WO2015190857A1 - 효소를 이용하여 ｐＨ를 조절하는 무세포 단백질 합성 방법 - Google Patents

효소를 이용하여 ｐＨ를 조절하는 무세포 단백질 합성 방법 Download PDF

Info

Publication number
WO2015190857A1
WO2015190857A1 PCT/KR2015/005910 KR2015005910W WO2015190857A1 WO 2015190857 A1 WO2015190857 A1 WO 2015190857A1 KR 2015005910 W KR2015005910 W KR 2015005910W WO 2015190857 A1 WO2015190857 A1 WO 2015190857A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
protein synthesis
free protein
enzyme
decarboxylase
Prior art date
Application number
PCT/KR2015/005910
Other languages
English (en)
French (fr)
Inventor
김동명
강택진
김호철
이기백
Original Assignee
충남대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충남대학교산학협력단 filed Critical 충남대학교산학협력단
Publication of WO2015190857A1 publication Critical patent/WO2015190857A1/ko
Priority to US15/374,168 priority Critical patent/US10088493B2/en

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/84—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving inorganic compounds or pH
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/02—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length in solution
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures

Definitions

  • the present invention relates to a cell-free protein synthesis method using an enzyme to adjust the pH, and more particularly, by adjusting the pH decrease using amino acid decarboxylases, the amount of cell-free protein synthesis
  • the present invention relates to a cell-free protein synthesis method that can be used for active screening without increasing the synthesis protein.
  • cell-free protein synthesis extracts only intracellular protein synthesis machinery and its factors related to protein production in cells, and excludes physiological control mechanisms from outside the cell.
  • the required protein biosynthesis mechanisms such as ribosomes, initiators, kidney factors, terminators, aminoacyl tRNA synthetases, etc. It can be used in addition to or included separately in the solution (Yoshihiro Shimizu et. Al, 2001, Nature Biotechnology, 19 (8): 751-755; Tae-Wan Kim et. Al, 2006, Journal of Biotechnology, 126 (4): 554-561).
  • the buffer solution used for pH control is not removable after cell-free protein synthesis, when analyzing the activity of the enzyme synthesized by the cell-free synthesis reaction based on pH, the buffer solution included in the synthesis solution Since it is included in the activity assay solution, it is possible to suppress the pH change due to the enzyme activity, which makes it difficult to accurately analyze the enzyme activity.
  • Korean Patent No. 0749053 discloses a cell-free protein synthesis method
  • Korean Patent No. 0733712 discloses preparation of a cell extract for cell-free protein synthesis and a protein synthesis method using the same.
  • Korean Patent No. 1229849 A method for improving protein expression yield of a cell-free protein synthesis system by adding an antifoaming agent has been disclosed, but no technique has been reported to solve the above problem.
  • the present invention is derived from the above requirements, by confirming that a cell-free protein synthesis can be efficiently carried out by controlling the pH using a mutated amino acid decarboxylase in the cell-free protein synthesis process, Completed.
  • the present invention provides a cell-free protein synthesis method characterized in that the pH is adjusted by adding an enzyme to the cell-free protein synthesis reaction solution.
  • the present invention also provides a library of proteins synthesized by the cell-free protein synthesis method.
  • the present invention also provides a method for screening an active protein using a protein library synthesized by the cell-free protein synthesis method.
  • the present invention relates to a cell-free protein synthesis method characterized by adjusting the pH using an enzyme, when a cell-free protein synthesis using glutamic acid decarboxylase (GAD) and glutamic acid, cell-free protein reaction As this progresses, glutamic acid is consumed and depleted, and the cell-free synthesis reaction solution after the enzyme synthesis reaction becomes a pH-Buffer-Free state. Therefore, if a part of the cell-free protein synthesis reaction solution is taken and analyzed for the activity of the enzyme contained in the cell-free protein synthesis reaction solution, there is no factor that inhibits the pH change, thereby enabling a highly sensitive enzyme activity analysis.
  • GAD glutamic acid decarboxylase
  • Figure 1 shows the concentration of sfGFP synthesis ( ⁇ g / ml) according to the concentration of the chemical buffer (HEPES buffer) (- ⁇ -57mM,- ⁇ -118mM,- ⁇ -179mM and- ⁇ -240mM) in cell-free protein synthesis (A ) And the pH reduction degree (B).
  • HEPES buffer chemical buffer
  • Figure 2 is a graph showing the average expression of sialic acid transfer enzyme (ST) obtained by the synthesis of cell-free protein under the conditions of 240mM buffer (HEPES buffer).
  • ST sialic acid transfer enzyme
  • Figure 3 is a graph confirming the pH change control effect (A) and the expression level of sfGFP protein under each condition by glutamic acid decarboxylase when cell-free protein synthesis under 57mM buffer (HEPES buffer) conditions.
  • -X-Control is a control, without glutamic acid decarboxylase added
  • - ⁇ -WT GAD is the addition of wild type glutamic acid decarboxylase
  • H465A is the addition of a mutant wild type glutamic acid decarboxylase in which the 465th histidine is replaced with alanine
  • ⁇ 465-466 is the addition of the mutant glutamic acid decarboxylase deleted from the 465th histidine and the 466th threonine
  • Glu89Gln / ⁇ 465-466 is the 89th glutamic acid substituted with glutamine and the 465th histidine and 466th threonine are added to the mutant glutamic acid decarboxylase. It
  • FIG. 4 shows the expression of sfGFP protein according to the concentration of the mutated glutamic acid decarboxylase in which the 89th glutamic acid is substituted with glutamine and the 465th histidine and 466 threonine are deleted. It is a graph showing the quantity.
  • FIG. 5 is a graph comparing the time-dependent change in pH and protein expression in cell-free protein synthesis using 1.6 mg / ml GAD (Glu89Gln / ⁇ 465-466) and 240 mM buffer (HEPES-KOH).
  • Figure 6 is a graph confirming the glutamic acid exhaustion time by acellular protein synthesis for each initial concentration of glutamic acid.
  • Figure 7 is a view showing the assay process for analyzing the activity of the cell-free protein synthesis and synthesized enzyme using the library production, amino acid decarboxylase of the present invention.
  • FIG. 8 is a diagram illustrating a cell-free protein synthesis process using glutamic acid decarboxylase and glutamic acid according to an embodiment of the present invention.
  • WT is a wild type sialic acid transfer enzyme
  • No DNA is a control group that was subjected to cell-free protein synthesis except DNA.
  • FIG. 10 is a schematic diagram of PCR conditions for preparing a gene library of sialic acid transfer enzyme.
  • Figure 11 is a graph showing the screening results of the active sialic acid transfer enzyme utilizing a cell-free protein synthesis system.
  • the present invention provides a cell-free protein synthesis method characterized in that the pH is adjusted by adding an enzyme to the cell-free protein synthesis reaction solution.
  • the cell-free protein synthesis reaction solution may include cell extracts, genes, energy sources, buffer solutions, amino acids, and the like, and may further include amino acids such as glutamic acid, arginine, and lysine to be used as substrates of enzymes.
  • the enzyme is an amino acid decarboxylase, and the amino acid decarboxylase is decomposed to generate carbon dioxide and amines corresponding to each amino acid by releasing CC bonds by acting on various amino acids. It is an enzyme.
  • Preferred amino acid decarboxylase include glutamate decarboxylase (EC 4.1.1.15), arginine decarboxylse (EC 4.1.1.19), lysine decarboxylase , EC 4.1.1.18), aspartate 4-decarboxylse (EC 4.1.1.12), valine decarboxylse (EC 4.1. 1.14), histidine decarboxylase aromatic L-amino acid decarboxylase (aromatic-L-amino acid) acting on (histidine decarboxylse, EC 4.1.1.22), tyrosine decarboxylse (EC 4.1.1.25), phenylalanine, tryptophan, tyrosine, etc.
  • glutamate decarboxylase EC 4.1.1.15
  • arginine decarboxylse EC 4.1.1.19
  • lysine decarboxylase EC 4.1.1.18
  • aspartate 4-decarboxylse
  • decarboxylase EC 4.1.1.28
  • phenylalanine decarboxylase EC 4.1.1.53
  • methionine decarboxylase EC 4.1. 1.57
  • glutamic acid decarboxylase glutamate decarboxylase, EC 4.1.1.15
  • at least one selected from arginine decarboxylase EC 4.1.1.19
  • lysine decarboxylase EC 4.1.1.18
  • SEQ ID NO: 1 Glutamic acid decarboxylase characterized in that the 89th glutamic acid of the amino acid sequence is substituted with glutamine and the amino acids 465 and 466 are deleted, but not limited thereto, and some amino acid residues of the amino acid decarboxylase May be substituted, deleted or inserted and may include amino acid residues in modified forms such as phosphorylation or methylation.
  • the pH is preferably not lowered to 6.5 or less, more preferably to 6.5 to 8.0.
  • the amino acid decarboxylase is to adjust the pH by removing hydrogen ions generated when regenerating ATP from the carbon source
  • the carbon source is preferably at least one selected from monosaccharides, disaccharides, polysaccharides, polyhydric alcohols and organic acids, more preferably Preferably but not limited to glucose.
  • the present invention also provides a protein library synthesized by the cell-free protein synthesis of the present invention.
  • the protein library is preferably, but not limited to, a sialic acid transferase protein library.
  • the sialic acid transfer enzyme is an enzyme that attaches sialic acid to the sugar chain structure terminal of the glycoprotein, and sialic lactose and sialyl oligosaccharides derived from the enzyme are capable of supplying sialic acid to body tissues, skin, and tofu. It also serves as a major source.
  • the present invention also provides a method for screening an active protein, characterized by screening for an active protein against a protein library synthesized by the cell-free protein synthesis method of the present invention.
  • the protein library can be screened without purification.
  • BL21 (DE3) derived from E. coli was inoculated in 5 ml of LB medium and incubated at 37 ° C for 12 hours. Subsequently, it was passaged in 40 ml of 2xYTPG medium overnight at 37 °C, inoculated in a fermenter containing 4L of 2xYTPG medium and incubated at the same temperature. When the absorbance (OD 600 ) reached 0.6, 1 mM isopropylthio- ⁇ -D-galactoside (IPTG) was finally added to the fermenter to express T7 RNA polymerase, and the absorbance (OD 600 ) was 4.5. When the cell culture was stopped, the cell pellet was collected from the medium by centrifugation (4,500 rpm, 15 minutes, 4 ° C).
  • the recovered E. coli 20mM buffer solution A [10mM Tris-acetate buffer (pH 8.2), 14mM magnesium acetate, 60mM potassium glutamate, 1mM dithiothreitol (DTT), 0.05% (v / v) 2-mercaptoethanol (2- ME)] was added and washed well three times.
  • the cell-free protein synthesis reaction was placed in a small test tube of 1.75 ml and reacted in a constant temperature water bath at 30 ° C.
  • Quantification of the active sfGFP was determined by measuring fluorescence using a VICTOR X3 multilabel plate reader (Perkin-Elmer, Waltham, MA). The size of the produced sfGFP was confirmed by Coomassie blue-stained Tricine-SDS-PAGE gels.
  • the gene sequence of wild type GAD enzyme and mutant GAD (Glu89Gln / ⁇ 465-466) were cloned into pET28b vector and transformed into E. coli BL21 (DE3). Each of these cells was incubated under a temperature of 37 ° C. in 500 ml of LB medium containing 50 ⁇ g / ml of kanamycin, and 1 mM IPTG was added when the OD 600 reached 2.5 to express GAD. gave. After incubation for two more hours under the same conditions, cells were harvested and washed with Buffer A. Thereafter, the cell mass was released with buffer B, and then crushed at a pressure of 12,000 psi using a French Pressure Cell Press, and the supernatant was recovered by centrifuging at 30,000 rc for 30 minutes at 4 ° C.
  • the recovered supernatant was separated and purified using Ni-NTA agarose beads (Qiagen) and concentrated using Buffer B to VIVA-spin 20 (MWCO 10 kDa, Sartorius). Thereafter, the concentration of the protein was measured by the Bradford method and stored at ⁇ 80 ° C. until use.
  • the concentration of the chemical buffer solution (HEPES buffer) was increased, the deceleration range of the pH was decreased and the amount of protein synthesis was increased.
  • the concentration of the buffer (HEPES buffer) was optimized to 240mM or less in order to maintain the 6.5 level of the minimum pH condition in the reaction using excess glucose (80mM).
  • Cell-free protein synthesis was carried out in a buffer condition of 240 mM, and it was confirmed that about 2 mg / ml of sfGFP protein was obtained.
  • sialic acid transferase 96 cells of sialic acid transferase gene library were used to perform cell-free protein synthesis under the conditions of the optimized 240 mM buffer solution.
  • the sialic acid transfer enzyme was isolated and purified to confirm the availability of the activity analysis, and in the case of the isolated purification, the change in color was observed according to the activity of the protein.
  • Example 1 it was confirmed that a buffer mechanism that does not interfere in the activity assay is required while controlling the pH change in the cell-free protein synthesis reaction.
  • the amino acid decarbocylase was used as a buffering mechanism that regulates the pH change in the cell-free protein synthesis reaction and does not interfere in the activity assay.
  • Example 2 glutamic acid decarboxylase (GAD) was used to remove hydrogen ions produced by glycolysis of the cell extract.
  • GAD glutamic acid decarboxylase
  • One molecule of glutamic acid is converted to one molecule of derived amino acid ( ⁇ -aminobutyric acid) through the enzyme, and serves to remove the same mole number of hydrogen ions. Therefore, when GAD and glutamic acid are added to the cell-free protein synthesis solution, hydrogen ions generated during the regeneration of ATP are removed, thereby maintaining a stable pH.
  • E. coli-derived GAD is determined by the role of some specific amino acid residues.
  • glutamic acid the 89th amino acid of E. coli GAD
  • glutamine can be substituted with glutamine to be active even at a neutral pH range.
  • histidine and threonine the 465th and 466th amino acids
  • the effects of these mutations were applied together to produce mutated GADs (Glu89Gln / ⁇ 465-466) that are active at near-neutral pH and over a wide range of pH.
  • Example 2 the effect of pH change control and the expression level of sfGFP protein by glutamic acid decarboxylase (GAD) in acellular protein synthesis were confirmed.
  • GAD glutamic acid decarboxylase
  • the initial concentration of 166mM glutamic acid contained in the reaction solution is exhausted during the reaction of 6 hours to form a buffer-free condition (Fig. 6). Therefore, when using the 166mM glutamic acid as the initial concentration it was found that the cell-free protein synthesis time is preferably performed up to 6 hours. After 6 hours, the addition of glutamic acid is not ruled out, and the cell-free protein synthesis reaction time can be extended by appropriately adjusting the concentration of glutamic acid.
  • Example 3 as described in FIG. 7, the assay was performed to prepare a library of sialic acid transfer enzyme, to synthesize acellular protein using amino acid decarboxylase, and to analyze the activity of the synthesized enzyme. .
  • Example 3 expresses 10,000 different gene libraries and screens the activity of expressed proteins in a cell-free protein synthesis method characterized in that pH is controlled using glutamic acid decarboxylase (GAD) and glutamic acid. (FIG. 8).
  • GAD glutamic acid decarboxylase
  • FIG. 8 glutamic acid
  • Randomized 265th threonine (Th), 313th arginine (Arg) and 357th threonine (Th) codons of the amino acid sequence of SEQ ID NO: 2 were prepared by PCR technique to produce a gene library of sialic acid transferase.
  • the primers used were shown in Table 1. Three amino acid positions were selected from the sites predicted as the active site of the sialic acid transfer enzyme to prepare a randomly mutated gene library and to express the mutated genome whose enzyme activity was increased compared to the wild type.
  • FIG. 10 Conditions such as temperature and time of performing PCR are shown in FIG. 10.
  • the gene produced by PCR was cloned into pIVEX2.3d vector and replaced with different gene sequences at positions 265 th threonine (Th), 313 th arginine (Arg) and 357 th threonine (Th).
  • Colonies were obtained to prepare libraries. 10,000 colonies were taken from the library using colony collectors (K3, K biosystems) and seeded into 96 well plates containing 200 ⁇ l of LB medium. The obtained 10 4 96 well plates were incubated by stirring at 37 ° C. for 15 hours.
  • the cultured cells were transferred 1.5 ⁇ l into 26 384 well plates containing 23.5 ⁇ l of PCR reaction solution, and each gene amplified by PCR contained 19.5 ⁇ l of cell-free protein synthesis reaction solution. 3.0 ⁇ l each was transferred to 384 well plates. The plate was subjected to cell-free protein synthesis for 3 hours in a stirrer at 30 ° C. with high humidity.
  • the reaction solution contained in the sialic acid transferase library prepared in Example 3 was diluted three-fold with 5 mM Tris-Cl (pH 8.5) solution, followed by 58.5 ⁇ l of the 1.8 ⁇ l diluted solution. It was transferred to a 384 well plate containing an active screening solution (5 mM Tris-Cl pH 8.5, 4 mM CMP-NeuAc, 0.4 mM cresol-red, 4 mM lactose) and left at room temperature for 15 minutes. The OD 600 value of the library was measured with a plate reader (Victor 3, PerkinElmer) to select the specimen with the highest absorbance. The process of transferring the solution in all of the above steps is based on an automated liquid handling system (JANUS). Automated Workstation, PerkinElmer).
  • sialic acid transfer enzymes As shown in FIG. 11, it was possible to identify sialic acid transfer enzymes with markedly increased activity through expression of sialic acid transfer enzymes and screening of active protein from about 10,000 genes.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Inorganic Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 효소를 이용하여 pH를 조절하는 것을 특징으로 하는 무세포 단백질 합성 방법에 관한 것으로, 더욱 상세하게는 아미노산 탈카르복실화 효소를 이용하여 ATP의 재생 시 생성되는 수소이온을 제거함으로써, pH를 조절하는 것을 특징으로 하는 무세포 단백질 합성 방법에 관한 것이다. 본 발명의 무세포 단백질 합성 방법은 단백질의 발현량을 향상시킬 뿐만 아니라 발현된 단백질의 분리정제 없이 바로 활성분석에 활용할 수 있는 이점이 있다.

Description

효소를 이용하여 ｐＨ를 조절하는 무세포 단백질 합성 방법
본 발명은 효소를 이용하여 pH를 조절하는 무세포 단백질 합성 방법에 관한 것으로, 더욱 상세하게는 아미노산 탈카르복실화 효소(amino acid decarboxylases)를 이용하여 pH 저하를 조절함으로써, 무세포 단백질 합성량을 증가시킬 뿐만 아니라 합성된 단백질을 분리정제하지 않고 활성형 스크리닝에 활용할 수 있는 무세포 단백질 합성 방법에 관한 것이다.
일반적으로 무세포 단백질 합성(cell-free protein synthesis)은 세포에서 단백질 생산에 관련되는 세포 내 단백질 합성기구와 이의 인자들만을 추출하여 세포 외부에서 세포의 생리적 조절 기작이 배제된 상태로 단백질의 합성 과정만을 인위적으로 반복시켜 단기간에 목적 단백질을 대량 생산하는 기술로서, 요구되는 단백질 생합성 기구 즉, 리보좀, 개시인자, 신장인자, 종결인자, 아미노아실티알엔에이(aminoacyl tRNA) 합성효소 등은 세포의 파쇄액에 포함된 것을 이용하거나 별개로 추가하여 사용할 수 있다(Yoshihiro Shimizu et. al, 2001, Nature Biotechnology, 19(8):751-755; Tae-Wan Kim et. al, 2006, Journal of Biotechnology, 126(4):554-561).
단백질 합성 기구들에 의한 DNA의 전사 및 번역 반응은 지속적인 ATP의 공급이 요구되므로 무세포 단백질 합성용액에는 ATP의 재생을 위한 메커니즘이 필요하다. 전통적으로 ATP의 재생을 위해 사용되는 아세틸포스페이트(acetyl phosphate), 크레아틴인산(creatine phosphate) 또는 포스포에놀피루베이트(phosphoenolpyruvate; PEP) 등의 물질들은 ATP의 재생 효율이 낮을 뿐만 아니라 무기 인산(inorganic phosphate)을 축적하여 단백질 합성 효율이 저하되는 문제점이 있다는 것이 제기되어 왔다.
최근에 이와 같은 문제점을 해소하기 위하여 Swartz 등은 무세포 단백질 합성 반응에 요구되는 ATP의 재생 물질로 포도당을 사용함으로써 장시간 동안 ATP의 공급을 원활하게 하여 높은 생산성의 무세포 단백질 합성이 가능함을 보였으며, 포도당과 같은 저가의 에너지원을 ATP의 재생에 이용함으로써 무세포 단백질 합성 반응의 생산성과 경제성을 크게 향상시킬 수 있음을 입증하였다(Kara A. Calhoun et. al, 2005, Biotechnology Progress, 21(4):1146-1153). 포도당은 세포 추출액 내에 존재하는 효소들에 의하여 이화작용과 산화적 인산화(oxidative phosphorylation)의 과정을 거치면서 여러 개의 ATP를 재생시킬 수 있기 때문에 무세포 단백질 합성 시스템 내에서 효율적인 에너지원으로서 사용될 수 있다.
하지만, 무세포 단백질 합성 반응에서 포도당 및 포도당 이하 해당작용의 중간체들이 사용될 경우, 이들로부터 생성되는 유기산의 축적에 의하여 반응액의 pH가 감소하게 된다. 이 같은 pH의 저하는 단백질 합성 기구들의 활성을 저해하여 무세포 단백질 합성의 생산성을 제한하는 요인으로 작용하게 된다(Ho-Cheol Kim et. al, 2011, Process Biochemistry, 46(6):1366-1369). 따라서 세포 추출액 내의 단백질 합성 도구들이 영향을 받지 않는 범위 내에서 pH를 제어하는 것이 필수적이다.
이와 같이 pH 제어를 위해, Tris 또는 HEPES 등의 화학적인 pH 완충제를 사용하는 것이 일반적이나, 현재 통상적으로 사용되는 pH 완충제의 농도는 포도당 등의 사용으로 인한 반응액의 pH 저하를 충분히 억제하지 못할 뿐만 아니라, 고농도의 완충제의 사용은 이에 비례하는 염 농도의 증가를 동반하게 되므로 단백질 합성을 저해하는 요인으로 작용하는 문제점이 있다.
또한, pH 제어를 위해 사용된 완충용액은 무세포 단백질 합성 후에 제거할 수 있는 것이 아니므로, 무세포 합성 반응으로 합성한 효소의 활성을 pH 기반으로 분석하고자 할 때, 합성액에 포함된 완충용액이 활성 분석용액에 포함되므로 효소활성에 의한 pH 변화를 억제하게 되어 정확한 효소활성의 분석이 어렵다는 문제점도 있다.
한편, 한국등록특허 제0749053호에 무세포 단백질 합성방법이 개시되어 있고, 한국등록특허 제0733712호에 무세포 단백질 합성용 세포 추출액 제조 및 이를 이용한 단백질 합성법이 개시되어 있으며, 한국등록특허 제1229849호에 소포제의 첨가에 의한 무세포 단백질 합성 시스템의 단백질 발현 수율 개선 방법이 개시되어 있으나, 상기의 문제점을 해소할 수 있는 기술은 보고된 바 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 무세포 단백질 합성과정에서 변이 아미노산 탈카르복실화 효소를 이용하여 pH를 조절하여 효율적으로 무세포 단백질 합성을 할 수 있음을 확인함으로써, 본 발명을 완성하였다.
상기 목적을 달성하기 위하여, 본 발명은 무세포 단백질 합성 반응액에 효소를 첨가하여 pH를 조절하는 것을 특징으로 하는 무세포 단백질 합성 방법을 제공한다.
또한, 본 발명은 상기 무세포 단백질 합성 방법으로 합성된 단백질의 라이브러리를 제공한다.
또한, 본 발명은 상기 무세포 단백질 합성 방법으로 합성된 단백질 라이브러리를 이용한 활성형 단백질의 스크리닝 방법을 제공한다.
본 발명은 효소를 이용하여 pH를 조절하는 것을 특징으로 하는 무세포 단백질 합성 방법에 관한 것으로, 글루탐산 탈카르복실화 효소(GAD)와 글루탐산을 이용하여 무세포 단백질을 합성하게 되면, 무세포 단백질 반응이 진행됨에 따라, 글루탐산이 소모되어 고갈되므로, 효소 합성 반응 후의 무세포 합성 반응액은 pH 완충기작이 없는(Buffer-Free) 상태가 된다. 따라서 무세포 단백질 합성 반응액의 일부를 취하여 무세포 단백질 합성 반응액에 포함된 효소의 활성을 분석하면, pH 변화를 억제하는 요소가 없으므로, 고감도의 효소활성 분석이 가능하게 된다.
또한, 화학적인 완충용액을 사용하는 경우, pH 저하를 충분히 억제하지 못할 뿐만 아니라, 고농도의 완충제의 사용은 이에 비례하는 염 농도의 증가를 동반하게 되므로 단백질 합성을 저해하는 요인으로 작용하여 단백질 합성량이 낮은 수준이지만, 본 발명의 GAD 시스템을 이용하게 되면, pH 저하를 억제하는 효과가 탁월하므로, 단백질의 합성량이 증진된 효과가 있다.
도 1은 무세포 단백질 합성에서 화학 완충용액(HEPES buffer)의 농도(-◆- 57mM, -■- 118mM, -▲- 179mM 및 -●- 240mM)에 따른 sfGFP 합성 농도(㎍/㎖)(A) 및 pH 감소 정도(B)를 확인한 그래프이다.
도 2는 240mM의 완충용액(HEPES buffer)의 조건으로 무세포 단백질 합성하여 획득한 시알산 전이 효소(ST)의 평균발현량을 나타낸 그래프이다.
도 3은 57mM의 완충용액(HEPES buffer)의 조건으로 무세포 단백질 합성 시, 글루탐산 탈카르복실화 효소에 의해 pH 변화 조절 효과(A) 및 각 조건에서의 sfGFP 단백질의 발현량을 확인한 그래프이다. -×- Control은 대조구로서, 글루탐산 탈카르복실화 효소가 첨가되지 않은 것이고; -◆- WT GAD는 야생형 글루탐산 탈카르복실화 효소가 첨가된 것이고; -▲- H465A는 465번째 히스티딘(Histidine)이 알라닌(Alanine)으로 치환된 변이 야생형 글루탐산 탈카르복실화 효소가 첨가된 것이고; -●- Δ465-466는 465번째 히스티딘(Histidine)과 466번째 트레오닌(Threonine)이 결실된 변이 글루탐산 탈카르복실화 효소가 첨가된 것이고; -■- Glu89Gln/Δ465-466는 89번째 글루탐산(Glutamic acid)이 글루타민(Glutamine)으로 치환되고, 465번째 히스티딘(Histidine)과 466번째 트레오닌(Threonine)이 결실된 변이 글루탐산 탈카르복실화 효소가 첨가된 것이다.
도 4는 89번째 글루탐산(Glutamic acid)이 글루타민(Glutamine)으로 치환되고, 465번째 히스티딘(Histidine)과 466번째 트레오닌(Threonine)이 결실된 변이 글루탐산 탈카르복실화 효소의 농도에 따른 sfGFP 단백질의 발현량을 나타낸 그래프이다.
도 5는 1.6㎎/㎖의 GAD(Glu89Gln/Δ465-466) 및 240mM의 완충용액(HEPES-KOH)을 사용한 무세포 단백질 합성에서의 pH 변화와 단백질 발현량을 시간에 따라 비교한 그래프이다.
도 6은 글루탐산의 초기 농도별 무세포 단백질 합성에 의한 글루탐산 소진시간을 확인한 그래프이다.
도 7은 본 발명의 라이브러리 제작, 아미노산 탈카르복실화 효소를 이용하여 무세포 단백질 합성 및 합성된 효소의 활성을 분석하는 어세이 과정을 나타낸 도면이다.
도 8은 본 발명의 일실시예에 따른 글루탐산 탈카르복실화 효소 및 글루탐산을 이용한 무세포 단백질 합성과정을 나타낸 도면이다.
도 9는 본 발명의 일실시예에 따른 무작위 선별된 시알산 전이 효소 변이체의 무세포 단백질 합성량을 나타낸 그래프이다. WT는 야생형 시알산 전이 효소이고, No DNA는 DNA를 제외하고 무세포 단백질 합성을 실시한 대조구이다.
도 10은 시알산 전이 효소의 유전자 라이브러리를 제작하기 위한 PCR 조건을 도식화한 것이다.
도 11은 무세포 단백질 합성 시스템을 활용한 활성형 시알산 전이 효소의 스크리닝 결과를 나타낸 그래프이다.
본 발명의 목적을 달성하기 위하여, 본 발명은 무세포 단백질 합성 방법에 있어서, 무세포 단백질 합성 반응액에 효소를 첨가하여 pH를 조절하는 것을 특징으로 하는 무세포 단백질 합성 방법을 제공한다.
상기 무세포 단백질 합성 반응액에는 세포 추출액, 유전자, 에너지원, 완충용액, 아미노산 등이 포함될 수 있으며, 여기에 글루탐산, 아르기닌, 리신 등의 아미노산이 추가로 포함되어 효소의 기질로 이용될 수 있다.
상기 효소는 아미노산 탈카르복실화 효소(amino acid decarboxylase)이며, 상기 아미노산 탈카르복실화 효소는 각종의 아미노산에 작용하여 C-C 결합을 탈리하여 이산화탄소와 각 아미노산에 해당하는 아민(amine)을 생성하는 분해효소이다.
바람직한 아미노산 탈카르복실화 효소로는 글루탐산 탈카르복실화 효소(glutamate decarboxylase, EC 4.1.1.15), 아르기닌 탈카르복실화 효소(arginine decarboxylse, EC 4.1.1.19), 리신 탈카르복실화 효소(lysine decarboxylase, EC 4.1.1.18), 아스파르트산 4-탈카르복실화 효소(aspartate 4-decarboxylse, EC 4.1.1.12), 발린 탈카르복실화 효소(valine decarboxylse, EC 4.1. 1.14), 히스티딘 탈카르복실화 효소(histidine decarboxylse, EC 4.1.1.22), 티로신 탈카르복실화 효소(tyrosine decarboxylse, EC 4.1.1.25), 페닐알라닌, 트립토판, 티로신 등에 작용하는 방향족 L-아미노산 탈카르복실화 효소(aromatic-L-amino acid decarboxylase, EC 4.1.1.28), 페닐알라닌 탈카르복실화 효소(EC 4.1.1.53), 메티오닌 탈카르복실화 효소(EC 4.1. 1.57) 중에서 선택된 하나 이상인 것이며, 더욱 바람직하게는 글루탐산 탈카르복실화 효소(glutamate decarboxylase, EC 4.1.1.15), 아르기닌 탈카르복실화 효소(arginine decarboxylse, EC 4.1.1.19) 및 리신 탈카르복실화 효소(lysine decarboxylase, EC 4.1.1.18) 중에서 선택된 하나 이상인 것이고, 더더욱 바람직하게는 서열번호 1의 아미노산 서열의 89번째 글루탐산이 글루타민으로 치환되고, 465번째와 466번의 아미노산이 결실된 것을 특징으로 하는 글루탐산 탈카르복실화 효소인 것이지만 이에 제한하는 것은 아니며, 상기 아미노산 탈카르복실화 효소의 일부 아미노산 잔기가 치환, 결실 또는 삽입될 수 있으며, 인산화 또는 메틸화 등의 변형된 형태의 아미노산 잔기를 포함할 수 있다.
상기 pH는 6.5 이하로 저하되지 않는 것이 바람직하며, 더욱 바람직하게는6.5 내지 8.0로 조절되는 것이다.
상기 아미노산 탈카르복실화 효소는 탄소원으로부터 ATP를 재생할 때 생성되는 수소이온을 제거하여 pH를 조절하는 것이고, 상기 탄소원은 단당류, 이당류, 다당류, 다가 알코올 및 유기산 중에서 선택된 하나 이상인 것이 바람직하며, 더욱 바람직하게는 포도당이지만 이에 제한하지 않는다.
또한, 본 발명은 본 발명의 무세포 단백질 합성법으로 합성된 단백질 라이브러리를 제공한다. 상기 단백질 라이브러리는 시알산전이 효소 단백질 라이브러리인 것이 바람직하지만 이에 제한하지 않는다. 상기 시알산 전이 효소는 당단백질의 당쇄구조 말단에 시알산을 붙여주는 역할을 하는 효소로서, 상기 효소로부터 유도된 시알릭락토오스 및 시알릴 올리고당은 몸조직, 피부 및 두되 등에 시알산을 공급할 수 있는 주요한 공급원으로서도 역할을 수행하는 것이 특징이다.
또한, 본 발명은 본 발명의 무세포 단백질 합성 방법으로 합성된 단백질 라이브러리를 대상으로 활성형 단백질을 스크리닝하는 것을 특징으로 하는 활성형 단백질의 스크리닝 방법을 제공한다. 상기 단백질 라이브러리는 분리정제하지 않고 스크리닝할 수 있는 것이 특징이다.
이하, 실시예를 이용하여 본 발명을 더욱 상세하게 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로 본 발명의 범위가 이들에 의해 제한되지 않는다는 것은 당해 기술분야에서 통상의 지식을 가진 자에게 있어 자명한 것이다.
[재료 및 실험방법]
1. 세포 추출액(S12 extract)의 제조
대장균 유래의 BL21(DE3)를 5㎖의 LB 배지에 접종하여 37℃에서 12시간 동안 배양하였다. 이후 37℃에서 밤새 40㎖의 2xYTPG 배지에 계대 배양을 하고, 4ℓ의 2xYTPG 배지가 들어있는 발효조에 접종을 하여 같은 온도에서 배양을 하였다. 흡광도(OD600)가 0.6이 되었을 때, 최종적으로 1mM의 이소프로필티오-β-D-갈락토시드(IPTG)를 발효조에 넣어주어 T7 RNA 중합효소를 발현시키고, 흡광도(OD600)가 4.5가 되었을 때, 세포 배양을 중단하고, 원심분리(4,500rpm, 15분, 4℃)를 통하여 배지로부터 대장균만(cell pellet)을 수집하였다.
상기 회수된 대장균은 1g당 20mM의 완충용액 A[10mM Tris-acetate buffer (pH 8.2), 14mM magnesium acetate, 60mM potassium glutamate, 1mM dithiothreitol (DTT), 0.05%(v/v) 2-mercaptoethanol(2-ME)]를 넣어 잘 씻어주는 과정을 3회 반복하였다.
상기 세척된 대장균 10g 당 12.7㎖의 완충용액 B(완충용액 A에서 2-ME를 제거한 완충용액)를 넣고 상기 대장균을 균일하게 잘 풀어준 후, 압착기(French Pressure Cell Press, Thermo Scientific)를 이용하여 일정한 압력(12,000 psi)으로 세포를 파쇄하였다. 상기 세포 파쇄액은 원심분리(30,000rcf, 30분, 4℃)를 통해 상등액을 수득하였고, 이를 37℃에서 30분간 인큐베이션 한 다음 소량씩 분주하여 사용할 때까지 초저온 냉동고(-80℃)에 보관하였다.
2. 무세포 단백질 합성 및 확인
무세포 단백질 합성 반응은 1.75㎖의 소형 시험관에 넣고 30℃의 항온수조에서 반응하였다.
57mM의 완충용액(HEPES-KOH, pH 8.2), 1.4mM의 ATP, 1.0mM의 CTP, GTP 및 UTP, 1.8mM의 DTT, 90mM의 포타슘 글루타메이트(potassium glutamate), 80mM의 암모늄 아세테이트(ammonium acetate), 8mM의 마그네슘 아세테이트(magnesium acetate), 20mM의 포타슘 포스페이트(potassium phosphate), 34㎍/㎖의 L-5-포르밀-5,6,7,8-테트라히드로폴릭산(L-5-formyl-5,6,7,8-tetrahydrofolic acid; folinic acid), 3.2mM의 20종의 아미노산, 2%(w/v)의 PEG (8000), 80mM의 D-포도당, 13.3㎍/㎖의 플라스미드, 및 27%(v/v)의 S12 extract를 무세포 단백질 합성 반응액으로 사용하였다.
상기 완충용액(HEPES-KOH, pH 8.2), 아미노산, 포도당(glucose) 및 L-글루탐산(L-glutamate)의 농도는 필요에 따라 조정하였다. 생산된 단백질의 총량은 TCA-침전 후 방사성 동위원소의 방사선량에 따라 결정하였다.
활성형 sfGFP의 정량은 VICTOR X3 multilabel plate reader(Perkin-Elmer, Waltham, MA)를 이용하여 형광을 측정하여 결정하였다. 생산된 sfGFP는 Coomassie blue-stained Tricine-SDS-PAGE gels를 통하여 크기를 확인하였다.
pH의 변화는 90㎕의 반응액에 마이크로 pH-전극(micro-combination pH-electrode; InLab 423, Mettler-Toledo GmbH, Switzerland)으로 매 시간마다 측정하여 기록하였다.
3. 글루탐산 탈카르복실화 효소(GAD)를 이용한 무세포 단백질 합성 및 정제
야생형 GAD 효소와 변이 GAD(Glu89Gln/△465-466)의 유전자 서열은 각각 pET28b 벡터에 클로닝하여 대장균 BL21(DE3)에 형질전환 하였다. 이들 각 세포는 50㎍/㎖의 카나마이신(kanamycin)이 포함되어 있는 500㎖의 LB 배지에서 37℃의 온도 조건 하에 배양하였고, GAD를 발현시키기 위해 OD600 값이 2.5가 되었을 때 1mM의 IPTG를 넣어주었다. 이후 같은 조건에서 두 시간을 더 배양한 후, 세포를 수거해서 완충용액 A로 세척을 하였다. 이후, 상기 세포 덩어리를 완충용액 B로 풀어준 뒤, 압착기(French Pressure Cell Press)를 이용하여 12,000psi의 압력으로 파쇄하였고, 30,000rcf로 4℃에서 30분간 원심분리하여 상등액을 회수하였다.
회수된 상등액은 Ni-NTA agarose beads(Qiagen)를 이용하여 분리 정제하였고, VIVA-spin 20(MWCO 10 kDa, Sartorius)으로 완충용액 B를 이용하여 농축하였다. 이후, 브레드포드(Bradford) 방법으로 단백질의 농도를 측정한 뒤 사용할 때까지 -80℃에 보관하였다.
실시예 1. 무세포 단백질 합성에서의 완충용액의 농도에 따른 단백질 합성량 및 pH 변화량 확인
무세포 단백질 합성에서 완충용액의 농도에 따른 pH 변화를 확인하기 위하여 57mM, 118mM, 179mM 및 240mM의 완충용액을 이용하여 제조하여 sfGFP 단백질의 무세포 단백질 합성을 실시하였다.
도 1에 개시된 바와 같이 화학 완충용액(HEPES buffer)의 농도를 늘려감에 따라 pH의 감속 폭이 줄어들고 단백질의 합성량이 증가하는 것을 확인하였다. 이때 과량의 포도당(80mM)을 사용한 반응에서 최소한의 pH 유지 조건인 6.5 수준을 유지하기 위해 완충용액(HEPES buffer)의 농도를 240mM 이하로 최적화하였다. 240mM의 완충용액 조건에서 무세포 단백질 합성을 수행한 결과, 약 2㎎/㎖의 sfGFP 단백질이 획득됨을 확인하였다.
이후, 시알산 전이 효소의 활성을 스크리닝하기 위하여 96개의 시알산 전이 효소 유전자라이브러리를 이용하여 상기 최적화한 240mM의 완충용액의 조건으로 무세포 단백질 합성을 실시하였다.
도 2에 개시한 바와 같이, 96종의 시알산 전이 효소 라이브러리를 96웰 플레이트에서 무세포 단백질 합성을 수행하여 630±101㎍/㎖의 시알산 전이 효소가 발현됨을 확인되었으나, pH 지시약과 기질을 이용한 활성 측정 반응에서는 아무런 색의 변화도 관찰할 수 없었다. 이 과정에서 pH 지시약의 색 변화가 나타나지 않은 것은 고농도의 완충용액(HEPES buffer, 240mM)이 활성 측정용액 내에서도 수소이온 농도의 변화에 대한 완충작용을 하여 색의 변화가 나타나지 않은 것으로 판단되었다.
따라서, 시알산 전이 효소를 분리정제하여 활성분석의 가능 여부를 확인하였고, 분리정제된 경우는 상기 단백질의 활성에 따라 색의 변화를 관찰할 수 있었다.
본 실시예 1을 통하여 무세포 단백질 합성 반응에서 pH 변화를 조절하면서 활성분석에서 간섭을 하지 않는 완충 메커니즘이 필요하다는 것을 확인하였다.
실시예 2. 무세포 단백질 합성에서의 글루탐산 탈카르복실화 효소에 의한 pH 변화 조절 효과 및 sfGFP 단백질의 발현량 확인
무세포 단백질 합성 반응에서 pH 변화를 조절하면서 활성분석에서 간섭을 하지 않는 완충 메커니즘으로 아미노산 탈카르보실화효소를 이용하고자 하였다.
수많은 미생물은 산성 조건에서도 살아남을 수 있는 내재된 완충시스템이 있는데, 예를 들어 대장균의 경우, 몇 종류의 아미노산 탈카르복실화 효소(아르기닌, 글루탐산, 리신 탈카르복실화 효소)는 산성 조건에서 유도 발현된다. 상기 효소들은 각 아미노산에서 카르복실기를 이탈시키면서 수소이온을 함께 제거하고, 산성 조건에서도 대장균 세포 내부의 pH를 유지시키는 기능을 하는 것으로 알려져 있다. 이와 같은 특징을 이용하여 상기 미생물의 항산성 메커니즘을 무세포 단백질 합성 시스템의 pH 변화를 조절하는데 적용하고자 하였다.
본 실시예 2에서는 세포 추출액의 해당과정으로 인해 생성되는 수소이온을 제거하기 위해 글루탐산 탈카르복실화 효소(GAD)를 이용하였다. 글루탐산 한 분자는 상기 효소를 통해 한 분자의 유도 아미노산(γ-aminobutyric acid)으로 변하면서 같은 몰 수의 수소이온을 제거하는 역할을 수행한다. 따라서 GAD 및 글루탐산을 무세포 단백질 합성 용액에 첨가하게 되면 ATP의 재생과정에서 생성되는 수소이온을 제거하게 되므로 pH를 안정하게 유지할 수 있는 것이다.
하지만, GAD를 이용하여 pH를 조절하는 시스템은 글루탐산이 소진됨과 동시에 완충효과가 사라지고, pH에 의존적인 대장균의 야생형 GAD의 활성이 pH가 3.8 내지 4.6에서 활성 및 단백질의 협동성(cooperativity)을 보이고 있기 때문에 GAD의 활성은 무세포 단백질 합성 시스템에 적합한 pH인 6.5 내지 8.0에서는 나타나지 않는 것이다.
그러나 다행히도 최근 연구에서 대장균 유래 GAD의 pH 의존도는 일부의 특정 아미노산 잔기의 역할에 의하여 결정된다는 것이 알려졌다. 즉, 상기 GAD 효소의 엔지니어링을 통해 효소의 pH 의존도를 변화시킬 수 있다는 것이다. 그 예로, Ho 등의 연구에서는 대장균 GAD의 89번째 아미노산인 글루탐산을 글루타민으로 치환하여 중성 범위의 pH에서도 활성을 가질 수 있다는 것이 밝혀졌다. 또한, 465번째와 466번째 아미노산인 히스티딘과 트레오닌을 제거함으로 인해 pH에 의존하는 협동성을 없애면서 활성을 가지는 pH의 범위를 늘릴 수 있었다. 이러한 변이에 의한 효과가 함께 적용되면서 중성에 가까운 pH, 그리고 넓은 범위의 pH에서도 활성을 가지는 변이된 GAD(Glu89Gln/Δ465-466)를 만들게 되었다.
본 발명자들은 효소에 의한 pH 조절을 위해 상기한 바와 같은 변이된 GAD(Glu89Gln/Δ465-466)를 이용하기로 결정하였고, 포도당을 이용한 무세포 단백질 합성 반응에서 pH 감소가 줄어들 것으로 예상하였다.
따라서 본 실시예 2에서 무세포 단백질 합성에서의 글루탐산 탈카르복실화 효소(GAD)에 의한 pH 변화 조절 효과 및 sfGFP 단백질의 발현량 확인을 하였다.
결과는 pH가 중성으로 유지되는 시간이 증가하면서 무세포 단백질 합성 반응을 통해 얻어진 단백질의 양이 현저히 증가함을 알 수 있었다. 대조구로 실시한 57mM의 HEPES-KOH의 완충용액을 사용한 경우, 반응액의 pH가 80분 이내에서 6.5 이하로 떨어진 반면, 동일한 반응액에 0.4㎎/㎖의 변이된 GAD를 추가한 경우에는 pH가 6.5에 도달하기까지의 시간이 약 130분까지 증가한 것을 확인하였다 (도 3A).
이와 같이 pH의 떨어지는 속도가 늦춰진 반응에서는 합성된 단백질의 양도 함께 늘어 약 두 배에 가까운 생산성을 나타내었다. 한편, 야생형 GAD를 추가해준 경우에는 pH를 제어하는 효과가 거의 나타나지 않았으며, 단백질의 생산성도 기존의 반응과 비슷한 수준을 나타내었다(도 3B). 이와 같은 결과는 야생형 GAD 효소보다 변이된 GAD(Glu89Gln/Δ465-466)가 반응액의 pH의 감소에 대하여 효과적이라는 것을 의미하였다.
또한, 무세포 단백질 합성 반응액에 GAD(Glu89Gln/Δ465-466)의 농도를 1.6㎎/㎖ 이상의 농도까지 높이게 될 경우에 항산화 작용이 더욱 커지게 되어 무세포 단백질 합성 반응액 내에서 단백질의 생산성이 늘어나는 효과를 볼 수 있었다(도 4).
또한, 1.6㎎/㎖의 GAD(Glu89Gln/Δ465-466)와 240mM의 HEPES-KOH를 무세포 단백질 합성 용액에 각각 사용하였을 때의 pH 변화와 합성된 단백질의 양을 각 시간에 따라 비교하였다. 도 5에 개시한 바와 같이 일정 농도 이상의 GAD가 있을 때 반응액 내에서 완충용액인 HEPES-KOH를 완전히 제거하더라도 pH가 완벽하게 유지된다는 것을 확인하였다.
또한, 반응액 내에 포함된 166mM 글루탐산의 초기 농도는 6시간의 반응 동안 모두 소진이 됨으로써 완충제가 없는 조건이 형성되게 된다 (도 6). 따라서 초기농도로 166mM의 글루탐산을 사용하는 경우 무세포 단백질 합성시간이 6시간까지 수행하는 것이 바람직함을 알 수 있었다. 6시간 이후에, 글루탐산을 추가로 첨가하여 진행하는 것을 배제하지 않으며, 글루탐산의 농도를 적절히 조절함에 따라 무세포 단백질 합성 반응 시간을 연장할 수 있을 것이다.
실시예 3. 시알산 전이 효소 라이브러리 제작, 발현 및 활성 분석
본 실시예 3에서는 도 7에 개시한 바와 같은 과정으로, 시알산 전이 효소의 라이브러리 제작, 아미노산 탈카르복실화 효소를 이용하여 무세포 단백질 합성 및 합성된 효소의 활성을 분석하는 어세이를 실시하였다.
본 실시예 3에서는 글루탐산 탈카르복실화 효소(GAD) 및 글루탐산을 이용하여 pH를 조절하는 것을 특징으로 하는 무세포 단백질 합성 방법으로 10,000여 개의 다양한 유전자 라이브러리를 발현하고 발현된 단백질의 활성을 스크리닝하고자 하였다(도 8).
도 9에 개시한 바와 같이, 글루탐산 탈카르복실화 효소(GAD) 및 글루탐산을 이용하여 pH를 조절하는 GAD 시스템을 이용한 무세포 단백질 합성한 시알산 전이 효소 변이체들의 합성량이 거의 일정하게 합성됨을 확인함으로써, 반응액을 일정량 취하여 활성 분석의 결과가 발현량에 의한 차이가 아니라는 것을 알 수 있었다.
또한, GAD를 이용한 무세포 단백질 합성을 통해 생산된 시알산 전이 효소를 별도의 정제과정 없이 활성측정 용액에 적용한 결과가 정제된 시알산 전이 효소의 활성 분석 결과와 같은 동일한 양상으로 나타나는 것을 확인하였다.
따라서 본 발명에 따른 아미노산 탈카르복실화 효소를 이용한 pH를 조절하는 무세포 단백질 합성 방법으로 합성된 단백질 라이브러리를 이용한 pH 기반의 효소 스크리닝이 가능할 것으로 예상하였다.
시알산 전이 효소의 유전자 라이브러리를 제작하기 위해 PCR 기법으로 서열번호 2의 아미노산 서열의 265번째 트레오닌(Threonine; Thr), 313번째 아르기닌(Arginine; Arg) 및 357번째 트레오닌(Threonine; Thr) 코돈을 무작위 변이시켰고, 사용된 프라이머는 표 1에 나타내었다. 상기 시알산 전이 효소의 활성부위로 예측되는 부위 중에서 세 곳의 아미노산 위치를 선택하여 무작위로 변이된 유전자 라이브러리를 제작하고 이를 발현하여 효소 활성이 야생형보다 증대된 변이 유전체를 선별하고자 하였다.
표 1 시알산 전이 효소의 유전자 라이브러리 제작을 위한 프라이머
서열번호 프라이머 명칭 시작점 염기서열(5'-> 3')
3 T7 promoter Forward TCGATCCCGCGAAATTAATACGACTCACTATAGG
4 1st fragment Backward AAAGATAAATTTAGCTTGTTGCACTTC
5 2nd fragment Forward GAAGTGCAACAAGCTAAATTTATCTTTNNSGGCACG
6 2nd fragment Backward AGGATGCCCTTTAAAGTAGATTTT
7 3rd fragment Forward AAAATCTACTTTAAAGGGCATCCTNNSGGTGGTGAAATTAATGACTACATTCTGA
8 3rd fragment Backward TGAACTTGCAACACCACCCAC
9 4th fragment Forward GTGGGTGGTGTTGCAAGTTCANNSTATTTC
10 T7 terminator Backward CAAAAAACCCCTCAAGACCCGTTTA
PCR을 수행한 온도 및 시간 등의 조건은 도 10에 나타내었다. PCR을 통하여 제작된 유전자는 pIVEX2.3d 벡터에 클로닝하여 상기 265번째 트레오닌(Threonine; Thr), 313번째 아르기닌(Arginine; Arg) 및 357번째 트레오닌(Threonine; Thr) 위치에 각각 다른 유전자 서열로 치환된 콜로니(colony)를 획득하여 라이브러리를 제작하였다. 콜로니 채집기(K3, K biosystems)를 이용하여 상기 라이브러리 중에서 10,000개의 콜로니를 취하여 200㎕의 LB 배지가 들어있는 96웰 플레이트에 접종하였다. 상기 획득한 104개의 96웰 플레이트를 37℃에서 15시간 동안 교반시켜 배양하였다.
상기 배양된 세포들은 23.5㎕의 PCR 반응 용액이 담겨있는 26개의 384웰 플레이트에 1.5㎕씩 옮겨 담았고, 이후, PCR을 통하여 증폭된 각각의 유전자는 19.5㎕의 무세포 단백질 합성 반응액이 담겨있는 새로운 384웰 플레이트에 각각 3.0㎕씩 옮겨졌다. 상기 플레이트는 습도가 높은 30℃의 교반기에 3시간 동안 무세포 단백질 합성 반응을 실시하였다.
무세포 단백질 합성 반응이 끝난 직후, 본 실시예 3에서 제작한 시알산 전이 효소 라이브러리에 담긴 반응액을 5mM의 Tris-Cl(pH 8.5) 용액으로 3배 희석한 후, 1.8㎕의 희석액을 58.5㎕의 활성 스크리닝 용액(5mM의 Tris-Cl pH 8.5, 4mM의 CMP-NeuAc, 0.4mM의 cresol-red, 4mM의 lactose)이 담긴 384웰 플레이트에 옮겨서 15분간 상온에 방치하였다. 상기 라이브러리의 OD600 값은 플레이트 리더(Victor 3, PerkinElmer)로 측정하여 가장 높은 흡광도를 가진 표본을 선별하였다. 상기 모든 과정에서의 용액을 옮기는 공정은 자동화된 리퀴드 핸들링 시스템(JANUS　 Automated Workstation, PerkinElmer)을 활용하였다.
결과는 도 11에 개시한 바와 같이, 10,000 여개의 유전자로부터 시알산 전이 효소의 발현 및 활성형 단백질의 스크리닝을 통해 현저하게 증가된 활성을 보이는 시알산 전이 효소를 식별해낼 수 있었다.

Claims (11)

  1. 무세포 단백질 합성 방법에 있어서, 무세포 단백질 합성 반응액에 효소를 첨가하여 pH를 조절하는 것을 특징으로 하는 무세포 단백질 합성 방법.
  2. 제1항에 있어서, 상기 효소는 아미노산 탈카르복실화 효소(amino acid decarboxylase)인 것을 특징으로 하는 무세포 단백질 합성 방법.
  3. 제2항에 있어서, 상기 아미노산 탈카르복실화 효소는 글루탐산 탈카르복실화 효소, 아르기닌 탈카르복실화 효소 및 리신 탈카르복실화 효소 중에서 선택된 하나 이상인 것을 특징으로 하는 무세포 단백질 합성 방법.
  4. 제3항에 있어서, 상기 글루탐산 탈카르복실화 효소는 서열번호 1의 아미노산 서열의 89번째 글루탐산이 글루타민으로 치환되고, 465번째와 466번의 아미노산이 결실된 것을 특징으로 하는 무세포 단백질 합성 방법.
  5. 제1항에 있어서, 상기 pH는 6.5 내지 8.0로 조절되는 것을 특징으로 하는 무세포 단백질 합성 방법.
  6. 제2항에 있어서, 상기 아미노산 탈카르복실화 효소는 탄소원으로부터 ATP를 재생할 때 생성되는 수소이온을 제거하여 pH를 조절하는 것을 특징으로 하는 무세포 단백질 합성 방법.
  7. 제6항에 있어서, 상기 탄소원은 단당류, 이당류, 다당류, 다가 알코올 및 유기산 중에서 선택된 하나 이상인 것을 특징으로 하는 무세포 단백질 합성 방법.
  8. 제7항에 있어서, 상기 단당류는 포도당인 것을 특징으로 하는 무세포 단백질 합성 방법.
  9. 제1항 내지 제8항 중 어느 한 항의 무세포 단백질 합성 방법으로 합성된 단백질의 라이브러리.
  10. 제9항의 단백질 라이브러리를 대상으로 활성형 단백질을 스크리닝하는 것을 특징으로 하는 활성형 단백질의 스크리닝 방법.
  11. 제10항에 있어서, 상기 단백질 라이브러리는 분리정제하지 않은 것을 특징으로 하는 활성형 단백질의 스크리닝 방법.
PCT/KR2015/005910 2014-06-12 2015-06-12 효소를 이용하여 ｐＨ를 조절하는 무세포 단백질 합성 방법 WO2015190857A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/374,168 US10088493B2 (en) 2014-06-12 2016-12-09 Method for cell-free protein synthesis involved with pH control with amino acid decarboxylase

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2014-0071736 2014-06-12
KR20140071736 2014-06-12

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/374,168 Continuation-In-Part US10088493B2 (en) 2014-06-12 2016-12-09 Method for cell-free protein synthesis involved with pH control with amino acid decarboxylase

Publications (1)

Publication Number Publication Date
WO2015190857A1 true WO2015190857A1 (ko) 2015-12-17

Family

ID=54833860

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/005910 WO2015190857A1 (ko) 2014-06-12 2015-06-12 효소를 이용하여 ｐＨ를 조절하는 무세포 단백질 합성 방법

Country Status (3)

Country Link
US (1) US10088493B2 (ko)
KR (1) KR101671688B1 (ko)
WO (1) WO2015190857A1 (ko)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102085946B1 (ko) 2017-07-24 2020-03-06 충남대학교 산학협력단 무세포 단백질 합성 시스템을 이용한 아미노산의 정량 방법
CN108504669A (zh) * 2018-03-21 2018-09-07 天津大学 一种含小分子糖的体外高效合成蛋白质的系统
US11839881B2 (en) 2021-02-25 2023-12-12 Ardent Mills, Llc Systems and methods for extracting and isolating purified wheat embryo products

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100733712B1 (ko) * 2006-02-17 2007-06-29 충남대학교산학협력단 무세포 단백질 합성용 세포 추출액 제조 및 이를 이용한단백질 합성법
KR101202797B1 (ko) * 2011-08-18 2012-11-19 동국대학교 산학협력단 신규한 글루타메이트 디카르복실라아제 변이체

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE368747T1 (de) 2000-08-29 2007-08-15 Cellfree Sciences Co Ltd Verfahren zur synthese von zellfreien proteinen
US20090100536A1 (en) * 2001-12-04 2009-04-16 Monsanto Company Transgenic plants with enhanced agronomic traits
TWI354021B (en) * 2002-12-23 2011-12-11 Alcon Inc Compositions and methods for inhibiting protein on
US8298759B2 (en) 2004-03-25 2012-10-30 The Board Of Trustee Of The Leland Stanford Junior University Protein expression yield enhancement in cell-free protein synthesis systems by addition of antifoam agents
JP2010017081A (ja) * 2006-10-10 2010-01-28 Ajinomoto Co Inc Ｌ−アミノ酸の製造法
WO2011053764A2 (en) * 2009-11-02 2011-05-05 Plant Sensory Systems, Llc Method for the biosynthesis of taurine or hypotaurine in cells

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100733712B1 (ko) * 2006-02-17 2007-06-29 충남대학교산학협력단 무세포 단백질 합성용 세포 추출액 제조 및 이를 이용한단백질 합성법
KR101202797B1 (ko) * 2011-08-18 2012-11-19 동국대학교 산학협력단 신규한 글루타메이트 디카르복실라아제 변이체

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KIM, T.-W. ET AL.: "A Highly Efficient and Economical Cell -free Protein Synthesis System Using the S12 Extract of Escherichia coli", BIOTECHNOLOGY AND BIOPROCESS ENGINEERING, vol. 13, 2008, pages 464 - 469, XP055242692 *
PARK, JI YEONG: "Graduate Thesis of Chungnam National University(Master", HIGH- THROUGHPUT SCREENING OF GLYCOSYLTRANSFERASE IN A CELL -FREE PROTEIN SYNTHESIS SYSTEM, 2012 *

Also Published As

Publication number Publication date
US20170089931A1 (en) 2017-03-30
US10088493B2 (en) 2018-10-02
KR20150142638A (ko) 2015-12-22
KR101671688B1 (ko) 2016-11-03

Similar Documents

Publication Publication Date Title
KR100723826B1 (ko) 변이형 ｄ－아미노트랜스퍼라제 및 이를 사용하는 광학활성글루탐산 유도체의 제조방법
JP2021514682A (ja) トリプタミンの生産方法
US8785162B2 (en) Aminotransferase and oxidoreductase nucleic acids and polypeptides and methods of using
US11407976B2 (en) Genetically modified microorganisms having improved tolerance towards L-serine
JP2020527359A (ja) 鉄硫黄クラスタの輸送が改善された細胞工場
JP2015529459A (ja) フィードバック阻害が低下したまたはオフとなった酵素をコードする遺伝子を含有するベクターの製造方法、ならびにアミノ酸およびヌクレオチドを生産するための、その使用
WO2015190857A1 (ko) 효소를 이용하여 ｐＨ를 조절하는 무세포 단백질 합성 방법
WO2016182321A1 (ko) L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법
WO2015199406A1 (ko) L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법
WO2017122931A1 (ko) L-시스테인 생산용 변이미생물 및 이를 이용한 l-시스테인의 제조방법
Veeravalli et al. Strain engineering to prevent norleucine incorporation during recombinant protein production in E scherichia coli
WO2017069567A1 (ko) Ｌ-쓰레오닌을 생산하는 재조합 미생물 및 이를 이용하여 ｌ-쓰레오닌을 생산하는 방법
WO2019068726A1 (en) CELL TRANSPORT SYSTEM FOR TRANSFERRING CARGO SULFONIC ACID CONSTRUCTION IN CYTOPLASM OF CELL
EP2883960B1 (en) METHOD FOR PRODUCING gamma-GLUTAMYL-VALYL-GLYCINE CRYSTAL
WO2017065457A1 (ko) L-쓰레오닌 생산능을 가지는 미생물 및 그를 이용하여 l-쓰레오닌을 생산하는 방법
WO2018151347A1 (ko) L-쓰레오닌 생산능을 가지는 미생물 및 그를 이용하여 l-쓰레오닌을 생산하는 방법
WO2013154312A1 (ko) Laci 단백질 변이체를 이용한 독성 단백질의 생산 방법
EP2522738B1 (en) Process for production of l-glutamine or l-glutamic acid
EP3119874A1 (en) Microorganisms having enhanced l-amino acids productivity and process for producing l-amino acids using the same
WO2023285585A2 (en) Microbial cell factories producing vitamin b compounds
CN117897476A (zh) 生产维生素b化合物的微生物细胞工厂
KR101742477B1 (ko) 라세믹 트레오닌으로부터 d-트레오닌 및 호모알라닌을 순차적으로 생산하는 방법
WO2024044657A1 (en) Biocatalysts and methods thereof
CN117925744A (zh) 非核糖体肽合成酶在生产脱羧肌肽中的应用
CN117802187A (zh) 嘌呤类物质的制造方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15805728

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15805728

Country of ref document: EP

Kind code of ref document: A1