WO2016030323A1 - Use of elafin for disorders associated with elastase independent increase in troponin - Google Patents
Use of elafin for disorders associated with elastase independent increase in troponin Download PDFInfo
- Publication number
- WO2016030323A1 WO2016030323A1 PCT/EP2015/069341 EP2015069341W WO2016030323A1 WO 2016030323 A1 WO2016030323 A1 WO 2016030323A1 EP 2015069341 W EP2015069341 W EP 2015069341W WO 2016030323 A1 WO2016030323 A1 WO 2016030323A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- troponin
- polypeptide
- elafin
- diseases
- surgery
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/55—Protease inhibitors
- A61K38/57—Protease inhibitors from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/55—Protease inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/06—Antiarrhythmics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/08—Vasodilators for multiple indications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/12—Antihypertensives
Definitions
- the present invention relates to the use of elafin for the treatment and/or prevention of diseases or disorders associated with an increase in troponin levels, which are non eiastase dependent.
- the present invention in a preferred embodiment relates to a method and composition, using elafin, for protecting the heart muscle or other muscles from damage induced by abnormal blood flow and/or inflammation, which may result from, for example, a heart infarction.
- the present invention additionally or concomitantly relates to the use of elafin for the treatment and/or prevention of disorders or diseases which are associated with a rise in the level of troponin I and/or T.
- Elafin is a recombinant human protein, known to act as a reversible tight binding inhibitor of eiastase and the closely related serine protease proteinase 3.
- Elafin can be taken up from the extracellular medium by monocytes [Butler et al., 2006] and vascular endothelial cells [Nickel et al., 2013]. The full citations are indicated at the end of the Background Section.
- Elafin can interfere with intracellular signaling events.
- U937 elafin inhibited the LPS-induced activation of the transcription factors AP-1 and NF- ⁇ via an effect on the ubiquitin-proteasome pathway, with no inhibition of peptidase activities associated with the 20 S proteasome.
- macrophage chemokine MCP-1 macrophage chemoattractant protein-1 ; CCL2
- elafin by gene transfer suppressed an inflammatory response in cultured human umbilical vein endothelial cells (HUVEC).
- HUVEC human umbilical vein endothelial cells
- LPS and TNFa were reduced by elafin overexpression.
- elafin overexpression in macrophages attenuated the LPS-stimulated release of the proinflammatory cytokine TNFa. In both cell types these effects were associated with reduced activation of the inflammatory transcription factor NF- ⁇ , through up-regulation of ⁇ [Henriksen et al., 2004].
- elafin has in particular been known to be a highly specific, potent and reversible inhibitor for neutrophil- derived eiastase and proteinase 3. Its activity was shown to be largely restricted to epithelial tissues.
- elafin has been proposed as a suitable agent for the treatment or prevention of e.g. inflammatory diseases which have been shown to be the result of abundant amounts of eiastase, e g. SIRS (systemic inflammation response syndrome) or MODS (multiple-organ dysfunction syndrome).
- SIRS systemic inflammation response syndrome
- MODS multiple-organ dysfunction syndrome
- the heart muscle is composed of millions of contractile cardiomyocytes that are responsible for the pump function of the heart.
- Troponin is a complex of three regulatory proteins (troponin C, troponin I, and troponin T) that is integral to muscle contraction in cardiac muscle.
- Troponin is an intracellular protein complex that is not normally present in the blood serum.
- Troponin I is specific to cardiomyocytes and is useful as a diagnostic marker or therapeutic target for various heart disorders in particular as a highly specific marker for myocardial infarction or heart muscle cell death.
- troponin I Upon cardiomyocyte damage troponin I is released into the circulation with the consequence of loss of contractile function.
- Abnormally high troponin I levels in the blood are indicative of cardiomyocyte damage in a broad variety of cardiac diseases.
- these include instable angina pectoris [Bonaca et al., 2013], heart infarction [Mueller, 2013], myocarditis [Elamm et al., 2012], acute rejection of heart transplants [Labarrere et al., 2000], myocardial infarctions resulting from stent implantation [Zimarino et at., 2011], as well as traumatic surgical procedures, such as coronary artery bypass grafting [Moon et al., 2012],
- Troponin I blood levels exceeding diagnostic cutoff representing the 99th percentile of a reference population are highly indicative for myocardial infarctions [Thomas et al, 2013].
- troponin T is also broadly used and accepted as a marker for damage, both to the heart muscles as well as further muscles.
- leukocyte protease inhibitor attenuates NF-kappa B-dependent inflammatory
- Nickel NP Wang L, Li GG, Spiekerkoetter E., Rabinovitch M.
- the elastase inhibitor elafin restores endothelial cell homeostasis In pulmonary arterial hypertension and attenuates vascular remodeling In the Sugen/hypoxia rat model. Am J Respir Crit Care Med (2013) 187:A1031
- the present invention relates to the use of elafin for the treatment and/or prevention of diseases or disorders which are associated with an increase in troponin I and/or T.
- This rise in troponin I and/or T is not associated with any increase or decrease of elastase activity in said disease or disorder.
- the elafin can be used for the treatment of these diseases, although it was commonly believed that elafin is useful only in the context of those diseases which are associated with an increase in elastase.
- the present invention in a preferred embodiment relates to a method and composition, using elafin, for protecting the heart muscle or other muscles from damage induced by abnormal blood flow, surgery, an accident with muscle damage and/or inflammation, which may result from, for example, a heart infarction.
- Elafin treatment has been shown by the present inventor to lower myocyte damage. This is particularly surprising as this effect has also been shown to be independent of elastase activity. It is even more surprising as the inventor could show that the action of elafin is independent of its well known anti-inflammatory properties which are based on inhibition of elastase and proteinase 3.
- the present invention also relates to the use of elafin for the treatment and/or prevention of diseases or disorders which are associated with a rise in troponin levels (in particular troponin I or T, particularly preferred troponin I) above the 99% percentile of the normal range.
- troponin ! or T has been shown by the present inventors to occur independently from the occurrence of increased elastase activity in subjects with any one of the above disorders.
- troponins as described herein, in particular of cardiac troponin I, is frequently associated with an adverse prognosis. This can be seen not only in e.g. ail types of primary myocardial infarctions but also in secondary myocardial infarctions which occur as a secondary condition following another disease like all those conditions which are associated with an imbalance between myocardial oxygen supply and/or demand, e.g. coronary endothelial dysfunction, coronary artery spasm, coronary embolism, tachy-/brady-arrhythmias, aneamia, respiratory failure, hypotension and hypertension (see e.g. the Third Universal Definition of Myocardial Infarction, Thygesen et al, Eur. Heart J. 2012)
- Coronary artery bypass surgery is a suitable model to investigate the principle of cardiomyocyte protection, as it combines cardiomyocyte damage due to insufficient blood supply during surgery and the consequences of cardiac inflammation as a result of the surgical procedure and reperfusion.
- the present inventor has uncovered that the already well known release of elastase during the surgical procedure can lead only to an increase of enzymatically inactive elastase-alpha-1-proteinase inhibitor complexes, but not to a rise in free enzymaticailv active elastase in the circulation.
- elafin could not be used for a treatment and/or prevention.
- the present inventor was successful in showing that quite clearly, elafin can mediate beneficiary effects via different pathways and can thus also be used for the treatment and/or prevention of such disorders or diseases which are not mediated by or dependent on a rise of active elastase in the circulation.
- elastase activity can be defined as the quantity of enzyme that liberated 1 ⁇ ! of p-nitroaniline in 24 h.
- the activity of elastase can be determined in human serum, as shown e.g. by Nagamatsu et al used the same method as described above.
- Elastase has been used as a marker for disease, in particular heart disease and here in particular as a marker for disorders like SIRS and MODS occurring during or after heart surgery and it is thus well known to the person of skill in the art how to detect elastase activity and how to evaluate the results.
- the references above are explicitly incorporated herein for reference in their entirety, but in particular for those parts describing the elastase substrate and the assay to determine the activity of elastase on said substrate.
- Figure 1 shows an approximate 7-fold increase of circulating complexes of elastase and its physiological inhibitor alpha- 1 -protease inhibitor
- Figure 2 shows that free active elastase did not rise in serum during and after coronary artery bypass surgery.
- Figure 3 depicts that postoperative rises of the pro-inflammatory cytokine IL-6 were not affected by the treatment with elafin.
- Figure 4 depicts that postoperative rises of the C-reactive protein were not affected by the treatment with elafin.
- Figure 5 shows the time course of plasma troponin I after commencement of coronary artery bypass surgery in patients treated with elafin versus placebo (mean, SD).
- Figure 6 depicts that free active eiastase in serum does not correlate with plasma troponin I after coronary artery bypass surgery.
- the present invention is defined preferably as foilows:
- a polypeptide comprising the sequence of SEQ ID NO:1 or homologues, fragments or derivatives thereof, for use in the prevention and/or treatment of disorders or diseases which are associated with cell damage and/or cell death leading to troponin I and/or troponin I release and/or with a rise in plasma troponin I and/ troponin T.
- a polypeptide comprising the sequence of SEQ ID NO:1 or homologues or derivatives, or fragments thereof, for the use of item 1 wherein the rise in troponin I and/or troponin T is not associated with an increase in elastase activity.
- polypeptide for the use of item 1 or 2, wherein the disorders or diseases are additionally not associated with an increase in the serine protease proteinase 3.
- polypeptide for the use of any one of items 1 to 4, wherein the homologues are defined as having a sequence homology of more than 60%, preferably more than 70%, more than 80%, more than 90%, more than 95%, and even more preferably more than 98% compared to the polypeptide shown in SEQ ID NO: 1.
- polypeptide for the use of any one of items 1 - 4, wherein the derivatives differ from the polypeptide shown in SEQ ID NO: 1 or from the homologues and fragments derived therefrom by amino acid modifications, such as glycosylation, PEGylation, biotinylation, cyclization and/or oxidation.
- polypeptide for the use of any one of items 1 - 6, wherein the polypeptide is to be administered parenterally, e.g. intravenously, subcutaneously, by inhalation, intramuscularly or intraarterialiy, preferably intravenously or subcutaneously.
- polypeptide for the use of any one of items 1 - 7, wherein the polypeptide is for a preventive use and is applied as a coating to an implant and/or stent.
- polypeptide for the use of any one of items 1 - 8, wherein the polypeptide is to be administered before, during or shortly after surgery.
- a method/use of reducing cardiomyocyte damage comprising administering to a subject in need thereof a therapeutically effective amount of elafm (e.g. 200 mg) and e.g. a pharmaceutically acceptable carrier.
- elafm e.g. 200 mg
- a pharmaceutically acceptable carrier e.g. a pharmaceutically acceptable carrier.
- the method comprises a further step wherein the troponin I or troponin T level is determined before administration of elafin and/or wherein an elastase activity is determined before the administration of elafin.
- the present polypeptide, homologue, derivative or fragment thereof can be given as a bolus administration before, during or after surgery, without the necessity of repeated administration and will still prevent the outbreak of the described diseases.
- a "bolus” administration in the present context shall mean an administration, which is carried out only once or twice, preferably once, to achieve the desired effect as described above.
- the administration should preferably have a duration of not more than approximately 60 min. (infusion), preferably not more than 30 min.
- the infusion could be continued for up to 12 h, or up to 24 h.
- the actual administration time and dosage regime will be determined by the practitioner and will depend on the remaining muscle damage and/or rise in troponin I and/or T levels.
- the present polypeptide, homologue, derivative or fragment thereof is particularly useful for the preparation of a pharmaceutical composition for the prevention and/or treatment of disorders and/or diseases not associated with an increase of elastase activity.
- the present invention contemplates in a further embodiment the use of the above-described compound for the preparation of wound dressings and/or as an additive to an organ perfusion medium.
- the elafin compound as described above is administered intravenously.
- the elafin compound can be administered subcutaneously.
- administration can be carried out as a preventive administration e.g. before, during or shortly after surgery.
- a preferred administration is before surgery, even more preferred as a bolus (preferably once or twice and more preferred once) intravenously or subcutaneously.
- Before surgery in accordance with the present invention means an administration, which is carried out within 10 hours, preferably 6 hours, even more preferred, 4 hours, further preferred, 2 hours, or most preferred, within 1 min. to one hour before the beginning of surgery, or with the beginning of surgery.
- Shortly after surgery in the present context means a period until no troponin I and/or T release is observable. This can be a period of up to several weeks, e.g. up to 4 weeks, or up to two weeks or of up to up to 1 week after the end of surgery; preferably within 3 days, more preferred, within 2 days and even more preferred within 6 hours after surgery.
- the present invention provides a possibility to prevent an outbreak or ameliorate the severity of the above-mentioned diseases.
- elafin can be used to prevent or treat disorders or diseases associated with muscle damage or muscle cell death, preferably as indicated by a release of troponin I or troponin T or both, and even more preferably without an observable elastase activity or an observable increase in etastase activity.
- the present elafin compound can also be used as an advantageous additive for the preparation of medical devices.
- a medical device would be an organ perfusion medium; similarly said elafin compound could be used for the preparation of a wound dressing, for the preparation of an additive to an organ perfusion medium, for the preparation of a medical sealant, for the preparation of a coating which is suitable for coating an implant or stent and for the implant or stent per se.
- Elafin Compound or “elafin” as used hereinabove and hereinafter is interchangeable and always encompasses the polypeptide comprising the sequence of SEQ ID NO:1 as well as homologues. derivatives or fragments thereof.
- Reference “Troponin” shall encompass in this application troponin T, troponin I, as well as the cardiac or skeletal subtypes thereof, if not explicitly mentioned otherwise.
- An elafin compound will be further characterized in that it comprises the functionality to inhibit the release of troponin I and/or troponin T from muscle cells. This is measurable by testing for troponin levels in patients, as described below.
- An inhibition of troponin release will be assumed e.g. if the level of troponins is rised or is expected to rise above the 99 th percentile or above 0.04 g/ml and lowered by at least 20 %, preferably at least 30 % compared to a situation where no elafin is applied, either preventive or therapeutic.
- An inhibition of troponin release can e.g. also be determined to be present if the level of troponins stay below the 99 th percentile or below 0.04 pg/ml in a condition where muscles have been damaged.
- SEQ ID NO:1 is the following sequence: Ala Gin Glu Pro Val Lys Gly Pro Vai Ser Thr Lys Pro Gly Ser Cys Pro He He Leu He Arg Cys Ala Met Leu Asn Pro Pro Asn Arg Cys Leu Lys Asp Thr Asp Cys Pro Gly He Lys Lys Cys Cys Glu Gly Ser Cys Gly Met Ala Cys Phe Val Pro Gin
- Elafin was first isolated from the skin of patients with psoriasis, an inflammatory skin disease, it is a soluble protein with 57 amino acids and a molecular weight of about 6 kDa. Cloning of the elafin cDNA revealed that it is synthesized as a 12.3 kDa precursor (117 residues) which is processed intracellularly by cleavage of an N-terminal 22 residue signal sequence to give a 9.9 kDa protein called proeiafin (or trappin-2, see below) which is secreted [Molhuizen HO, Alkemade HA, Zeeuwen PL, de Jongh GJ, Wieringa B, Schalkwijk J (1993) SKALP/elafin: an elastase inhibitor from cultured human keratinocytes. Purification, cDNA sequence, and evidence for
- the N- terminal domain contains four repeats of the sequence -Gly-G!n-Asp-X-Val-Lys- (SEQ ID NO:4) which is characteristic of transglutaminase substrates.
- the g!utamine and lysine residues serve as acyl donors and acceptors, respectively, in the transglutaminase-mediated formation of isopeptide inter-protein cross-links [Molhuizen HO, Alkemade HA, Zeeuwen PL, de Jongh GJ, Wieringa B, Schalkwijk J (1993) SKALP/elafin: an elastase inhibitor from cultured human keratinocytes. Purification, cDNA sequence, and evidence for transglutaminase cross-linking. J Biol Chem. 268(16): 12028-32]. This portion of the molecule is often referred to as the cementoin domain. Tissue transglutaminase is able to cross-link proeiafin to a variety of extracellular matrix proteins of the stratum corneum via this domain.
- the second domain consisting of the C-terminal 57 residues, harbours the protease inhibition function of proeiafin and is identical to the 6 kDa soluble form of the molecule, i.e. elafin, originally isolated from psoriatic skin.
- This domain exhibits similarities to members of the whey acidic protein (abbreviated WAP) family in terms of its sequence, protein folding and arrangement of four characteristic disulphide bridges [Tamechika I, Itakura M, Saruta Y, Furukawa M, Kato A, Tachibana S, Hirose S (1996) Accelerated evolution in inhibitor domains of porcine elafin family members. J Biol Chem.
- proeiafin The covalent attachment of proeiafin to extracellular matrix proteins has little effect on its ability to inhibit elastase and proteinase-3 [Guyot N, Zani ML, Maurel MC, Dallet-Choisy S, Moreau T (2005). Elafin and its precursor trappin-2 stili inhibit neutrophil serine proteinases when they are cova!entiy bound to extracellular matrix proteins by tissue transglutaminase, Biochemistry 44, 15610-8], suggesting that transglutamination is a means of immobilizing this protease inhibitor in an active form. The mechanism by which elafin is released from proelafin has not been unequivocally elucidated.
- Proeiafin produced in culture by a type II pneumocyte cell line was processed to elafin only in the presence of serum, indicating that cleavage occurs extracellularly.. possibly prior to immobilization by transglutaminase [Sallenave JM, Silva A (1993) Characterization and gene sequence of the precursor of elafin, an elastase-specific inhibitor in bronchial secretions. Am J Respir Ceil Mol Biol. 8, 439-45]. Consistent with this, tryptase, a mast eel!
- protease was able to selectively release elafin from soluble proelafin [Guyot N, Zani ML, Berger P, Dallet-Choisy S, Moreau T (2005) Proteolytic susceptibility of the serine protease inhibitor trappin-2 (pre-elafin): evidence for tryptase-mediated generation of elafin. Biol Chem. 386, 391-9].
- tryptase was inactive with proelafin cross-linked to fibronectin [Guyot N, Zani ML, Maurel MC, Dallet-Choisy S, Moreau T (2005).
- Elafin and its precursor trappin-2 still inhibit neutrophil serine proteinases when they are covalently bound to extracellular matrix proteins by tissue
- proelafin The biosynthesis of proelafin is regulated at the transcriptional level and is strongly enhanced in response to the presence of epithelial inflammatory diseases, such as lymphocytic alveolitis and psoriasis. Physical injury, infections, irritation and exposure to ultraviolet radiation also induce elafin expression in the skin. Accordingly, proinflammatory stimuli such as the cytokines IL-1 ⁇ and TNFa induce the expression of proelafin and elafin in various cultured cells, including respiratory cells and keratinocytes.
- the invention generally relates to novel uses of polypeptides comprising the sequence depicted in SEQ ID NO: 1 or homologue, derivatives, or fragments of the sequence depicted in SEQ ID NO: 1 , for the treatment of medical conditions for which a use of elafin has not yet been contemplated, as defined above and below.
- elafin can be used for those diseases and/or disorders where no elastase activity or increase in elastase activity is observable.
- no observable elastase activity* or 'no observable increase in elastase activity shall be - for the purposes of this application - the same as "not associated with an increase in active elastase” or “not associated with a rise of active elastase in the circulation” and shall be defined in the context of this application as described above, i.e. based on the well known assay for a detection of elastase activity.
- Elastase activity in the patients' sera is in a preferred embodiment determined by the cleavage of the chromogenic substrate eO-Suc-Ala- Ala-Pro-Val-pNA, as is well known to the person of skill in the art and is described above in more detail.
- neutrophil activation takes place with concomitant release of leukocyte elastase.
- a certain proportion of elastase in human serum remains uninhibited and enzymatically active.
- Myocardial injury leads to a release of troponins into the circulation. This occurs e.g. in ischemic heart diseases, and other diseases which are accompanied by myocardial injuries, such as stable coronary artery disease, chronic heart failure, acute pulmonary embolism, or chronic pulmonary arterial hypertension. Troponin T release is similarly seen in these diseases but also serves as a marker for muscle cell damage in general, i.e. in further parts of the body.
- the terminology "wherein the disorders or diseases are associated or correlated with (celt damage leading to) troponin I (or T) release and/or with a rise in plasma Troponin l(or T)” shall mean in the context of this application that subjects/patients are included which have an elevated troponin (I or T, preferably I, even more preferred cardiac (c) troponin I and/or cardiac (c) troponin T for all disorders involving damage to a cardiac muscle) level above the 99% percentile of the normal range. This is the well established definition of an "elevated troponin level" and is used throughout the medical community.
- cTroponin I is measured by the Abbot Architect assay for troponins.
- the unit of measure is ng/ml.
- the reference range is ⁇ 0.05 g/l.
- a disease or disorder according to this invention can be treated with elafin if it is associated with a cTroponin I level of more than 0.04 pg/ml in an approved troponin-l assay, e.g. the STAT Troponin-I on Architect I by Abbott.
- disorders and/or diseases to be treated or prevented in the context of the present invention are all characterized in that they are not associated with an increase of elastase, as defined above and preferably are additionally associated with cell damage leading to an increase of troponin i (and/or T) in plasma.
- Such diseases encompass:
- the diseases are selected from the group consisting of:
- All of these diseases are characterized by an increase of the troponin I- and/or T-level.
- the term “homologue” refers to peptides or polypeptides which share a substantial degree of homology on the amino acid level with the sequence of SEQ ID NO: 1 over a certain stretch of its primary structure.
- the term “homologue” relates to polypeptides having a sequence (or comprising such sequence) which differs from the sequence depicted in SEQ ID NO: 1 by the substitution (or deletion) of one or more single amino acids.
- any amino acid from the sequence depicted in SEQ ID NO: 1 can be deleted or substituted against another amino acid as long as the inhibitory activity to the troponin rises of the polypeptide is not lost.
- polypeptides are also included which differ from the sequence of SEQ ID NO: 1 by the insertion of one or more additional amino acids. "One or more” in the above context always refers to 1-50, preferably 1-20, even more preferably 1-10, most preferably 1-5.
- the sequence homology of a homologue according to the invention is usually more than 60%, preferably more than 70%, more than 80%, more than 90%, more than 95%, and even more preferably more than 98% compared to the polypeptide shown in SEQ ID NO: 1.
- the degree of amino acid homology may be evaluated by use of suitable computer programs known in the art, such as the GCG program package.
- a degree of homology, which is used throughout this description interchangeably with "identity” can be determined also by hybridization techniques, which are well known to a person skilled in the art.
- Identity may be measured using sequence analysis software (e.g., ClustalW at PBIL (Pole Bioposition Lyonnais) http://npsa- pbii.ibcp.fr).
- Sequence identity or similarity may be determined using standard techniques known in the art, including, but not limited to, the local sequence identity algonthm of Smith & Waterman, Adv. Appl. Math. 2, 82 (1981), by the sequence identity alignment algorithm of Needleman & Wunsch, J. Mol., Biol. 48,443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci.
- the present invention also provides the inventive polypeptides expressed recombinant in a suitable host from a corresponding polynucleotide.
- the present invention particularly provides such polynucleotides, which hybridize under stringent conditions to corresponding polynucleotides.
- stringent conditions means conditions which permit hybridization between polynucleotides sequences and the polynucleotide sequences of SEQ ID NO: 1 where there is at least about 60%, preferably more than 70%, more than 80%, more than 90%, more than 95%, and even more preferably more than 98% identity.
- stringent conditions can be defined by, e. g., the concentrations of salt orformamide in the prehybridization and hybridization solutions, or by the hybridization temperature, and are well known in the art.
- stringency can be increased by reducing the concentration of salt, by increasing the concentration of formamide, and/or by raising the hybridization temperature.
- hybridization under high stringency conditions may employ about 50% formamide at about 37°C to 42°C
- hybridization under reduced stringency conditions might employ about 35% to 25% formamide at about 30°C to 35°C.
- One particular set of conditions for hybridization under high stringency conditions employs 42°C, 50% formamide, 5x SSPE, 0.3% SDS, and 200 pg/ml sheared and denatured salmon sperm DNA.
- similar conditions as described above may be used in 35% formamide at a reduced temperature of 35°C.
- the temperature range corresponding to a particular level of stringency can be further narrowed by calculating the purine to pyrimidine ratio of the nucleic acid of interest and adjusting the temperature accordingly. Variations on the above ranges and conditions are well known in the art.
- homologue also comprises polypeptides which are longer than the sequence of SEQ ID NO: 1 and therefore comprise more amino acids, insofar as a part of their amino acid sequence shares substantial homology with the polypeptide of SEQ ID NO: 1.
- a polypeptide comprising the sequence depicted in SEQ ID NO: 1 which can be used according to the invention is, for example, the preproelafin shown in SEQ ID NO: 2 (Met Arg Ala Ser Ser Phe Leu lie Val Val Val Phe Leu lie Ala Gly Thr Leu Val Leu Glu Ala Ala Val Thr Gly Val Pro Val Lys Gly Gin Asp Thr Val Lys Gly Arg Val Pro Phe Asn Gly Gin Asp Pro Val Lys Gly Gin Val Ser Val Lys Gly Gin Asp Lys Val Lys Ala Gin Glu Pro Val Lys Gly Pro Val Ser Thr Lys Pro Gly Ser Cys Pro lie lie Leu He Arg Cys Ala Met Leu Asn Pro Pro Asn Arg Cys Leu Lys
- preproelafin comprises an additional N-terminal extension on the N-terminus and is post- translationally cleaved to provide the mature form.
- Preproelafin (117 amino acids) is first cleaved in proelafin (95 amino acids) and the N-terminal signal peptide (22 amino acids).
- proelafin becomes cross!inked to cornified envelope proteins by epidermal transglutaminase.
- the mature elafin is apparently released from these cornified envelope proteins by a yet unknown mechanism and can be extracted from horny layers of human skin, particularly from scales of patients suffering from psoriasis.
- fragment refers to any biologically active portion of the polypeptide in
- a fragment of elafin can consist of an amino acid sequence differing from the amino acid sequence in SEQ ID NO: 1 by the deletion of one or more amino acids at the N-terminus and/or C-terminus.
- a fragment according to the invention may lack amino acid residue (s) 1 , 1-2, 1-3, 1-4, 1-5, 1-6, 1-10 or 1-20 at the N-terminus of the polypeptide. Similarly, it may lack the corresponding residues at the C-terminus.
- the elafin fragment can consist of the N-terminus of elafin.
- a fragment may differ from the amino acid sequence in SEQ ID NO: 1 by lacking amino acid residues at both the N-terminus and C-terminus.
- a fragment may consist of amino acids 6-30 of the polypeptide shown in SEQ ID NO: 1.
- derivatives refers to peptides or polypeptides which differ from the polypeptide shown in SEQ ID NO: 1 or from the homologs and fragments derived therefrom by well known amino acid modifications, such as glycosyiation, PEGylation, biotinylation, cyclization and/or oxidation.
- polypeptides of the invention can be obtained as described in the prior art (see, for example, EP 0402068) or can be prepared by recombinant expression of the coding sequence as described by Salienave, J. . and Silva, A (Am. J. Respir. Cell Mol. Biol. 8 (4), 439-445 (1993) ⁇ .
- the coding sequence is also provided in SEQ ID NO: 3 (aggccaagct ggactgcata aagattggta tggccttagc tcttagccaa acaccttcct gacaccatga gggccagcag cttctttgatc gtggtggtgt tcctcatcgc tgggacgctg gttctagagg cagctgtcac gggagttcct gttaaggtc aagacactgt caaaggccgt gtccattca atggacaaga tcccgttaaa ggacaagttt cagttaagg ttcaagataaa gtcaaagcgctccactaagagccagt caaaggtccactccactctaagtccactaagagccag
- the polypeptides, homologues, derivatives and fragments as defined herein may be used as obtained or purified in a known and appropriate manner and formulated into pharmaceutical compositions, for example by admixture with a pharmaceutically acceptable diluent or carrier.
- Administration may be by way of various routes known in the art. In particular, administration may be effected parenterally, for example intra-nasally, intravenously, rectally, pulmonary, and by way of injection such as by way of intramuscular or subcutaneous injection.
- the pharmaceutical compositions will be formulated according to the mode of administration to be employed. For example, when the composition is to be administered by inhalation via the oral route or also e.g. intra-nasally, the composition may be formulated as a powdered aerosol; and when the composition is to be administered by way of injection it may be formulated as a sterile solution or suspension.
- Suitable diluents including aqueous solutions and additives, such as buffers and surfactants may be added.
- compositions of the present invention also include controlled release formulations.
- the polypeptides of the present invention may be encapsulated in a biodegradable polymer, or may be dispersed in a matrix of such a polymer, so that the polypeptide is released as the degradation of the polymer matrix proceeds.
- Suitable biodegradable polymers for use in sustained release formulations include polyesters which gradually become degraded by hydrolysis when placed in an aqueous, physiological environment.
- a particular pharmaceutical composition which provides for extended release of a polypeptide is described in European Patent No. 0058481.
- a polyiactide is employed, and when placed in an aqueous physiological-type environment, the polypeptide is released from the composition in a continuous manner until essentially all of the polypeptide has been released.
- Such polymers therefore offer the advantage of a highly localised target area, thus minimizing dosage and any potential side effects. This is in particular desirable as it is possible to continuously administer the elafirt to the damaged cell area after injury of a muscle. This would apply for example to stents which have been inserted in a surgical procedure whereby this procedure is always accompanied by a certain risk of cell damage. Coating the stent with elafin will enable a continuous release of the elafin and will ensure that disorders associated with cell damage can be treated in a suitable fashion.
- Elafin may be administered systemically or by use of microspheres incorporated e.g. into a medical device, e.g. into a stent or implant, or coated or part of a wound dressing, which release the elafin in a controlled manner.
- the elafin can also be used in the form of elafin-containing polymers that release elafin in a controlled manner.
- the high stability of elafin to ethylene oxide sterilization is a further important aspect for its therapeutic application in this context, especially if is to remain active as a slow release drug or as a component in a medical device coating.
- the biocompatibility of elafin has been proven.
- Plasma levels of immunoreactive elastase were quantified with a human elastase ELISA kit (Hycult, Uden, Netherlands) according to the instructions of the manufacturer.
- the human neutrophil elastase ELISA has been developed for the quantitative measurement of free and bound natural human neutrophil elastase in plasma with a lower detection level of 0.4 ng/ml.
- the human neutrophil Eiastase ELISA is a solid-phase enzyme-linked immunosorbent assay based on the sandwich principle. Samples and standards were captured by a solid bound specific antibody.
- Captured human neutrophil eiastase was detected by a biotinylated tracer antibody, a streptavidin-peroxidase conjugate binding to the biotinylated tracer antibody, and peroxidase catalyzed reaction with tetramethylbenzidine.
- the enzyme reaction was stopped by the addition of oxalic acid.
- the absorbance at 450 nm was measured with a spectrophotometer.
- a standard curve was obtained by plotting the absorbance versus the corresponding concentrations of the human neutrophil eiastase standards.
- the human neutrophil eiastase concentration of samples, which were run concurrently with the standards, were determined from the standard curve.
- Human eiastase hydropses the synthetic substrate MeO-Suc-Ala-Ala-Pro-Val-pNA and releases the yellow dye p- nitroaniline.
- the degree of p-nitroaniline release was quantified spectrophotometrically and used to determine the enzymatic activity of human neutrophil eiastase.
- the neutrophil eiastase activity Units represent delta OD 405 nm after 24 hour reaction at 37°C.
- Serum levels of interieukin 6 were determined by the use of a Human Interieukin 6 Immunoassay (R&D Systems Europe, Abingdon, UK) according to the instructions of the manufacturer. This assay employs the quantitative sandwich enzyme immunoassay technique.
- a monoclonal antibody specific for IL-6 has been pre-coated onto a microplate. Interieukin 6 standards and samples were pipetted into wells and any IL-6 present was bound by an immobilized antibody. After washing away any unbound substances, an enzyme-linked polyclonal antibody specific for IL-6 was added to the wells. Following a wash to remove any unbound antibody-enzyme reagent, a substrate solution was added to the wells. After an incubation period, an amplifier solution was added to the wells and color developed in proportion to the amount of IL-
- Plasma cTroponin I concentrations were quantified with the Abbott Architect highly-sensitive assay (Abbott Laboratories, ILL) according to the manufacturers instructions. This assay has a sensitivity of 0.01 ng/mL or less, with a 10% coefficient of variation of 0.032 ng/mL and a 99th percentile (male and female) of 0.012 ng/mL.
- cTroponin i is a regulatory protein of cardiomyocyte contraction and its presence in blood plasma is a specific indication of cardiomyocyte injury.
- the cardiovascular damage was therefore assessed by troponin I release from cardiomyocytes.
- the plasma level of troponin I a regulatory protein of cardiomyocyte contraction, is a specific marker for myocardial damage.
- Patients treated with eiafin at the start of surgery showed a significant reduction of troponin I release 6 hours after commencement of surgery and an overall reduction of the troponin I release over 48 hours (area under the curve) of 20 - 40%.
- elafin treatment lowers cardiomyocyte damage.
- the mechanism is independent of its well known antiinflammatory properties which are based on inhibition of eiastase and proteinase 3.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Epidemiology (AREA)
- Zoology (AREA)
- Neurology (AREA)
- Urology & Nephrology (AREA)
- Physical Education & Sports Medicine (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Transplantation (AREA)
- Pulmonology (AREA)
- Hospice & Palliative Care (AREA)
- Rheumatology (AREA)
- Pain & Pain Management (AREA)
- Vascular Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Materials For Medical Uses (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2017511942A JP2017530954A (ja) | 2014-08-26 | 2015-08-24 | トロポニンのエラスターゼから独立した増加と関連する障害のためのエラフィンの使用 |
| EP15756141.6A EP3185892B1 (en) | 2014-08-26 | 2015-08-24 | Use of elafin for disorders associated with elastase independent increase in troponin |
| US15/506,481 US20180221462A1 (en) | 2014-08-26 | 2015-08-24 | Use of elafin for disorders associated with elastase independent increase in troponin |
| US16/404,441 US20190255158A1 (en) | 2014-08-26 | 2019-05-06 | Use of elafin for disorders associated with elastase independent increase in troponin |
| US17/554,486 US20220133867A1 (en) | 2014-08-26 | 2021-12-17 | Use of elafin for disorders associated with elastase independent increase in troponin |
| US17/557,874 US20220111021A1 (en) | 2014-08-26 | 2021-12-21 | Use of elafin for disorders associated with elastase independent increase in troponin |
| US18/084,456 US20230285524A1 (en) | 2014-08-26 | 2022-12-19 | Use of elafin for disorders associated with elastase independent increase in troponin |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE102014216985 | 2014-08-26 | ||
| DE102014216985.2 | 2014-08-26 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/506,481 A-371-Of-International US20180221462A1 (en) | 2014-08-26 | 2015-08-24 | Use of elafin for disorders associated with elastase independent increase in troponin |
| US16/404,441 Continuation US20190255158A1 (en) | 2014-08-26 | 2019-05-06 | Use of elafin for disorders associated with elastase independent increase in troponin |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016030323A1 true WO2016030323A1 (en) | 2016-03-03 |
Family
ID=54011022
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2015/069341 Ceased WO2016030323A1 (en) | 2014-08-26 | 2015-08-24 | Use of elafin for disorders associated with elastase independent increase in troponin |
Country Status (4)
| Country | Link |
|---|---|
| US (5) | US20180221462A1 (enExample) |
| EP (1) | EP3185892B1 (enExample) |
| JP (1) | JP2017530954A (enExample) |
| WO (1) | WO2016030323A1 (enExample) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4125988A4 (en) * | 2020-03-26 | 2024-04-24 | The Regents of University of California | DETECTION AND TREATMENT OF INTESTINAL FIBROSIS |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20190060506A1 (en) * | 2017-08-22 | 2019-02-28 | The Board Of Trustees Of The Leland Stanford Junior University | Elafin Incorporated Biomaterials for the Treatment of Chronic Tissue Ulcers |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999043308A2 (en) * | 1998-02-27 | 1999-09-02 | Marlene Rabinovitch | Treating pulmonary hypertension through tenascin suppression and elastase inhibition |
| WO2003090682A2 (en) * | 2002-04-25 | 2003-11-06 | The Scripps Research Institute | Treatment and prevention of pulmonary conditions |
| WO2011107505A1 (en) * | 2010-03-03 | 2011-09-09 | Proteo Biotech Ag | Novel uses of elafin |
-
2015
- 2015-08-24 US US15/506,481 patent/US20180221462A1/en not_active Abandoned
- 2015-08-24 JP JP2017511942A patent/JP2017530954A/ja active Pending
- 2015-08-24 WO PCT/EP2015/069341 patent/WO2016030323A1/en not_active Ceased
- 2015-08-24 EP EP15756141.6A patent/EP3185892B1/en active Active
-
2019
- 2019-05-06 US US16/404,441 patent/US20190255158A1/en not_active Abandoned
-
2021
- 2021-12-17 US US17/554,486 patent/US20220133867A1/en not_active Abandoned
- 2021-12-21 US US17/557,874 patent/US20220111021A1/en not_active Abandoned
-
2022
- 2022-12-19 US US18/084,456 patent/US20230285524A1/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999043308A2 (en) * | 1998-02-27 | 1999-09-02 | Marlene Rabinovitch | Treating pulmonary hypertension through tenascin suppression and elastase inhibition |
| WO2003090682A2 (en) * | 2002-04-25 | 2003-11-06 | The Scripps Research Institute | Treatment and prevention of pulmonary conditions |
| WO2011107505A1 (en) * | 2010-03-03 | 2011-09-09 | Proteo Biotech Ag | Novel uses of elafin |
Non-Patent Citations (8)
| Title |
|---|
| A. W. BAROLET ET AL: "Arterial Elastase Activity After Balloon Angioplasty and Effects of Elafin, an Elastase Inhibitor", ARTERIOSCLEROSIS, THROMBOSIS, AND VASCULAR BIOLOGY., vol. 21, no. 8, 1 August 2001 (2001-08-01), US, pages 1269 - 1274, XP055219753, ISSN: 1079-5642, DOI: 10.1161/hq0801.093589 * |
| ALAM SHIRJEL R ET AL: "Role of the endogenous elastase inhibitor, elafin, in cardiovascular injury From epithelium to endothelium", BIOCHEMICAL PHARMACOLOGY, vol. 83, no. 6, 2012, pages 695 - 704, XP028890393, ISSN: 0006-2952, DOI: 10.1016/J.BCP.2011.11.003 * |
| ANONYM: "Elafin granted second FDA orphan drug designation", 22 March 2013 (2013-03-22), XP002745733, Retrieved from the Internet <URL:https://integrity.thomson-pharma.com/integrity/xmlxsl/pk_ref_list.xml_show_ficha_ref?p_ref_id=1961448> [retrieved on 20151009] * |
| COWAN B ET AL: "Elafin, a serine elastase inhibitor, attenuates post-cardiac transplant coronary arteriopathy and reduces myocardial necrosis in rabbits afer heterotopic cardiac transplantation", JOURNAL OF CLINICAL INVESTIGATION, AMERICAN SOCIETY FOR CLINICAL INVESTIGATION, US, vol. 97, no. 11, 1 June 1996 (1996-06-01), pages 2452 - 2468, XP009172925, ISSN: 0021-9738 * |
| KUNIO OHTA ET AL: "Elafin-overexpressing mice have improved cardiac function after myocardial infarction", AMERICAN JOURNAL OF PHYSIOLOGY - HEART AND CIRCULATORY PHYSIOLOGY, 1 July 2004 (2004-07-01), United States, pages 286 - 292, XP055219351, Retrieved from the Internet <URL:http://ajpheart.physiology.org/content/287/1/H286.full.pdf> DOI: 10.1152/ajpheart.00479.2002 * |
| LEE SHAW ET AL: "Therapeutic potential of human elafin: Figure 1", BIOCHEMICAL SOCIETY TRANSACTIONS, vol. 2, no. 5, 1 October 2011 (2011-10-01), GB, pages 749 - 1454, XP055219347, ISSN: 0300-5127, DOI: 10.1093/ndt/gfq041 * |
| O'BLENES S B ET AL: "Gene transfer of the serine elastase inhibitor elafin protects against vein graft degeneration", CIRCULATION, LIPPINCOTT WILLIAMS & WILKINS, US, vol. 102, no. 19, 7 November 2000 (2000-11-07), pages III.289 - III.295, XP002350040, ISSN: 0009-7322 * |
| S. H.E. ZAIDI: "Overexpression of the Serine Elastase Inhibitor Elafin Protects Transgenic Mice From Hypoxic Pulmonary Hypertension", CIRCULATION, vol. 105, no. 4, 29 January 2002 (2002-01-29), US, pages 516 - 521, XP055219355, ISSN: 0009-7322, DOI: 10.1161/hc0402.102866 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4125988A4 (en) * | 2020-03-26 | 2024-04-24 | The Regents of University of California | DETECTION AND TREATMENT OF INTESTINAL FIBROSIS |
Also Published As
| Publication number | Publication date |
|---|---|
| US20220133867A1 (en) | 2022-05-05 |
| US20230285524A1 (en) | 2023-09-14 |
| EP3185892A1 (en) | 2017-07-05 |
| US20220111021A1 (en) | 2022-04-14 |
| US20190255158A1 (en) | 2019-08-22 |
| EP3185892B1 (en) | 2020-02-12 |
| US20180221462A1 (en) | 2018-08-09 |
| JP2017530954A (ja) | 2017-10-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8541236B2 (en) | Mutant apolipoprotein A-1 polypeptide with increased resistance to oxidation and reactive carbonyls | |
| US20230285524A1 (en) | Use of elafin for disorders associated with elastase independent increase in troponin | |
| US20140287985A1 (en) | Novel uses of elafin | |
| KR20140011372A (ko) | 인공 표면과의 접촉을 포함하는 의료 시술에 투여하기 위한 인자 xii 억제제 | |
| CA2802072A1 (en) | Treatment of coagulopathy with hyperfibrinolysis | |
| US20100210531A1 (en) | Agents with angiogenic and wound healing activity | |
| US20100330028A1 (en) | Combination therapy for chronic dermal ulcers | |
| US20030228283A1 (en) | Preventing secondary lymphedema with VEGF-D DNA | |
| CA2709337A1 (en) | Haemostasis- modulating compositions and uses therefor | |
| US20040203102A1 (en) | Antiplasmin cleaving enzyme | |
| AU2017238309A1 (en) | CD31SHED agonists for use in the prevention and/or treatment of reperfusion injury | |
| JP2007513881A (ja) | Xi因子の治療学的使用 | |
| AU745017B2 (en) | Method of inhibiting smooth muscle cell proliferation | |
| US20030199441A1 (en) | Procollagen (III) Propeptides and Related Substances for Treating Fibrotic Diseases | |
| DK175408B1 (da) | Isohirudiner, fremgangsmåde til deres fremstilling, pharmaceutisk middel samt fremgangsmåde til dets fremstilling | |
| US20030220253A1 (en) | Inhibitors for use in hemostasis | |
| US10837007B2 (en) | Recombinant fusion proteins for preventing or treating adhesions of tissues or organs | |
| JP2008542265A (ja) | 細胞核に侵入する組成物 | |
| CA2530866A1 (en) | Methods and compositions for treating disorders of the extracellular matrix | |
| JP2007537153A (ja) | 細胞外基質蓄積の治療または防止 | |
| Ann Buczek-Thomas et al. | Elastase Mediates the Release of Growth Factors from LungIn Vivo | |
| WO2019178526A1 (en) | Recombinant smnpp5 and methods of use | |
| WO2005059170A2 (en) | Method for the determination of fibrinolytic activity in blood | |
| MXPA06005477A (en) | Therapeutic use of factor xi | |
| EP2579890A1 (en) | Treatment of coagulopathy with hyperfibrinolysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15756141 Country of ref document: EP Kind code of ref document: A1 |
|
| REEP | Request for entry into the european phase |
Ref document number: 2015756141 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2015756141 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2017511942 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15506481 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |