WO2016032163A1 - 디제너러시 리프로그래밍을 통한 비천연 단백질 합성 방법 - Google Patents

디제너러시 리프로그래밍을 통한 비천연 단백질 합성 방법 Download PDF

Info

Publication number
WO2016032163A1
WO2016032163A1 PCT/KR2015/008646 KR2015008646W WO2016032163A1 WO 2016032163 A1 WO2016032163 A1 WO 2016032163A1 KR 2015008646 W KR2015008646 W KR 2015008646W WO 2016032163 A1 WO2016032163 A1 WO 2016032163A1
Authority
WO
WIPO (PCT)
Prior art keywords
trna
amino acid
natural amino
protein
target
Prior art date
Application number
PCT/KR2015/008646
Other languages
English (en)
French (fr)
Inventor
강택진
이기백
Original Assignee
동국대학교 산학협력단
한국보건산업진흥원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 동국대학교 산학협력단, 한국보건산업진흥원 filed Critical 동국대학교 산학협력단
Publication of WO2016032163A1 publication Critical patent/WO2016032163A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione

Definitions

  • the present invention relates to a method for synthesizing non-natural proteins, and more particularly, by removing certain tRNAs from a protein synthesis system to make some codons encoding natural amino acids empty and then using empty codons.
  • a method for producing a protein comprising an unnatural amino acid by introducing a natural amino acid into the protein.
  • non-natural amino acids into proteins based on genetic information transcribed from DNA.
  • the genetic information consists of a genetic code (codon) consisting of three nucleotide combinations.
  • codons There are four nucleotides, a total of 64 possible combinations of codons, of which 61 are used to encode amino acids and three are used to encode protein synthesis disruption. Therefore, to use non-natural amino acids rather than 20 natural amino acids for protein synthesis, one of three protein synthesis stop codons (stop codons) instead of 61 codons is newly encoded non-natural amino acids. Must be resigned.
  • the UAG stop codons are the least frequently used codons in E. coli and have been the most widely used codons encoding non-natural amino acids.
  • the process of translating stop codons into non-natural amino acids occurs competitively with the process of translating stop codons into protein synthesis.
  • one stop codon is necessary for normal synthesis of the protein, and there is a limit that up to two can be used from the stop codon when encoding a non-natural amino acid into a 3-nucleotide codon. Therefore, there is a need for a technique for reprogramming some of the codons encoding natural amino acids rather than stop codons into codons encoding non-natural amino acids.
  • the present inventors removed a tRNA having an anti-codon that decodes the codon in a protein synthesis system in order to change a 3-nucleotide codon that encodes a natural amino acid into a codon that encodes an unnatural amino acid.
  • the present invention has been completed by developing a method of adding a tRNA that decodes the codon and an element that binds a non-natural amino acid to the tRNA, or a tRNA to which the non-natural amino acid is already bound.
  • An object of the present invention is to 1) remove the tRNA for some of the codons encoding natural amino acids to remove the coding functions of the corresponding codons, and 2) tRNA for normal protein synthesis and tRNA used for the introduction of non-natural amino acids from outside.
  • the introduction provides degenercy reprogramming, where multiple codons reprogram the degenercy of an organism that specifies one amino acid to specify two or more amino acids.
  • a target tRNA is removed by treating bacteriocin that selectively degrades a target tRNA that decodes a codon encoding a target natural amino acid to be replaced with an unnatural amino acid. Manufacturing the codon in an empty state;
  • Protein synthesis system by introducing a tRNA for deciphering the codon encoded by the target tRNA and an aminoacylated tRNA (aminoacyl tRNA) combined with a non-natural amino acid in a cell-free protein synthesis system in which the target tRNA was removed in step 1). It provides a method for synthesizing a protein comprising a non-natural amino acid comprising the step of recovering.
  • aminoacyl tRNA aminoacylated tRNA
  • the present invention also provides a method for removing target tRNA in a cell-free protein synthesis system, comprising treating the bacteriocin that selectively degrades the target tRNA in a cell-free protein synthesis system that produces the desired protein.
  • It provides a method for producing an EGFP variant comprising a non-natural amino acid comprising 2) introducing a tRNA that decodes codons for arginine synthesized from the outside, and a tRNA having a target non-natural amino acid bound to the tRNA.
  • non-natural amino acids can be efficiently introduced into proteins, and it is possible to synthesize proteins consisting of 23 amino acids based on 3-nucleotide codons. Proteins containing such non-natural amino acids can be usefully used for basic or pharmaceutical research, therapeutic protein production, diagnostic protein production, and the like.
  • FIG. 1 is a diagram showing a conceptual diagram of degenerate reprogramming according to the present invention, specifically, after removing all tRNAs for a specific amino acid with bacteriocin, coding for codons and non-natural amino acids to be used for encoding natural amino acids in protein synthesis.
  • Figure 2 shows the process of degeneracy reprogramming by identifying the codons to be used and then adding tRNAs and non-natural amino acid-tRNAs to each protein synthesis system.
  • FIG. 2 shows the results of Western blot analysis of the expression of EGFP, the target protein, in E. coli extract from which Arginyl-tRNA was removed and E. coli extract with tRNAccu added thereto according to an embodiment of the present invention. Is a picture showing.
  • Figure 3 is a non-natural amino acid acetyl lysine in the cell-free protein synthesis system using E. coli extract from which Arginyl-tRNA was removed by treating EGFP, a protein of interest, according to one embodiment of the present invention
  • Figure shows the results of Western blot analysis of protein synthesis after the introduction of acyl tRNA.
  • FIG. 4 is a non-natural protein synthesis system using E. coli extract from which Arginyl-tRNA has been removed by treating Colysine D with monomethyllysine, dimethyllysine, and trimethyllysine, respectively, according to an embodiment of the present invention.
  • Figure shows the results of Western blot analysis of the introduction of the amino acid acetyl lysine and the amino-acyl tRNA bound to the amino acid position 47, 159, 190.
  • the present invention removes the tRNA for some of the codons encoding natural amino acids to remove the coding functions of the codons, and then introduces the tRNAs necessary for normal protein synthesis and the tRNAs used for introduction of non-natural amino acids from outside, thereby making it non-natural.
  • a degenercy reprogramming method for preparing proteins comprising amino acids is provided.
  • the method is a
  • a target tRNA is treated by treating bacteriocin or a variant thereof that selectively degrades a target tRNA that decodes a codon encoding a target natural amino acid to be replaced with an unnatural amino acid. Removing the codon to produce an empty state;
  • Protein synthesis system by introducing a tRNA for deciphering the codon encoded by the target tRNA and an aminoacylated tRNA (aminoacyl tRNA) combined with a non-natural amino acid in a cell-free protein synthesis system in which the target tRNA was removed in step 1).
  • Recovering may include.
  • the cell-free protein synthesis system of step 1) may comprise an E. coli extract, or a whole tRNA mixture derived from E. coli, capable of producing a protein of interest.
  • the bacteriocin of the step 1) or a variant thereof may use any one selected from the group consisting of Cholysin D, Cholysin E5 or PrrC, or a cleavage or protein engineering variant thereof.
  • step 1) may further comprise the step of separating the codon to be used for the coding of the natural amino acid and the non-natural amino acid in the protein synthesis after step.
  • bacteriocins are proteinaceous toxins that interfere with the growth of other microorganisms through various mechanisms.
  • E. coli-producing colicin D is a type of bacteriocin that enters other E. coli and specifically breaks down the growth of arginyl-tRNA in cells.
  • Bacteriocins derived from colysine D or other bacteria are isolated and added to E. coli extracts for cell-free protein production to break down arginyl-tRNA in E. coli extracts.
  • E. coli-producing colicin D is a type of bacteriocin that enters other E. coli and specifically breaks down the growth of arginyl-tRNA in cells.
  • Bacteriocins derived from colysine D or other bacteria are isolated and added to E. coli extracts for cell-free protein production to break down arginyl-tRNA in E. coli extracts.
  • E. coli extracts for cell-free protein production to break down arginyl
  • Escherichia coli can be expressed in Escherichia coli so that arginyl-tRNA degradation can occur in E. coli, and an extract can be prepared from E. coli, or a limited time can be obtained.
  • collidin D is an anti-codon specific tRNA degrading enzyme, this description is not limited to E. coli.
  • Escherichia coli uses six codons that encode arginine, including CGU, CGC, CGA, CGG, AGA, and AGG. There are also tRNAs containing four anti-codons to decode these six codons. Colysine D degrades all four of these tRNAs.
  • colysine D may comprise a separation tag comprising a histidine tag at the amino- or carboxy-terminus. More conveniently, the tagged colysine D is first bound to the beads, and the colysine D-beads are reacted with the E. coli extract, and the beads are removed by centrifugation or the like. The reaction may proceed with varying time between 0 and 42 ° C. and the required reaction time may vary depending on the presence or absence of agitation.
  • This approach can be applied to the use of all bacteriocins that are selective for tRNA in addition to bacteriocins that are selective for arginyl-tRNA and bacteriocins that have equivalent activity. That is, it is different from other proteins such as cholinecin E5, which selectively acts on tRNA against tyrosine, histidine, asparagine, aspartic acid, and cholineine such as PrrC that is selective for tRNA against lysine, or pyocin S4, a bacteriocin derived from Pseudomonas aeruginosa. Bacteriocins with bacterial tRNA degrading enzyme activity can be used.
  • tRNA degrading enzymes can also be used to pretreat E. coli derived tRNA mixtures added for cell-free protein production as well as pretreatment of extracts for cell-free protein production.
  • an essential component of the Protein Synthesis Using Recombinant Elements (PURE) system in which all protein components required for protein synthesis are separated and recombined, is a whole tRNA mixture derived from E. coli.
  • the method can be used to reprogram degeneracy for a particular amino acid.
  • Colysine D can remove all the arginyl-tRNA present in E. coli extract, and thus, extracts treated with colysine D cannot synthesize arginine-containing proteins. Therefore, one or more arginyl-tRNAs are added to the extract treated with Colysine D after external synthesis.
  • the codons for arginine in the protein of interest are unified in one, and when the arginyl-tRNA for the protein is externally synthesized and added, there is no problem in protein synthesis. Instead, arginine codons that are not deciphered by externally synthesized arginyl-tRNAs can no longer act as codons because there are no tRNAs with the corresponding anti-codons. Therefore, these arginine codons can be used for the purpose of encoding unnatural amino acids.
  • the present invention also provides a method of removing certain tRNAs in a protein synthesis system to empty some codons that were encoding natural amino acids.
  • the method can be performed by treating the cell-free protein synthesis system producing the desired protein with bacteriocin that selectively degrades the target tRNA.
  • the cell-free protein synthesis system of step 1) is mixed in the cell-free protein synthesis system in a form naturally contained in the extract preparation in the E. coli extract which can produce the target protein, or separately separated from the outside. It may include a whole tRNA mixture in the form of E. coli.
  • the bacteriocin of step 1) may be bacteriocin having tRNA degrading enzyme activity from various bacteria, such as collidin D, collidin E5, PrrC or pyocin S4, or other various bacteria.
  • It provides a method for producing an EGFP variant comprising a non-natural amino acid comprising 2) introducing a tRNA that decodes codons for arginine synthesized from the outside, and a tRNA having a target non-natural amino acid bound to the tRNA.
  • the colysine or variant thereof may be any one selected from the group consisting of colysine D, colysine E5 or PrrC, or a cleavage or protein engineering variant thereof.
  • the non-natural amino acid may be acetyllysine.
  • the genetic information of the colysine D detoxifying protein and the genetic information of colysine D were sequentially cloned into pETDuet-1 (Novazen, USA).
  • the two genes were cloned under separate T7 promoters for co-expression.
  • Colicin D has a histidine tag consisting of six histidines at its amino terminus.
  • Overexpression and isolation of the protein used conventional methods. Specifically, E. coli BL21 (DE3) transformed with pETDuet-1 cloned with the colysine D detoxification protein and colysine D was incubated for 12 hours using IPTG.
  • Cholicin D detoxification protein was removed from the beads by removing the binding.
  • the beads were washed again several times with buffer 1 and then stored in buffer 1 containing glycerol and used.
  • Colysine D may be stored and used after eluting from Ni-NTA beads.
  • E. coli extracts for cell-free protein production are well known and described by Kim et al. 2006, Simple procedures for the construction of a robust and cost-effective cell-free protein synthesis system. 126, 554-561).
  • the production method of E. coli extract is similar to each other, even when using the E. coli extract used in the present embodiment or the extract contained in the commercially available kit for producing cell-free protein, there is no difference in the method of construction of the arginyl-tRNA removed system. 15 ⁇ l of colysine D-bead was added per 100 ⁇ l of E. coli extract and then treated at 4 ° C., 16 ° C., 37 ° C.
  • Treatment time was made into 24 hours, 16 hours, and 1 hour according to process temperature, respectively.
  • the following example representatively describes an example of treatment at 37 ° C. for 1 hour, but essentially the same result can be obtained in the other cases.
  • Beads were removed from E. coli extracts treated with colysine D-beads and used for cell-free protein synthesis.
  • the conditions for the cell-free synthesis are basically described in Kim et al. 2006, Simple procedures for the construction of a robust and cost-effective cell-free protein synthesis system.Journal of Biotechnology 126, 554-561.
  • the composition is as follows; 57 mM HEPES (pH 7.5), 1.2 mM ATP, 0.85 mM GTP, UTP, and CTP, 2 mM DTT, 90 mM potassium glutamate, 80 mM ammonium acetate, 20 mM magnesium acetate, 34 ⁇ g / mL folinic acid, 2.5 mM amino acid (20 types), 2% polyethylene glycol 8000, 67 mM creatine phosphate, 3.2 ⁇ g / mL creatine kinase, DNA, 4 ⁇ L of E. coli extract.
  • An enhanced green fluorescent protein (amino acid sequence of SEQ ID NO: 5; nucleotide sequence of EGFP: SEQ ID NO: 6) was expressed in a cell-free protein synthesis system to confirm the construction of the system from which the arginyl-tRNA was removed.
  • the amino acid sequence and base sequence of the protein used are shown in the sequence information.
  • This protein has histidine tag and FLAG tag attached to amino and carboxy terminus, respectively, and contains 6 arginine.
  • the codons for these six arginines were all unified with AGG to synthesize genes (Bionia, Korea), clone them into pET28b (Novazen, USA), and then use the PCR (polymerase chain reaction) portion of the T7 promoter and terminator.
  • the amplification method was used as a template for the cell-free protein synthesis reaction.
  • Primers of this PCR reaction were prepared in the following sequence; 5'GAGGATCGAGATCTCGATCC 3 '(SEQ ID NO: 7), 5'ATCCGGATATAGTTCCTCCTT 3' (SEQ ID NO: 8).
  • the expressed protein was confirmed by Western blot using an antibody against the FLAG sequence at the carboxy terminus.
  • E. coli extracts treated with Colysine D do not have tRNAccu capable of deciphering AGG codons, and thus, EGFP is normally expressed as a result of adding externally synthesized tRNAccu to E. coli extracts treated with Colysine D. 2).
  • TAC 139-141 of SEQ ID NO: 6
  • the genetic code for tyrosine was transformed into CGA, CGC, CGG, CGT, TAG (amber) using a gene mutation technique.
  • PET28b vector cloned with the target protein for substitution of the genetic code was PCR using the following primer pairs:
  • the part where the genetic code is substituted is underlined.
  • the nucleotide sequence was confirmed by obtaining plasmid DNA from a single colony obtained by transforming E. coli amplified genetic information amplified by PCR. From the plasmid into which the mutation was introduced, PCR was used to include the T7 promoter and the terminator and used for the cell-free protein. The following primer pairs were used: 5′GAGGATCGAGATCTCGATCC 3 ′ (SEQ ID NO: 19), 5′ATCCGGATATAGTTCCTCCTT 3 ′ (SEQ ID NO: 20).
  • Escherichia coli extracts treated with Colysine D do not have tRNA for the genetic code, so protein synthesis will not occur effectively.
  • tRNAs having anti-codons for these genetic codes must be externally synthesized.
  • E. coli asparaginyl-tRNA-derived sequences were modified and used (Lee et al. 2012, Comparative evaluation of two cell-free protein synthesis systems derived from Escherichia coli for genetic code reprogramming. Journal of biotechnology 164, 330-335 ).
  • tRNA sequence information derived from various other may be modified and used. The sequence information shows the DNA sequence used for tRNA synthesis including anti-codons for the CGA, CGC, CGG, CGT, TAG codons.
  • T7 RNA polymerase Since they commonly include the T7 promoter region, they were transcribed into tRNAs expressed as separate sequences through in vitro transcription using T7 RNA polymerase. In vitro transcription was done using Promega's kit, but isolated T7 RNA polymerase is a fundamental response for the researchers. Even when these synthesized tRNAs were added to the cell-free protein system, these tRNAs did not properly synthesize proteins, although they contained anti-codons for each codon but were not recognized by aminoacylase (Aminoacyl tRNA samples). (FIG. 3).
  • an artificial amino acid linking to a tRNA for an empty codon was intended to complete the dinerary reprogramming.
  • a tRNA for an empty codon was intended to complete the dinerary reprogramming.
  • Lee et al. 2012 Comparative evaluation of two cell-free protein synthesis systems derived from Escherichia coli for genetic code reprogramming.Journal of biotechnology 164, 330-335 The aminoacylation reaction of tRNA was used.
  • tRNA was reacted with acetyl lysine by reacting each tRNA with an aminoacylated ribozyme dFx under 0.1 M Tris-HCl (pH 7.4), 0.3 M MgCl 2 , 5 mM acetyllysine-3 ', 5'dinitrobenzyl ester. Noacylated.
  • the sequence of ribozyme dFx was synthesized by in vitro transcription from a DNA template corresponding to 5 ′ GGAUCGAAAGAUUUCCGCAUCCCCGAAAGGGUACAUGGCGUUAGGU 3 ′ (SEQ ID NO: 31).
  • ribozymes Without using ribozymes, it is also possible to use a mutated aminoacylating enzyme or a method of aminoacylating tRNA by chemical methods.
  • the above-described example was applied to other non-natural amino acids other than acetyllysine.
  • the amino acids applied are mono-, di- and trimethyllysine, which show that the method described herein can be applied to the introduction of other non-natural amino acids that can be used for protein synthesis. It is also shown that these non-natural amino acids can be introduced sequentially at positions including positions 159 and 190 in addition to position 47.
  • the mutant using the primer pair (5′AACAGCCACAACGTCCGAATCATGGCCGACAAGCAGAAGA 3 ′ (SEQ ID NO: 32), 5 ′ TTCGGACGTTGTGGCTGTTGTAGTTGTAC 3 ′ (SEQ ID NO: 33) from a plasmid obtained by replacing the tyrosine genetic code at position 47 with a CGA codon
  • a plasmid was obtained in which the genetic code of the tyrosine amino acid was substituted with a CGA codon.
  • the genetic code for the codon substitution of tyrosine which is substituted for tyrosine at amino acid 47, 159, 190, by mutation using a primer pair (5′CAGCTCGCCGACCACCGACAGCAGAACACCCCCATCGGCGACGGC 3 ′ (SEQ ID NO: 34), 5 ′ GTCGGTGGTCGGCGAGCTGCACGCTGCCG 3 ′ (SEQ ID NO: 35)). Plasmids were obtained. From these plasmids, the genetic information of the protein of interest was amplified by PCR to include the T7 promoter and the terminator.
  • the amplified DNA was added to a cell-free protein system using an extract treated with colysine D together with tRNAucg aminoacylated with monomethyllysine, dimethyllysine and trimethyllysine.
  • the aminoacylation process of tRNA has been described above.
  • all non-natural amino acids including trimethyllysine which are used at very low efficiency for protein synthesis, can be introduced into various positions of the target protein at the same time with high efficiency up to three places (FIG. 4).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 디제너러시 리프로그래밍(degenercy reprogramming)을 통한 비천연 아미노산을 포함하는 단백질의 합성 방법에 관한 것으로, 보다 상세하게는 1) 천연 아미노산을 암호화하는 코돈 중 일부에 대한 tRNA를 제거하여 해당 코돈들의 암호화 기능을 제거한 후 다시 2) 정상적인 단백질 합성에 필요한 tRNA와 비천연 아미노산 도입에 사용되는 tRNA를 외부에서 도입함으로써, 여러 개의 코돈이 하나의 아미노산을 지정하는 생명체의 디제너러시(degenercy)를 재프로그램하여 두 가지 이상의 아미노산을 지정하도록 만드는 디제너러시 리프로그래밍하여 비천연 아미노산을 포함하는 단백질을 생산하는 방법에 관한 것이다.

Description

디제너러시 리프로그래밍을 통한 비천연 단백질 합성 방법
본 발명은 비천연 단백질의 합성 방법에 관한 것으로서, 보다 상세하게는 단백질 합성 시스템에서 특정 tRNA를 제거하여 천연 아미노산을 암호화하던 일부 코돈을 비어있는(empty) 상태로 만든 후 비어있는 코돈들을 이용하여 비천연 아미노산을 단백질 내로 도입함으로써 비천연 아미노산을 포함한 단백질을 제조하는 방법에 관한 것이다.
단백질 내에 비천연 아미노산을 위치특이적으로 도입하는 것은 단백질의 기능을 연구하거나 단백질에 새로운 기능을 부여하는 방법의 하나로 최근 관심이 증폭되고 있다. 일반적으로 생명체 혹은 생명체로부터 유래된 단백질 합성시스템에서는 20가지의 아미노산이 DNA로부터 전사된 유전정보에 따라 단백질로 합성된다. 이때 유전정보는 3개의 뉴클레오티드 조합으로 이루어진 유전암호(코돈)으로 구성되어 있다. 뉴클레오티드는 4가지로, 코돈은 총 64가지의 가능한 조합을 보이고, 이중 61가지의 코돈이 아미노산을 암호화하는데 사용되며 3가지의 코돈은 단백질 합성 중단을 암호화하는데 사용된다. 따라서 20가지의 천연 아미노산이 아닌 비천연 아미노산을 위치특이적으로 단백질 합성에 사용하기 위해서는 61가지의 코돈이 아닌 3가지의 단백질 합성 중단 코돈(스톱 코돈) 중 하나를 새로이 비천연 아미노산을 암호화하는 코돈으로 재지정(reassignment)해야 한다.
지금까지 3가지 스톱 코돈 중 특히 UAG 스톱 코돈은 대장균에서 가장 사용 빈도가 낮은 코돈으로 비천연 아미노산을 암호화하는 코돈으로 가장 널리 사용되어 왔다. 하지만 일반적으로 스톱 코돈을 비천연 아미노산으로 번역하는 과정은 스톱 코돈을 단백질 합성 중단으로 번역하는 과정과 경쟁적으로 발생하게 되어 그 효율이 낮은 단점이 있다. 또한, 스톱 코돈은 단백질의 정상적인 합성을 위해 반드시 하나는 필요한 바, 비천연 아미노산을 3-뉴클레오티드 코돈으로 암호화할 경우 스톱 코돈으로부터 최대 2가지만을 사용할 수 있다는 한계가 존재한다. 따라서 스톱 코돈이 아닌 천연 아미노산을 암호화하는 코돈 중 일부를 비천연 아미노산을 암호화하는 코돈으로 재프로그래밍하는 기법이 필요하다.
이에, 본 발명자들은 천연 아미노산을 암호화하는 3-뉴클레오티드 코돈을 온전히 비천연 아미노산을 암호화하는 코돈으로 변경하기 위해서는 단백질 합성 시스템에서 해당 코돈을 해독(decode)하는 안티-코돈을 갖는 tRNA를 제거한 후 다시 외부에서 해당 코돈을 해독하는 tRNA와 상기 tRNA에 비천연 아미노산을 결합하는 요소들, 또는 비천연 아미노산이 이미 결합된 tRNA를 첨가할 수 있는 방법을 개발함으로써 본 발명을 완성하였다.
본 발명의 목적은 1) 천연 아미노산을 암호화하는 코돈 중 일부에 대한 tRNA를 제거하여 해당 코돈들의 암호화 기능을 제거한 후 다시 2) 정상적인 단백질 합성에 필요한 tRNA와 비천연 아미노산 도입에 사용되는 tRNA를 외부에서 도입함으로써, 여러 개의 코돈이 하나의 아미노산을 지정하는 생명체의 디제너러시(degenercy)를 재프로그램하여 두 가지 이상의 아미노산을 지정하도록 만드는 디제너러시 리프로그래밍(degenercy reprogramming)을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은
1) 목적 단백질을 생산하는 무세포 단백질 합성 시스템에서, 비천연 아미노산으로 치환하고자 하는 표적 천연 아미노산을 암호화하는 코돈을 해독하는 표적 tRNA를 선택적으로 분해하는 박테리오신(Bacteriocin)을 처리하여 표적 tRNA를 제거하여 상기 코돈이 비어있는(empty) 상태로 제조하는 단계; 및
2) 상기 단계 1)에서 표적 tRNA가 제거된 무세포 단백질 합성 시스템에 상기 표적 tRNA가 암호화하는 코돈을 해독하는 tRNA 및 비천연 아미노산과 결합된 아미노아실화 tRNA(aminoacyl tRNA)를 도입하여 단백질 합성 시스템을 회복시키는 단계;를 포함하는 비천연 아미노산을 포함하는 단백질의 합성 방법을 제공한다.
또한, 본 발명은 목적 단백질을 생산하는 무세포 단백질 합성 시스템에 표적 tRNA를 선택적으로 분해하는 박테리오신을 처리하는 단계를 포함하는, 무세포 단백질 합성 시스템에서의 표적 tRNA 제거 방법을 제공한다.
아울러, 본 발명은
1) 무세포 단백질 생산 시스템에서 목적 단백질을 생산하는 대장균 추출액에 콜리신를 처리하여 아르기닌에 대한 코돈을 해독하는 tRNA(arginyl-tRNA)를 제거하는 단계; 및
2) 외부에서 합성한 아르기닌에 대한 코돈을 해독하는 tRNA, 및 상기 tRNA에 표적 비천연 아미노산을 결합시킨 tRNA를 도입하는 단계;를 포함하는 비천연 아미노산을 포함하는 EGFP 변이체의 제조방법을 제공한다.
본 방법을 이용하여 비천연 아미노산을 효율적으로 단백질 내로 도입할 수 있으며, 3-뉴클레오티드 코돈에 의거하여 23가지의 아미노산으로 이루어진 단백질을 합성하는 것이 가능하다. 이러한 비천연 아미노산을 포함한 단백질은 기초 혹은 의약용 연구, 치료용 단백질 생산, 진단용 단백질 생산 등에 유용하게 사용될 수 있다.
도 1은 본 발명에 따른 디제너러시 리프로그래밍의 개념도를 보여주는 그림으로서, 구체적으로 특정 아미노산에 대한 tRNA를 박테리오신으로 전부 제거한 후, 단백질 합성에 있어 천연 아미노산의 암호화에 사용할 코돈과 비천연 아미노산의 암호화에 사용할 코돈을 구분한 다음, 각각에 대한 tRNA와 비천연 아미노산-tRNA를 단백질 합성 시스템에 첨가하여 수행하는 디제너러시 리프로그래밍의 과정을 보여주는 그림이다.
도 2는 본 발명의 한가지 실시예에 따라 콜리신D를 처리하여 Arginyl-tRNA가 제거된 대장균 추출액과 여기에 tRNAccu를 첨가한 대장균 추출액에서 각각 목적 단백질인 EGFP의 발현 여부를 웨스턴 블랏으로 분석한 결과를 보여주는 그림이다.
도 3은 본 발명의 한가지 실시예에 따라 목적 단백질인 EGFP에 콜리신D를 처리하여 Arginyl-tRNA가 제거된 대장균 추출액을 사용하는 무세포 단백질 합성 시스템에서 비천연 아미노산인 아세틸리신과 외부에서 결합한 아미노아실 tRNA를 도입한 후 단백질 합성을 웨스턴 블랏으로 분석한 결과를 보여주는 그림이다.
도 4는 본 발명의 한가지 실시예에 따라 목적 단백질인 모노메틸리신, 디메틸리신, 트리메틸리신에 각각 콜리신D를 처리하여 Arginyl-tRNA가 제거된 대장균 추출액을 사용하는 무세포 단백질 합성 시스템에서 비천연 아미노산인 아세틸리신과 외부에서 결합한 아미노아실 tRNA의 47, 159, 190번 아미노산 위치에의 도입을 웨스턴 블랏으로 분석한 결과를 보여주는 그림이다.
이하, 본 발명을 상세히 설명한다.
본 발명은 천연 아미노산을 암호화하는 코돈 중 일부에 대한 tRNA를 제거하여 해당 코돈들의 암호화 기능을 제거한 후, 다시 정상적인 단백질 합성에 필요한 tRNA와 비천연 아미노산 도입에 사용되는 tRNA를 외부에서 도입함으로써, 비천연 아미노산을 포함하는 단백질을 제조하는 디제너러시 리프로그래밍(degenercy reprogramming) 방법을 제공한다.
상기 방법은
1) 목적 단백질을 생산하는 무세포 단백질 합성 시스템에서, 비천연 아미노산으로 치환하고자 하는 표적 천연 아미노산을 암호화하는 코돈을 해독하는 표적 tRNA를 선택적으로 분해하는 박테리오신(Bacteriocin) 또는 이의 변형체를 처리하여 표적 tRNA를 제거하여 상기 코돈이 비어있는(empty) 상태로 제조하는 단계; 및
2) 상기 단계 1)에서 표적 tRNA가 제거된 무세포 단백질 합성 시스템에 상기 표적 tRNA가 암호화하는 코돈을 해독하는 tRNA 및 비천연 아미노산과 결합된 아미노아실화 tRNA(aminoacyl tRNA)를 도입하여 단백질 합성 시스템을 회복시키는 단계;를 포함할 수 있다.
상기 방법에 있어서, 단계 1)의 무세포 단백질 합성 시스템은 목적 단백질을 생산할 수 있는 대장균 추출액, 또는 대장균 유래 전 tRNA 혼합물(whole tRNA mixture)을 포함할 수 있다.
상기 방법에 있어서, 단계 1)의 박테리오신 또는 이의 변형체는 콜리신D, 콜리신E5 또는 PrrC, 또는 이들의 절단체 또는 단백질공학 변형체로 구성된 군으로부터 선택된 어느 하나를 사용할 수 있다.
상기 방법에 있어서, 단계 1) 이후 단백질 합성에 있어 천연 아미노산의 암호화에 사용할 코돈과 비천연 아미노산의 암호화에 사용할 코돈을 구분하는 단계를 더 포함할 수 있다.
구체적으로, 상기 방법의 각 공정을 상세히 설명한다.
1) 특정 tRNA 제거
미생물들은 혹독한 환경에서 생존하기 위해 독소를 생산하여 경쟁관계에 있는 다른 미생물들의 생장을 방해하거나 혹은 죽인다. 이 중 박테리오신(bacteriocin)들은 여러 형태의 기작으로 다른 미생물들의 생장을 방해하는 단백질성의 독소이다. 특히 특정 대장균이 생산하는 콜리신D는 다른 대장균 내로 들어가 세포 내 arginyl-tRNA를 특정적으로 분해하여 생장을 방해하는 박테리오신의 일종이다. 콜리신D 혹은 이에 해당하는 다른 박테리아 유래의 박테리오신을 분리하여 무세포 단백질 생산을 위한 대장균 추출액에 첨가하여 대장균 추출액 내의 arginyl-tRNA를 분해한다. 또한 한시적으로 콜리신D를 대장균에서 발현하여 대장균 내에서 arginyl-tRNA 분해가 일어나도록 한 후 이 대장균으로부터 추출액을 제조할 수도 있으며, 혹은 한시적으로 단백질 합성이 중단된 대장균 균체 자체를 얻을 수도 있다. 또한, 콜리신D는 안티-코돈에 특이적인 tRNA 분해 효소이므로 이 설명은 단지 대장균에 국한되지 않는다. 대장균은 아르기닌을 암호화하는 6가지의 코돈을 사용하며 이는 CGU, CGC, CGA, CGG, AGA, AGG 등이다. 또한 이들 6가지의 코돈을 해독하기 위해 4가지의 안티-코돈을 포함하는 tRNA가 존재한다. 콜리신D는 이러한 4가지의 tRNA 모두를 분해한다. Arginyl-tRNA의 분해가 완료된 시점에서 이후의 단백질 합성 반응을 저해하는 콜리신D를 제거한다. 이를 위해 콜리신D는 아미노- 혹은 카르복시-말단에 히스티딘 태그를 포함하는 분리 태그를 포함할 수 있다. 더욱 편리하게는 태그가 포함된 콜리신D를 먼저 비드에 결합하고 콜리신D-비드를 대장균 추출액과 반응한 후 비드를 원심분리 등으로 제거한다. 반응은 0~42℃ 사이에서 시간을 달리하며 진행할 수 있으며 교반의 유무에 따라 필요한 반응 시간이 변할 수 있다.
이러한 접근 방식은 arginyl-tRNA에 선택적인 콜리신D 혹은 그와 동등한 활성을 갖는 박테리오신 외에 다른 tRNA에 선택성을 갖는 모든 박테리오신의 활용에도 적용될 수 있다. 즉, 티로신, 히스티딘, 아스파라긴, 아스파르트산에 대한 tRNA에 선택적으로 작용하는 콜리신E5와 리신에 대한 tRNA에 선택성을 보이는 PrrC 등의 콜리신, 또는 그 외에 Pseudomonas aeruginosa 유래의 박테리오신인 pyocin S4과 같이 다른 박테리아 유래의 tRNA 분해 효소 활성이 있는 박테리오신이 사용될 수 있다.
또한 이들 tRNA 분해 효소의 사용은 무세포 단백질 생산을 위한 추출액의 전처리 뿐만 아니라 무세포 단백질 생산을 위해 첨가하는 대장균 유래 tRNA 혼합물들을 전처리하는데 사용될 수 있다. 예를 들어, 단백질 합성에 필요한 모든 단백질 구성물들을 분리하고 다시 재조합하여 구성한 PURE(Protein synthesis Using Recombinant Elements) 시스템의 필수 구성요소는 이러한 대장균 유래의 전 tRNA 혼합물(whole tRNA mixture)인 바, 본 발명의 방법을 이용하여 특정 아미노산에 대한 디제너러시를 리프로그램할 수 있다.
2) 단백질 합성 시스템 회복
콜리신D는 대장균 추출액에 존재하는 모든 arginyl-tRNA를 제거할 수 있으며, 이에 따라 콜리신D로 처리한 추출액으로는 아르기닌을 포함하는 단백질을 합성할 수 없다. 따라서 콜리신D로 처리한 추출액에 하나 혹은 그 이상의 arginyl-tRNA를 외부에서 합성한 후 첨가한다. 목적 단백질에서 아르기닌에 대한 코돈은 하나로 통일한 후 이에 대한 arginyl-tRNA를 외부에서 합성한 후 첨가할 경우 단백질 합성에는 전혀 문제가 없다. 대신 외부에서 합성하여 첨가한 arginyl-tRNA로 해독되지 않는 아르기닌 코돈은 해당 안티-코돈을 갖는 tRNA가 없으므로 더 이상 코돈으로 작용하지 못한다. 따라서 이들 아르기닌 코돈들을 비천연 아미노산을 암호화하는 목적으로 사용할 수 있게 된다.
또한, 본 발명은 본 발명은 단백질 합성 시스템에서 특정 tRNA를 제거하여 천연 아미노산을 암호화하던 일부 코돈을 비어있는(empty) 상태로 만드는 방법을 제공한다.
상기 방법은 목적 단백질을 생산하는 무세포 단백질 합성 시스템에 표적 tRNA를 선택적으로 분해하는 박테리오신을 처리하는 단계로 수행할 수 있다.
상기 방법에 있어서, 단계 1)의 무세포 단백질 합성 시스템은 목적 단백질을 생산할 수 있는 대장균 추출액 내에 추출액 제조 과정에서 자연적으로 함유된 형태로, 혹은 외부에서 따로 분리한 후 무세포 단백질 합성시스템에 혼합되는 형태로 대장균 유래 전 tRNA 혼합물(whole tRNA mixture)을 포함할 수 있다.
상기 방법에 있어서, 단계 1)의 박테리오신은 콜리신D, 콜리신E5, PrrC 또는 pyocin S4, 또는 그 외에 다양한 박테리아 유래의 tRNA 분해 효소 활성이 있는 박테리오신일 수 있다.
아울러, 본 발명은
1) 무세포 단백질 생산 시스템에서 목적 단백질을 생산하는 대장균 추출액에 콜리신 또는 이의 변형체를 처리하여 아르기닌에 대한 코돈을 해독하는 tRNA(arginyl-tRNA)를 제거하는 단계; 및
2) 외부에서 합성한 아르기닌에 대한 코돈을 해독하는 tRNA, 및 상기 tRNA에 표적 비천연 아미노산을 결합시킨 tRNA를 도입하는 단계;를 포함하는 비천연 아미노산을 포함하는 EGFP 변이체의 제조방법을 제공한다.
상기 방법에 있어서, 상기 콜리신 또는 이의 변형체는 콜리신D, 콜리신E5 또는 PrrC, 또는 이들의 절단체 또는 단백질공학 변형체로 구성된 군으로부터 선택된 어느 하나일 수 있다.
상기 방법에 있어서, 상기 비천연 아미노산은 아세틸리신일 수 있다.
이하 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
[실시예 1]
Arginyl-tRNA 제거된 시스템의 구성
대장균이 선호하는 코돈으로 구성된 콜리신D와 콜리신D해독단백질(Immunity protein D)의 유전자는 ㈜바이오니아(한국)에서 주문 제작하였다. 두 단백질의 아미노산 서열과 염기 서열을 서열 정보에 나타내었다(콜리신D의 아미노산 서열: 서열번호 1; 콜리신D의 염기 서열: 서열번호 2; 콜리신D해독단백질의 아미노산 서열: 서열번호 3; 콜리신D해독단백질의 염기서열: 서열번호 4). 콜리신D를 대장균에서 발현할 경우 대장균의 생장이 억제되므로 콜리신D해독단백질을 함께 발현한 후 콜리신D를 분리하였다. 두 단백질의 동시 발현을 위해 콜리신D해독단백질의 유전정보와 콜리신D의 유전정보를 pETDuet-1(노바젠, 미국)에 순차적으로 클로닝하였다. 두 유전정보는 독립된 T7 프로모터 하에 클로닝되어 동시 발현이 가능하였으며 콜리신D는 그 아미노 말단에 6개의 히스티딘으로 이루어진 히스티딘 태그가 존재한다. 단백질의 과발현 및 분리는 통상의 방법을 사용하였다. 구체적으로, 콜리신D해독단백질과 콜리신D가 클로닝된 pETDuet-1으로 형질전환된 대장균 BL21(DE3)를 배양한 후 IPTG를 이용하여 12시간 동안 과발현을 유도하였다. 100 mL의 배지에서 얻어진 세포를 버퍼1 (10 mM Tris-acetate (pH 8.2), 14 mM MgCl2, 60 mM K(OAc), 1 mM dithiothreitol)으로 현탁한 후 초음파 파쇄법을 이용하여 파쇄하였다. 원심분리 후 얻어진 상등액에서 히스티딘 태그를 포함하는 콜리신D를 250 ㎕의 Ni-NTA 비드 (Merck, 미국)을 이용하여 분리하였다. 이 과정에서 콜리신D와 강력하게 결합하여 세포 사멸을 방해하는 콜리신D해독단백질이 함께 분리되므로 콜리신D가 결합한 Ni-NTA 비드를 버퍼1로 씻은 후 6 M guanidinium hydrochloride를 이용하여 단백질-단백질 결합을 제거함으로써 콜리신D해독단백질을 비드에서 제거하였다. 이 비드를 다시 버퍼1로 수차례 씻은 후 글리세롤을 포함한 버퍼1에 보관하였다가 사용하였다. 또는 콜리신D를 Ni-NTA 비드에서 용출한 후 보관하고 사용할 수도 있다.
무세포 단백질 생산을 위한 대장균 추출액의 다양한 제조 방법은 이미 잘 알려져 있으며 김 등이 논문(Kim et al. 2006, Simple procedures for the construction of a robust and cost-effective cell-free protein synthesis system. Journal of Biotechnology 126, 554-561)으로 발표한 것과 같은 방법을 사용하였다. 대장균 추출액의 제조 방법은 서로 대동소이하여 본 실시예에서 사용한 대장균 추출액이나 시판되는 무세포 단백질 생산을 위한 키트에 포함된 추출액을 이용하는 경우에도 arginyl-tRNA가 제거된 시스템의 구성 방법에는 차이가 없다. 대장균 추출액 100 ㎕당 15 ㎕의 콜리신D-비드를 첨가한 후 이를 4℃, 16℃, 37℃에서 처리하였다. 처리 온도에 따라 처리 시간을 각각 24시간, 16시간, 1시간으로 하였다. 아래 실시예는 대표적으로 37℃에서 1시간 처리한 예를 기술하나 근본적으로 나머지 경우에도 같은 결과를 얻을 수 있다. 콜리신D-비드로 처리한 대장균 추출액에서 비드를 제거한 후 이를 무세포 단백질 합성 반응에 사용하였다. 무세포 합성 반응의 조건은 기본적으로 김 등이 논문(Kim et al. 2006, Simple procedures for the construction of a robust and cost-effective cell-free protein synthesis system. Journal of Biotechnology 126, 554-561)으로 발표한 것과 같아, 그 조성은 다음과 같다; 57 mM HEPES (pH 7.5), 1.2 mM ATP, 0.85 mM GTP, UTP, and CTP, 2 mM DTT, 90 mM potassium glutamate, 80 mM ammonium acetate, 20 mM magnesium acetate, 34 μg/mL folinic acid, 2.5 mM 아미노산 (20 종류), 2 % polyethylene glycol 8000, 67 mM creatine phosphate, 3.2 μg/mL creatine kinase, DNA, 대장균 추출액 4μL.
Arginyl-tRNA가 제거된 시스템의 구성을 확인하기 위해 EGFP(enhanced green fluorescent protein)(EGFP의 아미노산 서열: 서열번호 5; EGFP의 염기 서열: 서열번호 6)를 무세포 단백질 합성 시스템에서 발현하였다. 사용한 단백질의 아미노산 서열과 염기서열은 서열정보에 나타내었다. 본 단백질은 아미노 말단과 카르복시 말단에 각각 히스티딘 태그와 FLAG 태그가 결합되어 있으며, 총 6개의 아르기닌을 포함하고 있다. 이 6개의 아르기닌에 대한 코돈은 모두 AGG로 통일하여 유전자를 합성하고 (㈜바이오니아, 한국), pET28b (노바젠, 미국)에 클로닝한 후 T7 프로모터와 터미네이터를 포함하는 부분을 PCR(polymerase chain reaction) 방법으로 증폭하여 무세포 단백질 합성 반응의 주형으로 사용하였다. 본 PCR 반응의 프라이머는 다음의 서열로 제작되었다; 5′GAGGATCGAGATCTCGATCC 3′(서열번호 7), 5′ATCCGGATATAGTTCCTCCTT 3'(서열번호 8). 발현된 단백질은 카르복시 말단에 있는 FLAG 서열에 대한 항체를 이용하는 웨스턴블랏으로 확인하였다.
그 결과, 콜리신D로 처리하지 않은 대장균 추출액을 사용한 경우 EGFP가 잘 발현되었으나 콜리신D로 처리한 대장균 추출액을 사용한 경우에는 단백질이 전혀 발현되지 않았다(도 2). 이는 콜리신D로 처리한 대장균 추출액에는 AGG 코돈을 해독할 수 있는 tRNAccu가 없기 때문이므로, 다시 콜리신D로 처리한 대장균 추출액에 외부에서 합성한 tRNAccu를 첨가한 결과, EGFP가 정상적으로 발현되었다(도 2).
[실시예 2]
비천연 아미노산의 도입
목적 단백질로 사용한 EGFP의 47번째 아미노산인 티로신을 비천연 아미노산으로 치환한 예를 설명한다. 이를 위해서는 본 실시예에서 상술하는 단백질의 47번째 아미노산에 대한 유전 암호를 비어있는(empty) 상태가 되도록 해야 한다. 따라서 티로신에 대한 유전 암호인 TAC(서열번호 6의 139-141)를 유전자 돌연변이 기법을 사용하여 CGA, CGC, CGG, CGT, TAG(amber)으로 변형하였다. 유전 암호의 치환을 위해 목적 단백질이 클로닝된 pET28b 벡터를 아래의 프라이머 짝을 이용하여 PCR하였다:
1) CGA
5′GAGGGCGATGCCACCCGAGGCAAGCTGACCCTGAAGTTCATCTGC 3′(서열번호 9)
5′CTCGGGTGGCATCGCCCTCGCCCTCG 3′(서열번호 10)
2) CGC
5′GAGGGCGATGCCACCCGCGGCAAGCTGACCCTGAAGTTCATCTGC 3′(서열번호 11)
5′CGCGGGTGGCATCGCCCTCGCCCTCG 3′(서열번호 12)
3) CGG
5′GAGGGCGATGCCACCCGGGGCAAGCTGACCCTGAAGTTCATCTGC 3′(서열번호 13)
5′CCCGGGTGGCATCGCCCTCGCCCTCG 3′(서열번호 14)
4) CGT
5′GAGGGCGATGCCACCCGTGGCAAGCTGACCCTGAAGTTCATCTGC 3′(서열번호 15)
5′CACGGGTGGCATCGCCCTCGCCCTCG 3′(서열번호 16)
5) TAG
5′GAGGGCGATGCCACCTAGGGCAAGCTGACCCTGAAGTTCATCTGC 3′(서열번호 17)
5′CCTAGGTGGCATCGCCCTCGCCCTCG 3′(서열번호 18)
유전 암호가 치환된 부분을 밑줄로 나타내었다. PCR로 증폭한 유전정보를 대장균에 형질전환한 후 얻어진 단일 군락으로부터 플라스미드 DNA를 얻어 염기 서열을 확인하였다. 변이가 도입된 플라스미드로부터 T7 프로모터와 터미네이터가 포함되도록 PCR하여 무세포 단백질에 사용하였다. 이때 다음의 프라이머 짝을 사용하였다: 5′GAGGATCGAGATCTCGATCC 3′(서열번호 19), 5′ATCCGGATATAGTTCCTCCTT 3′(서열번호 20).
콜리신D로 처리한 대장균 추출액에는 상기 유전암호에 대한 tRNA가 없으므로 단백질 합성이 효과적으로 일어나지 않을 것이다. 이들 코돈을 비천연 아미노산 도입에 사용하기 위해서는 상기 유전암호들에 대한 안티-코돈을 갖는 tRNA를 외부에서 합성해야 한다. 본 실시예에서는 대장균 asparaginyl-tRNA 유래의 서열을 변형하여 사용하였다(Lee et al. 2012, Comparative evaluation of two cell-free protein synthesis systems derived from Escherichia coli for genetic code reprogramming. Journal of biotechnology 164, 330-335). 이 외에도 다른 여러 유래의 tRNA 서열 정보를 변형하여 사용할 수 있다. 서열 정보에 CGA, CGC, CGG, CGT, TAG 코돈에 대한 안티-코돈을 포함하는 tRNA 합성에 사용한 DNA 서열을 나타내었다.
1) CGA에 대한 안티-코돈을 갖는 tRNA 합성용 DNA 서열
GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGACTTCGAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGCCA (서열번호 21)
2) CGA에 대한 안티-코돈을 갖는 tRNA 서열
GGCUCUGUAGUUCAGUCGGUAGAACGGCGGACUUCGAAUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGCCA (서열번호 22)
3) CGC에 대한 안티-코돈을 갖는 tRNA 합성용 DNA 서열
GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGCGAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGCCA (서열번호 23)
4) CGC에 대한 안티-코돈을 갖는 tRNA 서열
GGCUCUGUAGUUCAGUCGGUAGAACGGCGGACUGCGAAUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGCCA (서열번호 24)
5) CGG에 대한 안티-코돈을 갖는 tRNA 합성 용 DNA 서열
GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGACTCCGAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGCCA (서열번호 25)
6) CGG에 대한 안티-코돈을 갖는 tRNA 서열
GGCUCUGUAGUUCAGUCGGUAGAACGGCGGACUCCGAAUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGCCA (서열번호 26)
7) CGT에 대한 안티-코돈을 갖는 tRNA 합성용 DNA 서열
GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGACTACGAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGCCA (서열번호 27)
8) CGT에 대한 안티-코돈을 갖는 tRNA 서열
GGCUCUGUAGUUCAGUCGGUAGAACGGCGGACUACGAAUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGCCA (서열번호 28)
9) TAG에 대한 안티-코돈을 갖는 tRNA 합성용 DNA 서열
GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGACTCTAAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGCCA (서열번호 29)
10) TAG에 대한 안티-코돈을 갖는 tRNA 서열
GGCUCUGUAGUUCAGUCGGUAGAACGGCGGACUCUAAAUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGCCA (서열번호 30)
이들은 공통적으로 T7 프로모터 부위를 포함하고 있어 T7 RNA polymerase를 이용한 in vitro transcription을 통해 별도의 서열로 표시한 tRNA로 전사하여 사용하였다. In vitro transcription은 Promega사의 키트를 사용하였으나 분리 정제한 T7 RNA polymerase를 사용하는 것은 해당 연구자들에게는 기본적인 반응이다. 이들 합성된 tRNA를 무세포 단백질 시스템에 첨가한 경우에도 이 tRNA들은 비록 각 코돈에 대한 안티-코돈을 포함하나 아미노아실화효소에 인지되지 못하므로 제대로 단백질을 합성하지 못하였다(- Aminoacyl tRNA 샘플들)(도 3).
본 발명에서 기술하는 바와 같이 비어있는 코돈에 대한 tRNA에 인위적으로 아미노산을 연결하여 디저너리시 리프로그래밍을 완성하고자 하였다. 본 실시예에서는 이 등이 논문(Lee et al. 2012, Comparative evaluation of two cell-free protein synthesis systems derived from Escherichia coli for genetic code reprogramming. Journal of biotechnology 164, 330-335)으로 발표한 바와 같이 리보자임을 이용한 tRNA의 아미노아실화 반응을 이용하였다.
구체적으로, 각 tRNA와 아미노아실화 리보자임인 dFx를 0.1 M Tris-HCl (pH 7.4), 0.3 M MgCl2, 5 mM acetyllysine-3’,5’dinitrobenzyl ester 조건에서 반응하여 tRNA를 아세틸리신으로 아미노아실화 하였다. 리보자임 dFx의 서열은 5′ GGAUCGAAAGAUUUCCGCAUCCCCGAAAGGGUACAUGGCGUUAGGU 3′(서열번호 31)으로 해당하는 DNA 주형으로부터 in vitro transcription을 통해 합성하였다. 리보자임을 이용하지 않고, 변이 아미노아실화 효소를 사용하거나, 화학적인 방법으로 tRNA를 아미노아실화하는 방법도 사용 가능하다. 아세틸리신으로 아미노아실화된 tRNA를 콜리신D로 처리한 대장균 추출액을 사용하는 무세포 단백질 합성 시스템에 도입한 결과, CGT 코돈을 사용하는 경우를 제외한 모든 경우에서 자연형과 같은 크기의 단백질로 효과적으로 합성됨을 목적단백질의 카르복시 말단에 포함된 FLAG 서열에 대한 웨스턴블랏으로 확인할 수 있다(도 3).
이는 의도한 바와 같이 위치 특이적으로 비천연 아미노산을 도입하는데 있어 디제너러시 리프로그래밍을 사용할 수 있음을 보여주는 것이다.
[실시예 3]
다양한 비천연 아미노산에의 적용
이상과 같이 상술한 예를 아세틸리신 외의 다른 비천연 아미노산에 적용하였다. 적용한 아미노산은 mono-, di-, trimethyllysine들로 이는 본 발명이 기술하는 방법이 단백질 합성에 사용될 수 있는 기타 비천연 아미노산의 도입에도 적용될 수 있음을 보인다. 또한 47번 위치 외에 159번과 190번 위치를 포함하는 위치에 순차적으로 이들 비천연 아미노산이 도입될 수 있음을 보인다. 상술한 바와 같이 47번 위치 티로신 유전암호를 CGA 코돈으로 치환한 플라스미드로부터 프라이머 짝(5′AACAGCCACAACGTCCGAATCATGGCCGACAAGCAGAAGA 3′(서열번호 32), 5′ TTCGGACGTTGTGGCTGTTGTAGTTGTAC 3′(서열번호 33))을 이용한 돌연변이로 47, 159번 아미노산인 티로신의 유전암호가 CGA 코돈으로 치환된 플라스미드를 얻었다. 유전자 돌연변이에 대한 실험 방법은 전술한 바 있다. 다시 이로부터 프라이머 짝(5′CAGCTCGCCGACCACCGACAGCAGAACACCCCCATCGGCGACGGC 3′(서열번호 34), 5′ GTCGGTGGTCGGCGAGCTGCACGCTGCCG 3′(서열번호 35))을 이용한 돌연변이로 47, 159, 190번 아미노산인 티로신의 유전암호가 CGA 코돈으로 치환된 플라스미드를 얻었다. 이들 플라스미드로부터 목적단백질의 유전정보를 T7 프로모터와 터미네이터를 포함하도록 PCR로 증폭해 내었다. 증폭한 DNA를 모노메틸리신, 디메틸리신, 트리메틸리신으로 아미노아실화된 tRNAucg와 함께 콜리신D로 처리한 추출액을 사용하는 무세포 단백질 시스템에 첨가하였다. tRNA의 아미노아실화 과정은 전술한 바 있다. 그 결과 단백질 합성에 매우 낮은 효율로 사용되는 트리메틸리신을 포함한 모든 비천연 아미노산을 목적 단백질의 여러 위치에 그것도 동시에 3군데까지 높은 효율로 도입할 수 있음을 알 수 있다(도 4).
이상에서 본 발명의 바람직한 실시예에 대하여 상세하게 설명하였지만 본 발명의 권리범위는 이에 한정되는 것은 아니고 다음의 청구범위에서 정의하고 있는 본 발명의 균등범위 내로서 이용가능한 당업자의 여러 변형 및 개량 형태 또한 본 발명의 권리범위에 속하는 것이다.

Claims (9)

1) 목적 단백질을 생산하는 무세포 단백질 합성 시스템에서, 비천연 아미노산으로 치환하고자 하는 표적 천연 아미노산을 암호화하는 코돈을 해독하는 표적 tRNA를 선택적으로 분해하는 박테리오신(Bacteriocin) 또는 이의 변형체를 처리하여 표적 tRNA를 제거하여 상기 코돈이 비어있는(empty) 상태로 제조하는 단계; 및
2) 상기 단계 1)에서 표적 tRNA가 제거된 무세포 단백질 합성 시스템에 상기 표적 tRNA가 암호화하는 코돈을 해독하는 tRNA 및 비천연 아미노산과 결합된 아미노아실화 tRNA(aminoacyl tRNA)를 도입하여 단백질 합성 시스템을 회복시키는 단계;를 포함하는 비천연 아미노산을 포함하는 단백질의 합성 방법.
제 1항에 있어서, 상기 단계 1)의 무세포 단백질 합성 시스템은 대장균 유래 전 tRNA 혼합물(whole tRNA mixture)을 포함하는 것을 특징으로 하는 방법.
제 1항에 있어서, 상기 단계 1)의 박테리오신 또는 이의 변형체는 콜리신D, 콜리신E5, PrrC, 및 이들의 절단체 및 이들의 단백질공학 변형체로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하는 방법.
제 1항에 있어서, 상기 단계 1) 이후 단백질 합성에 있어 천연 아미노산의 암호화에 사용할 코돈과 비천연 아미노산의 암호화에 사용할 코돈을 구분하는 단계를 더 포함하는 것을 특징으로 하는 방법.
목적 단백질을 생산하는 무세포 단백질 합성 시스템에 표적 tRNA를 선택적으로 분해하는 박테리오신(Bacteriocin)을 처리하는 단계를 포함하는, 무세포 단백질 합성 시스템에서의 표적 tRNA 제거 방법.
제 5항에 있어서, 상기 단계 1)의 무세포 단백질 합성 시스템은 대장균 유래 전 tRNA 혼합물(whole tRNA mixture)을 포함하는 것을 특징으로 하는 방법.
제 5항에 있어서, 상기 단계 1)의 박테리오신은 콜리신D, 콜리신E5 및 PrrC로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하는 방법.
1) 무세포 단백질 생산 시스템에서 목적 단백질을 생산하는 대장균 추출액에 콜리신 또는 이의 변형체를 처리하여 아르기닌에 대한 코돈을 해독하는 tRNA(arginyl-tRNA)를 제거하는 단계; 및
2) 외부에서 합성한 아르기닌에 대한 코돈을 해독하는 tRNA, 및 상기 tRNA에 표적 비천연 아미노산을 결합시킨 tRNA를 도입하는 단계;를 포함하는 비천연 아미노산을 포함하는 EGFP 변이체의 제조방법.
제 8항에 있어서, 상기 단계 2)의 비천연 아미노산은 아세틸리신인 것을 특징으로 하는 방법.
PCT/KR2015/008646 2014-08-27 2015-08-19 디제너러시 리프로그래밍을 통한 비천연 단백질 합성 방법 WO2016032163A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2014-0112273 2014-08-27
KR1020140112273A KR101646728B1 (ko) 2014-08-27 2014-08-27 디제너러시 리프로그래밍을 통한 비천연 단백질 합성 방법

Publications (1)

Publication Number Publication Date
WO2016032163A1 true WO2016032163A1 (ko) 2016-03-03

Family

ID=55400009

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/008646 WO2016032163A1 (ko) 2014-08-27 2015-08-19 디제너러시 리프로그래밍을 통한 비천연 단백질 합성 방법

Country Status (2)

Country Link
KR (1) KR101646728B1 (ko)
WO (1) WO2016032163A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR900702044A (ko) * 1988-11-18 1990-12-05 더 리젠쯔 오브 더 유니버시티 오브 캘리포니아 비천연 아미노산 단백질에 부위특이적으로 첨가하는 방법
KR20070092287A (ko) * 2004-12-22 2007-09-12 암브룩스, 인코포레이티드 아미노아실-ｔＲＮＡ 합성효소의 조성물 및 그것의 용도
CN102348807A (zh) * 2009-01-12 2012-02-08 苏特罗生物制药公司 利用体外蛋白合成体系将非天然氨基酸引入蛋白的单装载体系

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR900702044A (ko) * 1988-11-18 1990-12-05 더 리젠쯔 오브 더 유니버시티 오브 캘리포니아 비천연 아미노산 단백질에 부위특이적으로 첨가하는 방법
KR20070092287A (ko) * 2004-12-22 2007-09-12 암브룩스, 인코포레이티드 아미노아실-ｔＲＮＡ 합성효소의 조성물 및 그것의 용도
CN102348807A (zh) * 2009-01-12 2012-02-08 苏特罗生物制药公司 利用体外蛋白合成体系将非天然氨基酸引入蛋白的单装载体系

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
AHN, JIN - HO ET AL.: "Use of signal sequences as an in situ removable sequence element to stimulate protein synthesis in cell -free extracts", NUCLEIC ACIDS RESEARCH, vol. 35, no. 4, 2007, pages e21 *
LEE, KI BEAK: "Comparative evaluation of two cell -free protein synthesis systems for genetic code reprogramming", MASTER'S THESIS, DONGGUK UNIVERSITY, February 2014 (2014-02-01), pages 1 - 89 *

Also Published As

Publication number Publication date
KR101646728B1 (ko) 2016-08-09
KR20160025661A (ko) 2016-03-09

Similar Documents

Publication Publication Date Title
US20060084136A1 (en) Production of fusion proteins by cell-free protein synthesis
Carr et al. Engineering the genome of Thermus thermophilus using a counterselectable marker
Engels et al. The transcriptional activator ClgR controls transcription of genes involved in proteolysis and DNA repair in Corynebacterium glutamicum
DeBenedictis et al. Measuring the tolerance of the genetic code to altered codon size
US20110027829A1 (en) Methods and Compositions
CN109072244A (zh) 使用滚环扩增产物的无细胞蛋白质表达
WO2020032711A1 (ko) 신규한 crispr 연관 단백질 및 이의 용도
WO2017122931A1 (ko) L-시스테인 생산용 변이미생물 및 이를 이용한 l-시스테인의 제조방법
JP2024521175A (ja) 微生物及びその使用
WO2016032163A1 (ko) 디제너러시 리프로그래밍을 통한 비천연 단백질 합성 방법
US20230383286A1 (en) Phage engineering: protection by circularized intermediate
WO2022145944A1 (ko) 재조합 바실러스 속 미생물 및 이를 이용한 모유올리고당 제조방법
WO2016159536A1 (ko) 신규 프로모터 및 이의 용도
CN101928719A (zh) 用于筛选蛋白可溶性表达的t载体及其构建方法和应用
CN109055378A (zh) 单亚基RNA聚合酶KP34RP在长链mRNA合成中的生产应用
US20220306677A1 (en) Compositions and methods for making hybrid polypeptides
WO2009113794A2 (en) Methods for screening initial codons providing desired expression levels of proteins, and methods for tuning expression and production of recombinant proteins
CN116710471A (zh) 具有减少的细胞运动的突变的宿主细胞
WO2015147379A1 (ko) 숙주세포의 생체 회로 간섭 없이 외래 유전자를 발현하기 위한 재조합 벡터 및 이의 용도
Xu et al. Degradation mechanism of AtrA mediated by ClpXP and its application in daptomycin production in Streptomyces roseosporus
Román-Hurtado et al. One pathway, two cyclic pentapeptides: heterologous expression of BE-18257 AC and pentaminomycins AE from Streptomyces cacaoi CA-170360
Alden et al. Measuring the tolerance of the genetic code to altered codon size
CN101535482A (zh) 遗传编码的荧光香豆素氨基酸
WO2023113582A1 (ko) 단백질 자동 발현 시스템
WO2017094969A1 (ko) 막 단백질 제조용 융합 단백질, 발현 벡터, 및 이를 이용한 막 단백질 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15835952

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15835952

Country of ref document: EP

Kind code of ref document: A1