09 Syddansk Universitet Functionalized nucleotide derivatives
US7888497B2 (en) 2003-08-13 2011-02-15 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
JP4731324B2 (ja) 2003-08-28 2011-07-20 武 今西 N−o結合性架橋構造型新規人工核酸
WO2005023835A2 (en) 2003-09-09 2005-03-17 Irm Llc Modulators of transmembrane protease serine 6
WO2005027962A1 (en) 2003-09-18 2005-03-31 Isis Pharmaceuticals, Inc. 4’-thionucleosides and oligomeric compounds
ES2516815T3 (es) 2006-01-27 2014-10-31 Isis Pharmaceuticals, Inc. Análogos de ácidos nucleicos bicíclicos modificados en la posición 6
US8178503B2 (en) 2006-03-03 2012-05-15 International Business Machines Corporation Ribonucleic acid interference molecules and binding sites derived by analyzing intergenic and intronic regions of genomes
CA2651453C (en) 2006-05-11 2014-10-14 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
JP5244103B2 (ja) 2006-08-09 2013-07-24 ホームステッド クリニカル コーポレイション 器官特異的蛋白質およびその使用方法
WO2008024858A2 (en) 2006-08-22 2008-02-28 University Of Virginia Patent Foundation Methods and compounds regulating the erythroid response to iron deficiency
US20100190837A1 (en) 2007-02-15 2010-07-29 Isis Pharmaceuticals, Inc. 5'-Substituted-2-F' Modified Nucleosides and Oligomeric Compounds Prepared Therefrom
WO2008150729A2 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
EP2173760B2 (en) 2007-06-08 2015-11-04 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
AU2008272918B2 (en) 2007-07-05 2012-09-13 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
US8546556B2 (en) 2007-11-21 2013-10-01 Isis Pharmaceuticals, Inc Carbocyclic alpha-L-bicyclic nucleic acid analogs
EP3705125B1 (en) 2007-12-04 2023-07-05 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US8530640B2 (en) 2008-02-07 2013-09-10 Isis Pharmaceuticals, Inc. Bicyclic cyclohexitol nucleic acid analogs
EP2294181A4 (en) 2008-05-22 2013-04-24 Isis Pharmaceuticals Inc MODULATION OF SMRT EXPRESSION
EP2331141B1 (en) * 2008-08-25 2016-01-06 Excaliard Pharmaceuticals, Inc. Antisense oligonucleotides directed against connective tissue growth factor and uses thereof
WO2010036698A1 (en) 2008-09-24 2010-04-01 Isis Pharmaceuticals, Inc. Substituted alpha-l-bicyclic nucleosides
CN106146591B (zh) 2010-01-08 2020-07-31 Ionis制药公司 血管生成素样3表达的调节
CN108410868A (zh) * 2011-09-20 2018-08-17 Ionis制药公司 Gcgr表达的反义调节
JP2016528873A (ja) 2012-05-16 2016-09-23 ラナ セラピューティクス インコーポレイテッド 遺伝子発現を調節するための組成物及び方法
WO2014190157A1 (en) * 2013-05-22 2014-11-27 Alnylam Pharmaceuticals, Inc. Tmprss6 compositions and methods of use thereof
TW201536329A (zh) * 2013-08-09 2015-10-01 Isis Pharmaceuticals Inc 用於調節失養性肌強直蛋白質激酶(dmpk)表現之化合物及方法
EP3262181B1 (en) 2015-02-23 2024-04-10 Ionis Pharmaceuticals, Inc. Method for solution phase detritylation of oligomeric compounds

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070134655A1 (en) * 2002-11-14 2007-06-14 Itzhak Bentwich Bioinformatically detectable group of novel regulatory genes and uses thereof
US20140194489A1 (en) * 2011-03-29 2014-07-10 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of tmprss6 gene
US20140309286A1 (en) * 2011-11-07 2014-10-16 Isis Pharmaceuticals, Inc. Modulation of tmprss6 expression
WO2014179625A1 (en) * 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. COMPOSITIONS AND METHODS FOR MODULATING APOLIPOPROTEIN (a) EXPRESSION

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10538764B2 (en) 2014-06-16 2020-01-21 University Of Southampton Reducing intron retention
US11891605B2 (en) 2014-06-16 2024-02-06 University Of Southampton Reducing intron retention
US10696969B2 (en) 2014-10-03 2020-06-30 Cold Spring Harbor Laboratory Targeted augmentation of nuclear gene output
US11702660B2 (en) 2015-10-09 2023-07-18 University Of Southampton Modulation of gene expression and screening for deregulated protein expression
US10941405B2 (en) 2015-10-09 2021-03-09 University Of Southampton Modulation of gene expression and screening for deregulated protein expression
US11096956B2 (en) 2015-12-14 2021-08-24 Stoke Therapeutics, Inc. Antisense oligomers and uses thereof
US11083745B2 (en) 2015-12-14 2021-08-10 Cold Spring Harbor Laboratory Antisense oligomers for treatment of autosomal dominant mental retardation-5 and Dravet Syndrome
US11873490B2 (en) 2017-08-25 2024-01-16 Stoke Therapeutics, Inc. Antisense oligomers for treatment of conditions and diseases
US10913947B2 (en) 2017-08-25 2021-02-09 Stoke Therapeutics, Inc. Antisense oligomers for treatment of conditions and diseases
US10683503B2 (en) 2017-08-25 2020-06-16 Stoke Therapeutics, Inc. Antisense oligomers for treatment of conditions and diseases
WO2019213016A1 (en) 2018-04-30 2019-11-07 The Children's Hospital Of Philadelphia Methods of improving anemias by combining agents
US12263205B2 (en) 2018-04-30 2025-04-01 The Children's Hospital Of Philadelphia Methods of improving anemias by combining agents
US12060558B2 (en) 2018-05-04 2024-08-13 Stoke Therapeutics, Inc. Methods and compositions for treatment of cholesteryl ester storage disease
JP7562505B2 (ja) 2018-07-26 2024-10-07 サイレンス・セラピューティクス・ゲーエムベーハー Tmprss6の発現を阻害するための核酸及び鉄キレート剤
JP2021531029A (ja) * 2018-07-26 2021-11-18 サイレンス・セラピューティクス・ゲーエムベーハー Tmprss6の発現を阻害するための核酸及び鉄キレート剤
AU2019308710B2 (en) * 2018-07-26 2025-12-11 Silence Therapeutics Gmbh Nucleic acids for inhibiting expression of TMPRSS6 and iron chelators
WO2020021108A3 (en) * 2018-07-26 2020-04-30 Silence Therapeutics Gmbh Nucleic acids for inhibiting expression of tmprss6 and iron chelators
EP3598995A1 (en) * 2018-07-26 2020-01-29 Silence Therapeutics GmbH Products and compositions
CN113164768B (zh) * 2018-07-26 2024-03-01 赛伦斯治疗有限责任公司 用于抑制tmprss6表达的核酸和铁螯合剂
CN113164768A (zh) * 2018-07-26 2021-07-23 赛伦斯治疗有限责任公司 用于抑制tmprss6表达的核酸和铁螯合剂
US12076335B2 (en) 2018-07-26 2024-09-03 Silence Therapeutics Gmbh Nucleic acids for inhibiting expression of TMPRSS6 and iron chelators
US20220056455A1 (en) * 2018-12-20 2022-02-24 Praxis Precision Medicines, Inc. Compositions and methods for the treatment of kcnt1 related disorders
US12338437B2 (en) 2020-05-11 2025-06-24 Stoke Therapeutics, Inc. OPA1 antisense oligomers for treatment of conditions and diseases
US11814622B2 (en) 2020-05-11 2023-11-14 Stoke Therapeutics, Inc. OPA1 antisense oligomers for treatment of conditions and diseases
WO2022229150A1 (en) 2021-04-27 2022-11-03 Silence Therapeutics Gmbh Sirna targeting tmprss6 for the treawtment of myeloproliferative disorders
US11952574B2 (en) 2022-06-24 2024-04-09 Novo Nordisk A/S Compositions and methods for inhibiting transmembrane serine protease 6 (TMPRSS6) expression
US12503701B2 (en) 2022-11-23 2025-12-23 Novo Nordisk A/S Compositions and methods for inhibiting transmembrane serine protease 6 (TMPRSS6) expression
WO2024200512A1 (en) 2023-03-27 2024-10-03 Silence Therapeutics Gmbh Compounds and compositions for use in stem cell transplantation
WO2025148896A1 (en) * 2024-01-08 2025-07-17 Shanghai Argo Biopharmaceutical Co., Ltd. Compositions and methods for inhibiting expression of transmembrane serine protease 6 (tmprss6)

Also Published As

Publication number Publication date
HK1249140A1 (zh) 2018-10-26
JP6833705B2 (ja) 2021-02-24
US20240026364A1 (en) 2024-01-25
US20220259600A1 (en) 2022-08-18
CA2978100C (en) 2023-10-17
AU2016244106A1 (en) 2017-08-03
US20200190522A1 (en) 2020-06-18
BR112017015864A2 (pt) 2018-07-31
KR102539587B1 (ko) 2023-06-01
IL253509B1 (en) 2023-04-01
MX2017012426A (es) 2018-01-26
EP3277817A4 (en) 2018-12-05
US20180105817A1 (en) 2018-04-19
US10415038B2 (en) 2019-09-17
AU2016244106B2 (en) 2022-05-19
JP2018511307A (ja) 2018-04-26
JP7037681B2 (ja) 2022-03-16
KR20170129263A (ko) 2017-11-24
EP3277817A1 (en) 2018-02-07
IL253509A0 (en) 2017-09-28
JP2022104917A (ja) 2022-07-12
CA2978100A1 (en) 2016-10-06
IL286669A (en) 2021-10-31
JP2021074010A (ja) 2021-05-20
IL253509B2 (en) 2023-08-01
CN107429250B (zh) 2022-03-01
RU2017137410A3 (enExample) 2020-01-21
CN107429250A (zh) 2017-12-01
RU2017137410A (ru) 2019-05-06

Similar Documents

Publication Publication Date Title
JP7037681B2 (ja) Tmprss6発現を調節するための化合物及び方法
US10912792B2 (en) Compounds and methods for modulating angiotensinogen expression
US10184125B2 (en) Modulation of TMPRSS6 expression
US20140378533A1 (en) Modulation of rna by repeat targeting
EP3603677A1 (en) Modulators of complement factor b
WO2013142514A1 (en) Methods and compositions for modulating alpha-1-antitrypsin expression
EP2758533A1 (en) Antisense modulation of gcgr expression
WO2013130868A1 (en) Methods for modulating fibrinogen expression
HK40120876A (en) Compounds and methods for modulating angiotensinogen expression
HK40069167A (en) Compounds and methods for modulating angiotensinogen expression
BR112017015864B1 (pt) Compostos e composições para modular a expressão de tmprss6, bem como uso dos referidos compostos
HK40022442A (en) Modulators of complement factor b

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16774409

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 253509

Country of ref document: IL

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112017015864

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2016244106

Country of ref document: AU

Date of ref document: 20160404

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2978100

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2017546624

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2017/012426

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20177030957

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2017137410

Country of ref document: RU

ENP Entry into the national phase

Ref document number: 112017015864

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20170725

WWW Wipo information: withdrawn in national office

Ref document number: 286669

Country of ref document: IL

WWG Wipo information: grant in national office

Ref document number: 733858

Country of ref document: NZ