WO2016044707A1 - Compositions and methods for treating fibrosis - Google Patents
Compositions and methods for treating fibrosis Download PDFInfo
- Publication number
- WO2016044707A1 WO2016044707A1 PCT/US2015/050906 US2015050906W WO2016044707A1 WO 2016044707 A1 WO2016044707 A1 WO 2016044707A1 US 2015050906 W US2015050906 W US 2015050906W WO 2016044707 A1 WO2016044707 A1 WO 2016044707A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- fibrosis
- day
- receptor
- subject
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/10—Peptides having 12 to 20 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61N—ELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
- A61N5/00—Radiation therapy
- A61N5/10—X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy
- A61N5/1001—X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy using radiation sources introduced into or applied onto the body; brachytherapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
- C07K14/5406—IL-4
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
- C07K14/5437—IL-13
Definitions
- compositions and methods for treating, inhibiting, reducing the severity of and/or promoting prophylaxis of fibrosis, pancreatitis and/or pancreatic cancer in subject in need thereof comprise inhibitors of IL-4/IL-13 receptor function.
- CP pancreatitis
- CP histologic features include chronic inflammation, fibrosis, acinar cell atrophy and distorted and/or blocked ducts.
- the management of CP is challenging with focus on the management of complications, and most patients remain symptomatic despite limited supportive therapy.
- Recurrent AP or pancreatic insults lead to necroinflammation and are linked to the development of pancreatic fibrosis (the necrosis-fibrosis concept).
- PSCs pancreatic stellate cells
- Macrophages are innate immune cells, which are for simplicity divided into two spectra of major types based on Siamon Gordon's scheme: (1) classically activated macrophages (Ml), induced by interferon gamma (IFNy) and/or lipopolysaccharide, characterized by the production of reactive oxygen and nitrogen species and thought to play a critical role in host defense and antitumour immunity; and (2) alternatively activated macrophages (AAMs, M2), on exposure to IL-4/IL-13, are characterized by cell surface expression of scavenger receptors CD206.
- AAMs play key roles in dampening inflammation, promote wound-healing, fibrosis and tumorigenesis.
- the inventors demonstrate that progression to CP is associated with alternative activation of macrophages and show an important role for the IL-4/IL-13 pathway in a crosstalk between macrophages and PSCs using in vivo and in vitro animal studies as well as ex vivo human primary cells.
- blocking IL-4/IL-13 using a peptide antagonist we show a therapeutic effect in established experimental CP and proof-of-concept therapeutic ex vivo effect using human samples.
- compositions comprising and inhibitor of IL-4/IL- 13 receptor and a pharmaceutically acceptable carrier/excipient.
- the inhibitor comprises, consists of or consists essentially of CSRM53567 (as described in SEQ ID NO: 1) peptide, CSRM535671 (as described in SEQ ID NO: 2) peptide, CSRM535672 (as described in SEQ ID NO: 3) peptide or a combination thereof, as described herein.
- the peptide can be modified to extend the shelf life and/or bioavailability using one or more non-natural peptide bonds or amino acids or by attaching to the peptide functional groups such as, e.g., polyethylene glycol (PEG).
- PEG polyethylene glycol
- composition may further comprise a carrier, such as a pharmaceutically acceptable carrier.
- the method includes providing a composition comprising an inhibitor of IL-4/IL-13 receptor and administering an effective amount of the composition to the subject so as to treat, inhibit, reduce the severity of and/or promote prophylaxis of the disease state.
- the disease-state is fibrosis and/or cancer.
- the inhibitor of IL-4/IL-13 receptor is any one or more of CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the subject is human.
- the methods include providing a composition comprising an inhibitor of IL-4/IL-13 receptor and administering an effective amount of the composition to the subject so as to treat, inhibit, reduce the severity of and/or promote prophylaxis of fibrosis.
- the methods for treating, inhibiting, reducing the severity of or promoting prophylaxis of fibrosis may further comprise prescribing and/or administering existing therapies for organ-specific fibrosis.
- the inhibitor of IL-4/IL-13 receptor is any one or more of CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the subject is human.
- fibrosis is pancreatic fibrosis.
- fibrosis is lung fibrosis.
- the methods include providing a composition comprising an inhibitor of IL-4/IL-13 receptor and administering an effective amount of the composition to the subject so as to treat, inhibit, reduce the severity of and/or prevent metastasis of cancer.
- the methods for treating, inhibiting, reducing the severity of and/or preventing metastasis of cancer may further comprise prescribing and/or administering existing therapies for specific types of cancer.
- the inhibitor of IL-4/IL-13 receptor is any one or more of CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the subject is human.
- the cancer is pancreatic cancer.
- the cancer is lung cancer.
- kits for treating, inhibiting, reducing the severity of or promoting prophylaxis of pancreatitis in a subject in need thereof include providing a composition comprising an inhibitor of IL-4/IL-13 receptor and administering an effective amount of the composition to the subject so as to treat, inhibit, reduce the severity of and/or promote prophylaxix of pancreatitis in the subject.
- the methods for treating, inhibiting, reducing the severity of and/or promoting prophylaxis of pancreatitis may further comprise prescribing and/or administering existing therapies for pancreatitis.
- the inhibitor of IL-4/IL-13 receptor is any one or more of CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the subject is human.
- the cancer is pancreatic cancer.
- the methods include providing a composition comprising an inhibitor of IL-4/IL-13 receptor and administering an effective amount of the composition to the subject so as to treat, inhibit, reduce the severity of and/or promote prophylaxis of disease-states associated with IL-4/IL- 13 receptor signaling.
- the disease-states include chronic pancreatitis, chronic inflammation, fibrosis, cancer or a combination thereof.
- the inhibitor of IL-4/IL-13 receptor is any one or more of CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the subject is human.
- the methods include providing a composition comprising an inhibitor of IL-4/IL-13 receptor and administering an effective amount of the composition to the subject so as to treat, inhibit, reduce the severity of and/or promote prophylaxis of disease-states treatable by inhibiting IL- 4/IL-13 receptor function.
- the disease-states include chronic pancreatitis, chronic inflammation, fibrosis, cancer or a combination thereof.
- the inhibitor of IL-4/IL-13 receptor is any one or more of CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the subject is human.
- FIG. 1A to Fig. 1C depict, in accordance with various embodiments of the present invention, that CSRM53567 reduces macrophages and fibrosis in chronic pancreatitis mouse model.
- Fig. 1A show the treatment strategy
- Fig. IB shows the effect of CSRM53567 macrophages as measured by FACS.
- Fig. 1C shows the effect of CSRM53567 on preventing pancreas shrinkage due to chronic pancreatitis mediated fibrosis.
- FIG. 2 A to Fig. 2E depict, in accordance with various embodiments of the present invention, that macrophages are increased in mouse and human CP.
- Fig. 2 A shows a heat map of cytokine and chemokine expressions in the pancreas lysates from control (Con) and CP mice quantitated via the Luminex analysis.
- Fig. 2B shows representative immunofluorescence images of the pancreas from control and CP mice stained with amylase (acinar cells), a-SMA and GFAP (PSCs), F4/80 (macrophages) and 4,6-diamidino-2- phenylindole (DAPI). Scale bars, 50 ⁇ .
- Fig. 1 shows a heat map of cytokine and chemokine expressions in the pancreas lysates from control (Con) and CP mice quantitated via the Luminex analysis.
- Fig. 2B shows representative immunofluorescence images of the pancreas from
- FIG. 2C shows representative immunofluorescence images of the human pancreas from paired normal and CP tissue stained with amylase, a- SMA, CD68 (macrophages) and DAPI. Scale bars, 50 ⁇ .
- pancreatic leukocytes were isolated from control and CP mice and analysed using flow cytometry for macrophage numbers, BrdU incorporation, Ki-67 expression (n>3 per group).
- Fig. 2E CCR2 WT CD45.1 + CD45.2 + C57BL/6 mice were lethally irradiated and reconstituted with a 1 : 1 mixture of BM cells from CCR2 WT CD45.1 + and CCR2 KO CD45.2 + mice over 8 weeks.
- FIG. 3D depict, in accordance with various embodiments of the present invention, that alternatively activated macrophages are dominant in mouse and human CP.
- FIG. 3A pancreatic leukocytes from control and CP mice were isolated and sorted for SSC- A low CDl lb + monocytes/macrophages (five mice were pooled for each group). Markers of alternatively and classically activated macrophages were assessed using quantitative PCR. Expression of the genes was normalized to their relative expression in control mice.
- alternative activation markers CD206, IL-10 and IL-4Ra
- MHCII and TNFa classical activation markers
- FIG. 3C shows representative immunofluorescence images of mouse and human CP tissues co-stained with macrophage F4/80 (mouse) or CD68 (human), CD206 (M2 marker) and DAPI (nuclei).
- Fig. 3D shows representative immunofluorescence images of mouse and human CP tissues, co-stained with F4/80 or CD68, TNFa (Ml marker) and DAPI. Scale bars, 50 ⁇ .
- FIG. 4A to Fig. 4G depict, in accordance with various embodiments of the present invention, that mouse and human pancreatic stellate cells promote alternative macrophage polarization.
- FIG. 4A culture supematants from primary PSCs isolated from CP mice were collected and quantitated via the Luminex analysis, cytokine data presented as a heat map.
- Fig. 4B shows analysis of macrophage activation-associated genes in BMDMs cocultured in the presence or absence of PSCs for 2 days. Bar graphs represent BMDM gene expression in the presence of PSCs relative to absence of PSCs (BMDMs alone).
- BMDMs macrophage activation-associated genes
- BMDMs were cultured with PSC conditioned medium (PSC CM) or control medium (Con) for 24 h, and expression of CD206, IL-10, IL-4Ra, MHCII and TNFa determined using flow cytometry.
- BMDMs from WT or IL-4Ra ' ⁇ mice were cultured with PSC CM or IL-4/IL-13 (as a positive control for alternative macrophage polarization) for 24 h, and the expression of CD206 was examined using flow cytometry.
- PSC CM PSC conditioned medium
- Con control medium
- mouse PSCs were cultured with TGFP (5 ng ml 1 ), PDGFP (10 ng mP 1 ) or controls for 6 h and indicated gene expression was determined using qPCR. Representative bar graphs show relative mRNA expression over control treatments.
- Fig. 4F culture supematants from primary PSCs derived from PDAC pieces (nos 2, 4, 6), normal margin of patients with PDAC (nos 3 and 5) and normal pancreas (no. 1; patient with nonpancreatic tumour requiring partial resection of the pancreas) were collected and quantitated via the Luminex analysis. Data presented as a cytokine heat map expression. In Fig.
- monocyte-derived human macrophages were exposed to the conditioned medium from human PSCs (hPSC CM) for 24 h.
- the expressions of CD206 and TNFa were examined using flow cytometry. *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001. Data presented as means ⁇ s.e.m. (unpaired two-tailed Student's t-test).
- FIG. 5 A to Fig. 5F depict, in accordance with various embodiments of the present invention, that global or myeloid-specific IL-4Ra deficiency is protective against CP.
- WT IL-4/IL-I3-'-
- Fig. 5 A relative pancreas weight (pancreas weight/body weight) are shown.
- n 6-7 per genotype, means ⁇ s.e.m., ***P ⁇ 0.001, ns, not significant, P ⁇ 0.05 considered significant (one-way analysis of variance (ANOVA), Tukey's post hoc test).
- ANOVA one-way analysis of variance
- FIG. 5B histologic feature of the pancreas from different genotypes of mice are shown using H&E and Trichrome staining. Scale bar, 200 ⁇ .
- Fig. 5C and Fig. 5D show quantitative RT-PCR analysis of fibrosis-associated genes aSMA (a-SMA) and Collal (CoUagenlAl) in the pancreas of indicated mice is shown. Means ⁇ s.e.m. *P ⁇ 0.05, **P ⁇ 0.01, ns, not significant (one-way ANOVA, Tukey's post hoc test). Fig.
- FIG. 5E shows representative immunofluorescence images of the pancreas from each genotype of mice (co-stained with a- SMA, CoUagenlAl and DAPI).
- Fig. 5F shows flow cytometry analysis of pancreatic macrophages (CD1 lb + F4/80 ) CD206 expression (MFI) from different genotypes of mice is shown. Means ⁇ s.e.m., *P ⁇ 0.05, **P ⁇ 0.01, ns, not significant (one-way ANOVA, Tukey's post hoc test).
- Fig. 6A to Fig. 6G depict, in accordance with various embodiments of the present invention, that IL-4/IL- 13 -blocking peptide ameliorates established CP.
- IL-4/IL- 13 -blocking peptide (IL4/13BP i.p., 50 ⁇ g per mouse, 5 days per week) was administrated to mice 2 weeks after starting CP induction and mice were killed as previous after 4 weeks of caerulein injections.
- Fig. 6A shows relative pancreas weight from Con and IL4/13BP-treated mice. per group, means ⁇ s.e.m. (unpaired two-tailed Student's t-test).
- FIG. 6B shows representative pancreas H&E and Trichrome staining. Scale bar, 200 ⁇ .
- Fig. 6C shows representative immunofluorescence images of the pancreas from indicated mice (co-stained with a-SMA, CoUagenlAl and DAPI). Scale bar: 50 ⁇ .
- Fig. 6D and Fig. 6E show RT- PCR analysis of a-SMA and Collal (CoUagenlAl) gene expression in the pancreas of indicated mice. Means ⁇ s.e.m. (unpaired two-tailed Student's t-test). Fig.
- FIG. 6F shows flow cytometry analysis of CD206 expression (MFI) by pancreatic macrophages (CD1 lb + F4/80 ) isolated from indicated mice. Means ⁇ s.e.m. (unpaired two-tailed Student's t-test).
- human macrophages as above were cultured with control medium (Con), conditioned medium from hPSCs (hPSC CM) or hPSC CM pretreated with 1 ⁇ IL4/13BP (hPSC_CM+BP) for 24h.
- Expression of CD206 (% CD206 + macrophages) was analysed using flow cytometry.
- FIG. 7 depicts, in accordance with various embodiments of the present invention, a schematic rep esentation of macrophage and pancreatic stellate cell (PSC) interation in chronic pancreatitis.
- PSC pancreatic stellate cell
- the term “comprising” or “comprises” is used in reference to compositions, methods, and respective component(s) thereof, that are useful to an embodiment, yet open to the inclusion of unspecified elements, whether useful or not. It will be understood by those within the art that, in general, terms used herein are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.).
- “Beneficial results” may include, but are in no way limited to, lessening or alleviating the severity of the disease condition, preventing the disease condition from worsening, curing the disease condition, preventing the disease condition from developing, lowering the chances of a patient developing the disease condition and prolonging a patient's life or life expectancy.
- Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of the deficit, stabilized (i.e., not worsening) state of cancer progression, delay or slowing of metastasis or invasiveness, and amelioration or palliation of symptoms associated with the cancer.
- Treatment also includes a decrease in mortality or an increase in the lifespan of a subject as compared to one not receiving the treatment.
- administering refers to the placement an agent as disclosed herein into a subject by a method or route which results in at least partial localization of the agents at a desired site.
- a "cancer” or “tumor” as used herein refers to an uncontrolled growth of cells which interferes with the normal functioning of the bodily organs and systems.
- a subject that has a cancer or a tumor is a subject having objectively measurable cancer cells present in the subject's body. Included in this definition are benign and malignant cancers, as well as dormant tumors or micrometastatses. Cancers which migrate from their original location and seed vital organs can eventually lead to the death of the subject through the functional deterioration of the affected organs.
- the term “carcinoma” refers to a cancer arising from epithelial cells.
- the term “invasive” refers to the ability to infiltrate and destroy surrounding tissue.
- Melanoma is an invasive form of skin tumor.
- cancer include, but are not limited to B-cell lymphomas (Hodgkin's lymphomas and/or non-Hodgkins lymphomas), brain tumor, breast cancer, colon cancer, lung cancer, hepatocellular cancer, gastric cancer, pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, cancer of the urinary tract, thyroid cancer, renal cancer, carcinoma, melanoma, head and neck cancer, brain cancer, and prostate cancer, including but not limited to androgen-dependent prostate cancer and androgen-independent prostate cancer.
- B-cell lymphomas Hodgkin's lymphomas and/or non-Hodgkins lymphomas
- brain tumor breast cancer
- colon cancer lung cancer
- gastric cancer pancreatic cancer
- cervical cancer ovarian cancer
- liver cancer bladder cancer
- cancer of the urinary tract thyroid cancer
- renal cancer carcinoma
- melanoma head and neck cancer
- brain cancer and prostate cancer, including but not limited to androg
- the term "effective amount” as used herein refers to the amount of a pharmaceutical composition comprising one or more peptides as disclosed herein or a mutant, variant, analog or derivative thereof, to decrease at least one or more symptom of the disease or disorder, and relates to a sufficient amount of pharmacological composition to provide the desired effect.
- the phrase "therapeutically effective amount” as used herein means a sufficient amount of the composition to treat a disorder, at a reasonable benefit/risk ratio applicable to any medical treatment.
- a therapeutically or prophylactically significant reduction in a symptom is, e.g. at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%), at least about 60%>, at least about 70%>, at least about 80%>, at least about 90%>, at least about 100%, at least about 125%, at least about 150% or more in a measured parameter as compared to a control or non-treated subject or the state of the subject prior to administering the peptide.
- Measured or measurable parameters include clinically detectable markers of disease, for example, elevated or depressed levels of a biological marker, as well as parameters related to a clinically accepted scale of symptoms or markers for fibrosis and/or inflammation.
- a "subject” means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomologous monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, and canine species, e.g., dog, fox, wolf. The terms, "patient”, “individual” and “subject” are used interchangeably herein.
- the subject is mammal.
- the mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but are not limited to these examples.
- the methods described herein can be used to treat domesticated animals and/or pets.
- the term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be included within the scope of this term.
- the terms “treat,” “treatment,” “treating,” or “amelioration” refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with, a disease or disorder.
- the term “treating” includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder, such as fibrosis, an autoimmune disease, a chronic infection or a cancer.
- Treatment is generally “effective” if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective” if the progression of a disease is reduced or halted.
- treatment includes not just the improvement of symptoms or markers, but also a cessation of at least slowing of progress or worsening of symptoms that would be expected in absence of treatment.
- Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
- treatment also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).
- Therapeutic agents refers to agents that are used to, for example, treat, inhibit, prevent, mitigate the effects of, reduce the severity of, reduce the likelihood of developing, slow the progression of and/or cure, a disease.
- Diseases targeted by the therapeutic agents include but are not limited to fibrosis, chronic pancreatitis, cancer and/or any disease-state associated with IL-4/IL-13 receptor mediated function and/or signaling.
- Peptidomimetic as used herein is a small protein-like chain designed to mimic a protein function. They may be modifications of an existing peptide or newly designed to mimic known peptides. They may be, for example peptoids and/or ⁇ -peptides and/or D- peptides.
- Recombinant virus refers to a virus that has been genetically altered (e.g., by the addition or insertion of a heterologous nucleic acid construct into the particle).
- a "gene” or “coding sequence” or a sequence which "encodes” a particular protein or peptide is a nucleic acid molecule that is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences.
- the boundaries of the gene are determined by a start codon at the 5' (i.e., amino) terminus and a translation stop codon at the 3' (i.e., carboxy) terminus.
- a gene can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and even synthetic DNA sequences.
- a transcription termination sequence will usually be located 3' to the gene sequence.
- control elements refers collectively to promoter regions, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, and the like, which collectively provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all of these control elements need always be present, so long as the selected coding sequence is capable of being replicated, transcribed and translated in an appropriate host cell.
- promoter region is used herein in its ordinary sense to refer to a nucleotide region including a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene which is capable of binding R A polymerase and initiating transcription of a downstream (3 '-direction) coding sequence.
- operably linked refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function.
- control elements operably linked to a coding sequence are capable of effecting the expression of the coding sequence.
- the control elements need not be contiguous with the coding sequence, so long as they function to direct the expression thereof.
- intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered “operably linked" to the coding sequence.
- Gene transfer refers to methods or systems for reliably inserting foreign DNA into host cells. Such methods can result in transient expression of nonintegrated transferred DNA, extrachromosomal replication and expression of transferred replicons (e.g., episomes), or integration of transferred genetic material into the genomic DNA of host cells.
- Gene transfer provides a unique approach for the treatment of acquired and inherited diseases. A number of systems have been developed for gene transfer into mammalian cells. See, e.g., U.S. Pat. No. 5,399,346. Examples of well-known vehicles for gene transfer include adenovirus and recombinant adenovirus (RAd), adeno-associated virus (AAV), herpes simplex virus type 1 (HSV-1), and lentivirus (LV).
- RAd adenovirus and recombinant adenovirus
- AAV adeno-associated virus
- HSV-1 herpes simplex virus type 1
- LV lentivirus
- Genetically modified cells refer to cells that express the polynucleotide having the sequence of any one or more of CSRM53567, CSRM535671, CSRM535672 or a combination thereof, or a variant, derivative, pharmaceutical equivalent, peptidomimetic or an analog thereof.
- naked DNA refers to DNA encoding a polypeptide having the sequence of any one or more of CSRM53567, CSRM535671, CSRM535672 or a combination thereof, or a variant, derivative, pharmaceutical equivalent, peptidomimetic or an analog thereof, cloned in a suitable expression vector in proper orientation for expression.
- Viral vectors which may be used include but are not limited SIN lentiviral vectors, retroviral vectors, foamy virus vectors, adeno-associated virus (AAV) vectors, hybrid vectors and/or plasmid transposons (for example sleeping beauty transposon system) or integrase based vector systems.
- Polynucleotide as used herein includes but is not limited to DNA, RNA, cDNA (complementary DNA), mRNA (messenger RNA), rRNA (ribosomal RNA), shRNA (small hairpin RNA), snRNA (small nuclear RNA), snoRNA (short nucleolar RNA), miRNA (microRNA), genomic DNA, synthetic DNA, synthetic RNA, and/or tRNA.
- transfection is used herein to refer to the uptake of foreign DNA by a cell.
- a cell has been "transfected” when exogenous DNA has been introduced inside the cell membrane.
- transfection techniques are generally known in the art. See, e.g., Graham et al. Virology, 52:456 (1973); Sambrook et al. Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York (1989); Davis et al, Basic Methods in Molecular Biology, Elsevier (1986), and Chu et al. Gene 13:197 (1981).
- Such techniques can be used to introduce one or more exogenous DNA moieties, such as a plasmid vector and other nucleic acid molecules, into suitable host cells.
- the term refers to both stable and transient uptake of the genetic material.
- Vector refers to the vehicle by which a polynucleotide sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression ⁇ e.g. transcription and translation) of the introduced sequence.
- Vectors include plasmids, phages, viruses, etc.
- IL4/IL-13 receptor inhibitors for example small molecule inhibitors CSRM53567, CSRM535671 and CSRM535672
- fibrosis and/or cancer for example, fibrosis in subjects with pancreatitis and pancreatic cancer.
- compositions comprising, consisting of or consisting essentially of, an inhibitor that targets the IL-4/IL-13 receptor function and an acceptable carrier/excipient.
- the inhibitor is any one or more of a small molecule, a peptide, a protein, an aptamer, an antibody or a fragment thereof, a nucleic acid molecule, a bispecific polypeptide comprising binding sites specific for IL-4 and the IL- 4/IL-13 receptor, a bispecific polypeptide comprising binding sites specific for IL-13 and the IL-4/IL-13 receptor or a combination thereof.
- the inhibitors include but are not limited to, antibodies ("antibodies” includes antigen-binding portions of antibodies such as epitope or antigen- binding peptides, paratopes, functional CDRs; recombinant antibodies; chimeric antibodies; tribodies; midibodies; or antigen-binding derivatives, analogs, variants, portions, or fragments thereof), protein-binding agents, small molecules, recombinant protein, peptides, aptamers, avimers and protein-binding derivatives, portions or fragments thereof.
- antibodies includes antigen-binding portions of antibodies such as epitope or antigen- binding peptides, paratopes, functional CDRs; recombinant antibodies; chimeric antibodies; tribodies; midibodies; or antigen-binding derivatives, analogs, variants, portions, or fragments thereof), protein-binding agents, small molecules, recombinant protein, peptides, aptamers, avimers and protein-binding derivatives, portions
- compositions comprising, consisting of or consisting essentially of an inhibitor that targets the IL-4/IL-13 receptor function and an acceptable carrier/excipient.
- the inhibitor is any one or more of CSRM53567 peptide, CSRM535671 peptide, CSRM535672 peptide or combinations thereof, or analogs, pharmaceutical equivalents and/or peptidomimetics thereof, as described herein.
- the peptide further comprises a fusion protein.
- the fusion protein can be selected from an epitope tag and a half- life extender or a combination thereof.
- the one or more peptide causes a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% 95% Or 100% inhibition of IL-4/IL-13 receptor function.
- the peptide composition typically further comprises a pharmaceutically acceptable solution or carrier.
- the polypeptide or protein (for example, CSRM53567 peptide, CSRM535671 peptide, CSRM535672 peptide or combinations thereof) is a "modified polypeptide" comprising non-naturally occurring amino acids.
- the polypeptides comprise a combination of naturally occurring and non-naturally occurring amino acids, and in some embodiments, the peptides comprise only non-naturally occurring amino acids.
- the inhibitor is CSRM53567 comprising, consisting of or consisting essentially of the amino acid sequence TYR-CYS-ASP-ASP-PHE-VAL-GLY- SER-PHE-ASP-CYS-TYR (SEQ ID NO: 1), or an analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the inhibitor is CSRM535671 comprising, consisting of or consisting essentially of the amino acid sequence TYR-CYS-ASP-ASP-PHE-VAL-GLY- SER-PHE-ASP-CYS-TYR-ASP (SEQ ID NO: 2), or an analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the inhibitor is CSRM535672 comprising, consisting of or consisting essentially of the amino acid sequence TYR-CYS-ASP-ASP-PHE-VAL-GLY- SER-PHE-ASP-CYS-TYR-GLU (SEQ ID NO: 3), or an analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the inhibitors CSRM53567 peptide, CSRM535671 peptide, CSRM535672 peptide or combinations thereof, or analogs, pharmaceutical equivalents and/or peptidomimetics thereof are modified peptides.
- Modified peptide may include the incorporation of lactam-bridge, head-to-tail cyclization, non-natural amino acids into the peptides of the invention, including synthetic non-native amino acids, substituted amino acids, or one or more D-amino acids into the peptides (or other components of the composition, with exception for protease recognition sequences) is desirable in certain situations.
- D-amino acid-containing peptides exhibit increased stability in vitro or in vivo compared to L-amino acid-containing forms.
- the construction of peptides incorporating D-amino acids can be particularly useful when greater in vivo or intracellular stability is desired or required.
- D- peptides are resistant to endogenous peptidases and proteases, thereby providing better oral trans-epithelial and transdermal delivery of linked drugs and conjugates, improved bioavailability of membrane-permanent complexes (see below for further discussion), and prolonged intravascular and interstitial lifetimes when such properties are desirable.
- the use of D-isomer peptides can also enhance transdermal and oral trans-epithelial delivery of linked drugs and other cargo molecules.
- D-peptides cannot be processed efficiently for major histocompatibility complex class II-restricted presentation to T helper cells, and are therefore less likely to induce humoral immune responses in the whole organism.
- Peptide conjugates can therefore be constructed using, for example, D-isomer forms of cell penetrating peptide sequences, L-isomer forms of cleavage sites, and D-isomer forms of therapeutic peptides. Therefore, in some embodiments the peptides as disclosed comprise L and D amino acids, wherein no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 D-amino acids are included. In certain aspects, the peptides comprise more than 10 D-amino acids, and in certain aspects all the amino acids of the peptides are D-amino acids.
- the inhibitors are retro-inverso peptides of CSRM53567 peptide, CSRM535671 peptide, CSRM535672 peptide or combinations thereof, or analogs, pharmaceutical equivalents and/or peptidomimetics thereof.
- a "retro-inverso peptide” refers to a peptide with a reversal of the direction of the peptide bond on at least one position, i.e., a reversal of the amino- and carboxy-termini with respect to the side chain of the amino acid.
- a retro-inverso analogue has reversed termini and reversed direction of peptide bonds while approximately maintaining the topology of the side chains as in the native peptide sequence.
- the retro-inverso peptide can contain L-amino acids or D-amino acids, or a mixture of L-amino acids and D-amino acids, up to all of the amino acids being the D- isomer.
- Partial retro-inverso peptide analogues are polypeptides in which only part of the sequence is reversed and replaced with enantiomeric amino acid residues.
- retro-inverso forms of cell penetrating peptides have been found to work as efficiently in translocating across a membrane as the natural forms. Synthesis of retro-inverso peptide analogues are described in Bonelli, F. et al, Int J Pept Protein Res. 24(6):553-6 (1984); Verdini, A and Viscomi, G. C, J. Chem. Soc. Perkin Trans. 1 :697-701 (1985); and U.S.
- Patent No. 6,261,569 which are incorporated herein in their entirety by reference.
- Processes for the solid-phase synthesis of partial retro-inverso peptide analogues have been described (EP 97994-B) which is also incorporated herein in its entirety by reference.
- variants of the peptides described herein can comprise conservatively substituted sequences, meaning that one or more amino acid residues of an original peptide are replaced by different residues, and that the conservatively substituted peptide retains a desired biological activity, i.e., the ability to inhibit the IL-4/IL-13 receptor that is essentially equivalent to that of the original peptide.
- conservative substitutions include substitution of amino acids that do not alter the secondary and/or tertiary structure of CSRM53567, CSRM535671, CSRM535672, substitutions that do not change the overall or local hydrophobic character, substitutions that do not change the overall or local charge, substitutions by residues of equivalent sidechain size, or substitutions by sidechains with similar reactive groups.
- a given amino acid can be replaced by a residue having similar physiochemical characteristics, e.g., substituting one aliphatic residue for another (such as He, Val, Leu, or Ala for one another), or substitution of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gin and Asn).
- Other such conservative substitutions e.g., substitutions of entire regions having similar hydrophobicity characteristics or substitutions of residues with similar sidechain volume are well known.
- Isolated peptides comprising conservative amino acid substitutions can be tested in any one of the assays described herein to confirm that a desired activity, e.g. inhibition of the IL-4/IL-13 receptor function is retained, as determined by the assays described elsewhere herein.
- Amino acids can be grouped according to similarities in the properties of their side chains (in A. L. Lehninger, in Biochemistry, second ed., pp. 73-75, Worth Publishers, New York (1975)): (1) non-polar: Ala (A), Val (V), Leu (L), lie (I), Pro (P), Phe (F), Trp (W), Met (M); (2) uncharged polar: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gin (Q); (3) acidic: Asp (D), Glu (E); (4) basic: Lys (K), Arg (R), His (H).
- Naturally occurring residues can be divided into groups based on common side-chain properties: (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, He, Phe, Trp; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gin, Ala, Tyr, His, Pro, Gly; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; (6) aromatic: Trp, Tyr, Phe, Pro, His, or hydroxyproline.
- Non-conservative substitutions will entail exchanging a member of one of these classes for another class.
- conservative substitutions for use in the variants described herein are as follows: Ala into Gly or into Ser; Arg into Lys; Asn into Gin or into His; Asp into Glu or into Asn; Cys into Ser; Gin into Asn; Glu into Asp; Gly into Ala or into Pro; His into Asn or into Gin; He into Leu or into Val; Leu into He or into Val; Lys into Arg, into Gin or into Glu; Met into Leu, into Tyr or into He; Phe into Met, into Leu or into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr or into Phe; Tyr into Phe or into Trp; and/or Phe into Val, into Tyr, into He or into Leu.
- conservative substitutions encompass residue exchanges with those of similar physicochemical properties (i.e. substitution of a hydrophobic residue for another hydrophobic amino acid).
- a "functional fragment” is a fragment or segment of a peptide comprising at least 5 amino acids and which can inhibit the IL-4/IL-13 receptor function according to the assays described herein.
- a functional fragment can comprise conservative substitutions of the sequences disclosed herein so long as they preserve the function of inhibiting the IL-4/IL-13 receptor function. This can be tested by detecting an inhibition of at least 50% of that of the parent (e.g. original) version of the peptide.
- an isolated peptide as described herein can comprise at least one peptide bond replacement.
- a single peptide bond or multiple peptide bonds e.g. 2 bonds, 3 bonds, 4 bonds, 5 bonds, or 6 or more bonds, or all the peptide bonds can be replaced.
- An isolated peptide as described herein can comprise one type of peptide bond replacement or multiple types of peptide bond replacements, e.g. 2 types, 3 types, 4 types, 5 types, or more types of peptide bond replacements.
- Non-limiting examples of peptide bond replacements include urea, thiourea, carbamate, sulfonyl urea, trifluoroethylamine, ortho-(aminoalkyl)-phenylacetic acid, para-(aminoalkyl)-phenylacetic acid, meta-(aminoalkyl)-phenylacetic acid, thioamide, tetrazole, boronic ester, olefmic group, and derivatives thereof.
- an isolated peptide as described herein can comprise naturally occurring amino acids commonly found in polypeptides and/or proteins produced by living organisms, e.g. Ala (A), Val (V), Leu (L), lie (I), Pro (P), Phe (F), Trp (W), Met (M), Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gin (Q), Asp (D), Glu (E), Lys (K), Arg (R), and His (H).
- an isolated peptide as described herein can comprise alternative amino acids.
- Non-limiting examples of alternative amino acids include, D-amino acids; beta-amino acids; homocysteine, phosphoserine, phosphothreonine, phosphotyrosine, hydroxyproline, gamma-carboxyglutamate; hippuric acid, octahydroindole-2-carboxylic acid, statine, l,2,3,4,-tetrahydroisoquinoline-3-carboxylic acid, penicillamine (3-mercapto-D- valine), ornithine, citruline, alpha-methyl-alanine, para-benzoylphenylalanine, para-amino phenylalanine, p-fluorophenylalanine, phenylglycine, propargylglycine, sarcosine, and tert- butylglycine), diaminobutyric acid, 7-hydroxy-tetrahydroisoquinoline carboxylic acid, naphthy
- an isolated peptide can be modified, e.g. a moiety can be added to one or more of the amino acids comprising the peptide.
- an isolated peptide as described herein can comprise one or more moiety molecules, e.g. 1 or more moiety molecules per peptide, 2 or more moiety molecules per peptide, 5 or more moiety molecules per peptide, 10 or more moiety molecules per peptide or more moiety molecules per peptide.
- an isolated peptide as described herein can comprise one more types of modifications and/or moieties, e.g. 1 type of modification, 2 types of modifications, 3 types of modifications or more types of modifications.
- Non- limiting examples of modifications and/or moieties include PEGylation; glycosylation; HESylation; ELPylation; lipidation; acetylation; amidation; end-capping modifications; cyano groups; phosphorylation; and cyclization.
- an end-capping modification can comprise acetylation at the N-terminus, N-terminal acylation, and N- terminal formylation.
- an end-capping modification can comprise amidation at the C-terminus, introduction of C-terminal alcohol, aldehyde, ester, and thioester moieties.
- An isolated peptide as described herein can be coupled and or connected to a second functional molecule, peptide and/or polypeptide.
- an isolated peptide as described herein is coupled to a targeting molecule.
- an isolated peptide as described herein is coupled to a targeting molecule by expressing the peptide and the targeting molecule as a fusion peptide, optionally with a peptide linker sequence interposed between them.
- a "targeting molecule" can be any molecule, e.g. a peptide, antibody or fragment thereof, antigen, targeted liposome, or a small molecule that can bind to or be bound by a specific cell or tissue type.
- an isolated peptide as described herein if it is desired to target an isolated peptide as described herein to the lung (e.g. to treat inflammation, lung fibrosis, or lung cancer), an isolated peptide comprising the amino acid sequence of any of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 could be coupled to an antibody or fragment thereof which is specific for lung cells or tissue, e.g. an antibody or antibody fragment as described in US Patent Publication 2005/0287066.
- an isolated peptide as described herein to the pancreas e.g.
- an isolated peptide comprising the amino acid sequence of any of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 could be coupled to an antibody or fragment thereof which is specific for lung cells or tissue, e.g. an antibody or antibody fragment that targets the ErbB receptors or and/or carcinoembryonic antigen (CEA) and/or Cancer antigen 19-9 (CA 19-9).
- CEA carcinoembryonic antigen
- CA 19-9 Cancer antigen 19-9
- an isolated peptide as described herein can be a fusion peptide or polypeptide.
- a fusion polypeptide can comprise a peptide linker domain interposed between the first domain of the peptide comprising an amino acid sequence of SEQ ID NOs: 1-3 or derivatives, variants, functional fragments, prodrug, or analog thereof as described herein and at least a second domain of the fusion peptide.
- the first peptide domain can be the N-terminal domain or the C-terminal domain or an internal sequence in the case where the partner domain forms after fragment complementation of constituent parts.
- fusion protein refers to a recombinant protein of two or more proteins. Fusion proteins can be produced, for example, by a nucleic acid sequence encoding one protein is joined to the nucleic acid encoding another protein such that they constitute a single open-reading frame that can be translated in the cells into a single polypeptide harboring all the intended proteins. The order of arrangement of the proteins can vary. Fusion proteins can include an epitope tag or a half-life extender.
- Epitope tags include biotin, FLAG tag, c-myc, hemaglutinin, His6, digoxigenin, FITC, Cy3, Cy5, green fluorescent protein, V5 epitope tags, GST, ⁇ -galactosidase, AU1, AU5, and avidin.
- Half-life extenders include Fc domain and serum albumin.
- an isolated peptide as described herein can be a pharmaceutically acceptable prodrug.
- a prodrug refers to compounds that can be converted via some chemical or physiological process (e.g., enzymatic processes and metabolic hydrolysis) to a therapeutic agent.
- the term “prodrug” also refers to a precursor of a biologically active compound that is pharmaceutically acceptable.
- a prodrug may be inactive when administered to a subject, i.e. an ester, but is converted in vivo to an active compound, for example, by hydrolysis to the free carboxylic acid or free hydroxyl.
- the prodrug compound often offers advantages of solubility, tissue compatibility or delayed release in an organism.
- prodrug is also meant to include any covalently bonded carriers, which release the active compound in vivo when such prodrug is administered to a subject.
- Prodrugs of an active compound may be prepared by modifying functional groups present in the active compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent active compound.
- Prodrugs include compounds wherein a hydroxy, amino or mercapto group is bonded to any group that, when the prodrug of the active compound is administered to a subject, cleaves to form a free hydroxy, free amino or free mercapto group, respectively.
- prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of an alcohol or acetamide, formamide and benzamide derivatives of an amine functional group in the active compound and the like. See Harper, “Drug Latentiation” in Jucker, ed. Progress in Drug Research 4:221-294 (1962); Morozowich et al, "Application of Physical Organic Principles to Prodrug Design” in E. B. Roche ed. Design of Biopharmaceutical Properties through Prodrugs and Analogs, APHA Acad. Pharm. Sci. 40 (1977); Bioreversible Carriers in Drug in Drug Design, Theory and Application, E. B. Roche, ed., APHA Acad. Pharm.
- an isolated peptide as described herein can be a pharmaceutically acceptable solvate.
- solvate refers to an isolated peptide as described herein in the solid state, wherein molecules of a suitable solvent are incorporated in the crystal lattice.
- a suitable solvent for therapeutic administration is physiologically tolerable at the dosage administered. Examples of suitable solvents for therapeutic administration are ethanol and water. When water is the solvent, the solvate is referred to as a hydrate.
- solvates are formed by dissolving the compound in the appropriate solvent and isolating the solvate by cooling or using an antisolvent. The solvate is typically dried or azeotroped under ambient conditions.
- an isolated peptide as described herein can be in a noncrystalline, i.e. amorphous solid form.
- a vector comprising a nucleic acid encoding a peptide as described herein.
- the term "vector”, as used herein, refers to a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells.
- a vector can be viral or non-viral.
- the term "vector" encompasses any genetic element that is capable of replication when associated with the proper control elements and that can transfer gene sequences to cells.
- a vector can include, but is not limited to, a cloning vector, an expression vector, a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc.
- Many vectors useful for transferring exogenous genes into target mammalian cells are available.
- the vectors can be episomal, e.g., plasmids, virus derived vectors such cytomegalovirus, adenovirus, etc., or can be integrated into the target cell genome, through homologous recombination or random integration, e.g., retrovirus derived vectors such MMLV, HIV-1, ALV, etc.
- constructs containing the nucleic acid encoding a polypeptide can be integrated and packaged into non- replicating, defective viral genomes like Adenovirus, Adeno-associated virus (AAV), or Herpes simplex virus (HSV) or others, including retroviral and lentiviral vectors, for infection or transduction into cells.
- AAV Adeno-associated virus
- HSV Herpes simplex virus
- the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors.
- the nucleic acid incorporated into the vector can be operatively linked to an expression control sequence such that the expression control sequence controls and regulates the transcription and translation of that polynucleotide sequence.
- expression vector refers to a vector that directs expression of an R A or polypeptide from sequences linked to transcriptional regulatory sequences on the vector.
- the sequences expressed will often, but not necessarily, be heterologous to the cell.
- An expression vector can comprise additional elements, for example, the expression vector can have two replication systems, thus allowing it to be maintained in two organisms, for example in human cells for expression and in a prokaryotic host for cloning and amplification.
- transfection as used herein to methods, such as chemical methods, to introduce exogenous nucleic acids, such as the nucleic acid sequences encoding a peptide as described herein into a cell.
- exogenous nucleic acids such as the nucleic acid sequences encoding a peptide as described herein into a cell.
- transfection does not encompass viral- based methods of introducing exogenous nucleic acids into a cell. Methods of transfection include physical treatments (electroporation, nanoparticles, magnetofection), and chemical- based transfection methods.
- Chemical-based transfection methods include, but are not limited to those that use cyclodextrin, polymers, liposomes, nanoparticles, cationic lipids or mixtures thereof (e.g., DOPA, Lipofectamine and UptiFectin), and cationic polymers, such as DEAE- dextran or polyethylenimine.
- viral vector refers to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle.
- the viral vector can contain the nucleic acid encoding a peptide as described herein in place of non-essential viral genes.
- the vector and/or particle can be utilized for the purpose of transferring any nucleic acids into cells either in vitro or in vivo. Numerous forms of viral vectors are known in the art.
- replication incompetent when used in reference to a viral vector means the viral vector cannot further replicate and package its genomes.
- the heterologous (also known as transgene) gene is expressed in the patient's cells, but, the rAAV is replication defective (e.g., lacks accessory genes that encode essential proteins for packaging the virus) and viral particles cannot be formed in the patient's cells.
- transduction refers to the use of viral particles or viruses to introduce exogenous nucleic acids into a cell.
- Retroviruses such as lentiviruses, provide a convenient platform for delivery of nucleic acid sequences encoding an agent of interest.
- a selected nucleic acid sequence can be inserted into a vector and packaged in retroviral particles using techniques known in the art.
- the recombinant virus can then be isolated and delivered to cells, e.g. in vitro or ex vivo .
- Retroviral systems are well known in the art and are described in, for example, U.S. Pat. No.
- a nucleotide sequence of interest is inserted into an adenovirus-based expression vector.
- adenoviruses persist extrachromosomally thus minimizing the risks associated with insertional mutagenesis (Haj-Ahmad and Graham (1986) J. Virol. 57:267-74; Bett et al. (1993) J. Virol. 67:5911-21; Mittereder et al. (1994) Human Gene Therapy 5:717-29; Seth et al. (1994) J. Virol. 68:933-40; Barr et al. (1994) Gene Therapy 1 :51-58; Berkner, K. L.
- Adenoviral vectors have several advantages in gene therapy. They infect a wide variety of cells, have a broad host-range, exhibit high efficiencies of infectivity, direct expression of heterologous sequences at high levels, and achieve long-term expression of those sequences in vivo. The virus is fully infective as a cell-free virion so injection of producer cell lines is not necessary. With regard to safety, adenovirus is not associated with severe human pathology, and the recombinant vectors derived from the virus can be rendered replication defective by deletions in the early -region 1 ("El") of the viral genome.
- El early -region 1
- Adenovirus can also be produced in large quantities with relative ease. For all these reasons vectors derived from human adenoviruses, in which at least the El region has been deleted and replaced by a gene of interest, have been used extensively for gene therapy experiments in the pre-clinical and clinical phase.
- Adenoviral vectors for use with the compositions and methods described herein can be derived from any of the various adenoviral serotypes, including, without limitation, any of the over 40 serotype strains of adenovirus, such as serotypes 2, 5, 12, 40, and 41.
- the adenoviral vectors of used in the methods described herein are generally replication-deficient and contain the sequence of interest under the control of a suitable promoter. For example, U.S. Pat. No.
- adenoviral vectors that include a human gene under the control of the Rous Sarcoma Virus (RSV) promoter.
- RSV Rous Sarcoma Virus
- Other recombinant adenoviruses of various serotypes, and comprising different promoter systems, can be created by those skilled in the art. See, e.g., U.S. Pat. No. 6,306,652, incorporated herein by reference in its entirety.
- Other useful adenovirus-based vectors for delivery of nucleic acid sequences include, but are not limited to: "minimal" adenovirus vectors as described in U.S. Pat. No.
- 6,306,652 which retain at least a portion of the viral genome required for encapsidation (the encapsidation signal), as well as at least one copy of at least a functional part or a derivative of the ITR; and the "gutless" (helper-dependent) adenovirus in which the vast majority of the viral genome has been removed and which produce essentially no viral proteins, such vectors can permit gene expression to persist for over a year after a single administration (Wu et al. (2001) Anesthes. 94: 1119-32; Parks (2000) Clin. Genet. 58: 1-11; Tsai et al. (2000) Curr. Opin. Mol. Ther. 2:515-23).
- a nucleotide sequence encoding a peptide as described herein is inserted into an adeno-associated virus-based expression vector.
- AAV is a parvovirus which belongs to the genus Dependovirus and has several features not found in other viruses.
- AAV can infect a wide range of host cells, including non-dividing cells.
- AAV can infect cells from different species.
- AAV has not been associated with any human or animal disease and does not appear to alter the biological properties of the host cell upon integration. Indeed, it is estimated that 80-85% of the human population has been exposed to the virus.
- AAV is stable at a wide range of physical and chemical conditions, facilitating production, storage and transportation.
- AAV is a helper-dependent virus; that is, it requires co-infection with a helper virus (e.g., adenovirus, herpesvirus or vaccinia) in order to form AAV virions in the wild.
- helper virus e.g., adenovirus, herpesvirus or vaccinia
- AAV establishes a latent state in which the viral genome inserts into a host cell chromosome, but infectious virions are not produced.
- Subsequent infection by a helper virus rescues the integrated genome, allowing it to replicate and package its genome into infectious AAV virions.
- the helper virus While AAV can infect cells from different species, the helper virus must be of the same species as the host cell.
- Adeno-associated virus has been used with success in gene therapy.
- AAV has been engineered to deliver genes of interest by deleting the internal nonrepeating portion of the AAV genome (i.e., the rep and cap genes) and inserting a heterologous sequence (in this case, the sequence encoding the agent) between the ITRs.
- the heterologous sequence is typically functionally linked to a heterologous promoter (constitutive, cell-specific, or inducible) capable of driving expression in the patient's target cells under appropriate conditions.
- Recombinant AAV virions comprising a nucleic acid sequence encoding an agent of interest can be produced using a variety of art-recognized techniques, as described in U.S. Pat. Nos. 5,139,941; 5,622,856; 5,139,941; 6,001,650; and 6,004,797, the contents of each of which are incorporated by reference herein in their entireties.
- Vectors and cell lines necessary for preparing helper virus-free rAAV stocks are commercially available as the AAV Helper-Free System (Catalog No. 240071) (Agilent Technologies, Santa Clara, Calif).
- Additional viral vectors useful for delivering nucleic acid molecules encoding a peptide as described herein include those derived from the pox family of viruses, including vaccinia virus and avian poxvirus.
- avipoxviruses such as the fowlpox and canarypox viruses, can be used to deliver the genes.
- the use of avipox vectors in cells of human and other mammalian species is advantageous with regard to safety because members of the avipox genus can only productively replicate in susceptible avian species.
- Molecular conjugate vectors such as the adenovirus chimeric vectors, can also be used for delivery of sequence encoding a peptide as described herein (Michael et al. (1993) J. Biol. Chem. 268:6866-69 and Wagner et al. (1992) Proc. Natl. Acad. Sci. USA 89:6099- 6103).
- Sindbis and Semliki Forest viruses can also be used as viral vectors for delivering a nucleic acid sequence (See, e.g., Dubensky et al. (1996) J. Virol. 70:508-19; WO 95/07995; WO 96/17072).
- the vector further comprises a signal peptide operably linked to the peptide.
- Signal peptides are terminally (usually N-terminally) located peptide sequences that provide for passage of the protein into or through a membrane.
- Different signal peptides can be of use in different applications. For example, as regards a cellular system for the production of isolated peptides as described herein, a secretory signal peptide can permit increased yields and ease of purification.
- multiple signal peptides e.g.
- a peptide signaling for secretion from the first cell, a peptide signaling for internalization by a second cell, and a final peptide signaling for nuclear localization can increase the amount of peptide reaching the target environment.
- a peptide signaling for nuclear localization can increase the amount of peptide reaching the target environment.
- Signal peptides are known in the art.
- Non-limiting examples of nuclear localization signal (NLS) peptides for use in mammalian cells include; the SV40 large T-antigen NLS (PKKKR V) (SEQ ID NO: 4); the nucleoplasm ⁇ NLS (K [PAATKKAGQA]KK K)(SEQ ID NO: 5); the K-K/R-X-K/R (SEQ ID NO: 6)consensus NLS (KKXR (SEQ ID NO: 56); KKXK (SEQ ID NO: 57); KRXK (SEQ ID NO: 58); KRXR (SEQ ID NO: 59); and PY- NLSs (see, e.g. Dingwall et al.
- Non-limiting examples of secretion signal peptides for use in mammalian cells include human albumin signal peptide (MKWVTFISLLFLFSSAYS) (SEQ ID NO: 7); human chymotrypsin signal peptide (MAFLWLLSCWALLGTTGF) (SEQ ID NO: 8); human interleukin-2 signal peptide (MQLLSCIALILALV) (SEQ ID NO: 9); human trypsinogen-2 signal peptide (MNLLLILTFVAAAVA) (SEQ ID NO: 10); and sequences which include a coding region for a signal for precursor cleavage by signal peptidase, furin or other prohormone convertases (e.g., PC3).
- MKWVTFISLLFLFSSAYS human albumin signal peptide
- MAFLWLLSCWALLGTTGF MAFLWLLSCWALLGTTGF
- MQLLSCIALILALV human interleukin-2 signal peptide
- MNLLLILTFVAAAVA S
- a signal (peptide) sequence which is cleaved by furin also known as PACE, see U.S. Pat. No. 5,460,950
- other subtilisins including PC2, PC1/PC3, PACE4, PC4, PC5/PC6, LPC/PC7IPC8/SPC7 and SKI-I; Nakayama, Biochem. J., 327:625-635 (1997)); enterokinase (see U.S. Pat. No. 5,270,181) or chymotrypsin
- enterokinase see U.S. Pat. No. 5,270,181
- chymotrypsin can be introduced into the signal (peptide) sequence as defined herein.
- Additional signal peptides are known in the art and the choice of signal peptide can be influenced by the cell type, growth conditions, and the desired destination of the peptide.
- the cell expressing a vector as described herein is a cell suitable for the production of polypeptides.
- a cell suitable for the production of polypeptides can be a prokaryotic or eukaryotic cell, e.g. bacteria, virus, yeast, fungi, mammalian cells, insect cells, plant cells, and the like.
- cells for the production of proteins are commercially available, e.g. bacterial cells (BL21 derived cells - Cat. No. 60401-1, Lucigen; Middleton, WI and mammalian cells (293 F cells - Cat. No. 11625-019, Invitrogen; Grand Island, NY).
- Recombinant molecules e.g. vectors as described herein, can be introduced into cells via transformation, particularly transduction, conjugation, lipofection, protoplast fusion, mobilization, particle bombardment, electroporation (Neumann et al., "Gene Transfer into Mouse Lyoma Cells by Electroporation in High Electric Fields," EMBO J. l(7):841-845 (1982); Wong et al, “Electric Field Mediated Gene Transfer,” Biochem Biophys Res Commun 107(2):584-587 (1982); Potter et al., “Enhancer-dependent Expression of Human Kappa Immunoglobulin Genes Introduced into Mouse pre-B Lymphocytes by Electroporation," Proc. Natl.
- cultivation After cultivation, the cell is disrupted by physical or chemical means, and the protein or polypeptide purified from the resultant crude extract.
- cultivation may include conditions in which the protein or polypeptide is secreted into the growth medium of the recombinant host cell, and the protein or polypeptide is isolated from the growth medium.
- Alternative methods may be used as suitable.
- the peptides can also be attached to adjuvants.
- adjuvant refers to a compound or mixture that enhances the immune response and/or promotes the proper rate of absorption following inoculation, and, as used herein, encompasses any uptake-facilitating agent.
- Non-limiting examples of adjuvants include, chemokines (e.g., defensins, HCC-1, HCC4, MCP-1, MCP-3, MCP4, ⁇ - ⁇ , ⁇ - ⁇ , ⁇ - ⁇ , MIP-3a, MIP-2, RANTES); other ligands of chemokine receptors (e.g., CCR1, CCR-2, CCR-5, CCR6, CXCR-1); cytokines (e.g., IL- ⁇ , IL-2, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, IL-12, IL-13, IL-15, IL-17 (A-F), IL- 18; IFNa, IFN- ⁇ ; TNF-a; GM-CSF); TGF)-P; FLT-3 ligand; CD40 ligand; other ligands of receptors for those cytokines; Thl cytokines including, without limitation, IFN- ⁇ , IL-2,
- PCPP polymer poly[di(carboxylatophenoxy)phosphazene]
- RIBI RIBI
- MPL+TDM+CWS cell wall skeleton
- OM-174 a glucosamine disaccharide related to lipid A
- OM Pharma SA Meyrin, Switzerland
- heat shock proteins and derivatives thereof Leishmania homologs of elF4a and derivatives thereof
- bacterial ADP-ribosylating exotoxins and derivatives thereof e.g., genetic mutants, A and/or B subunit-containing fragments, chemically toxoided versions
- chemical conjugates or genetic recombinants containing bacterial ADP-ribosylating exotoxins or derivatives thereof C3d tandem array
- lipid A and derivative poly[di(carboxylatophenoxy)phosphazene]
- MPL+TDM+CWS cell wall skeleton
- OM-174 a glucosamine disaccharide related to
- adjuvants can include the RIBI adjuvant system (Ribi Inc., Hamilton, MT.), alum, mineral gels such as aluminum hydroxide gel, oil-in-water emulsions, water-in- oil emulsions such as, e.g., Freund's complete and incomplete adjuvants, Block co-polymer (CytRx, Atlanta GA), QS-21 (Cambridge Biotech Inc., Cambridge MA), and SAF-M (Chiron, Emeryville CA), AMPHIGEN® adjuvant, saponin, Quil A or other saponin fraction, monophosphoryl lipid A, and Avridine lipid-amine adjuvant, and METASTIM®.
- RIBI adjuvant system Ribi Inc., Hamilton, MT.
- mineral gels such as aluminum hydroxide gel
- oil-in-water emulsions such as, e.g., Freund's complete and incomplete adjuvants
- Block co-polymer (CytRx,
- Suitable adjuvants can include, for example, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol, and others.
- cell may be genetically engineered to express the peptides described herein and the genetically engineered cells may be used for cell therapy.
- examples of cells that may be used include but are not limited to, dendritic cells, T-lymphocytes (T- cells), na ' ive T cells (T N ), memory T cells (for example, central memory T cells (TC M ), effector memory cells (T EM )), natural killer cells, hematopoietic stem cells and/or pluripotent embryonic/induced stem cells capable of giving rise to therapeutically relevant progeny.
- the genetically engineered cells are autologous cells.
- individual T-cells of the invention may be CD4+/CD8-, CD4-/CD8+, CD4-/CD8- or CD4+/CD8+.
- the T-cells may be a mixed population of CD4+/CD8- and CD4-/CD8+ cells or a population of a single clone.
- CD4+ T-cells may produce IL-2, IFNy, TNFa and other T- cell effector cytokines when co-cultured in vitro with cells expressing the peptides (for example CD20+ and/or CD 19+ tumor cells).
- CD8 + T-cells may lyse antigen-specific target cells when co-cultured in vitro with the target cells.
- T cells may be any one or more of CD45RA CD62L na ' ive cells, CD45RO CD62L + central memory cells, CD62L " effector memory cells or a combination thereof (Berger et al., Adoptive transfer of virus-specific and tumor-specific T cell immunity. Curr Opin Immunol 2009 21(2)224-232).
- tolerized antigen presenting cells may be used in cell therapy. Examples include B cells, dendritic cells, macrophages and the like. The cells may be of any origin, including from humans. The cells may be tolerized using the peptides described herein. In some embodimements, the cell are tolerized in the presence of cytokines. [088] In some embodiments, the cell producing the peptide as described herein can be administered to a subject, e.g. for the treatment of pancreatic fibrosis, pancreatitis, pancreatic cancer, lung fibrosis or lung cancer.
- nanoparticles containing the peptide as described herein can be administrated to a subject.
- the nanoparticles for use with the peptides described herein may be as described in Levine et al., Polymersomes: A new multi-functional tool for cancer diagnosis and therapy. Methods 2008 Vol 46 pg 25-32 or as described in S Jain, et al., Gold nanoparticles as novel agents for cancer therapy. Br J Radiol. 2012 Feb; 85(1010): 101-113.
- the cell expressing a vector encoding a peptide as described herein can be a cell of a subject, e.g. a subject administered gene therapy for the treatment of cancer.
- Vectors for gene therapy can comprise viral or non-viral vectors as described elsewhere herein.
- the methods include providing a composition comprising an inhibitor of IL-4/IL-13 receptor and administering an effective amount of the composition to the subject so as to treat, inhibit, reduce the severity of and/or promote prophylaxis of the disease state.
- the disease-state is fibrosis and/or cancer.
- the inhibitor of IL-4/IL-13 receptor is any one or more of CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the subject is human.
- the compositions described herein are administrated to the subject before, during, or after the subject develops the disease-state.
- the composition is administrated to the subject 1-3 times per day or 1-7 times per week.
- the composition is administrated to the subject for 1- 5 days, 1-5 weeks, 1-5 months, or 1-5 years.
- kits for treating, inhibiting, reducing the severity of or promoting prophylaxis of fibrosis include providing a composition comprising an inhibitor of IL-4/IL-13 receptor and administering an effective amount of the composition to the subject so as to treat, inhibit, reduce the severity of and/or promote prophylaxis of fibrosis.
- the methods for treating, inhibiting, reducing the severity of or promoting prophylaxis of fibrosis may further comprise administering existing therapies for organ- specific fibrosis.
- the methods for treating, inhibiting, reducing the severity of or promoting prophylaxis of fibrosis described herein may further comprise pharmacologic alleviation of abdominal pain, pharmacologic restoration of digestion and absorption, endoscopic treatments, surgical therapies, dietary care or combinations thereof for fibrosis in the pancreas.
- the methods for treating, inhibiting, reducing the severity of or promoting prophylaxis of fibrosis described herein may further comprise oxygen therapy, prednisone, azathioprine and/or N-acetylcysteine for lung fibrosis.
- the methods for treating, inhibiting, reducing the severity of or promoting prophylaxis of fibrosis may further comprise administering angiotensin converting enzyme inhibitor or Lisinopril for myocardial fibrosis.
- compositions described herein for example compositions comprising CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof
- existing therapies may be administered sequentially or simultaneously.
- fibrosis is any one or more of fibrosis of the pancreas, cystic fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, progressive massive fibrosis, nephrogenic systemic fibrosis, Crohn's Disease, Keloid, Scleroderma/systemic sclerosis, Arthrofibrosis, Peyronie's disease, Dupuytren's contracture, adhesive capsulitis, fibrosis of the liver, fibrosis of the lung, , fibrosis of the intestine, fibrosis of the heart, or combinations thereof.
- the methods include providing a composition comprising an inhibitor of IL-4/IL-13 receptor and administering an effective amount of the composition to the subject so as to treat, inhibit, reduce the severity of and/or promote prophylaxix of pancreatitis in the subject.
- the methods for treating, inhibiting, reducing the severity of and/or promoting prophylaxis of pancreatitis may further comprise prescribing and/or administering existing therapies for pancreatitis.
- the inhibitor of IL-4/IL-13 receptor is any one or more of CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the subject is human.
- the cancer is pancreatic cancer. Examples of existing therapies include but are not limited to pharmacologic alleviation of abdominal pain, pharmacologic restoration of digestion and absorption, endoscopic treatments, surgical therapies, dietary care or combinations thereof.
- compositions described herein for example compositions comprising CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof
- existing therapies may be administered sequentially or simultaneously.
- the methods include providing a composition comprising an inhibitor of IL-4/IL-13 receptor and administering an effective amount of the composition to the subject so as to treat, inhibit, reduce the severity of and/or prevent metastasis of cancer.
- the methods for treating, inhibiting, reducing the severity of and/or preventing metastasis of cancer may further comprise prescribing and/or administering existing therapies for specific types of cancer, such as surgery, radiation therapy, or chemotherapy, or a combination thereof.
- the inhibitor of IL-4/IL-13 receptor is any one or more of CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the subject is human.
- the cancer is pancreatic cancer. The surgery, radiation therapy, or chemotherapy, or a combination thereof may be conducted before, during or after administering a therapeutically effective amount of the compositions described herein to the subject.
- the cancer is any one or more of lymphomas, sarcomas, brain cancer, breast cancer, colon cancer, lung cancer, hepatocellular cancer, gastric cancer, pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, cancer of the urinary tract, thyroid cancer, renal cancer, carcinoma, melanoma, head and neck cancer, brain cancer, and prostate cancer
- the method includes providing a composition comprising an inhibitor of IL-4/IL-13 receptor and administering an effective amount of the composition to the subject so as to treat, inhibit, reduce the severity of and/or promote prophylaxis of disease-states associated with IL-4/IL- 13 receptor signaling.
- the disease-states include chronic pancreatitis, chronic inflammation, fibrosis, cancer or a combination thereof.
- the inhibitor of IL-4/IL-13 receptor is any one or more of CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the subject is human.
- the method includes providing a composition comprising an inhibitor of IL-4/IL-13 receptor and administering an effective amount of the composition to the subject so as to treat, inhibit, reduce the severity of and/or promote prophylaxis of disease-states treatable by inhibiting IL- 4/IL-13 receptor function.
- the disease-states include chronic pancreatitis, chronic inflammation, fibrosis, cancer or a combination thereof.
- the inhibitor of IL-4/IL-13 receptor is any one or more of CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the subject is human.
- compositions for example, compositions comprising any one or more of CSRM53567, CSRM535671, CSRM535672 and/or a combination thereof, or analog, pharmaceutical equivalent or a peptidomimetic thereof
- compositions may be administered concurrently or sequentially with other therapeutic agents including but not limited to chemotherapeutic agents and/or radiation therapy.
- chemotherapeutic agents may be selected from any one or more of cytotoxic antibiotics, antimetabolities, anti-mitotic agents, alkylating agents, arsenic compounds, DNA topoisomerase inhibitors, taxanes, nucleoside analogues, plant alkaloids, and toxins; and synthetic derivatives thereof.
- Exemplary compounds include, but are not limited to, alkylating agents: treosulfan, and trofosfamide; plant alkaloids: vinblastine, paclitaxel, docetaxol; DNA topoisomerase inhibitors: doxorubicin, epirubicin, etoposide, camptothecin, topotecan, irinotecan, teniposide, crisnatol, and mitomycin; anti-folates: methotrexate, mycophenolic acid, and hydroxyurea; pyrimidine analogs: 5-fluorouracil, doxifluridine, and cytosine arabinoside; purine analogs: mercaptopurine and thioguanine; DNA antimetabolites: 2'-deoxy-5-fluorouridine, aphidicolin glycinate, and pyrazoloimidazole; and antimitotic agents: halichondrin, colchicine, and rhizoxin.
- compositions comprising one or more chemotherapeutic agents (e.g., FLAG, CHOP) may also be used.
- FLAG comprises fludarabine, cytosine arabinoside (Ara-C) and G- CSF.
- CHOP comprises cyclophosphamide, vincristine, doxorubicin, and prednisone.
- PARP e.g., PARP-1 and/or PARP-2
- inhibitors are well known in the art (e.g., Olaparib, ABT-888, BSI-201, BGP-15 (N-Gene Research Laboratories, Inc.); INO-1001 (Inotek Pharmaceuticals Inc.); PJ34 (Soriano et al., 2001; Pacher et al., 2002b); 3-aminobenzamide (Trevigen); 4-amino-l,8-naphthalimide; (Trevigen); 6(5H)-phenanthridinone (Trevigen); benzamide (U.S. Pat. Re. 36,397); and NU1025 (Bowman et al).
- therapies include, for example, radiation therapy.
- the radiation used in radiation therapy can be ionizing radiation.
- Radiation therapy can also be gamma rays, X-rays, or proton beams.
- Examples of radiation therapy include, but are not limited to, external-beam radiation therapy, interstitial implantation of radioisotopes (1-125, palladium, iridium), radioisotopes such as strontium-89, thoracic radiation therapy, intraperitoneal P-32 radiation therapy, and/or total abdominal and pelvic radiation therapy.
- the radiation therapy can be administered as external beam radiation or tele-therapy wherein the radiation is directed from a remote source.
- the radiation treatment can also be administered as internal therapy or brachytherapy wherein a radioactive source is placed inside the body close to cancer cells or a tumor mass.
- photodynamic therapy comprising the administration of photosensitizers, such as hematoporphyrin and its derivatives, Vertoporfm (BPD-MA), phthalocyanine, photosensitizer Pc4, demethoxy-hypocrellin A; and 2BA-2-DMHA.
- photosensitizers such as hematoporphyrin and its derivatives, Vertoporfm (BPD-MA), phthalocyanine, photosensitizer Pc4, demethoxy-hypocrellin A; and 2BA-2-DMHA.
- therapies include, for example, immunotherapy.
- Immunotherapy may comprise, for example, use of cancer vaccines and/or sensitized antigen presenting cells.
- therapies include targeting cells in the tumor microenvironment or targeting immune cells.
- the immunotherapy can involve passive immunity for short-term protection of a host, achieved by the administration of pre-formed antibody directed against a cancer antigen or disease antigen (e.g., administration of a monoclonal antibody, optionally linked to a chemotherapeutic agent or toxin, to a tumor antigen).
- Immunotherapy can also focus on using the cytotoxic lymphocyte-recognized epitopes of cancer cell lines.
- therapies include, for example, hormonal therapy
- Hormonal therapeutic treatments can comprise, for example, hormonal agonists, hormonal antagonists (e.g., flutamide, bicalutamide, tamoxifen, raloxifene, leuprolide acetate (LUPRON), LH-RH antagonists), inhibitors of hormone biosynthesis and processing, and steroids (e.g., dexamethasone, retinoids, deltoids, betamethasone, Cortisol, cortisone, prednisone, dehydrotestosterone, glucocorticoids, mineralocorticoids, estrogen, testosterone, progestins), vitamin A derivatives (e.g., all-trans retinoic acid (ATRA)); vitamin D3 analogs; antigestagens (e.g., mifepristone, onapristone), or antiandrogens (e.g., cyproterone acetate).
- hormonal antagonists e.g., flutamide,
- the effective amount of the inhibitor of IL-4/IL-13 receptor is any one or more of about 0.01 to 0.05 ⁇ g/kg/day, 0.05-0.
- ⁇ g/kg/day 0.1 to 0 ⁇ g/kg/day, 0.5 to 5 ⁇ g/kg/day, 5 to 10 ⁇ g/kg/day, 10 to 20 ⁇ g/kg/day, 20 to 50 ⁇ g/kg/day, 50 to 100 ⁇ g/kg/day, 100 to 150 ⁇ g/kg/day, 150 to 200 ⁇ g/kg/day, 200 to 250 ⁇ g/kg/day, 250 to 300 ⁇ g/kg/day, 300 to 350 ⁇ g/kg/day, 350 to 400 ⁇ g/kg/day, 400 to 500 ⁇ g/kg/day, 500 to 600 ⁇ g/kg/day, 600 to 700 ⁇ g/kg/day, 700 to 800 ⁇ g/kg/day, 800 to 900 ⁇ g/kg/day, 900 to 1000 ⁇ g/kg/day, 0.01 to 0.05mg/kg/day, 0.05-0.
- lmg/kg/day 0.1 to 0.5mg/kg/day, 0.5 to 1 mg/kg/day, 1 to 5 mg/kg/day, 5 to 10 mg/kg/day, 10 to 15 mg/kg/day, 15 to 20 mg/kg/day, 20 to 50 mg/kg/day, 50 to 100 mg/kg/day, 100 to 200 mg/kg/day, 200 to 300 mg/kg/day, 300 to 400 mg/kg/day, 400 to 500 mg/kg/day, 500 to 600 mg/kg/day, 600 to 700mg/kg/day, 700 to 800mg/kg/day, 800 to 900mg/kg/day, 900 to 1000 mg/kg/day or a combination thereof.
- Typical dosages of an effective amount of the IL-4/IL-13 receptor inhibitor can be in the ranges recommended by the manufacturer where known therapeutic compounds are used, and also as indicated to the skilled artisan by the in vitro responses or responses in animal models. Such dosages typically can be reduced by up to about an order of magnitude in concentration or amount without losing relevant biological activity.
- the actual dosage can depend upon the judgment of the physician, the condition of the patient, and the effectiveness of the therapeutic method based, for example, on the in vitro responsiveness of relevant cultured cells or histocultured tissue sample, such as biopsied malignant tumors, or the responses observed in the appropriate animal models.
- compositions of the invention comprising the IL-4/IL-13 receptor inhibitor may be administered once a day (SID/QD), twice a day (BID), three times a day (TID), four times a day (QID), or more, so as to administer an effective amount of the IL-4/IL-13 receptor inhibitor to the subject, where the effective amount is any one or more of the doses described herein.
- the subject is selected from the group consisting of human, non-human primate, monkey, ape, dog, cat, cow, horse, rabbit, mouse and rat.
- CSRM53567, CSRM535671, CSRM535672 or a combination thereof, or a variant, derivative, pharmaceutical equivalent, peptidomimetic or an analog thereof may be recombinant or chemically synthesized (Murali, R. and Green, M. Pharmaceuticals 2012 Vol 5 209-235) .
- purification tags including, but not limited to, His6, epitope (e.g., myc, V5, FLAG or soft-epitope), streptavidin, biotin, avidin, tetracysteine, calmodulin-binding protein, elastin-like peptide, fusion protein (e.g., glutathione- S- transferase, maltose binding protein, cellulose-binding domain, thioredoxin, NusA or mistin), chitin-binding domain, GFP, alkaline phosphatase, cutinase, 0 6 -alkylguanine alkyltransferase (AGT), or halo tag.
- His6, epitope e.g., myc, V5, FLAG or soft-epitope
- streptavidin e.g., biotin, avidin, tetracysteine
- calmodulin-binding protein elastin-like peptide
- CSRM53567 comprises, consists of or consists essentially of the amino acid sequence TYR-CYS-ASP-ASP-PHE-VAL-GLY-SER-PHE- ASP-CYS-TYR (SEQ ID NO: 1), or an analog, pharmaceutical equivalent or a peptidomimetic thereof.
- CSRM535671 comprises, consists of or consists essentially of the amino acid sequence TYR-CYS-ASP-ASP-PHE-VAL-GLY-SER- PHE-ASP-CYS-TYR-ASP (SEQ ID NO: 2), or an analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the inhibitor is CSRM535672 comprises, consists of or consists essentially of the amino acid sequence TYR-CYS-ASP-ASP-PHE- VAL-GLY-SER-PHE-ASP CYS-TYR-GLU (SEQ ID NO: 3), or an analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the method involves growing the host-vector system transfected with a vectors encoding any one or more of CSRM53567, CSRM535671, CSRM535672 or a combination thereof, or a variant, derivative, pharmaceutical equivalent, peptidomimetic or an analog thereof, so as to produce the any one or more of CSRM53567, CSRM535671, CSRM535672 or a combination thereof, or a variant, derivative, pharmaceutical equivalent, peptidomimetic or an analog thereof, in the host cells and then recovering any one or more of CSRM53567, CSRM535671, CSRM535672 or a combination thereof, or a variant, derivative, pharmaceutical equivalent, peptidomimetic or an analog thereof.
- nucleotide sequences encoding the amino acid sequences corresponding to any one or more of CSRM53567, CSRM535671, CSRM535672 or a combination thereof, or a variant, derivative, pharmaceutical equivalent, peptidomimetic or an analog thereof, may be expressed in a variety of systems known in the art.
- the cDNA may be excised by suitable restriction enzymes and ligated into suitable prokaryotic or eukaryotic expression vectors for such expression.
- the recombinant protein may be expressed in a prokaryotic, yeast, insect, plant or mammalian system.
- prokaryotic (bacterial) expression systems are E. coli (e.g. BL21, BL21 (DE3), XL1, XL1 Blue, DH5a or DH10B cell strains) and B. subtilis.
- Yeast cells include, but are not limited to, P. pastoris, K. lactis,S. cerevisiae, S. pombe, Y. lipolyt und K. marxianus.
- Suitable mammalian cell lines may be, among others, CHO, HEK 293 BHK, NS0, NS1, SP2/0.
- Insect cell lines may include, for example, Drosophila, Aedes aegypti mosquitoe, Sf21, Sf9, and T.ni cell lines.
- the isolated protein may comprise, depending of the expression system, different posttranslational modifications of amino acids, such as acetate groups, phosphate groups, various lipids and carbohydrates, changed chemical nature of an amino acid (e.g. citrullination) or structural changes, like disulfide bridges.
- Suitable vectors include but are not limited to viral vector systems e.g.
- non-vector methods include nonviral physical transfection of DNA into cells; for example, microinjection (DePamphilis et al, BioTechnique 6:662-680 (1988)); liposomal mediated transfection (Feigner et al, Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987), Feigner and Holm, Focus 11 :21-25 (1989) and Feigner et al, Proc. West. Pharmacol. Soc. 32: 115-121 (1989)) and other methods known in the art.
- compositions comprising, consisting of or consisting essentially of, an inhibitor that targets the IL-4/IL-13 receptor function and an acceptable carrier/excipeint.
- the inhibitor is any one or more of CSRM53567, CSRM535671, CSRM535672 or a combination thereof, or an analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the inhibitor is CSRM53567 comprising, consisting of or consisting essentially of the amino acid sequence TYR-CYS-ASP-ASP-PHE-VAL-GLY-SER-PHE-ASP-CYS-TYR ((SEQ ID NO: 1), or an analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the inhibitor is CSRM535671 comprising, consisting of or consisting essentially of the sequence TYR-CYS-ASP-ASP-PHE-VAL-GLY-SER-PHE-ASP-CYS-TYR-ASP (SEQ ID NO: 2), or an analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the inhibitor is CSRM535672 comprising, consisting of or consisting essentially of the sequence TYR-CYS-ASP-ASP-PHE-VAL-GLY-SER-PHE-ASP-CYS-TYR-GLU (SEQ ID NO: 3), or an analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the pharmaceutical compositions according to the invention may be formulated for delivery via any route of administration.
- Route of administration may refer to any administration pathway known in the art, including but not limited to aerosol, nasal, oral, transmucosal, transdermal, parenteral or enteral.
- Parenteral refers to a route of administration that is generally associated with injection, including intraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal.
- the compositions may be in the form of solutions or suspensions for infusion or for injection, or as lyophilized powders.
- the compositions may be in the form of solutions or suspensions for infusion or for injection.
- the pharmaceutical compositions can be in the form of tablets, gel capsules, sugar-coated tablets, syrups, suspensions, solutions, powders, granules, emulsions, microspheres or nanospheres or lipid vesicles or polymer vesicles allowing controlled release.
- parenteral administration and “administered parenterally” as used herein, refer to modes of administration other than enteral and topical administration, usually by injection.
- systemic administration refers to the administration of inhibitors of IL-4/IL-13 receptor other than directly into a target site, tissue, or organ, such that it enters the subject's circulatory system and, thus, is subject to metabolism and other like processes.
- “Pharmaceutically acceptable excipient” means an excipient that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and desirable, and includes excipients that are acceptable for veterinary use as well as for human pharmaceutical use. Such excipients may be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous.
- compositions according to the invention can also contain any pharmaceutically acceptable carrier.
- “Pharmaceutically acceptable carrier” as used herein refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body.
- the carrier may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or a combination thereof.
- Each component of the carrier must be “pharmaceutically acceptable” in that it must be compatible with the other ingredients of the formulation.
- compositions according to the invention can also be encapsulated, tableted or prepared in an emulsion or syrup for oral administration.
- Pharmaceutically acceptable solid or liquid carriers may be added to enhance or stabilize the composition, or to facilitate preparation of the composition.
- Liquid carriers include syrup, peanut oil, olive oil, glycerin, saline, alcohols and water.
- Solid carriers include starch, lactose, calcium sulfate, dihydrate, terra alba, magnesium stearate or stearic acid, talc, pectin, acacia, agar or gelatin.
- the carrier may also include a sustained release material such as glyceryl monostearate or glyceryl distearate, alone or with a wax.
- the pharmaceutical preparations are made following the conventional techniques of pharmacy involving milling, mixing, granulation, and compressing, when necessary, for tablet forms; or milling, mixing and filling for hard gelatin capsule forms.
- a liquid carrier When a liquid carrier is used, the preparation will be in the form of syrup, elixir, emulsion or an aqueous or non-aqueous suspension.
- Such a liquid formulation may be administered directly p.o. or filled into a soft gelatin capsule.
- the pharmaceutical compositions according to the invention may be delivered in a therapeutically effective amount.
- the precise therapeutically effective amount is that amount of the composition that will yield the most effective results in terms of efficacy of treatment in a given subject. This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of administration.
- the therapeutic may be administered to the patient in a single dose or in multiple doses.
- the doses may be separated from one another by, for example, one hour, three hours, six hours, eight hours, one day, two days, one week, two weeks, or one month.
- the therapeutic may be administered for, e.g., 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, or more weeks.
- the composition is administrated to the subject 1-3 times per day or 1-7 times per week.
- the composition is administrated to the subject for 1-5 days, 1-5 weeks, 1-5 months, or 1-5 years.
- therapeutically effective amounts of the one or more peptides as disclosed herein or a mutant, variant, analog or derivative thereof may be provided at a dose of 0.0001, 0.01, 0.01 0.1, 1, 5, 10, 25, 50, 100, 500, or 1,000 mg/kg or ⁇ g/kg. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test bioassays or systems.
- an effective amount as used herein would also include an amount sufficient to delay the development of a symptom of the disease, alter the course of a symptom of disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of disease. Thus, it is not possible to specify the exact "effective amount”. However, for any given case, an appropriate "effective amount" can be determined by one of ordinary skill in the art using only routine experimentation.
- Effective amounts, toxicity, and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
- the dosage can vary depending upon the dosage form employed and the route of administration utilized.
- the dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD50/ED50.
- Compositions and methods that exhibit large therapeutic indices are preferred.
- a therapeutically effective dose can be estimated initially from cell culture assays.
- a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the agent for inhibiting I1-4/IL-13 receptor function, which achieves a half-maximal inhibition of symptoms) as determined in cell culture, or in an appropriate animal model.
- IC50 i.e., the concentration of the agent for inhibiting I1-4/IL-13 receptor function, which achieves a half-maximal inhibition of symptoms
- levels in plasma can be measured, for example, by high performance liquid chromatography.
- the effects of any particular dosage can be monitored by a suitable bioassay. The dosage can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment.
- phrases "pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
- pharmaceutically acceptable carrier or “pharmaceutically acceptable excipient” as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, media, encapsulating material, manufacturing aid (e.g.
- lubricant talc magnesium, calcium or zinc stearate, or steric acid
- solvent encapsulating material involved in maintaining the stability, solubility, or activity of, an inhibitor of IL-4/IL-13 receptor.
- Each carrier must be "acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient.
- materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) excipients, such as cocoa butter and suppository waxes; (8) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (9) glycols, such as propylene glycol; (10) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (1 1) esters, such as ethyl oleate and ethyl laurate; (12) agar; (13) buffering agents, such as magnesium hydro
- the inhibitors of IL-4/IL-13 receptor described herein can be specially formulated for administration of the compound to a subject in solid, liquid or gel form, including those adapted for the following: (1) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; (2) topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin; (3) intravaginally or intrarectally, for example, as a pessary, cream or foam; (4) ocularly; (5) transdermally; (6) transmucosally; or (7) nasally.
- parenteral administration for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation
- topical application for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin
- inhibitors of IL-4/IL-13 receptor described herein can be implanted into a patient or injected using a drug delivery system. See, for example, Urquhart, et ah, Ann. Rev. Pharmacol. Toxicol. 24: 199-236 (1984); Lewis, ed. "Controlled Release of Pesticides and Pharmaceuticals” (Plenum Press, New York, 1981); U.S. Pat. No. 3,773,919; and U.S. Pat. No. 3,270,960.
- Parenteral dosage forms of inhibitors of IL-4/IL-13 receptor can also be administered to a subject by various routes, including, but not limited to, subcutaneous, intravenous (including bolus injection), intramuscular, and intra-arterial. Since administration of parenteral dosage forms typically bypasses the patient's natural defenses against contaminants, parenteral dosage forms are preferably sterile or capable of being sterilized prior to administration to a patient. Examples of parenteral dosage forms include, but are not limited to, solutions ready for injection, dry products ready to be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, suspensions ready for injection, controlled-release parenteral dosage forms, and emulsions.
- Suitable vehicles that can be used to provide parenteral dosage forms of the disclosure are well known to those skilled in the art. Examples include, without limitation: sterile water; water for injection USP; saline solution; glucose solution; aqueous vehicles such as but not limited to, sodium chloride injection, Ringer's injection, dextrose Injection, dextrose and sodium chloride injection, and lactated Ringer's injection; water-miscible vehicles such as, but not limited to, ethyl alcohol, polyethylene glycol, and propylene glycol; and non-aqueous vehicles such as, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.
- Aerosol formulations Inhibitors of IL-4/IL-13 receptor can be packaged in a pressurized aerosol container together with suitable propellants, for example, hydrocarbon propellants like propane, butane, or isobutane with conventional adjuvants. Inhibitors of IL- 4/IL-13 receptor can also be administered in a non-pressurized form such as in a nebulizer or atomizer. Inhibitors of IL-4/IL-13 receptor can also be administered directly to the airways in the form of a dry powder, for example, by use of an inhaler.
- suitable propellants for example, hydrocarbon propellants like propane, butane, or isobutane with conventional adjuvants.
- Inhibitors of IL- 4/IL-13 receptor can also be administered in a non-pressurized form such as in a nebulizer or atomizer. Inhibitors of IL-4/IL-13 receptor can also be administered directly to the airways in the form of a dry powder, for example, by use of an
- Suitable powder compositions include, by way of illustration, powdered preparations of inhibitors of IL-4/IL-13 receptor thoroughly intermixed with lactose, or other inert powders acceptable for intra-bronchial administration.
- the powder compositions can be administered via an aerosol dispenser or encased in a breakable capsule which can be inserted by the subject into a device that punctures the capsule and blows the powder out in a steady stream suitable for inhalation.
- the compositions can include propellants, surfactants, and co- solvents and can be filled into conventional aerosol containers that are closed by a suitable metering valve.
- Aerosols for the delivery to the respiratory tract are known in the art. See for example, Adjei, A. and Garren, J. Pharm. Res., 1 : 565-569 (1990); Zanen, P. and Lamm, J.- W. J. Int. J. Pharm., 114: 111-115 (1995); Gonda, I. "Aerosols for delivery of therapeutic an diagnostic agents to the respiratory tract," in Critical Reviews in Therapeutic Drug Carrier Systems, 6:273-313 (1990); Anderson et al, Am. Rev. Respir.
- the formulations of the inhibitors of IL-4/IL-13 receptor described herein further encompass anhydrous pharmaceutical compositions and dosage forms comprising the disclosed compounds as active ingredients, since water can facilitate the degradation of some compounds.
- water can facilitate the degradation of some compounds.
- the addition of water ⁇ e.g., 5% is widely accepted in the pharmaceutical arts as a means of simulating long-term storage in order to determine characteristics such as shelf life or the stability of formulations over time. See, e.g., Jens T. Carstensen, Drug Stability: Principles & Practice, 379-80 (2nd ed., Marcel Dekker, NY, N.Y.: 1995).
- Anhydrous pharmaceutical compositions and dosage forms of the disclosure can be prepared using anhydrous or low moisture containing ingredients and low moisture or low humidity conditions.
- compositions and dosage forms that comprise lactose and at least one active ingredient that comprise a primary or secondary amine are preferably anhydrous if substantial contact with moisture and/or humidity during manufacturing, packaging, and/or storage is expected.
- Anhydrous compositions are preferably packaged using materials known to prevent exposure to water such that they can be included in suitable formulary kits. Examples of suitable packaging include, but are not limited to, hermetically sealed foils, plastics, unit dose containers (e.g., vials) with or without desiccants, blister packs, and strip packs.
- inhibitors of IL-4/IL-13 receptor can be administered to a subject by controlled- or delayed-release means.
- the use of an optimally designed controlled- release preparation in medical treatment is characterized by a minimum of drug substance being employed to cure or control the condition in a minimum amount of time.
- Controlled-release formulations include: 1) extended activity of the drug; 2) reduced dosage frequency; 3) increased patient compliance; 4) usage of less total drug; 5) reduction in local or systemic side effects; 6) minimization of drug accumulation; 7) reduction in blood level fluctuations; 8) improvement in efficacy of treatment; 9) reduction of potentiation or loss of drug activity; and 10) improvement in speed of control of diseases or conditions.
- Controlled-release formulations can be used to control a compound's onset of action, duration of action, plasma levels within the therapeutic window, and peak blood levels.
- controlled- or extended-release dosage forms or formulations can be used to ensure that the maximum effectiveness of a compound of formula (I) is achieved while minimizing potential adverse effects and safety concerns, which can occur both from under-dosing a drug (i.e., going below the minimum therapeutic levels) as well as exceeding the toxicity level for the drug.
- a variety of known controlled- or extended-release dosage forms, formulations, and devices can be adapted for use with the inhibitors of IL-4/IL-13 receptor described herein. Examples include, but are not limited to, those described in U.S. Pat. Nos.: 3,845,770; 3,916,899; 3,536,809; 3,598,123; 4,008,719; 5674,533; 5,059,595; 5,591 ,767; 5,120,548; 5,073,543; 5,639,476; 5,354,556; 5,733,566; and 6,365,185 Bl, each of which is incorporated herein by reference in their entireties.
- dosage forms can be used to provide slow or controlled-release of one or more active ingredients using, for example, hydro xypropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems (such as OROS® (Alza Corporation, Mountain View, Calif. USA)), multilayer coatings, microparticles, liposomes, or microspheres or a combination thereof to provide the desired release profile in varying proportions.
- ion exchange materials can be used to prepare immobilized, adsorbed salt forms of the disclosed compounds and thus effect controlled delivery of the drug. Examples of specific anion exchangers include, but are not limited to, Duolite® A568 and Duolite® AP143 (Rohm&Haas, Spring House, Pa. USA).
- inhibitors of IL-4/IL-13 receptor for use in the methods described herein are administered to a subject by sustained release or in pulses.
- Pulse therapy is not a form of discontinuous administration of the same amount of a composition over time, but comprises administration of the same dose of the composition at a reduced frequency or administration of reduced doses.
- Sustained release or pulse administrations are particularly preferred when the disorder occurs continuously in the subject, for example where the subject has continuous or chronic symptoms of a viral infection.
- Each pulse dose can be reduced and the total amount of the inhibitors of IL-4/IL-13 receptor administered over the course of treatment to the patient is minimized.
- the interval between pulses when necessary, can be determined by one of ordinary skill in the art. Often, the interval between pulses can be calculated by administering another dose of the composition when the composition or the active component of the composition is no longer detectable in the subject prior to delivery of the next pulse. Intervals can also be calculated from the in vivo half-life of the composition. Intervals can be calculated as greater than the in vivo half-life, or 2, 3, 4, 5 and even 10 times greater the composition half-life.
- Various methods and apparatus for pulsing compositions by infusion or other forms of delivery to the patient are disclosed in U.S. Pat. Nos. 4,747,825; 4,723,958; 4,948,592; 4,965,251 and 5,403,590.
- the invention also provides a kit for the treatment of cancer and/or fibrosing disorder, inhibition of cancer and/or fibrosing disorder, reduction of cancer and/or fibrosing disorder or promotion of cancer and/or fibrosing disorder prophylaxis in a subject in need thereof.
- the kit comprises a composition comprising a IL-4/IL-13 receptor inhibitor and instructions for use of the composition for treating, inhibiting and/or reducing the severity of cancer and/or fibrosing disorder in subjects in need thereof.
- the IL-4/IL-13 receptor inhibitor is a small molecule, a peptide, a protein, an aptamer, an antibody or a fragment thereof, a nucleic acid molecule or a bispecific polypeptide agent comprising binding sites specific for IL-4 or IL-13 and IL-4/IL-13 receptor.
- the inhibitor is any one or more of CSRM53567, CSRM535671, CSRM535672 or a combination thereof, or an analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the kit is an assemblage of materials or components, including at least one of the compositions described herein.
- the kit contains a composition including a IL-4/IL-13 receptor inhibitor, wherein the IL-4/IL-13 receptor inhibitor is any one or more of CSRM53567, CSRM535671, CSRM535672 or a combination thereof, or an analog, pharmaceutical equivalent or a peptidomimetic thereof, as described herein.
- the kit is configured particularly for human subjects.
- the kit is configured for veterinary applications, treating subjects such as, but not limited to, farm animals, domestic animals, and laboratory animals.
- Instructions for use may be included in the kit.
- “Instructions for use” typically include a tangible expression describing the technique to be employed in using the components of the kit to effect a desired outcome, such as to treat, reduce the severity of, inhibit or prevent cancer and/or fibrosing disorders in a subject.
- the kit also contains other useful components, such as, measuring tools, diluents, buffers, pharmaceutically acceptable carriers, syringes or other useful paraphernalia as will be readily recognized by those of skill in the art.
- the materials or components assembled in the kit can be provided to the practitioner stored in any convenient and suitable ways that preserve their operability and utility.
- the components can be in dissolved, dehydrated, or lyophilized form; they can be provided at room, refrigerated or frozen temperatures.
- the components are typically contained in suitable packaging material(s).
- packaging material refers to one or more physical structures used to house the contents of the kit, such as inventive compositions and the like.
- the packaging material is constructed by well-known methods, preferably to provide a sterile, contaminant-free environment.
- the term "package” refers to a suitable solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding the individual kit components.
- a package can be a bottle used to contain suitable quantities of an inventive composition containing a the inhibitor is any one or more of CSRM53567, CSRM535671, CSRM535672 or a combination thereof, or an analog, pharmaceutical equivalent or a peptidomimetic thereof.
- the packaging material generally has an external label which indicates the contents and/or purpose of the kit and/or its components.
- CSRM53567 designed to inhibit 1L-4/1L-13 receptor function.
- pancreatitis and pancreatic cancer are characterized by tissue fibrosis caused by sustained pancreatic inflammation accompanied by fibrosis.
- myeloid cells, pancreatic stellate cells (PSCs) and pro-inflammatory cytokines from stellate cells and myeloid cells play central roles in disease pathogenesis.
- Stellate cells in the pancreas when activated during chronic pancreatitis and pancreatic cancer have similar characteristics and functions to fibroblastic cells in other tissue pathologies.
- IL-4/IL-13 receptor inhibitors for example small molecule inhibitors CSRM53567, CSRM535671 and CSRM535672, for prevention and/or treatment of fibrosis in pancreatitis and pancreatic cancer.
- exemplary inhibitors ofIL-4/IL-13 receptors are described below:
- CSRM53567 TYR-CYS-ASP-ASP-PHE-VAL-GLY-SER-PHE-ASP-CYS-TYR (SEQ ID NO: 1) (CYS2-CYS11 disulfide)
- CSRM535671 TYR-CYS-ASP-ASP-PHE-VAL-GLY-SER-PHE-ASP-CYS-TYR- ASP (SEQ ID NO: 2) (CYS2-CYS11 disulfide)
- CSRM535672 TYR-CYS-ASP-ASP-PHE-VAL-GLY-SER-PHE-ASP-CYS-TYR- GLU (SEQ ID NO: 3) (CYS2-CYS11 disulfide)
- FIG. 1 shows the experimental design (Fig. 1A). In this design a commonly used model to cause chronic pancreatitis in rodents was created. In this model, the animal is given the cholecystokinin analogue, Caerulein, as a set of 6 intraperitoneal injections over a day repeated 3 times a week for 4 weeks.
- Figure IB shows that CSRM53567 decreases macrophages in the tissue.
- CD206 is a marker of the type II macrophage while MHCII is highly expressed on type I macrophage.
- the increase in the tissue volume in CSRM53567 treated group is a reflection of decreased fibrosis (Fig. IB).
- mice BALB/c, C57BL/6, SJL, B6.SJL, IL-4Ra "/_ , CCR2 K0 mouse strains were purchased from Jackson Laboratory and bred in-house. Zy5A cre IL-4Ra flox/flox (ref. 24) and IL- 4/IL-13 "7" (McKenzie, G. J., et al. Simultaneous disruption of interleukin (IL)-4 and IL-13 defines individual roles in T helper cell type 2-mediated responses. J. Exp. Med. 189, 1565- 1572 (1999)) mice on BALB/c background were generated as described. All experimental mice were age- (6-8 weeks) and sex-matched, and animal experiments were approved by the Stanford University institutional animal care and use committees.
- CP was induced by repetitive caerulein injections (Lerch, M. M. & Gorelick, F. S. Models of acute and chronic pancreatitis.
- mice Myeloid, but not pancreatic, RelA/p65 is required for fibrosis in a mouse model of chronic pancreatitis. Gastroenterology 141, el 471 -el 477 (2011)).
- mice were given six hourly intraperitoneal (i.p.) injections of 50 ⁇ g kg "1 body weight caerulein (Sigma-Aldrich) 3 days per week, for a total of 4 weeks. Mice were then killed and analyzed 3 days after the last caerulein injection.
- mice were given caerulein injection 3 days per week for a total of 4 weeks as above, and 2 weeks following start of the caerulein injection mice were either given vehicle control (PBS) or IL-4/IL- 13 -blocking peptide (50 ⁇ g per mouse, 100 ⁇ daily for 5 days per week x 2 weeks) until being killed 4 weeks and 3 days later as above.
- PBS vehicle control
- IL-4/IL- 13 -blocking peptide 50 ⁇ g per mouse, 100 ⁇ daily for 5 days per week x 2 weeks
- Human pancreatic tissues from patients with CP, pancreatic ductal adenocarcinoma (PDAC) and normal pancreas margins from patients with PDAC, and one from a patient with normal pancreas (patient had adjacent non-pancreatic tumor that required partial resection of the pancreas) were obtained from the Stanford tissue bank with Local Ethics Committee approval and patient consents.
- the Luminex assay was performed in the Human Immune Monitoring Center at Stanford University (Xue, J. & Habtezion, A. Carbon monoxide-based therapy ameliorates acute pancreatitis via TLR4 inhibition. J. Clin. Invest. 124, 437-447 (2014)).
- Human 63-plex or Mouse 26 plex kits were purchased from Affymetrix and used according to the manufacturer's recommendations with modifications as described below. Briefly, samples were mixed with antibody-linked polystyrene beads on 96-well filter-bottom plates and incubated at room temperature for 2 h followed by overnight incubation at 4°C. Room temperature incubation steps were performed on an orbital shaker at 500-600 r.p.m.
- Antibodies and flow cytometry All antibodies used for flow cytometry were purchased from Biolegend, unless indicated. For surface staining, murine cells were stained with the following antibodies: APC-CD45.2 (109814, 1 :200), PE/Cy7-CD4 (100528, 1 :300), Percp/Cy5.5-CDllb (101228, 1 :200), BV421-F4/80 (123137, 1 :200), APC/Cy7-CDl 1C (117324, 1 :200), PE-IL-411.a (144803 1 : 100), AF488-CD206 (141710, 1 : 100), AF700- MHCII (107622, 1 :300), PB-Ly6C (128014, 1 :200), PE/Cy7-Ly-6G (127617, 1 :300), PE- FcsRIa (134307, 1 :200), AF488-ckit (105815, 1 :200),
- Human cells were stained with PE/Cy7-CD14 (301814,1 : 100), AF488-CD206 (321114, 1 :50) and APC-CD68 (333810, 1 : 100).
- cytokine staining cells were activated with phorbol myristate acetate (50 ng ml "1 ) and ionomycin (1 ⁇ g ml "1 ), in the presence of brefeldin A (10 ⁇ g ml "1 , eBioscience) for 4h at 37°C before staining. The cells were then fixed and permeabilized using the eBioscience kit following the manufacturer's guidelines.
- APC-IL10 554468, 1 : 100
- isotype control 556924, 1 :100
- BD Biosciences were used for intracellular staining.
- TNFa staining cells were incubated with or without lipopolysaccharide (100 ngml -1, InvivoGen) in the presence of brefeldin A before surface- staining.
- PE-TNFa 554419, 1 :200
- isotype control 554685, 1 :200
- Ki-67 and BrdU were stained for surface makers and then fixed and permeabilized using Foxp3 staining buffer set (eBioscience).
- BrdU staining cells were first incubated with DNase for 1 h at 37°C. The Cells were then stained with PE-BrdU (339812, 1 : 100) or AF488-Ki67 (558616, BD Biosciences, 1 :50). Dead cells were excluded from analysis using violet viability stain (Invitrogen). Flow cytometry data collection was performed on Fortessa LSRII (BD Biosciences) and analysed using the Flow Jo software (Tree Star Inc.).
- Pancreatic leukocytes were isolated using collagenase digestion method described previously for flow cytometry analysis (Xue, J., et al. Aryl hydrocarbon receptor regulates pancreatic IL-22 production and protects mice from acute pancreatitis. Gastroenterology 143, 1670-1680 (2012)). PSCs from CP mice were isolated by outgrowth method as described (Bachem, M. G. et al. Identification, culture, and characterization of pancreatic stellate cells in rats and humans. Gastroenterology 115, 421- 432 (1998)). Primary human PSCs from normal margins and PDAC were isolated using gradient centrifugation and outgrowth method, respectively (Bachem, M. G.
- Murine PSCs were cultured in DMEM/F12 (1 : 1) medium containing 10% FBS. Where indicated, mouse PSCs were cultured with TGFP (5 ng ml "1 ), PDGFP (10 ng ml "1 ) or media control for 6 h before being collected for mR A and qPCR analyses. Human PSCs were cultured in IMDM medium containing 20% FBS.
- CM Conditioned medium
- BMDMs were prepared as previously described (Xue, J. & Habtezion, A. Carbon monoxide- based therapy ameliorates acute pancreatitis via TLR4 inhibition. J. Clin. Invest. 124, 437- 447 (2014)).
- human monocyte-derived macrophage preparation human peripheral blood mononuclear cells were isolated from buffy coat using Ficoll-Hypaque density gradient centrifugation, and then monocytes were further enriched by CD14 + magnetic beads (Miltenyi Biotec).
- Enriched monocytes were cultured with complete RPMI medium containing 50 ng ml "1 human macrophage CSF. On day 6, human macrophages are ready for use (Vijayan, D. Isolation and differentiation of monocytes-macrophages from human blood. Methods Mol. Biol. 844, 183-187 (2012)).
- PSC and BMDM coculture experiments were performed in the Transwell system (Corning) in the DMEM/F12 medium with 10% FBS. After seeding 5 x 10 4 PSCs in the bottom well, 5 x 10 5 BMDMs were seeded on the upper mesh (pore size: 0.4 ⁇ ). Macrophages were collected for analysis after 48 h of the coculture.
- Quantitative PCR was performed with an ABI-7900 Sequence Detection System (Applied Biosystems) using designed specific TaqMan probes and primers as follows: YM1 (Forward, 5'-TGGTGAAGGAAATGCGTAAA-3(SEQ ID NO: 11); reverse, 5'- GTCAATGATTCCTGCTCCTG-3(SEQ ID NO: 12); probe, 5'- AGC AGCCTTGGAATGTCTTTCTCC A-3 ' (SEQ ID NO: 13); FIZZ1 forward, 5'- AGGAACTTCCTGCCAATCCA-3'(SEQ ID NO: 14); reverse, 5'- AC AAGC AC ACCC AGTAGC AG-3 ' (SEQ ID NO: 15); probe, 5'-CCTCCTGCCCTG CTGGGATG-3 ' (SEQ ID NO: 16); ⁇ rgl forward, 5 '-AGACCACAGTCTGGCAGTTG- 3'(SEQ ID NO: 17); reverse, 5'-CCACCCAAATGACACATAGG-3'
- AAACGAACGCTTCCGCTGCC-3) (SEQ ID NO: 40); CollegenlAl (forward, 5'- AGAAGGCCAGTCTGGAGAAA-3 '(SEQ ID NO: 41); reverse, 5 '-GAG CCCTTGAGACCTCTGAC-3'(SEQ ID NO: 42); probe, 5'- TGCCCTGGGTCCTCCTGGTC-3 '(SEQ ID NO: 43); Fibronectin forward, 5'- TGGTGGCCACTAAATACGAA-3 '(SEQ ID NO: 44); reverse, 5'- GGAGGGCTAACATTCTCCAG-3 '(SEQ ID NO: 45); probe, 5'- CAAGCAGACCAGCCCAGGGA-3 '(SEQ ID NO: 46); TIMP1 forward, 5'- CCAGAAATCAACGAGACCAC-3 '(SEQ ID NO: 47); reverse, 5'-GGCATAT CC AC AGAGGCTTT-3 ' (SEQ ID NO: 48); probe, 5 ' -TCTGCG
- Macrophages are increased in mouse and human CP.
- mice hyperstimulation of the pancreas with cholecystokinin analogue caerulein leads to AP, and continuous acute injury to the pancreas drives chronic inflammation of the pancreas (Witt, H., et al. Gastroenterology 132, 1557-1573 (2007); Lerch, M. et al. Gastroenterology 144, 1180-1193 (2013)).
- To generate experimental CP we induced AP in a repetitive manner over 4 weeks (three times per week). Mice undergoing repetitive treatment with caerulein revealed morphologic signs of CP with leukocyte infiltration, pancreatic fibrosis and acinar cell loss corresponding to small size of the pancreas relative to body weight.
- macrophage-associated cytokines and chemokines (granulocyte- macrophage CSF, granulocyte CSF, chemokine (C-C motif) ligand (CCL)2/monocyte- specific chemokine(MCP)-l, CCL7/MCP-3 and CCL3/macrophage inflammatory protein (MIP)IA) were upregulated, suggesting that monocytes/macrophages play an important role during CP.
- CXCL1 a neutrophil chemoattractant with role in AP
- CCR2 ligands such as CCL2 (MCP-1) and CCL7 (MCP-3) are also elevated in CP (Fig. 2a).
- a competitive bone marrow (BM) chimera was set up by lethally irradiating recipient CCR2 WT CD45.1 + CD45.2 + C57BL/6 mice and reconstituting them with a 1 : 1 mixture of BM derived from CCR2 wild-type (WT; CCR2 WT CD45.1 + ) and CCR2 knockout (CCR2 K0 CD45.2 + ) mice so that macrophages derived from CCR2 K0 and CCR2 WT mice could be distinguished from one another as well as from those of the recipient mice based on the allotypic CD45 markers.
- WT CCR2 WT CD45.1 +
- CCR2 knockout mice CCR2 K0 CD45.2 + mice
- CCR2 and CCR2 cells supporting CCR2's role in monocyte recruitment as a significant contributor to macrophage accumulation in CP (Fig. 2e).
- CP was induced in non-irradiated wild-type (CCR2 WT ) and CCR2 knockout (CCR2 K0 mice).
- CCR2 deficiency limits pancreatic macrophage accumulation in CP, and no proliferation difference is observed between presence and absence of CCR2, which is consistent with the above BM chimera findings.
- CCR2 in the absence of CCR2 there is still monocyte/macrophage recruitment to the pancreas during CP, suggesting that CCR2- independent mechanism(s) also exist.
- monocyte recruitment via CCR2- dependent and -independent mechanisms
- macrophage proliferation account for macrophage accumulation during CP progression.
- AAMs are dominant in mouse and human CP
- M2-associated markers CD206, IL-10 and IL-4Ra
- Ml -associated markers major histocompatibility complex class II (MHCII) and tumor-necrosis factor alpha (TNFa)
- MHCII major histocompatibility complex class II
- TNFa tumor-necrosis factor alpha
- IL-10 in AP is expressed at much lower level as compared with CP in pancreatic macrophages (Fig. 3), although not to the same extent, slightly higher level of YM1 expression is seen in CP as compared with AP.
- Argl has recently been shown to be expressed by both classic and AAMs (Murray, P. J. et al. Immunity 41, 14-20 (2014)).
- Flow cytometric data were consistent with the histologic analysis of pancreas from CP mice on the basis of immunofluorescence staining where a majority of F4/80 + macrophages were positive for CD206 but not TNFa. Similar findings were observed in human CP tissues, where CD68 + cells expressed CD206, but not TNFa (Fig. 3c,d).
- PSCs promote alternative activation of macrophages.
- Macrophages are highly heterogeneous cells that can rapidly change their activation status and function in response to local micro-environment signals (Sica, A. & Mantovani, A. J. Clin. Invest. 122, 787-795 (2012); Murray, P. J. & Wynn, T. A. Nat. Rev. Immunol. 11, 723-737 (2011)).
- PSCs In light of the crucial role played by PSCs in CP, we asked whether PSCs might contribute to macrophage polarization and function.
- BMDMs BM-derived macrophages
- M2 alternative activation
- CD206, CD301, IL-10, TGFP and PDGFP mRNA expression but had decreased expression of inducible nitric oxide synthase (Ml marker; Fig. 4b).
- conditioned medium from the PSCs resulted in upregulation of CD206, IL-10 and IL-4Ra, and downregulation of MHCII and TNFa expression (Fig. 4c), suggesting that factors released by PSCs promoted macrophage polarization towards M2.
- Th2 cytokines such as IL-4/IL-13 mediate alternate activation of macrophages via IL- 4 receptor.
- IL-4Ra BMDMs from WT and IL-4R ' ⁇ mice.
- IL-4R ' ⁇ BMDMs were unable to be alternatively activated by the conditioned medium from the PSCs (Fig. 4d).
- PSC conditioned medium was as good as exogenously added IL-4/IL- 13, standard M2 polarizing conditions.
- the macrophages produced TGFP and PDGFP (Fig.
- IL-4Ra signal deficiency limits AAMs and protects against CP
- pancreatic fibrosis was a direct consequence of IL-4Ra signaling
- mice with global deletion of IL-4Ra and Zj5A cre IL-4Ra flox/flox mice where IL-4Ra is deleted specifically in myeloid cells (i.e., macrophages and neutrophils) to induce CP
- myeloid cells i.e., macrophages and neutrophils
- pancreatic macrophages from lL-4Ra ⁇ and Zj5A cre IL-4Ra flox/flox mice displayed impaired alternative activation under chronic inflammation (Fig. 5f).
- IL-4Ra ⁇ and Zj3 ⁇ 4A ⁇ re IL-4Ra flox/flox mouse pancreas were less fibrotic and had lower expression of fibrosis-associated markers (a-SMA and CollengenlAl) as compared with their WT counterparts (Fig. 5a-e).
- IL-4Ra ⁇ and Zj5A cre IL-4Ra flox/flox mice showed no obvious difference in pancreatic fibrosis and alternative macrophage activation, suggesting that the protective effect of IL-4Ra inhibition is mediated via absence of this receptor or signaling on myeloid cells or macrophages.
- AAMs are important contributors to disease pathogenesis.
- IL-4/IL-13 blockade ameliorates established CP.
- pancreas fibrosis Compared with control treatment group, the inhibitor treatment limited pancreas fibrosis (Fig. 6a-e). Furthermore, blockade of alternative activation of pancreatic macrophages by the inhibitor was confirmed using flow cytometry (Fig. 6f). These observations, as a proof-of-concept, demonstrate potential for treating CP. We then tested the inhibitor's ability in blocking M2 polarization of human macrophage by the hPSCs. The peptide was indeed capable of inhibiting hPSC-mediated M2 polarization of human macrophages (Fig. 6g).
- CP is accepted as an irreversible and fibrotic disease, and current management is supportive at best with focus in controlling pain and complications associated with the exocrine and endocrine loss of functions (Witt, H., et al. Gastroenterology 132, 1557-1573 (2007)).
- potential treatment approaches in CP have proposed inhibition or inactivation of PSCs (Talukdar, R. & Tandon, R. K. J. Gastroenterol. Hepatol. 23, 34-41 (2008)).
- the immune responses and immune cell contribution to PSC activation during CP progression remain poorly understood.
- Macrophages have been proposed as the master regulators of inflammation and fibrosis in diseases such as liver fibrosis and systemic sclerosis (Wynn, T. A. & Barron, L. Semin. Liver Dis. 30, 245-257 (2010)).
- Our study reveals that macrophages are increased in both mouse and human CP.
- CP is also associated with an increase in macrophage-related cytokines and chemokines, supporting for a critical role of macrophages in disease progression. Since macrophages differentiate as well as polarize in tissues and do not recirculate, our data using competitive BM chimeras and proliferation studies suggest that both local (in situ) macrophage proliferation and monocyte recruitment contribute to the macrophage accumulation in CP.
- Macrophages represent a spectrum of activated phenotypes rather than a discrete stable subpopulation (Mosser, D., M. & Edwards, J. P. Nat. Rev. Immunol. 8, 958- 969 (2008)), and it is possible that macrophages in different activation states or mixed phenotypes coexist as have been shown under different physiological and pathological conditions (Kawanishi, N., et al. Exerc. Immunol. Rev. 16, 105-118 (2010)). Indeed, these phenomena may account for the varied expression level of some of the M2 markers (for example, YM1).
- TRIP2 tissue inhibitor metalloproteinase 2
- MMP9 matrix metalloproteinase 9
- PSCs may be providing signals to maintain and facilitate the increased alternative activation observed in CP.
- PSCs from both mouse and human pancreas expressed higher levels of Th2 cytokines, IL-4 and IL-13, which are required for macrophage alternative activation (Gordon, S. Nat. Rev. Immunol. 3, 23-35 (2003); Van Dyken, S. J. & Locksley, R. M. Annu. Rev. Immunol. 31, 317-343 (2013)).
- IL-4Ra-sufficient and - deficient mixed BM chimeras we confirmed that IL-4Ra signaling is required for alternative activation of macrophages in CP.
- IL-13 has been shown to be a major inducer of fibrosis in many chronic infectious and autoimmune diseases in part via the IL-13Ra2 (ref. 34). Inhibition of both IL-4 receptor and IL-13Ra2 signaling in the double knockout mice ⁇ IL-4/ IL-13 1 ) as compared with inhibition of the IL-4 receptor only in the IL-4Ra ⁇ and Zj5A cre IL-4Ra flox/flox mice may account for the increased protection against CP development observed in the IL-4IIL-13 ⁇ / ⁇ mice.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Radiology & Medical Imaging (AREA)
- Pathology (AREA)
- Pulmonology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2017515820A JP7095990B2 (ja) | 2014-09-18 | 2015-09-18 | 線維症を治療するための組成物及び方法 |
| EP15841396.3A EP3194446B1 (en) | 2014-09-18 | 2015-09-18 | Compositions and methods for treating fibrosis |
| US15/460,151 US10245298B2 (en) | 2014-09-18 | 2017-03-15 | Compositions and methods for treating fibrosis |
| US16/274,578 US11547738B2 (en) | 2014-09-18 | 2019-02-13 | Compositions and methods for treating fibrosis |
| US18/745,329 US20250121026A1 (en) | 2014-09-18 | 2024-06-17 | Compositions and methods for treating fibrosis |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462052111P | 2014-09-18 | 2014-09-18 | |
| US62/052,111 | 2014-09-18 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/460,151 Continuation-In-Part US10245298B2 (en) | 2014-09-18 | 2017-03-15 | Compositions and methods for treating fibrosis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016044707A1 true WO2016044707A1 (en) | 2016-03-24 |
Family
ID=55533900
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2015/050906 Ceased WO2016044707A1 (en) | 2014-09-18 | 2015-09-18 | Compositions and methods for treating fibrosis |
Country Status (4)
| Country | Link |
|---|---|
| US (3) | US10245298B2 (enExample) |
| EP (1) | EP3194446B1 (enExample) |
| JP (2) | JP7095990B2 (enExample) |
| WO (1) | WO2016044707A1 (enExample) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10245298B2 (en) | 2014-09-18 | 2019-04-02 | Cedars-Sinai Medical Center | Compositions and methods for treating fibrosis |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3930687A4 (en) | 2019-02-25 | 2023-06-07 | The University of Chicago | METHODS AND COMPOSITIONS FOR THE TREATMENT OF INFLAMMATORY AND AUTOIMMUNE CONDITIONS USING ECM AFFINITY PEPTIDES LINKED TO ANTI-INFLAMMATORY AGENTS |
Citations (51)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA163200A (en) | 1915-02-20 | 1915-06-15 | William James Davidson | Ash sifting shovel |
| US3270960A (en) | 1964-09-11 | 1966-09-06 | Sperry Rand Corp | Fluid sensor |
| US3536809A (en) | 1969-02-17 | 1970-10-27 | Alza Corp | Medication method |
| US3598123A (en) | 1969-04-01 | 1971-08-10 | Alza Corp | Bandage for administering drugs |
| US3773919A (en) | 1969-10-23 | 1973-11-20 | Du Pont | Polylactide-drug mixtures |
| US3845770A (en) | 1972-06-05 | 1974-11-05 | Alza Corp | Osmatic dispensing device for releasing beneficial agent |
| US3916899A (en) | 1973-04-25 | 1975-11-04 | Alza Corp | Osmotic dispensing device with maximum and minimum sizes for the passageway |
| US4008719A (en) | 1976-02-02 | 1977-02-22 | Alza Corporation | Osmotic system having laminar arrangement for programming delivery of active agent |
| EP0097994B1 (en) | 1982-06-24 | 1987-09-30 | ENICHEM S.p.A. | Method for the solid-phase synthesis of retro-inverso polypeptides |
| US4723958A (en) | 1986-05-23 | 1988-02-09 | Merck & Co., Inc. | Pulsatile drug delivery system |
| US4747825A (en) | 1984-06-29 | 1988-05-31 | Ferring Laboratories, Inc. | Apparatus and methodology for pulsed administration of growth promoting agents |
| WO1989003429A1 (en) | 1987-08-28 | 1989-04-20 | Health Research Inc. | Recombinant avipox virus |
| US4948592A (en) | 1986-05-09 | 1990-08-14 | Alza Corporation | Pulsed drug delivery |
| US4965251A (en) | 1987-04-03 | 1990-10-23 | The Board Of Regents Of The University Of Washington | Pulse treatment of hemoglobinopathies with erythropoietin |
| WO1990014837A1 (en) | 1989-05-25 | 1990-12-13 | Chiron Corporation | Adjuvant formulation comprising a submicron oil droplet emulsion |
| WO1991012882A1 (fr) | 1990-02-22 | 1991-09-05 | Medgenix Group S.A. | Microspheres pour la liberation controlee des substances hydrosolubles et procede de preparation |
| US5059595A (en) | 1989-03-22 | 1991-10-22 | Bioresearch, S.P.A. | Pharmaceutical compositions containing 5-methyltetrahydrofolic acid, 5-formyltetrahydrofolic acid and their pharmaceutically acceptable salts in controlled-release form active in the therapy of organic mental disturbances |
| US5073543A (en) | 1988-07-21 | 1991-12-17 | G. D. Searle & Co. | Controlled release formulations of trophic factors in ganglioside-lipsome vehicle |
| WO1992003545A1 (en) | 1990-08-15 | 1992-03-05 | Virogenetics Corporation | Flavivirus recombinant poxvirus vaccine |
| US5120548A (en) | 1989-11-07 | 1992-06-09 | Merck & Co., Inc. | Swelling modulated polymeric drug delivery device |
| US5139941A (en) | 1985-10-31 | 1992-08-18 | University Of Florida Research Foundation, Inc. | AAV transduction vectors |
| US5219740A (en) | 1987-02-13 | 1993-06-15 | Fred Hutchinson Cancer Research Center | Retroviral gene transfer into diploid fibroblasts for gene therapy |
| US5270181A (en) | 1991-02-06 | 1993-12-14 | Genetics Institute, Inc. | Peptide and protein fusions to thioredoxin and thioredoxin-like molecules |
| US5354556A (en) | 1984-10-30 | 1994-10-11 | Elan Corporation, Plc | Controlled release powder and process for its preparation |
| US5399346A (en) | 1989-06-14 | 1995-03-21 | The United States Of America As Represented By The Department Of Health And Human Services | Gene therapy |
| WO1995007995A2 (en) | 1993-09-13 | 1995-03-23 | Applied Immune Sciences, Inc. | Adeno-associated viral (aav) liposomes and methods related thereto |
| US5403590A (en) | 1992-12-21 | 1995-04-04 | New England Deaconess Hospital Corporation | Method of pulsatile drug infusion |
| US5460950A (en) | 1990-11-26 | 1995-10-24 | Genetics Institute, Inc. | Expression of PACE in host cells and methods of use thereof |
| WO1996017072A2 (en) | 1994-11-30 | 1996-06-06 | Chiron Viagene, Inc. | Recombinant alphavirus vectors |
| US5585089A (en) | 1988-12-28 | 1996-12-17 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5591767A (en) | 1993-01-25 | 1997-01-07 | Pharmetrix Corporation | Liquid reservoir transdermal patch for the administration of ketorolac |
| US5622856A (en) | 1995-08-03 | 1997-04-22 | Avigen | High efficiency helper system for AAV vector production |
| US5639476A (en) | 1992-01-27 | 1997-06-17 | Euro-Celtique, S.A. | Controlled release formulations coated with aqueous dispersions of acrylic polymers |
| US5674533A (en) | 1994-07-07 | 1997-10-07 | Recordati, S.A., Chemical And Pharmaceutical Company | Pharmaceutical composition for the controlled release of moguisteine in a liquid suspension |
| US5733566A (en) | 1990-05-15 | 1998-03-31 | Alkermes Controlled Therapeutics Inc. Ii | Controlled release of antiparasitic agents in animals |
| USRE36397E (en) | 1994-02-04 | 1999-11-16 | The John Hopkins University | Inhibitors of poly(ADP-ribose) synthetase and use thereof to treat NMDA neurotoxicity |
| US6001650A (en) | 1995-08-03 | 1999-12-14 | Avigen, Inc. | High-efficiency wild-type-free AAV helper functions |
| US6004797A (en) | 1995-11-09 | 1999-12-21 | Avigen, Inc. | Adenovirus helper-free recombinant AAV Virion production |
| US6048551A (en) | 1997-03-27 | 2000-04-11 | Hilfinger; John M. | Microsphere encapsulation of gene transfer vectors |
| WO2000078336A1 (en) * | 1999-06-21 | 2000-12-28 | Genetics Institute, Inc. | Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains |
| US6261569B1 (en) | 1992-08-27 | 2001-07-17 | Deakin Research Limited | Retro-, inverso- and retro-inverso synthetic peptide analogues |
| US6306652B1 (en) | 1995-06-15 | 2001-10-23 | Introgene B.V. | Packaging systems for human recombinant adenovirus to be used in gene therapy |
| US6365185B1 (en) | 1998-03-26 | 2002-04-02 | University Of Cincinnati | Self-destructing, controlled release peroral drug delivery system |
| US20030124121A1 (en) * | 2000-05-26 | 2003-07-03 | Immunex Corporation | Use of interleukin-4 antagonists and compositions thereof |
| US20050287066A1 (en) | 2004-06-28 | 2005-12-29 | Monoace, Inc. | Anti-rat angiotensin I-converting enzyme (ACE, CD143) monoclonal antibodies and uses thereof |
| US7410781B2 (en) * | 2004-02-27 | 2008-08-12 | Regeneron Pharmaceuticals, Inc. | IL-4/IL-13 specific polypeptides and therapeutic uses thereof |
| US20110183920A1 (en) * | 2007-11-14 | 2011-07-28 | Aerovance, Inc. | Modified il-4 mutein receptor antagonists |
| US20110256130A1 (en) * | 2008-12-01 | 2011-10-20 | Joshua Robert Schultz | Methods of treating inflammatory disorders |
| US20120156194A1 (en) * | 2010-12-16 | 2012-06-21 | Genentech, Inc. | Diagnosis and treatments relating to th2 inhibition |
| WO2012162592A1 (en) * | 2011-05-25 | 2012-11-29 | Intermune, Inc. | Pirfenidone and anti-fibrotic therapy in selected patients |
| US20130259866A1 (en) * | 2007-10-15 | 2013-10-03 | Sanofi | Antibodies that bind il-4 and/or il-13 and their uses |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6664227B1 (en) | 1996-03-01 | 2003-12-16 | Genetics Institute, Llc | Treatment of fibrosis by antagonism of IL-13 and IL-13 receptor chains |
| EP1263785A2 (en) * | 1999-11-11 | 2002-12-11 | THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES | Mutated il-13 molecules and their uses |
| WO2009018429A2 (en) | 2007-07-31 | 2009-02-05 | The Government Of The United States Of America, Asrepresented By The Secretary, Department Of Healt Of Human Services, National Institutes Of Healt | TREATMENT OF CANCER VIA TARGETING OF IL-13 RECEPTOR-α2 |
| KR20100061485A (ko) | 2007-09-11 | 2010-06-07 | 몬도바이오테크 래보래토리즈 아게 | 치료제로서의 피브로넥틴 단편 (196-203)의 용도 |
| US9296785B2 (en) | 2009-04-17 | 2016-03-29 | Wake Forest University Health Sciences | IL-13 receptor binding peptides |
| WO2016044707A1 (en) | 2014-09-18 | 2016-03-24 | Cedars-Sinai Medical Center | Compositions and methods for treating fibrosis |
-
2015
- 2015-09-18 WO PCT/US2015/050906 patent/WO2016044707A1/en not_active Ceased
- 2015-09-18 EP EP15841396.3A patent/EP3194446B1/en active Active
- 2015-09-18 JP JP2017515820A patent/JP7095990B2/ja active Active
-
2017
- 2017-03-15 US US15/460,151 patent/US10245298B2/en active Active
-
2019
- 2019-02-13 US US16/274,578 patent/US11547738B2/en active Active
-
2020
- 2020-09-04 JP JP2020148662A patent/JP2020203922A/ja not_active Withdrawn
-
2024
- 2024-06-17 US US18/745,329 patent/US20250121026A1/en active Pending
Patent Citations (51)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA163200A (en) | 1915-02-20 | 1915-06-15 | William James Davidson | Ash sifting shovel |
| US3270960A (en) | 1964-09-11 | 1966-09-06 | Sperry Rand Corp | Fluid sensor |
| US3536809A (en) | 1969-02-17 | 1970-10-27 | Alza Corp | Medication method |
| US3598123A (en) | 1969-04-01 | 1971-08-10 | Alza Corp | Bandage for administering drugs |
| US3773919A (en) | 1969-10-23 | 1973-11-20 | Du Pont | Polylactide-drug mixtures |
| US3845770A (en) | 1972-06-05 | 1974-11-05 | Alza Corp | Osmatic dispensing device for releasing beneficial agent |
| US3916899A (en) | 1973-04-25 | 1975-11-04 | Alza Corp | Osmotic dispensing device with maximum and minimum sizes for the passageway |
| US4008719A (en) | 1976-02-02 | 1977-02-22 | Alza Corporation | Osmotic system having laminar arrangement for programming delivery of active agent |
| EP0097994B1 (en) | 1982-06-24 | 1987-09-30 | ENICHEM S.p.A. | Method for the solid-phase synthesis of retro-inverso polypeptides |
| US4747825A (en) | 1984-06-29 | 1988-05-31 | Ferring Laboratories, Inc. | Apparatus and methodology for pulsed administration of growth promoting agents |
| US5354556A (en) | 1984-10-30 | 1994-10-11 | Elan Corporation, Plc | Controlled release powder and process for its preparation |
| US5139941A (en) | 1985-10-31 | 1992-08-18 | University Of Florida Research Foundation, Inc. | AAV transduction vectors |
| US4948592A (en) | 1986-05-09 | 1990-08-14 | Alza Corporation | Pulsed drug delivery |
| US4723958A (en) | 1986-05-23 | 1988-02-09 | Merck & Co., Inc. | Pulsatile drug delivery system |
| US5219740A (en) | 1987-02-13 | 1993-06-15 | Fred Hutchinson Cancer Research Center | Retroviral gene transfer into diploid fibroblasts for gene therapy |
| US4965251A (en) | 1987-04-03 | 1990-10-23 | The Board Of Regents Of The University Of Washington | Pulse treatment of hemoglobinopathies with erythropoietin |
| WO1989003429A1 (en) | 1987-08-28 | 1989-04-20 | Health Research Inc. | Recombinant avipox virus |
| US5073543A (en) | 1988-07-21 | 1991-12-17 | G. D. Searle & Co. | Controlled release formulations of trophic factors in ganglioside-lipsome vehicle |
| US5585089A (en) | 1988-12-28 | 1996-12-17 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5059595A (en) | 1989-03-22 | 1991-10-22 | Bioresearch, S.P.A. | Pharmaceutical compositions containing 5-methyltetrahydrofolic acid, 5-formyltetrahydrofolic acid and their pharmaceutically acceptable salts in controlled-release form active in the therapy of organic mental disturbances |
| WO1990014837A1 (en) | 1989-05-25 | 1990-12-13 | Chiron Corporation | Adjuvant formulation comprising a submicron oil droplet emulsion |
| US5399346A (en) | 1989-06-14 | 1995-03-21 | The United States Of America As Represented By The Department Of Health And Human Services | Gene therapy |
| US5120548A (en) | 1989-11-07 | 1992-06-09 | Merck & Co., Inc. | Swelling modulated polymeric drug delivery device |
| WO1991012882A1 (fr) | 1990-02-22 | 1991-09-05 | Medgenix Group S.A. | Microspheres pour la liberation controlee des substances hydrosolubles et procede de preparation |
| US5733566A (en) | 1990-05-15 | 1998-03-31 | Alkermes Controlled Therapeutics Inc. Ii | Controlled release of antiparasitic agents in animals |
| WO1992003545A1 (en) | 1990-08-15 | 1992-03-05 | Virogenetics Corporation | Flavivirus recombinant poxvirus vaccine |
| US5460950A (en) | 1990-11-26 | 1995-10-24 | Genetics Institute, Inc. | Expression of PACE in host cells and methods of use thereof |
| US5270181A (en) | 1991-02-06 | 1993-12-14 | Genetics Institute, Inc. | Peptide and protein fusions to thioredoxin and thioredoxin-like molecules |
| US5639476A (en) | 1992-01-27 | 1997-06-17 | Euro-Celtique, S.A. | Controlled release formulations coated with aqueous dispersions of acrylic polymers |
| US6261569B1 (en) | 1992-08-27 | 2001-07-17 | Deakin Research Limited | Retro-, inverso- and retro-inverso synthetic peptide analogues |
| US5403590A (en) | 1992-12-21 | 1995-04-04 | New England Deaconess Hospital Corporation | Method of pulsatile drug infusion |
| US5591767A (en) | 1993-01-25 | 1997-01-07 | Pharmetrix Corporation | Liquid reservoir transdermal patch for the administration of ketorolac |
| WO1995007995A2 (en) | 1993-09-13 | 1995-03-23 | Applied Immune Sciences, Inc. | Adeno-associated viral (aav) liposomes and methods related thereto |
| USRE36397E (en) | 1994-02-04 | 1999-11-16 | The John Hopkins University | Inhibitors of poly(ADP-ribose) synthetase and use thereof to treat NMDA neurotoxicity |
| US5674533A (en) | 1994-07-07 | 1997-10-07 | Recordati, S.A., Chemical And Pharmaceutical Company | Pharmaceutical composition for the controlled release of moguisteine in a liquid suspension |
| WO1996017072A2 (en) | 1994-11-30 | 1996-06-06 | Chiron Viagene, Inc. | Recombinant alphavirus vectors |
| US6306652B1 (en) | 1995-06-15 | 2001-10-23 | Introgene B.V. | Packaging systems for human recombinant adenovirus to be used in gene therapy |
| US6001650A (en) | 1995-08-03 | 1999-12-14 | Avigen, Inc. | High-efficiency wild-type-free AAV helper functions |
| US5622856A (en) | 1995-08-03 | 1997-04-22 | Avigen | High efficiency helper system for AAV vector production |
| US6004797A (en) | 1995-11-09 | 1999-12-21 | Avigen, Inc. | Adenovirus helper-free recombinant AAV Virion production |
| US6048551A (en) | 1997-03-27 | 2000-04-11 | Hilfinger; John M. | Microsphere encapsulation of gene transfer vectors |
| US6365185B1 (en) | 1998-03-26 | 2002-04-02 | University Of Cincinnati | Self-destructing, controlled release peroral drug delivery system |
| WO2000078336A1 (en) * | 1999-06-21 | 2000-12-28 | Genetics Institute, Inc. | Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains |
| US20030124121A1 (en) * | 2000-05-26 | 2003-07-03 | Immunex Corporation | Use of interleukin-4 antagonists and compositions thereof |
| US7410781B2 (en) * | 2004-02-27 | 2008-08-12 | Regeneron Pharmaceuticals, Inc. | IL-4/IL-13 specific polypeptides and therapeutic uses thereof |
| US20050287066A1 (en) | 2004-06-28 | 2005-12-29 | Monoace, Inc. | Anti-rat angiotensin I-converting enzyme (ACE, CD143) monoclonal antibodies and uses thereof |
| US20130259866A1 (en) * | 2007-10-15 | 2013-10-03 | Sanofi | Antibodies that bind il-4 and/or il-13 and their uses |
| US20110183920A1 (en) * | 2007-11-14 | 2011-07-28 | Aerovance, Inc. | Modified il-4 mutein receptor antagonists |
| US20110256130A1 (en) * | 2008-12-01 | 2011-10-20 | Joshua Robert Schultz | Methods of treating inflammatory disorders |
| US20120156194A1 (en) * | 2010-12-16 | 2012-06-21 | Genentech, Inc. | Diagnosis and treatments relating to th2 inhibition |
| WO2012162592A1 (en) * | 2011-05-25 | 2012-11-29 | Intermune, Inc. | Pirfenidone and anti-fibrotic therapy in selected patients |
Non-Patent Citations (133)
| Title |
|---|
| "APHA Acad. Pharm. Sci.", 1987, article "Bioreversible Carriers in Drug in Drug Design, Theory and Application" |
| "Controlled Release of Pesticides and Pharmaceuticals", 1981, PLENUM PRESS |
| A. L. LEHNINGER: "Biochemistry", 1975, WORTH PUBLISHERS, pages: 73 - 75 |
| ADJEI, A.GARREN, J., PHARM. RES., vol. 1, 1990, pages 565 - 569 |
| ALIEN ET AL.: "Remington: The Science and Practice of Pharmacy", 2000, WILLIAMS & WILKINS PA |
| ANDERSON ET AL., AM. REV. RESPIR. DIS., vol. 140, 1989, pages 1317 - 1324 |
| APTE, M. V. ET AL., GUT, vol. 44, 1999, pages 534 - 541 |
| APTE, M. V. ET AL.: "Periacinar stellate shaped cells in rat pancreas: identification, isolation, and culture", GUT, vol. 43, 1998, pages 128 - 133, XP055353979, DOI: 10.1136/gut.43.1.128 |
| ASGHARNEJAD: "Transport Processes in Pharmaceutical Systems", 2000, MARCELL DEKKER, article "Improving Oral Drug Transport", pages: 185 - 218 |
| BACHEM, M. G. ET AL.: "Identification, culture, and characterization of pancreatic stellate cells in rats and humans", GASTROENTEROLOGY, vol. 115, 1998, pages 421 - 432, XP005688663, DOI: 10.1016/S0016-5085(98)70209-4 |
| BALANT ET AL.: "Prodrugs for the improvement of drug absorption via different routes of administration", EUR. J. DRUG METAB. PHARMACOKINET., vol. 15, no. 2, 1990, pages 143 - 53, XP000653032 |
| BALIMANESINKO: "Involvement of multiple transporters in the oral absorption of nucleoside analogues", ADV. DRUG DELIVERY REV., vol. 39, no. 1-3, 1999, pages 183 - 209 |
| BARR ET AL., GENE THERAPY, vol. 1, 1994, pages 51 - 58 |
| BERGER ET AL.: "Adoptive transfer of virus-specific and tumor-specific T cell immunity", CURR OPIN IMMUNOL, vol. 21, no. 2, 2009, pages 224 - 232, XP026058400, DOI: 10.1016/j.coi.2009.02.010 |
| BERKNER, K. L., BIOTECHNIQUES, vol. 6, 1988, pages 616 - 29 |
| BETT ET AL., J. VIROL., vol. 67, 1993, pages 5911 - 21 |
| BONELLI, F. ET AL., INT J PEPT PROTEIN RES., vol. 24, no. 6, 1984, pages 553 - 6 |
| BROWNE: "Fosphenytoin (Cerebyx", CLIN. NEUROPHARMACOL., vol. 20, no. 1, 1997, pages 1 - 12, XP009124989, DOI: 10.1097/00002826-199702000-00001 |
| BRYON, P., ADV. DRUG. DEL. REV., vol. 5, 1990, pages 107 - 132 |
| BUNDGAARD H.: "Prodrugs as a means to improve the delivery of peptide drugs", ARFV. DRUG DELIVERY REV., vol. 8, no. 1, 1992, pages 1 - 38, XP023764110, DOI: 10.1016/0169-409X(92)90014-H |
| BUNDGAARD H: "Improved drug delivery by the prodrug approach", CONTROLLED DRUG DELIVERY, vol. 17, 1987, pages 179 - 96 |
| BUNDGAARD: "Bioreversible derivatization of drugs— principle and applicability to improve the therapeutic effects of drugs", ARCH. PHARM. CHEMI, vol. 86, no. 1, 1979, pages 1 - 39 |
| CHU ET AL., GENE, vol. 13, 1981, pages 197 |
| DAMMS, B.BAINS, W., NATURE BIOTECHNOLOGY, 1996 |
| DEPAMPHILIS ET AL., BIOTECHNIQUE, vol. 6, 1988, pages 662 - 680 |
| DINGWALL ET AL., J CELL BIOL, vol. 188, no. 107, pages 841 - 9 |
| DUBENSKY ET AL., J. VIROL., vol. 70, 1996, pages 508 - 19 |
| FARQUHAR D ET AL.: "Biologically Reversible Phosphate-Protective Groups", PHARM. SCI., vol. 72, no. 3, 1983, pages 324 - 325, XP000650041, DOI: 10.1002/jps.2600720332 |
| FEIGNER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 7413 - 7417 |
| FEIGNER ET AL., PROC. WEST. PHARMACOL. SOC., vol. 32, 1989, pages 115 - 121 |
| FEIGNERHOLM, FOCUS, vol. 11, 1989, pages 21 - 25 |
| FLEISHER ET AL.: "Design of prodrugs for improved gastrointestinal absorption by intestinal enzyme targeting", METHODS ENZYMOL. 112 (DRUG ENZYME TARGETING, vol. 112, 1985, pages 360 - 81, XP008107397 |
| FLEISHER ET AL.: "Improved oral drug delivery: solubility limitations overcome by the use of prodrugs", ARFV. DRUG DELIVERY REV., vol. 19, no. 2, 1996, pages 115 - 130, XP002478093, DOI: 10.1016/0169-409X(95)00103-E |
| FRALEY ET AL.: "Liposome-mediated Delivery of Tobacco Mosaic Virus RNA into Tobacco Protoplasts: A Sensitive Assay for Monitoring Liposome-protoplast Interactions", PROC. NATL. ACAD. SCI. USA, vol. 79, no. 6, 1982, pages 1859 - 1863, XP055442693, DOI: 10.1073/pnas.79.6.1859 |
| FREEMAN S ET AL.: "Bioreversible Protection for the Phospho Group: Chemical Stability and Bioactivation of Di(4-acetoxy-benzyl) Methylphosphonate with Carboxyesterase", CHEM. SOC., CHEM. COMMUN., 1991, pages 875 - 877 |
| FRENCH, D. L.EDWARDS, D. A.NIVEN, R. W., AEROSOL SCI., vol. 27, 1996, pages 769 - 783 |
| FRIISBUNDGAARD: "Prodrugs of phosphates and phosphonates: Novel lipophilic alphaacyloxyalkyl ester derivatives of phosphate- or phosphonate containing drugs masking the negative charges of these groups", EUR. J. PHARM. SCI., vol. 4, 1996, pages 49 - 59 |
| GAIGNAULT ET AL.: "Designing Prodrugs and Bioprecursors I. Carrier Prodrugs", PRACT. MED. CHEM., 1996, pages 671 - 696, XP002290286 |
| GANGWAR ET AL.: "Pro-drug, molecular structure and percutaneous delivery", DES. BIOPHARM. PROP. PRODRUGS ANALOGS, [SYMP.], 1976, pages 409 - 21 |
| GONDA, I.: "Aerosols for delivery of therapeutic an diagnostic agents to the respiratory tract", CRITICAL REVIEWS IN THERAPEUTIC DRUG CARRIER SYSTEMS, vol. 6, 1990, pages 273 - 313, XP009099233 |
| GORDON, S., NAT. REV. IMMUNOL., vol. 3, 2003, pages 23 - 35 |
| GRAHAM ET AL., VIROLOGY, vol. 52, 1973, pages 456 |
| GUIDUCCI, C. ET AL., CANCER RES., vol. 65, 2005, pages 3437 - 3446 |
| HAJ-AHMADGRAHAM, J. VIROL., vol. 57, 1986, pages 267 - 74 |
| HARPER: "Progress in Drug Research", vol. 4, 1962, article "Drug Latentiation", pages: 221 - 294 |
| HAY ET AL.: "Current Diagnosis and Treatment in Pediatrics (Current Pediatrics Diagnosis & Treatment", 25 September 2006, MCGRAW-HILL MEDICAL |
| HELLMAN ET AL.: "Principles of Cancer Management: Radiation Therapy", 2001, J. B. LIPPENCOTT COMPANY |
| HERBERT, D. R. ET AL., IMMUNITY, vol. 20, 2004, pages 623 - 635 |
| HUPATHAK, PHARMACOLOGICAL REVIEWS, vol. 52, 2000, pages 493 - 512 |
| JENKINS, S. J. ET AL., J. EXP. MED., vol. 210, 2013, pages 2477 - 2491 |
| JENS T.: "Carstensen, Drug Stability: Principles & Practice", 1995, MARCEL DEKKER, pages: 379 - 80 |
| JOSEPH SAMBROOKDAVID W. RUSSELL: "Molecular Cloning: A Laboratory Manual", vol. 16, 1982, COLD SPRING HARBOR LABORATORY PRESS |
| KAWANISHI, N. ET AL., EXERC. IMMUNOL. REV., vol. 16, 2010, pages 105 - 118 |
| KOBAYASHI, S. ET AL., PHARM. RES., vol. 13, no. 1, 1996, pages 80 - 83 |
| KOHLERMILSTEIN: "Eur. J. Immunol.", vol. 7, 6 July 1976, article "Derivation of specific antibody-producing tissue culture and tumor lines by cell fusion", pages: 511 - 9 |
| LERCH, M. M.GORELICK, F. S., GASTROENTEROLOGY, vol. 144, 2013, pages 1180 - 1193 |
| LERCH, M. M.GORELICK, F. S.: "Models of acute and chronic pancreatitis", GASTROENTEROLOGY, vol. 144, 2013, pages 1180 - 1193 |
| LEVINE ET AL.: "Polymersomes: A new multi-functional tool for cancer diagnosis and therapy", METHODS, vol. 46, 2008, pages 25 - 32, XP025519418, DOI: 10.1016/j.ymeth.2008.05.006 |
| MAKKERH ET AL., CURR BIOL., vol. 6, 1996, pages 1025 - 7 |
| MCKENZIE, G. J. ET AL.: "Simultaneous disruption of interleukin (IL)-4 and IL-13 defines individual roles in T helper cell type 2-mediated responses", J. EXP. MED., vol. 189, 1999, pages 1565 - 1572, XP002335872, DOI: 10.1084/jem.189.10.1565 |
| METHODS IN ENZYMOLOGY, vol. 65, 1980, pages 499 - 560 |
| MICHAEL ET AL., J. BIOL. CHEM., vol. 268, 1993, pages 6866 - 69 |
| MITTEREDER ET AL., HUMAN GENE THERAPY, vol. 5, 1994, pages 717 - 29 |
| MIZEN ET AL.: "The Use of Esters as Prodrugs for Oral Delivery of (3-Lactam antibiotics", PHARM. BIOTECH., vol. ll, 1998, pages 345 - 365, XP008136253, DOI: 10.1007/0-306-47384-4_15 |
| MOROZOWICH ET AL.: "Design of Biopharmaceutical Properties through Prodrugs and Analogs, APHA Acad. Pharm. Sci.", vol. 40, 1977, article "Application of Physical Organic Principles to Prodrug Design" |
| MOSSER, D., M.EDWARDS, J. P, NAT. REV. IMMUNOL., vol. 8, 2008, pages 958 - 969 |
| MUELLER, TD ET AL.: "Structure, Binding, And Antagonists In The IL -4/ IL -13 Receptor System", BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1592, 2002, pages 237 - 250, XP004391603, DOI: doi:10.1016/S0167-4889(02)00318-X * |
| MURALI, R.GREEN, M., PHARMACEUTICALS, vol. 5, 2012, pages 209 - 235 |
| MURRAY, P. J. ET AL., IMMUNITY, vol. 41, 2014, pages 14 - 20 |
| MURRAY, P. J.WYNN, T. A., J. LEUKOC. BIOL, vol. 89, 2011, pages 557 - 563 |
| MURRAY, P. J.WYNN, T. A., NAT. REV. IMMUNOL., vol. 11, 2011, pages 723 - 737 |
| NAKAYAMA, BIOCHEM. J., vol. 327, 1997, pages 625 - 635 |
| NATHWANIWOOD: "Penicillins: a current review of their clinical pharmacology and therapeutic use", DRUGS, vol. 45, no. 6, 1993, pages 866 - 94 |
| NEUMANN ET AL.: "Gene Transfer into Mouse Lyoma Cells by Electroporation in High Electric Fields", EMBO J., vol. 1, no. 7, 1982, pages 841 - 845, XP002038197 |
| NGUYEN, K. D. ET AL., NATURE, vol. 480, 2011, pages 104 - 108 |
| NIVEN, R. W. ET AL., PHARM. RES., vol. 12, no. 9, 1995, pages 1343 - 1349 |
| NOHRIA ET AL., BIOTHERAPY, vol. 7, 1994, pages 261 - 269 |
| OH, CK ET AL.: "Investigational therapeutics targeting the IL -4/ IL -13/STAT-6 pathway for the treatment of asthma.", EUR RESPIR REV, vol. 19, no. 115, 2010, pages 46 - 54, XP055418557 * |
| OMARY, M. B. ET AL., J. CLIN. INVEST., vol. 117, 2007, pages 50 - 59 |
| PARKS, CLIN. GENET., vol. 58, 2000, pages 1 - 11 |
| PASHINE ET AL., NATURE MEDICINE, vol. 11, April 2005 (2005-04-01), pages S63 - S68 |
| PATTON, J. S. ET AL., CONTROLLED RELEASE, vol. 28, 1994, pages 15 79 - 85 |
| PATTON, J.PLATZ, R., ADV. DRUG DEL. REV., vol. 8, 1992, pages 179 - 196 |
| PATTONPLATZ, ADVANCED DRUG DELIVERY REVIEWS, vol. 8, 1992, pages 179 - 196 |
| PAULETTI ET AL.: "Improvement in peptide bioavailability: Peptidomimetics and Prodrug Strategies", ADV. DRUG. DELIVERY REV., vol. 27, 1997, pages 235 - 256, XP002234351, DOI: 10.1016/S0169-409X(97)00045-8 |
| PORCHERAY, F. ET AL., CLIN. EXP. IMMUNOL., vol. 142, 2005, pages 481 - 489 |
| POTTER ET AL.: "Enhancer-dependent Expression of Human Kappa Immunoglobulin Genes Introduced into Mouse pre-B Lymphocytes by Electroporation", PROC. NATL. ACAD. SCI. USA, vol. 81, no. 22, 1984, pages 7161 - 7165, XP055669570, DOI: 10.1073/pnas.81.22.7161 |
| R.J. KAUFMAN: "Gene Expression Technology: Methods in Enzymology", 1991, article "Vectors used for expression in mammalian cells" |
| RICH ET AL., HUMAN GENE THERAPY, vol. 4, 1993, pages 461 - 76 |
| RIECHMANN ET AL.: "Reshaping human antibodies for therapy", NATURE, vol. 332, no. 6162, 24 March 1988 (1988-03-24), pages 323 - 7, XP002007067, DOI: 10.1038/332323a0 |
| ROBERTSON ET AL.: "The Harriet Lane Handbook: A Manual for Pediatric House Officers", 24 June 2005, MOSBY |
| RUDT, S.R. H. MULLER, J. CONTROLLED RELEASE, vol. 22, 1992, pages 263 - 272 |
| S JAIN ET AL.: "Gold nanoparticles as novel agents for cancer therapy", BR J RADIOL., vol. 85, no. 1010, February 2012 (2012-02-01), pages 101 - 113, XP055377402, DOI: 10.1259/bjr/59448833 |
| SACCANI, A. ET AL., CANCER RES., vol. 66, 2006, pages 11432 - 11440 |
| SAEKI, K. ET AL., GASTROENTEROLOGY, vol. 142, 2012, pages 1010 - 1020 |
| SCHWARTZ ET AL.: "The 5-Minute Pediatric Consult", 16 June 2005, LIPPINCOTT WILLIAMS & WILKINS |
| See also references of EP3194446A4 |
| SERBINA, N. V.PAMER, E. G., NAT. IMMUNOL., vol. 7, 2006, pages 311 - 317 |
| SETH ET AL., J. VIROL., vol. 68, 1994, pages 933 - 40 |
| SHEK, F. W. ET AL., AM. J. PATHOL., vol. 160, 2002, pages 1787 - 1798 |
| SICA, A.MANTOVANI, A., J. CLIN. INVEST., vol. 122, 2012, pages 787 - 795 |
| SINGLETON: "Dictionary of DNA and Genome Technology", 28 November 2012, WILEY-BLACKWELL |
| SINHABABUTHAKKER: "Prodrugs of anticancer agents", ADV. DRUG DELIVERY REV., vol. 19, no. 2, 1996, pages 241 - 273 |
| STELLA ET AL.: "Prodrugs. Do they have advantages in clinical practice?", DRUGS, vol. 29, no. 5, 1985, pages 455 - 73, XP000560851, DOI: 10.2165/00003495-198529050-00002 |
| STOUT, R. D. ET AL., J. IMMUNOL., vol. 175, 2005, pages 342 - 349 |
| STOUT, R. D.SUTTLES, J. J., LEUKOC. BIOL., vol. 76, 2004, pages 509 - 513 |
| TABATA, YY. IKADA, BIOMED. MATER. RES., vol. 22, 1988, pages 837 - 858 |
| TALUKDAR, R.TANDON, R. K., J. GASTROENTEROL. HEPATOL., vol. 23, 2008, pages 34 - 41 |
| TAN ET AL.: "Development and optimization of anti-HIV nucleoside analogs and prodrugs: A review of their cellular pharmacology, structure-activity relationships and pharmacokinetics", ADV. DRUG DELIVERY REV., vol. 39, no. 1-3, 1999, pages 117 - 151, XP001205764, DOI: 10.1016/S0169-409X(99)00023-X |
| TANSEY, I. P., SPRAY TECHNOL. MARKET, vol. 4, 1994, pages 26 - 29 |
| TAYLOR: "Improved passive oral drug delivery via prodrugs", ADV. DRUG DELIVERY REV., vol. 19, no. 2, 1996, pages 131 - 148 |
| TIMSINA, INT. J. PHARM., vol. 101, 1995, pages 1 - 13 |
| TREIBER, M. ET AL.: "Myeloid, but not pancreatic, RelA/p65 is required for fibrosis in a mouse model of chronic pancreatitis", GASTROENTEROLOGY, vol. 141, 2011, pages el471 - el477 |
| TSAI ET AL., CURR. OPIN. MOL. THER., vol. 2, 2000, pages 515 - 23 |
| URQUHART ET AL., ANN. REV. PHARMACOL. TOXICOL., vol. 24, 1984, pages 199 - 236 |
| VALENTINOBORCHARDT: "Prodrug strategies to enhance the intestinal absorption of peptides", DRUG DISCOVERY TODAY, vol. 2, no. 4, 1997, pages 148 - 155 |
| VAN DYKEN, S. J.LOCKSLEY, R. M., ANNU. REV. IMMUNOL., vol. 31, 2013, pages 317 - 343 |
| VERDINI, AVISCOMI, G. C, J. CHEM. SOC. PERKIN TRANS., vol. 1, 1985, pages 697 - 701 |
| VIJAYAN, D.: "Isolation and differentiation of monocytes-macrophages from human blood", METHODS MOL. BIOL., vol. 844, 2012, pages 183 - 187 |
| VISSER, J., POWDER TECHNOLOGY, vol. 58, 1989, pages 1 - 10 |
| WAGNER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 6099 - 6103 |
| WALL, D. A., DRUG DELIVERY, vol. 2, 1995, pages 10 1 - 20 |
| WALLER ET AL.: "Prodrugs", BR. J. CLIN. PHARMAC., vol. 28, 1989, pages 497 - 507, XP001062552 |
| WANG ET AL.: "Prodrug approaches to the improved delivery of peptide drug", CURR. PHARM. DESIGN., vol. 5, no. 4, 1999, pages 265 - 287, XP001089610 |
| WIEBEKNAUS: "Concepts for the design of anti-HIV nucleoside prodrugs for treating cephalic HIV infection", ADV. DRUG DELIVERY REV., vol. 39, no. 1-3, 1999, pages 63 - 80, XP002204743, DOI: 10.1016/S0169-409X(99)00020-4 |
| WITT, H. ET AL., GASTROENTEROLOGY, vol. 132, 2007, pages 1557 - 1573 |
| WONG ET AL.: "Electric Field Mediated Gene Transfer", BIOCHEM BIOPHYS RES COMMUN, vol. 107, no. 2, 1982, pages 584 - 587, XP024846537, DOI: 10.1016/0006-291X(82)91531-5 |
| WU ET AL., ANESTHES, vol. 94, 2001, pages 1119 - 32 |
| WYNN, T. A.BARRON, L., SEMIN. LIVER DIS., vol. 30, 2010, pages 245 - 257 |
| XUE, J. ET AL.: "Aryl hydrocarbon receptor regulates pancreatic IL-22 production and protects mice from acute pancreatitis", GASTROENTEROLOGY, vol. 143, 2012, pages 1670 - 1680, XP055596520, DOI: 10.1053/j.gastro.2012.08.051 |
| XUE, J.HABTEZION, A.: "Carbon monoxide-based therapy ameliorates acute pancreatitis via TLR4 inhibition", J. CLIN. INVEST., vol. 124, 2014, pages 437 - 447 |
| ZANEN, P.LAMM, J.-W., J. INT. J. PHARM., vol. 114, 1995, pages 111 - 115 |
| ZHANG, H. ET AL., J. CLIN. INVEST., vol. 123, 2013, pages 1019 - 1031 |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10245298B2 (en) | 2014-09-18 | 2019-04-02 | Cedars-Sinai Medical Center | Compositions and methods for treating fibrosis |
| US11547738B2 (en) | 2014-09-18 | 2023-01-10 | Cedars-Sinai Medical Center | Compositions and methods for treating fibrosis |
Also Published As
| Publication number | Publication date |
|---|---|
| US20250121026A1 (en) | 2025-04-17 |
| JP2020203922A (ja) | 2020-12-24 |
| EP3194446B1 (en) | 2022-10-26 |
| EP3194446A4 (en) | 2018-03-14 |
| US20170189471A1 (en) | 2017-07-06 |
| JP7095990B2 (ja) | 2022-07-05 |
| US10245298B2 (en) | 2019-04-02 |
| EP3194446A1 (en) | 2017-07-26 |
| JP2017529364A (ja) | 2017-10-05 |
| US11547738B2 (en) | 2023-01-10 |
| US20190183967A1 (en) | 2019-06-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250121026A1 (en) | Compositions and methods for treating fibrosis | |
| ES2763248T3 (es) | Injerto de células madre con una combinación de un agente dirigido a las células madre y modulación de señalización inmunoreguladora | |
| EP4194001A1 (en) | Enterically delivered bitter oligopeptides for the treatment for type 2 diabetes and obesity | |
| JP2021527655A (ja) | ネオ抗原およびそれらの使用 | |
| KR102181384B1 (ko) | 골수세포-1 상에 발현되는 촉발 수용체(trem-1) trem-유사 전사체 1(tlt-1)로부터 유도되는 억제 펩타이드 및 그의 용도 | |
| CN101835892A (zh) | Cdca1肽和包含cdca1肽的药剂 | |
| JP2013040204A (ja) | コポリマー1と組み合わせた、神経発生の誘発及び幹細胞治療 | |
| JP2001521383A (ja) | 20個のヒト分泌タンパク質 | |
| CN111032075A (zh) | 用于治疗癌症的方法和组合物 | |
| WO2019213686A1 (en) | Therapeutic compositions and uses therefor | |
| EP4205762A1 (en) | Improved dna vaccine for sars-cov-2 | |
| US7772367B2 (en) | C-terminal p53 palindromic peptide that induces apoptosis of cells with aberrant p53 and uses thereof | |
| CN114686429A (zh) | 一种激活nk细胞的肿瘤免疫治疗方法 | |
| KR102753455B1 (ko) | 암 및 자가면역 질환을 치료하기 위한 조성물 및 방법 | |
| ES2363972T3 (es) | Vectores de adn. | |
| EP3328378A1 (en) | Compositions and methods for treating acne | |
| CA2684321A1 (en) | Compositions comprising pkac fragments and uses thereof for inhibiting akt1, p70s6k or abl activity | |
| CN101017166A (zh) | 人rtn4b蛋白在制备抗肿瘤药物中的应用 | |
| JP2006524712A (ja) | カテプシンの阻害のための方法および組成物 | |
| US20220370586A1 (en) | Method of generating activated t cells for cancer therapy | |
| WO2025006714A1 (en) | Anti-upar car t cells and uses thereof | |
| WO2016138301A1 (en) | Anti-tgf-beta antibody for the treatment of fanconi anemia | |
| Bettenworth et al. | S1642 New Tools for In Vivo Imaging of Murine DSS-Colitis-Mrp14-Directed Fluorescence-Mediated Molecular Tomography (FMT) and High-Resolution Ultrasound Imaging | |
| HK1251177B (en) | Oncolytic hsv1 vector and methods of use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15841396 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2017515820 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2015841396 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2015841396 Country of ref document: EP |