WO2015183019A1 - 신규한 라이실 티알엔에이 합성효소 단편 및 이를 포함하는 마이크로베지클 - Google Patents

신규한 라이실 티알엔에이 합성효소 단편 및 이를 포함하는 마이크로베지클 Download PDF

Info

Publication number
WO2015183019A1
WO2015183019A1 PCT/KR2015/005371 KR2015005371W WO2015183019A1 WO 2015183019 A1 WO2015183019 A1 WO 2015183019A1 KR 2015005371 W KR2015005371 W KR 2015005371W WO 2015183019 A1 WO2015183019 A1 WO 2015183019A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
krs
fragment
cells
microvesicle
Prior art date
Application number
PCT/KR2015/005371
Other languages
English (en)
French (fr)
Inventor
김성훈
박민철
김상범
Original Assignee
재단법인 의약바이오컨버젼스연구단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인 의약바이오컨버젼스연구단 filed Critical 재단법인 의약바이오컨버젼스연구단
Publication of WO2015183019A1 publication Critical patent/WO2015183019A1/ko
Priority to US15/361,698 priority Critical patent/US20170073659A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y601/00—Ligases forming carbon-oxygen bonds (6.1)
    • C12Y601/01—Ligases forming aminoacyl-tRNA and related compounds (6.1.1)
    • C12Y601/01006—Lysine-tRNA ligase (6.1.1.6)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/9015—Ligases (6)

Definitions

  • Novel lysyl thial-NA synthetase fragments and microvesicles comprising the same
  • the present invention relates to a novel lysyl thial DNA synthetase fragment and a microvesicle comprising the same, more specifically, a lysyl thial comprising an amino acid sequence represented by SEQ ID NO: 1 and secreted from cancer cells
  • An RNA synthase (KRS) fragment a microvesicle comprising the KRS fragment, and a method for providing cancer diagnostic information and screening cancer metastasis inhibitors using the same.
  • Cancer is the product of abnormal, uncontrolled and disordered cell proliferation. In particular, if there is destructive growth permeability and metastasis, it is classified as malignant. Permeability is the property of infiltrating or destroying surrounding tissues, which generally means that the tumor spreads locally by destroying the basal layer that forms the boundary of the tissues, and often enters the circulatory system of the body. Translocation usually refers to the spread of tumor cells to a location different from the original location by lymphot ic or blood vessels. Metastasis also refers to the movement of tumor cells by stretching directly through serous body cavity or other spaces.
  • cytokines are secreted by many cells, especially immune cells. Cytokines also transmit intercellular signals that regulate cell proliferation, differentiation, migration, and apoptosis. Because cytokines have no function in cells, they must be secreted to work. Most cytokines contain a signal peptide sequence at the amino terminus directed to the endoplasmic reticulum. When the COP II complex carries cytokines from the endoplasmic reticulum to Golgi, the cytokines are secreted extracellularly. Ie, classical cytokines present in cells, for example TNF-alpha, TGF-beta, IL1- Beta has no function in cells and has a signal peptide sequence that is secreted outside the cell via ER-golgi.
  • non-classical cytokines also function in cells, they do not have signal peptide sequences at the amino terminus. For this reason, non-typical cytokines are secreted through non-universal secretion pathways, which include secretory mediators, microvesicle shedding, axosome release, and secretory lysosomes. Among these non-typical secretory pathways, exosomes carry intracellular molecules such as intracellular proteins, mRNA, micro RNA, and the like. Axosomes are membrane-derived microvesicles with a diameter of 30-100 nm. Axosomes originate inside polyporous bodies (MVBs), are mixed with endosomes derived from cell membranes and released into the cell. Among many cells, cancer cells and immune cells release exosomes to mediate intercellular interactions.
  • MVBs polyporous bodies
  • K S belongs to aminoacyl-t-RNA synthetases (ARSs) ⁇ , which conjugate cognate amino acids and tRNAs for protein synthesis.
  • ARSs aminoacyl-t-RNA synthetases
  • These primitive enzymes have pleiotropic features in addition to catalytic activity (Park, SG, Ewalt, KL & Kim, S. Functional expansion of arainoacyl-tRNA synthetases and their interacting factors- new perspectives on housekeepers. Trends Biochem. Sci. 30, 569-574 (2005)).
  • KRS act as molecular reservoirs (Ray, PS, Arif, A. & Fox, P. Macromolecular com lexes as depots) to regulate various functions of the constituent proteins.
  • KRS proteins are secreted in cancer cells and are known to cause inflammation by increasing TNF-alpha secret ion and macrophage migration through macrophage. KRS has been known to secrete secretion during serum starvation and increase secret ion upon simultaneous treatment with TNF-alpha. How this KRS becomes a secret ion is unknown.
  • Non-Patent Document 1 K. Choe, Y. Hwang, H. Seo, and P. Kim, "In vivo high spatiotemporal resolution visualization of circulating T lymphocytes in high endothelial venules of lymph nodes. , "
  • Non-Patent Document 2 N. Faust, F. Varas, L. M. Kelly, S. Heck, and T. Graf,
  • the present inventors studied the secretion mechanism of KRS, the KRS is essentially cleaved by caspase-8 for extracellular secretion, and the KRS fragment produced by the cleavage is secreted extracellularly through exosomes.
  • the use of the KRS fragment and microvesicles (particularly exosomes) containing the same for the diagnosis of cancer and the screening of cancer metastasis inhibitors was completed and the present invention was completed.
  • a lysyl thial-NA synthase fragment comprising an amino acid sequence represented by SEQ ID NO: 1 and secreted from cancer cells.
  • Another object of the present invention is to provide a microvesicle secreted by cancer cells including the lysyl thiA synthase fragment.
  • Another object of the present invention is to (a) separating the microvesicle from a biological sample taken from a suspected cancer; (b) crushing the microvesicle of step (a) to determine the level of lysyl thial-NA synthase fragment of SEQ ID NO: 1 or the expression level of the gene encoding the fragment; And (c) comparing the expression level of the fragment level or the gene encoding the fragment with the fragment level of the normal control sample or the expression level of the gene encoding the fragment.
  • Another object of the present invention is (A) Lysyl ThiaL synthase (KRS) or its
  • a KRS fragment comprising a C-terminal region, syntenin and a test agent; (B) measuring the change in the binding level of the KRS or fragments thereof and synthenin; And (C) contacting the test preparation with the binding level of the KRS or a fragment thereof and synthenin with a cancer cell, thereby secreting a microvesicle comprising a lysyl thial-NA synthase fragment of SEQ ID NO: 1 from the cancer cell. It is to provide a cancer transfer inhibitor screening method comprising the step of determining whether or not.
  • the present invention provides an lysyl thiA-N synthase fragment comprising an amino acid sequence represented by SEQ ID NO: 1 and secreted from cancer cells.
  • the present invention provides a microvesicle secreted by cancer cells comprising the lysyl thiA synthase fragment.
  • the present invention comprises the steps of (a) separating the microvesicle from a biological sample collected from a suspected cancer; (b) crushing the microvesicle of step (a) to determine the level of the lysyl thial DNA synthase fragment of SEQ ID NO: 1 or the expression level of the gene encoding the fragment; And (c) comparing the expression level of the fragment level or the gene encoding the fragment with the fragment level of the normal control sample or the expression level of the gene encoding the fragment.
  • the present invention provides (A) KRS fragment, syntenin and test agent comprising the lysyl thialene synthase (KRS) or C-terminal region thereof Contacting; (B) measuring the change in the binding level of the KRS or fragments thereof and synthenin; And (C) contacting a test agent with a change in the binding level of the KRS or a fragment thereof and synthenin with a cancer cell, thereby secreting a microvesicle comprising a lysyl thiA-N synthase fragment of SEQ ID NO: 1 from the cancer cell. It provides a cancer metastasis inhibitor screening method comprising the step of confirming.
  • protein 'means “polypeptide (ide)” or “peptide
  • ept ide It is used interchangeably with '', and refers to a polymer of amino acid residues, for example as commonly found in natural proteins.
  • Nucleic acid or “polynucleotide” in the present invention refers to a deoxyribonucleotide or ribonucleotide in the form of a single- or double-strand, similar to naturally occurring nucleotides, unless otherwise limited. Also included are known analogs of natural nucleotides that are common to nucleic acids by the method.
  • the present invention includes an amino acid sequence represented by SEQ ID NO: 1, and provides a lysyl thiA synthase fragment (KRS fragment) secreted from cancer cells.
  • KRS fragment lysyl thiA synthase fragment
  • KRS refers to a full-length polypeptide known in the art as lysyl thial-NA synthase.
  • the KRS is not particularly limited as long as the specific amino acid sequence is known in the art as a lysyl thioene synthase, for example SEQ ID NO: 2 (Genbank Accession No. NP — 005539.1), SEQ ID NO: 3 (Genbank Accession No. NP_001123561.1) and the like.
  • KRS may preferably mean a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 2 (Genbank Accession No. NP — 005539.1).
  • KRS fragment refers to a partial fragment of the KRS polypeptide full-length sequence, wherein the KRS fragment of the present invention is preferably a known human KRSCGenbank Accession No. NP_005539.1) amino acids 1-12 from N-terminus A fragment represented by SEQ ID NO: 1 in the form of an acid deleted.
  • the present inventors do not secrete the full length sequence of a polypeptide known as KRS protein from cancer cells, but in the form of KRS fragment (SEQ ID NO: 1) in which KRS is processed in the cell and some regions are cleaved.
  • the microvesicle of is used as a means of secretion, and this process revealed that the KS-derived component involved in the microenvironmental composition of cancer metastasis is indispensable for showing activity, which is disclosed for the first time in the present invention. It is. This is illustrated well in the specification examples of the present invention.
  • the present invention preferably provides a lysyl thialNA synthase fragment consisting of an amino acid sequence represented by SEQ ID NO: 1 and secreted from cancer cells, wherein the KRS fragment of the present invention comprises a functional equivalent thereof.
  • the functional equivalent refers to a polypeptide having at least 703 ⁇ 4 or more, preferably 80% or more, more preferably 90% or more sequence homology (ie, identity) with the amino acid sequence represented by SEQ ID NO: 1.
  • sequence homology ie, identity
  • It includes a polypeptide having a and refers to a polypeptide that exhibits substantially the same physiological activity as the polypeptide represented by SEQ ID NO: 1.
  • the functional equivalent may be the result of addition, substitution or deletion of some of the amino acid sequences of SEQ ID NO: 1. Substitution of amino acids in the above is preferably a conservative substitution. Examples of conservative substitutions of naturally occurring amino acids are: aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (l ie, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids ( Asp, Glu), basic amino acids (Hi s, Lys, Arg, Gin, Asn) and sulfur containing amino acids (Cys, Met). The functional equivalents also include variants in which a portion of the amino acid is deleted on the amino acid sequence of the KRS fragment polypeptide of the present invention.
  • Deletion or substitution of such amino acids is preferably located in regions not directly related to the physiological activity of the polypeptides of the invention. Deletion of amino acids is also preferably located at portions not directly involved in the physiological activity of the KRS fragment polypeptide. Also included are variants in which some amino acids are added to both ends or sequences of the amino acid sequence of the KRS fragment polypeptide. Also included in the scope of functional equivalents of the invention are polypeptide derivatives in which some chemical structures of the polypeptide have been modified while maintaining the basic backbone of the polypeptide and its physiological activity. For example, the stability, storage, This includes structural changes for changing volatility or solubility.
  • Sequence homology and homology herein refer to the amino acid sequence of the KRS fragment (SEQ ID NO:
  • sequence homogeneity can be determined by common standard methods used to compare similar portions of amino acid sequences of two polypeptides.
  • Computer programs such as BLAST or FASTA align the two polypeptides so that their respective amino acids are optimally matched (along the full length of one or two sequences or along the predicted portions of one or two sequences).
  • the program provides a default opening penalty and a default gap penal ty and can be used in conjunction with a computer program.
  • the PAM250 standard scoring matrix Dayhof f et al. in at las of Protein Sequence and Structure, vol 5, supp 3, 1978). For example, percentage homogeneity can be calculated as follows. The total number of ident ical matches is multiplied by 100 and then the sum of the length of the longer sequence in the matched span and the number of gaps introduced into the longer sequence to align the two sequences. Divide by.
  • KRS fragments according to the present invention can be extracted from nature or produced by genetic engineering methods.
  • nucleic acids eg, polynucleotide sequences of SEQ ID NO: 5
  • the nucleic acid can be constructed by PCR amplification using appropriate primers.
  • DNA sequences may be synthesized by standard methods known in the art, for example using an automated DNA synthesizer (available from Biosearch or Applied Biosys terns).
  • the constructed nucleic acid is inserted into a vector comprising one or more expression control sequences (eg, promoters, enhancers, etc.) that are operably linked thereto to regulate expression of the nucleic acid.
  • the host cell is transformed with the formed recombinant expression vector.
  • the resulting transformants are cultured under medium and conditions appropriate for the nucleic acid to be expressed, and the nucleic acid is removed from the culture. Recover the substantially pure polypeptide expressed by. The recovery can be carried out using methods known in the art (eg chromatography).
  • the term "substantially pure polypeptide” means that the polypeptide according to the present invention is substantially free of any other protein derived from a host cell.
  • polypeptide of the present invention may be prepared by chemical synthesis (Creighton,
  • the present invention provides a microvesicle secreted in cancer cells comprising the lysyl thiA synthase fragment.
  • the term 'microvesicle' is internally and externally separated by a lipid bilayer composed of cell membrane components, and has cell membrane lipids, proteins, nucleic acids and other cell components, and is larger than the original cells.
  • the microvesicle used by the KRS fragment of SEQ ID NO: 1 as its extracellular secretion means is exosome-like, exosome-like microvesicle (exosome-like microvesicle), e ididimosomes, argosomes, promininosomes, prostasomes, dexosomes, texosomes, archeosomes and OTicosomes.
  • the microvesicle may be an exosome-ike microvesi le in the form of an exosome or an exosome, and most preferably, the microvesicle of the present invention.
  • the KRS fragment of the present invention and the microvesicle comprising the same are characterized in that the cancer cells, the cancer is breast cancer, colon cancer, lung cancer, small cell lung cancer, stomach cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer , Skin or intraocular myeloma, uterine cancer, ovarian cancer, rectal cancer, anal muscle cancer, colon cancer, breast cancer, fallopian tube carcinoma, endometrial carcinoma, cervical cancer, vaginal cancer, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine Adenocarcinoma, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic
  • Microvesicles of the present invention are naturally secreted from cancer cells in vivo in vivo, but in order to obtain a large amount of microvesicles of the present invention to induce secretion in vitro through the production method comprising the following steps.
  • starvat ion stress is given to cancer cells, thereby promoting the generation of RS fragments of SEQ ID NO: 1 in the cells and activating their secretion mechanism.
  • Methods of imparting starvation stress to cells are known in the art and may be, for example, culturing cancer cells in serum free medium.
  • the type of cancer capable of secreting the microvesicle of the present invention is as described above.
  • step (1) a process of treating TNF-alpha together with the hunger stress may be additionally performed.
  • Step (2) is a step of separating and obtaining only microvesicles generated from the cells of step (1) and secreted to the outside of the cell.
  • the cell culture medium under starvation stress and recovered from the cultured cell culture medium was collected, and the structure (particle) fraction of a specific size or / and density estimated to contain the KRS fragment of the present invention was collected. Recover.
  • Methods of separating and obtaining only particles of the desired size or / and density from the mixture are well known in the art, for example, density gradients, centrifugation (ex. Ultracentrifugation, density gradient centrifugation, etc.), Filtration (eg, using a specific diameter filter), dialysis, and free flow electrophoresis.
  • density gradients for example, density gradients, centrifugation (ex. Ultracentrifugation, density gradient centrifugation, etc.), Filtration (eg, using a specific diameter filter), dialysis, and free flow electrophoresis.
  • micro-vesicles having a diameter of 10nm to 100Onm it is preferable to obtain micro-vesicles having a diameter of 10nm to 100Onm through the above-described method. More preferably, microvesicles having a diameter of 10 nm to 200 nm can be obtained, and most preferably, microvesicles having a diameter of 50 nm to 150 rai are obtained.
  • step (2) it may be desirable to obtain microvesicles having a density of 1.09 g / ml to 1.19 g / ml through the aforementioned method. It may be desirable to obtain microvesicles having a density of most preferably from 1.09 g / ml to 1.18 g / ml.
  • the KRS fragment represented by SEQ ID NO: 1 of the present invention is specifically secreted extracellularly from cancer cells in the form of microvesicles (particularly exosomes), and thus can be used as a diagnostic marker for cancer in vivo.
  • the microvesicle of the present invention which is a natural construct from cancer cells, is a carrier that secretes the KS fragment of SEQ ID NO. 1 out of the cell, and is associated with peripheral macrophages and neutrophils (macrophages / neutrophils) in relation to the microenvironment of cancer. Promote the secretion of cytokines associated with the recruitment and metastasis of the cancer, and create a cancer metastasis environment around the cancer tissue.
  • the microvesicle of the present invention can function as a biomarker for diagnosing cancer or diagnosing cancer metastasis. Therefore, the present invention provides a cancer diagnostic or metastasis diagnostic marker composition comprising a KRS fragment consisting of the amino acid sequence of SEQ ID NO: 1 or a microvesicle comprising the KRS fragment.
  • diagnosis in the present invention encompasses all types of analysis used to predict or derive a disease occurrence risk and to determine disease risk.
  • cancer diagnostic marker refers to a substance capable of confirming the onset of cancer by expressing it in cancer tissues and cells and confirming the expression thereof, preferably showing a significant difference between normal tissue and cancer tissue Organic molecules such as proteins or mRNA.
  • cancer metastasis diagnostic marker in the present invention is expressed in cancer cells showing signs of metastases (metastas is) by confirming the expression of the substance that can determine whether the metastasis of cancer, preferably normal tissue and It refers to an organic biomolecule such as protein or mRNA which shows a significant difference in cancer tissue.
  • the cancer diagnostic marker or cancer metastasis diagnostic marker is a KRS fragment represented by SEQ ID NO: 1 or a microvesicle containing the same, which is specifically expressed only in various cancer tissues and cells, and KRS represented by SEQ ID NO: 1 Cancer can be diagnosed by checking whether the fragment or microvesicle containing the same has been secreted extracellularly.
  • the conventional method of diagnosing cancer is a biopsy in which a portion of the tissue suspected of developing cancer in the early metastasis state is examined and it is not easy to determine an accurate biopsy site. There is this.
  • the markers of the present invention are processed and secreted from cancer cells through a special process, the markers of the present invention can be used directly for diagnosis of cancer and its potential metastasis.
  • the advantage of being able to diagnose cancer (or the possibility of its metastasis) is to use a less invasive method, such as liquid biopsy, without collecting tissue.
  • the liquid biopsy is a test using body fluid instead of biosolid tissue of a tumor patient.
  • Liquid biopsies are known to be simpler to collect than conventional biopsies and to reduce patient pain and risk of infection.
  • the present invention is the presence of the marker of the present invention (KRS fragment represented by SEQ ID NO: 1 or a micro-vesicle comprising the same), and the amount (pattern) for detecting the amount, pattern or both It provides a cancer diagnostic composition comprising a.
  • the presence of the marker and the substance detecting the amount, pattern or both may be an antibody specific for the marker of the present invention.
  • the presence or absence of the KRS fragment represented by SEQ ID NO: 1 and the amount, pattern, or both may be detected at the protein level.
  • the presence or absence of the KRS fragment represented by SEQ ID NO: 1 and the amount, pattern, or both may be detected at the protein level.
  • Reagents that can be detected at the protein level include, but are not limited to, monoclonal antibodies, polyclonal antibodies, substrates, uptamers, receptors, ligands or cofactors, or mass spectrometer detection reagents.
  • the material (reagent) used for the detection may be prepared based on the analysis by preparing the KRS fragment represented by SEQ ID NO: 1 of the present invention or a microvesicle comprising the same as described above. Can be screened.
  • the present invention also provides a kit for diagnosing cancer, the kit for diagnosing cancer comprising a computer in which a reagent for detecting a marker according to the present invention and an apparatus or algorithm for analyzing the same are embedded.
  • a method of providing information necessary for diagnosing cancer (or cancer metastasis) using the marker of the present invention may be performed by including the following steps;
  • step (B) crushing the microvesicle of step (a) to measure the level of lysyl thial DNA synthase fragment of SEQ ID NO: 1 or the expression level of the gene encoding the fragment;
  • microvesicles are isolated from biological samples collected from individuals suspected of having cancer.
  • the term 'subject' refers to an animal to be diagnosed with cancer, and may preferably be an animal including a mammal, especially a human.
  • the subject may be a patient in need of treatment.
  • the biological sample is obtained from an individual suspected of having cancer, and the type of biological sample is not particularly limited as long as it can obtain a microvesicle secreted from the cells in the present invention.
  • Cells whole blood (blood), plasma, serum, saliva, ocular fluid, cerebrospinal fluid, sweat, urine, milk, ascites fluid, synovial fluid, peritoneal fluid, lymph, etc., but is not limited thereto.
  • the biological sample may be urine, blood, serum or lymph. Samples may be pretreated before use for detection. For example, it may include filtration, distillation, extraction, concentration, inactivation of interference components, addition of reagents, and the like.
  • the desired microvesicle is separated from the sample, wherein a method of separating and obtaining only particles of the desired size or / and density from the mixture is well known in the art.
  • density gradients e.g. Ficoll, Glycerol, Sucrose, Suptrose, Opt i Prep TM, etc.
  • density gradients e.g. Ficoll, Glycerol, Sucrose, Suptrose, Opt i Prep TM, etc.
  • density gradients e.g. Ficoll, Glycerol, Sucrose, Suptrose, Opt i Prep TM, etc.
  • centrifugation ex. Ultracentrifugation, density gradient
  • Centrifugal method etc.
  • filtration eg, using a specific diameter filter such as gel filtration or ultrafiltration
  • dialysis e.g, using a specific diameter filter such as gel filtration or ultrafiltration
  • step (a) it is preferable to obtain microvesicles having a diameter of 10nm to 100Onm through the above-described method. More. Preferably, microvesicles having a diameter of 10 nm to 200 nm can be obtained, and most preferably, microvesicles having a diameter of 50 nm to 150 nm are obtained.
  • step (a) it may be desirable to obtain microvesicles having a density of 1.09 g / ml to 1.19 g / ml through the above-described method. It may be desirable to obtain microvesicles most preferably having a density of 1.09 g / ml to 1.18 g / ml.
  • step (b) the microvesicle separated and obtained in step (a) is crushed
  • the KRS fragment level of SEQ ID NO: 1 or the expression level of the gene encoding the fragment is measured, and in step (c), the fragment level or the expression level of the gene encoding the fragment is determined as the fragment of the normal control sample. The level or expression level of the gene encoding the fragment is compared.
  • the detection of the KRS fragment level of SEQ ID NO: 1 may be carried out through various immunoassay methods known in the art.
  • the detection of KRS fragment levels and their quantitative changes may include radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, enzyme-inked immunosorbent assay (ELISA), capture-ELISA, inhibition or competition assay, and sandwich assay.
  • ELISA enzyme-inked immunosorbent assay
  • sandwich assay sandwich assay.
  • Ouchter lony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, complement fixat ion assay, Fluorescence Act ivated Cel l Sorter, FACS ), Western blot, protein chip, etc. may be used, but is not limited thereto.
  • the expression level of the gene encoding the KRS fragment may be carried out through various methods known in the art.
  • mRNA expression levels were RT-PCR (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (200D), Competitive Reverse Transcription Polymerase Reaction (RT), Real Time Reverse Transcription Polymerization).
  • Real-t ime RT-PCR RNase protect ion assay (RPA), Northern blotting (Peter B. Kaufraa et al., Molecular.
  • a microvesicle comprising a lysyl thial DNA synthetase fragment of SEQ ID NO: 1 from the cancer cells by contacting a cancer cell with a test agent of which the binding level of the KRS or a fragment thereof and synthenin is contacted with the cancer cell It provides a cancer metastasis inhibitor screening method comprising the step of confirming whether it is secreted.
  • the inventors of the present invention have a microvesicle of the present invention (especially KRS exosomes) are secreted from cancer cells to create a metastasis environment in surrounding tissues, and syntenin plays an important role in the secretion of the microvesicles. It was identified. Specifically, the binding of synthenin-1 (3 1 61 ⁇ 11-1) to KRS through N-terminal cleavage in cells is increased, and this increase in synthenin binding is important for KRS exosome secretion. The secreted KRS exosomes play an important role in cancer metastasis by increasing the secretion of cytokines that act on the recruitment of macrophage and neutrophi l and promote cancer metastasis.
  • the present invention provides a cancer metastasis inhibitor screening method comprising the steps (A) to (C) based on the above-described secretion properties of the KRS fragment and the microvesicle comprising the same, it will be described step by step.
  • step (A) (i) contacting the KS fragment comprising lysyl thial-A synthase (KRS) or its C-terminal region with ( ⁇ ) synthenin and (iii) the test agent It is a system.
  • KRS is not particularly limited in amino acid sequence if known in the art as a lysyl thiA synthetase, for example SEQ ID NO: 2 (Genbank Accession). No. NP_005539.1) and SEQ ID NO: 3 (Genbank Accession No. NP_001123561.1) are known in the art.
  • step (A) KRS is meant to include functional equivalents thereof.
  • the KRS fragment used in the step (A) is characterized in that the fragment containing the C-terminal region of the KRS among the fragments (fragments) for the KRS polypeptide full-length sequence.
  • the C-terminal region of the KRS may preferably be composed of an amino acid sequence (VGTSV) represented by SEQ ID NO: 6, but is not limited thereto.
  • the KRS fragment (including the KRS C-terminal region) usable in step (A) may be composed of the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.
  • the KRS fragment in step (A) is meant to include functional equivalents thereof.
  • the syntenin may be, but is not limited to, a syntenin-l polypeptide comprising the amino acid sequence of SEQ ID NO: 4.
  • agent or “test agent” means any substance, molecule, element, compound, entity ( ent ity) or combinations thereof. Examples include, but are not limited to, proteins, polypeptides, small organic molecules, polysaccharides, polynucleotides, and the like. It may also be a natural product, synthetic compound or chemical compound or a combination of two or more substances. Unless otherwise specified, agents, substances and compounds may be used interchangeably.
  • a test agent that can be screened by the screening method of the present invention is a polypeptide, beta-turn mimet ics, polysaccharide, phospholipid, hormone, prostaglandin, steroid, aromatic compound, hetero Cyclic compounds, benzodiazepines, lolimeric N-substituted glycines, ol igocarbamates, saccharides, fatty acids, purines Or pyrimidines or derivatives thereof, structural analogs or combinations thereof.
  • Some test formulations may be synthetic and others may be natural. The test formulations can be obtained from a wide variety of sources, including libraries of synthetic or natural compounds.
  • the combinatorial library is a step-by-step room It can be produced as a variety of compounds that can be synthesized by formula.
  • Compounds of a number of combinatorial libraries can be prepared by ESUencoded synthetic libraries) methods (WO 95/12608, W093 / 06121, WO 94/08051, WO 95/395503 and WO 95/30642).
  • Peptide libraries can be prepared by phage display method 0TO91 / 18980). Libraries of natural compounds in the form of bacterial, bearish, plant and animal extracts can be obtained from commercial sources or collected in the field. Known pharmacological agents can be applied to directed or random chemical formulas such as acylation, alkylation, esterification, amidation, etc. to produce structural analogs. Can be.
  • the test agent may be a naturally occurring protein or fragment thereof.
  • test preparations can be obtained from natural sources, such as cell or tissue lysates. Libraries of polypeptide preparations can be obtained, for example, from cDNA libraries produced by conventional methods or commercially available.
  • the test agent may be a peptide such as a peptide having about 5-30, preferably about 5-20, more preferably about 7-15 amino acids.
  • the peptide may be a cleavage of a naturally occurring protein, random peptide or “biased” random peptide.
  • the test formulation may also be "nucleic acid.”
  • Nucleic acid test agents may be naturally occurring nucleic acids, random nucleic acids, or “biased” random nucleic acids. For example, cleavage of the prokaryotic or eukaryotic genome can be used similarly as described above.
  • the test formulation may be a small molecule (eg, a molecule having a molecular weight of about 1,000 or less).
  • the method for screening small molecule modulating agents may preferably be subjected to a high throughput assay. Many assays are useful for such screening (Shultz, Bioorg. Med. Chem. Lett., 8: 2409-2414, 1998; Weller, Mol.
  • Test formulations screened in the methods of the invention can be prepared based on structural studies on synthenin and KRS or fragments or analogs thereof. This structural study enables the identification of test agents that are likely to bind synthenin or KRS (or KRS fragment).
  • the three-dimensional structure of syntenin or KRS (or KRS fragment) can be determined in several ways, such as crystal structure and molecular modeling. modeling). Methods for studying protein structure using X-ray crystal lography are well known in the literature: Physical Bio-Chemistry, Van Holde, KE (Prent ice-Hall, New Jersey 1971), pp. 221-239, and Physical Chemistry with Applications to the Life Sciences, D. Eisengerg & D. Crossers (Benjamin Cummings, Menlo Park 1979).
  • the term “contacting” is its general meaning and combines two or more agents (eg two polypeptides), or agents and cells (eg proteins and cells). To combine. Contact can occur in vitro. For example, combining two or more agents in a test tube or other container, or combining a test agent with a cell or cell lysate and a test agent. Contact may also occur in cells or in situ. For example, two polypeptides are contacted in a cell or cell lysate by coexpressing a recombinant polynucleotide encoding the two polypeptides in a cell.
  • step (B) the change of the binding level of the KRS or fragment thereof and synthenin contacted with the test agent in the step (A) is measured, and from the measurement result of the KRS or fragment thereof and Test products with varying binding levels are selected.
  • the term 'binding' may be a direct or indirect binding of the entire KRS or a fragment thereof having an amino acid sequence of SEQ ID NO: 1 and a syntenin protein.
  • the indirect binding is a complex of binding between two proteins through different mediators or with mediators.
  • the change in the binding level of the KRS or fragments thereof and synthenin is desirable. Directly reducing the level of binding.
  • the decrease in the binding level means removing, preventing or inhibiting binding of the KRS or a fragment thereof to synthenin.
  • the decrease in the binding level may be such that the test agent removes, prevents or inhibits production of the KRS or fragments thereof and synthenin to change the level of expression of the KRS or fragments thereof and synthenin or the test agent is KS.
  • the test agent removes, prevents or inhibits production of the KRS or fragments thereof and synthenin to change the level of expression of the KRS or fragments thereof and synthenin or the test agent is KS.
  • competitively or non-competitively binding fragments and syntenin thereof to change the level of interaction (binding) between the two, or by a test formulation for KRS or fragment-synthenin protein complexes already produced intracellularly. It can be achieved by a method of removing the interaction (binding) allol between KRS of the complex or a fragment thereof and synthenin.
  • ком ⁇ онент means that the test agent binds to a site where KRS or a fragment thereof and synthenin interact with each other (bind) to remove, prevent or inhibit the interaction of KRS or a fragment thereof with syntenin.
  • the synthenin is characterized by interacting in the C-terminal region of KRS or fragments thereof.
  • Non-competitive binding means that the test agent binds to a site other than the site where KRS or a fragment thereof and synthenin interacts with each other (binding), thereby eliminating, preventing or inhibiting the interaction of KRS or a fragment thereof with syntenin.
  • the present invention inhibits the expression and intrinsic functions of KRS or fragments thereof and synthenin, and (independently black) intracellular interactions of KRS or fragments thereof with syntenin within the range that does not cause side effects. Screening for test agents that inhibit or reduce (bind) levelol.
  • the decrease in the binding level of the present invention is preferably a method in which the test agent binds KRS or fragments thereof and syntenin competitively or non-competitively to change the level of interaction (binding) between the two, or already in the cell.
  • the resulting KRS or fragment thereof-syntenin protein complex may be prepared by a test preparation to remove the interaction (binding) between KRS or fragment thereof and cintenine of the complex.
  • test agents are not necessarily functionally inhibiting the expression and intrinsic functions of KRS or fragments thereof and synthenin, and are sufficient to inhibit the interaction (binding) of KRS or fragments thereof and synthenin. .
  • the screening method of the present invention is a labeled in vitro protein-protein binding assay (in vitro pull-down assay), EMSA, immunoassay for protein binding, functional assay (phosphorylation assay, etc.), Yeast-2 Hybrid Assay, Non-Immunoprecipitation Assay, Immunoprecipitation Western Blot Assay, Immune-Co-Location Assay, etc. It may be carried out as, but is not limited to the above.
  • ⁇ i5i> the DNA-binding domain and yeast of bacterial refresher LexA or yeast GAL4
  • Yeast-2 hybrid assays are performed using yeasts expressing KRS or fragments thereof and synthenin, or portions or homologues of these proteins, each fused to a transact ivaton domain of GAL4 protein.
  • KIM M. J. et al., Nat. Gent., 34: 330-336, 2003.
  • the interaction of KRS or fragments thereof with synthenin allows reconstitution of a transactivator that induces expression of reporter genes under the control of a promoter having a regulatory sequence bound to the DNA-binding domain of LexA protein or GAL4.
  • the reporter gene may be a gene encoding any detectable polypeptide known in the art as described above (eg, chlorampheni col acetyl transferase (CAT), luciferase, beta-galactosidase, beta-). Glucosatase, alkaline phosphatase, and green f luorescent protein (GFP), etc. may be used if the binding of KRS or fragments thereof to synthenin, or portions or homologues of these proteins, is inhibited or weakened by the test agent. In this case, the reporter gene is not expressed or is less expressed compared to normal conditions.
  • any detectable polypeptide known in the art as described above eg, chlorampheni col acetyl transferase (CAT), luciferase, beta-galactosidase, beta-).
  • the reporter gene may be selected to encode a protein that enables the growth of the yeast (that is, the growth of the yeast is inhibited when the reporter gene is not expressed).
  • it may be an auxotropi c gene that encodes an enzyme involved in the biosynthesis process for amino acids or nitrogen bases (e.g., yeast genes such as ADE3, HIS3, or equivalent genes from other species).
  • yeast genes such as ADE3, HIS3, or equivalent genes from other species.
  • the binding of KRS or fragments thereof and synthenin, or a portion or homologue of these proteins expressed in this system does not express the reporter gene when inhibited by the test agent.
  • the growth of yeast is stopped or slowed down.
  • the effect of expression of these reporter genes can be observed with the naked eye or through a device (eg, a microscope).
  • step (C) the agent selected in step (B) (that is, a test agent in which the binding level of the KRS or fragment thereof and synthenin is changed) is contacted with cancer cells, and SEQ ID NO. Check whether the microvesicle containing the KRS fragment of the secretion is secreted, and the microvesicle is selected for the test agent is reduced (inhibited) secretion.
  • step (C) in order to confirm whether the microvesicle containing the KRS fragment of SEQ ID NO: 1 is secreted, the presence of the KRS fragment represented by SEQ ID NO: 1 or the microvesicle including the same And materials that detect the quantity, pattern, or both.
  • the reagents are as described above and are well known in the art for detecting the target material using the reagents.
  • the culture medium is recovered and the microvesicles are separated therefrom.
  • the microvesicle may be performed by measuring the KRS fragment level of SEQ ID NO: 1.
  • the method of separating the desired microvesicle from the sample and detecting the KRS fragment level of SEQ ID NO: 1 from the microvesicle can be referred to the above.
  • the cancer metastasis inhibitor screening method of the present invention may further perform the following step (D) after the steps (A) to (C);
  • the animal refers to a non-human animal, and may be preferably a non-human mammal.
  • the lysyl thiA-N synthase (KRS) fragment provided in the present invention and the microvesicle containing the KRS fragment are specific markers for cancer cells to be secreted from the cells, thereby providing information necessary for cancer diagnosis. By using this, cancer can be easily diagnosed.
  • the present invention provides a method for screening a cancer metastasis inhibitor based on the secretion characteristics of the KRS fragment and microvesicles containing the same from cancer cells, which is useful for the development of a substance that specifically inhibits cancer metastasis. Can be.
  • FIG. La is a western blot in which N-termi al is cleaved when KRS is secreted extracellularly. Results confirmed using the method. 24 hours after transforming HCT116 cells to express Myc-K S or KRS-myc, the transformants were serum-free (serum starvation media) with or without TNF-a (10 ng / ml). Incubated for 12 hours. The secreted proteins were precipitated by TCA and examined by western blot using anti-myc antibody (WCL: whole cell lysate).
  • WCL whole cell lysate
  • KRS wild type and myc— AN12 (13-597a.a mutant) were transformed into HCT116 cells and 24 hours later, the resulting transformants were either serum-free with or without TNF-a (10 ng / ml). Incubated for 12 hours in the medium (serum starvation media). The secreted protein was precipitated by TCA and examined by western blot using anti-myc antibody (WCL: whole cell lysate).
  • FIG. ID is a result of confirming the amount of KRS cleaved over time for serum starvation conditions or serum starvat ion + TNF-a lpha treatment conditions.
  • 24 hours after overexpressing GFP-KRS HCT116 cells were incubated for 30 minutes and 60 minutes in serum starvation media with or without TNF-a (10 ng / ml).
  • TNF-a 10 ng / ml
  • N-renil la—KRS-C-reni 1 la vector was used to determine whether KRS is cleaved due to starvation (serim stravation) conditions.
  • N-renilla-KRS-C-renilla vector and firefly lucif erase vector were transformed into HCT116 cells 24 hours after the incubation, each time (0 hours, 3 hours, 6 hours) was incubated in serum-free medium (serum starvation media). Then reni 1 la / firefly lucif erase activity in each sample was immediately corrected.
  • FIG. 2A shows the result of KRS multiple alignment using BioEdit.
  • Caspase cleavage consensus and eukaryot e ⁇ specifical expans i on domain are shown in this figure.
  • Figure 2b is a result confirmed by Western blot whether or not KRS secretion by treatment of Pan-caspase inhibitor.
  • Pan-caspase inhibitor Z-VAD-FMK was treated with starved HCT116 cells at 14 uM and incubated for 12 hours.
  • KRS secretion was examined by western blot method using anti-KRS antibody (WCL: whole cell lysate). .
  • Figure 2c is a result confirmed by Western blot whether KRS cleavage by treatment with Pan— caspase inhibitor.
  • Serum free starvation with 14 uM pan-caspase inhibitor (Z-VAD-FMK) resulted in the overexpression of GFP-KRS cells, demonstrating that intracellular cleavage of KRS was inhibited by pan-caspase inhibitors.
  • KS cleavage was detected by western blot using anti-GFP antibody.
  • 2D shows partial mutation of the KRS sequence recognized by caspase.
  • Figure 2e shows a partial mutation of the KRS sequence recognized by caspase.
  • 2f is a result of confirming Western blot whether or not K S secretion by the treatment of inhibitors that inhibit caspase-3, -6, -8, ⁇ 9.
  • Western blot method using anti-KRS antibody showed whether KRS is secreted extracellularly (WCL: whole cell) lysate).
  • Figure 2g is a result confirmed by Western blot whether KRS secretion by caspase-3, -6, -8, -9 siRNA treatment. After 48 hours of transforming with caspase-3, -6, -8, and -9 specific siRNA or non-specific siRNA control, HCT116 cells were cultured in serum-free starvation medium for 12 hours, and then KRS was secreted. -Western blot using KRS antibody shows the results (WCL: whole cell lysate).
  • Figure 2h is the result of confirming the expression level of Caspase -3, -6, -8, -9 in serum starvation conditions by western blot. After HCT116 cells were incubated in serum-free starvation medium for each hour, the expression levels of each caspase were examined from protein lysates.
  • FIG. 2i shows the result of investigating the amount of KRS cleavage under the overexpression condition of caspase-8 by western blot, confirming that the increase of caspase-8 increases the N-terminal cleavage of KRS.
  • FIG. 3A shows a result of multiple alignment of PDZ binding motif in C-terminal of KRS.
  • FIG. 3B shows the synthesis of KRS and syntenin-1 in starvation conditions or / and TNF-alpha treatment.
  • immunoprecipitation and western blot binding the interaction between KRS and syntenin-1 was induced by starvation conditions.
  • HCT116 cells were cultured in serum-free starvation condition or serum-free starvation medium containing TNF ⁇ alpha for 1 hour, immunoprecipitation (IP) was performed on syntenin-1, and Western blot was obtained using anti-KRS antibody.
  • IP immunoprecipitation
  • FIG. 3C shows that the binding of KRS and syntenin-1 to western blot during caspase-8 inhibi tor treatment was confirmed by the interaction of KRS-syntenin- ⁇ with caspase-8 inhibi tor treatment.
  • Cells were cultured in serum-free medium with or without caspase-8 inhibitor (Z-VAD-IETD), immunoprecipitated (IP) against syntenin-1, and Western blots were prepared using anti-KRS antibodies. The interaction between KRS and syntenin-1 was investigated.
  • 3D shows the results of investigating the interaction between KRS and syntenin-1 using the D12A mutant.
  • KRS WT and D12A mutants tagged with C-terminus myc were transgenic and overexpressed in cells, and after 24 hours, incubated in serum-free medium for 1 hour, and then precipitated using anti-myc antibody, followed by syntenin binding to KRS.
  • -1 was examined by western blot (mock: control with empty vector introduced into cells).
  • FIG. 3E shows the results of confirming the interaction (binding) of KRS and syntenin-1 by BiFC (Bimolecular fluorescence comlementat ion) assay.
  • BiFC Bimolecular fluorescence comlementat ion
  • FIG. 3F shows Western blots of KRS secret ions by syntenin-1 specific siRNA treatment. It was confirmed that KRS secretion was syntenin-1 dependent. After 48 hours of inhibiting the expression of Syntenin-1 by treating Syntenin-1 specific siRNA with HCT116 cel l, the cells were incubated for 12 hours in serum-free medium, and then the secreted KRS was precipitated with TCA. Western blot using anti-KRS antibody (con: siRNA control treatment, syn: syntenin-1 specific siRNA treatment, WCL: whole cel l lysate).
  • Figure 3g is a result of confirming the binding of the deletion mutant ( C 5 (l-592a.a)) and syntenin-1 that cut the c-terminal of KRS by western blot.
  • KRS WT and c-terainal deletion mutants ( ⁇ c5 (l-592a.a)) were used to investigate the interaction with syntenin-1 and KRS secretion.
  • the HCT116 cells KRS WT-myc or deletion mutant (A C 5 (1- 592a.
  • Figure 3h is the result of confirming the effect on the KRS secretion of KRS deletion mutan Ac5 (l-592a.a) by Western blot.
  • HCT116 cells are transformed with KRS WT and deletion mutant (A c5 (l-592a.a)) and incubated 12 hours in serum-free medium after 24 hours.
  • the protein secreted into the culture medium was precipitated with TCA and the amount of KRS secreted using anti-myc antibody was detected by Western blot.
  • FIG. 4A shows electron microscope images of microvesicles separated from KRS secreted media.
  • HCT116 cells were incubated in serum-free medium for 12 hours, and centrifuged at 100,000 g to separate extracellular secreted microvesicles, and images were confirmed using an electron microscope.
  • 4B shows the average size of microvesicles isolated from media with K S secreted. After HCT116 cells were incubated for 12 hours in serum-free medium, microvesicles isolated from the culture medium were separated using 100,000 g centrifugation. The size of the separated microvesicles was measured using dynamic light scattering.
  • Figure 4c is a result of confirming the density of the micro-vesicles detected KRS by opt i -prep gradient assay. After incubating the HCT116 cells in serum-free medium for 12 hours, the microvesicles isolated from the culture medium were loaded on an opti-prep gradient to obtain a total of nine fractions. These anti-KRS antibodies and anti-Syntenin-1 were obtained. It was analyzed by Western blot method using the antibody. ⁇ 216>
  • FIG. 4D shows that the secretion of KRS exosomes is dependent on syntenin-1 after si-syntenin treatment using KRS exosome secret ion as a western blot.
  • HCT116 cells were treated with Syntenin-1 specific siRNA to inhibit its expression and 48 hours later, the cells were cultured in serum-free medium for 12 hours.
  • the secreted axosomes were purified by centrifugation at 100,000 g, and proteins were examined by Western blot (si-Con: siRNA control treatment not affecting gene expression, si_syn: syntenin-1 specific siRNA treatment, WCL: whole cell lysate)
  • FIG. 4E shows the result of confirming the effect of KRS deletion mutant (Ac5 (l-592a.a)) ⁇ 1 KRS exosome secretion by western blot.
  • KRS WT-myc or deletion mutant (Ac5 (l-592a.a))-myc was used to examine the interactions with syntenin-1 and KRS exosome secretion.
  • HCT116 cells were transformed with KRS WT-myc or deletion mutant (Ac5 (l-592a.a))-myc and after 24 hours, the transformants were incubated for 12 hours in serum-free medium. Purified exosomes were analyzed by Western blot (WCL: whole eel 1 lysate).
  • Figure 5a shows the results of TNF-alpha secretion by treatment of KRS WT, truncated KRS (N12 (13-597a.a)) or KRS exosomes in macrophages by TNF-alpha EL ISA method.
  • RAW 264.7 cells were incubated with KRS WT, truncated KRS (AN12 (13-597a.a)) protein and KRS exosomes (0.05, 0.5, 5ug) of ⁇ ⁇ ⁇ and secreted TNF-alpha.
  • 5b shows KRS WT, truncated KRS (N12 (13-597a.a)) or KRS in macrophages.
  • KRS WT truncated KRS
  • N12 (13-597a.a) KRS in macrophages.
  • KRS 'exosome treatment cell migration following KRS 'exosome treatment was examined by wound-healing assay. After single scraping of RAW 264.7 cell monolayers, either ⁇ KRS protein (WT, AN12 respectively) or KRS exosomes (0.05, 0.5, 5 ug) were treated by concentration. After 12 hours, the migration of the cells was observed under a microscope.
  • FIG. 6A shows the results of purifying axosomes from si -con or si -KRS treated HCT116 cells to prepare a sample and performing immunoblotting.
  • TNF-alpha ELISA shows TNF-alpha ELISA when RAW 264.7 cells were incubated with ⁇ AN12 KRS protein or with exosomes (5ug / ml) purified from Si-con or Si-KRS treated HCT116 cells. The results of analysis of the secretion of TNF-alpha are shown.
  • FIG. 6C shows a transwel 1 migration assay when R 264.7 cells were incubated with ⁇ AN12 KRS protein or incubated with exosomes (5ug / ml) purified from Si-con or Si-KRS treated HCT116 cells.
  • the cell migration effect was analyzed by the method (left is the image of microscopic observation and the right is the quantification of the percentage of mobile cells).
  • FIG. 6D shows the results of quantifying in vivo images (left) and green fluorescence intensity in the images obtained using B16F10 cells overexpressing KRS WT-myc or D12A mutant-my c, respectively. (Right). After injecting the B16F10 cells into the mouse ears, it shows the results obtained by the image at time at Omin, 30min, 60min, 90min (red: cells, green: macrophages and neutrophils).
  • FIG. 6E shows luminex screening assays (bead-based multiplex kits) of each cytokine secreted from macrophages treated with ⁇ KRS protein (WT, AN12, respectively) or KRS exosome (5 ug / ml). The result evaluated by using is shown (Cont: untreated control group, Exo: KRS exosome treated group).
  • HCT116 cells were treated at 37 ° C using RPMI medium (Hyclone with 25 mM HEPES and L-Ghitamine) supplemented with 10% fetal bovine serum (FBS), 50 U g / mL penicillin and streptomycin. , 5% C0 2 incubator. 10% RAW264.7 cells
  • High glucose DMEM medium supplemented with FBS (fetal bovine serum), 50 ⁇ g / mL penicillin and streptomycin (2.5 g porecine trypsin, 4.00 mM L-glutamate, 400 mg / L Glutamaine and Sodium pyruvate, Hyclone)
  • FBS fetal bovine serum
  • streptomycin 2.5 g porecine trypsin, 4.00 mM L-glutamate, 400 mg / L Glutamaine and Sodium pyruvate, Hyclone
  • Human TNF—alpha (Sigma, USA) was treated at a concentration of 10 ng / ml under serum-free conditions.
  • si-RNA for syntenin-1 was obtained from santacuz (sc-42164).
  • Si-RNA for KRS was obtained from invitrogen; KRS si-RNA sequence (Cat.No/Lot No.
  • si-RNAs specific for caspase -3, -6, -8 and -9 were obtained from Sigma-aldrich. Stealth universal RNAi (Santa cruz) was used as a non-specific control and transformed (transfected) using Lipofectamine TM 2000 Trans feet ion reagent (Invitrogen, Cat. No. 18324—012) according to the manufacturer's protocol. . caspase-3 inhibitor (Cat No. 219002), caspase-6 inhibitor (Cat No. 218757), caspase-8 inhibitor (Cat No. 368055) and caspase-9 inhibitor (Cat No. 218776) were obtained from calbiochem. The caspase inhibitors were treated at a concentration of 14 uM under serum-free conditions.
  • Anti-KRS antibodies were used to perform immunoblotting of endogenous KRS.
  • Antibodies against Hsp90, syntenin-1, GFP, myc, caspase-3, -6, -8, -9, syntenin-1 were purchased from santa cruz—the company for alix Antibodies were purchased from cell signaling.
  • the anti-KRS antibody is expressed in KRSCGenbank Accession No.
  • NP_005539.1 The protein was injected into New Zealand white rabbits to cause an immune reaction, and then prepared by the usual procedure of obtaining an antibody against it.
  • cells were treated with 50 mM HEPES (pH 7.4) buffer containing 150 mM NaCl, 0.5% NP-40, 2 mM EDTA, 5% glycerol and protease inhibitors (Calbiochem, San diego, Calif., USA). Dissolved at 4 ° C. Protein extracts were incubated at 4t with each protein specific antibody. And protein G agarose was added. 4 hours after protein G agarose was added, the sample was centrifuged to obtain a precipitate sample. Precipitation samples were washed three times for 5 minutes, using cold lysis buffer. The precipitates were separated by SDS-PAGE.
  • HCT116 cells were cultured in RPMI medium containing 10% FBS (Hyclone),
  • the supernatant was discarded and the remaining pellet was neutralized with 100 mM HEPES ph8.0, and then separated by SDS-PAGE by adding 5 X sample buffer.
  • the product separated by SDS-PAGE was western blotting with anti-KRS antibody.
  • CDNA encoding the human KRS of SEQ ID NO: 2 was subcloned to pET-28a (Novagen) using EcoRI and Xh restriction enzymes, and then overexpressed by introduction into Escherichia coli BL21 (DE3). . Then, his-tagged KRS was purified using nickel affinity (Invitrogen) and Mono Q ion-exchange chromatography according to the manufacturer's protocol. In order to remove the lipopolysaccharide (LPS), a solution containing KRS was dialyzed in pyrogen-free buffer. In order to remove the remaining LPS, the KRS solution was dialyzed once again in PBS containing 20% glycerol and filtered through a Pos dyne membrane (Pal 1 Gel man Laboratory). ⁇ 253>
  • HCT116 cells were cultured for 4 hours under starvation conditions (starvat ion conditions, serum-free conditons) transfected with both KRS-VN173 plasmid and syntenin_l_VC155 plasmid.
  • the HCT116 cells were placed on a 9 ⁇ covers lip, fixed with 4% paraformaldehyde, and briefly washed with cold PBS. After incubation with 53 ⁇ 4 BSA blocking buffer for 1 hour, DAPI staining was performed for 10 minutes. Again wash with cold PBS 6 times for 5 minutes and mount on slide glass. The specimens were then observed with confocal Laser Scanning Microscopy Al, Nikon.
  • HCT116 cells After HCT116 cells have been incubated for a certain time in each treatment condition (especially serum-starvation condidion), the medium is separated and subjected to continuous centrifugation. Three times 500g (10 minutes), 10,000g (30 minutes), 100,000g (90 minutes) to form a microvesicle pellet. The amount of microvesicle protein was analyzed by Bradford assay.
  • microvesicles 100,000 g pelletized microvesicles were placed on a continuous opti-prep gradient gradient and centrifuged at 150,000 g for 15 hours. Nine fractions were obtained, the density was measured by refractive index, and then resuspended in SDS-PAGE sample buffer and immunoblotted using specific antibodies.
  • Luciferase activity was calculated using FLUOstar 0PTIMA (BMG LABTECH). After the introduction of BiFC-reniUa luciferase KRS plasmid and firefly luciferase plasimd, the cells were cultured in starvation (serum free media). After removing the medium, cells were washed with PBS. Lysis buffer (Promega, Madison, WI) 80ul / well was added to each well, gently shaken for 15 minutes at room temperature. Cell lysates were recovered and used for luciferase assay.
  • RAW264.7 cells were aliquoted onto the coverslip and incubated at 95% or more.
  • RAW264.7 cells (2 ⁇ 10 4 ) containing DMEM containing 10% FBS and 1% antibiotic
  • the cells were incubated for 2 hours in a 24-well plate and starved (starvation) in serum-free media for 2 hours.
  • Each KRS protein (FT, AN12, respectively) ⁇ and KRS exosomes (0.05, 0.5, 5 ug) were added for 6 hours, and then cell media were recovered by centrifugation at 3,000 g for 5 minutes.
  • TNF-alpha ELISA kit (Pharmingen, BD Science) was used according to the manufacturer's protocol to detect the secreted TNF-alpha from the cells.
  • the transwel 1 cell culture chamber 24-wel 1 piate (6.5 mm insert with 5.0 uM polycarbonate membrane) was purchased from Costar.
  • the 5 uM inserts were coated with 0.5 uL gelat in (Sigma) 10 uL and dried overnight under UV.
  • RAW264.7 cells were suspended in Serum—Free DMEM and added to the insert to the order of lX10 5 cells, and each well treated with BSA ( ⁇ ), KRS ( ⁇ 12) (100 ⁇ ), si-control or si_K S.
  • Exosomes (5ug / ml) purified from the cells were treated and incubated at 37 ° C for 8 hours in a 5% CO 2 incubator.
  • Imaging process ⁇ ⁇ was for motorized XYZ translational stage (MPC-200-R0E, Instrument Sutter) lyrics with a resolution of for ⁇ .
  • LysM-GFP Lysozyme M-GFP mice were used (N. Faust et al., 2000). Male LysM-GFP mice at 12-20 weeks of age were deeply anesthetized by intraperitoneal injection of Zoletil® (30 mg / kg) and xylazine (Rompun®, 10 mg / kg). The body temperature of the mice was maintained at 37 ° C. using a homeothermic controller (PhysioSuite TM, Right Temp TM, Kent Scientific) during the imaging process. Mouse ear skin was shaved at least 12 hours prior to imaging to eliminate the possibility of an immune reaction occurring by hair removal.
  • PhysioSuite TM Right Temp TM, Kent Scientific
  • B16F10 cells were transformed with Lipofectamine 3000 (Invitrogen, 11668027) with KRS-myc, D12A-myc or empty vector.
  • the transformed B16F10 cells were fluorescently labeled with the lipophilic fluorescent dye Vybrant DiD solution (V-22887, Life Technologies), and this procedure was performed for 1 hour after adding 5yL DiD solution per 1 ml of cell medium. It was performed by incubation. After washing three times with PBS, labeled cells were prepared by suspension in PBS solution (4xl0 4 cel ls were injected into the mouse ear skin using a 0.4 mi ll ion cel ls / u D. 31G microinjector. To visualize macrophage / neutrophil recruitment along the dice, t ime-lapse images were taken at 30 min intervals up to 90 min after injection.
  • Luminex screening assays (bead-based mul itplex kits)
  • RAW 246.7 cells were treated with DMEM medium containing 10% FBS and a) antibiotics.
  • the cells were incubated for 12 hours on a 12-wel l-plate and starved to cells in serum-free media for 2 hours.
  • Different amounts of KRS protein (WT, AN12, respectively) and KRS exosomes (5ug) were added to the medium.
  • condit ioned media was collected and spun down by centrifugation at 3,000 g for 10 minutes.
  • premixed beads for TNF-alpha, mCRG-2, IL-6, mIL-lbeta, mIL-12, mIL-10, MMP9, INF-gamma, mMIP3a and CXCL10 were obtained from R & D Science. It was purchased and used according to the manufacturer's protocol. Each sample was analyzed by BioRad Bioplex 200 system and software.
  • KRS protein is known to be secret ion in cancer cel l, causing inflammatory response by increasing TNF-alpha secret ion and macrophage migrat ion through macrophage.
  • KRS is known to produce secret ions during serum starvat ion and increase secret ions when TNF-alpha is treated simultaneously. How this KRS becomes a secret ion is not yet known.
  • Myc-KRS K S-myc plasmid was transfected into HCT116 eel I and observed KRS secret ion by western blot, it was confirmed that N-terminal was cleaved when KRS secret ion ( See also la).
  • N-renilla-RS-C-renilla plasmid was used to ensure that KRS was cut during starvation. Normally, the renilla half of the KRS N-terminal and the other half of the renilla of the KRS C-terminal combine to have renilla luciferase activity. Experiments were performed after transfection of N-reni 1 la-KRS—C-reni 11a plasmid and firefly luciferase plasmid into HCT116 cells.
  • proteases are present in the cell, and certain proteases perform a process of recognizing and recognizing specific sequences they can recognize.
  • the sequence of KRS has the possibility of being cut by 3, 6 and 8.
  • KRS secret ion after treating inhibitors that inhibit Caspase-3, -6, -8, and -9.
  • Experimental results show that only caspase-8 inhibi tor inhibits KRS secret ion (see FIG. 2F).
  • KRS secret ion was reduced only when caspase-8 was reduced in the same manner as the experiment with inhibitor. (See FIG.
  • the cytokine act ivi ty of KRS was measured in order to answer the question why the process cut by caspase-8 is important for KRS secret ion.
  • the cleavage process depends on the cytokine act ivi ty.
  • the cytokine act ivi ty of WT and AN12 mutant (13-597a.a) was identical.
  • the truncation process of KRS is performed between KRS and other proteins. I thought it would dominate binding affinity.
  • KRS has already demonstrated that it can bind syntenin-1 protein in previous papers. Syntenin-1 is a trafficking protein that serves to transport bound proteins in cells.
  • KRS binds to syntenin-1 with a specific sequence of c—terminal.
  • the C-terminal of this KRS is structurally likely to be covered by the N-terminal. Therefore, in the case of KRS cut N-terminal, the sequence that binds to syntenin-1 will be revealed more and binding affinity with syntenin will be increased.
  • this part was also conserved in higher eukaryotes similarly to the part cut by caspase-8 (see FIG. 3A).
  • FIG. 3b TNF-alpha treatment
  • deletion mutant that cut the c-terminal of KS to confirm that the c-terminal of KRS is important for binding to syntenin (corresponding to 1-592 a.a for the full length sequence of SEQ ID NO: 2, also denoted as Ac5)
  • the binding to syntenin was confirmed by fabrication.
  • Deletion Mutant (1—592a.a, Ac5) was able to bind to the syntenin was significantly lower than WT (see Figure 3g).
  • the degree of secretion was verified using KRS deletion mutant (l-592a.a, Ac5) and KRS WT, which could not bind to syntenin.
  • deletion mutant (Ac5) was less secreted compared to WT (Fig. 3h) Reference).
  • the N-terminal cutting revealed the syntenin binding mot if present in the c-terminal of KRS, which revealed that the binding of syntenin and KRS is increased, and this increased binding to syntenin is important for KRS secretion. It was.
  • Exosomes are known as mediators of cell-cell signaling. Exosome has various information such as specific protein, mi-RNA and tRNA. Due to the characteristics of these exosomes, this information is passed from cell to other cells, and the information that has been transferred causes the cell to play a role different from the original. Check the function of KRS exosomes . To this end, KRS WT, truncated KRS (AN12 (13-597a.a)) and KRS exosomes were treated with macrophage for 5 hours to confirm their TNF-alpha secretion effects.
  • KRS exosomes had an effect of increasing TNF-alpha secretion like KRS proteins (see FIG. 5A). These results demonstrate that KRS protein and KRS exosome have the same effect. To prove this once again, we confirmed the increase in migration using macrophage cells. As a result of the Wound-healing assay, the treatment of KRS protein (WT, AN12 (13-597a.a) and KRS exosomes) and the macrophge migration was increased 12 hrs later (see FIG. 5B). KRS exosomes showed the same effect as KRS protein.
  • KRS fragment contained in the KRS exosome proved to be involved in the activity of the KRS exosome, which indicates that the cutting process of the KRS is important for the activity of the KRS exosome. Therefore, KRS is cleaved by caspase-8, which enhances binding to syntenin and increases the transport to exosomes, thereby enhancing KRS exosome activity.
  • the cells were first treated with si-RNA (si-con, si-KRS, respectively). After 48 hours of si-RNA treatment, cells were grown for 12 hours in serum free starvation media. After purification of the exosomes in this media, proteins present in each exosome were analyzed (hereinafter, for convenience, si-con exosomes and si ⁇ KRS-treated cells were purified from the media of si-con-treated cells. The purified exosomes in the media are called si-KRS exosomes). As a result, it was confirmed that the KRS protein present in the exosome was enjoyed in the purified exosomes in the cells treated with si-KRS (FIG. 6A).
  • B16F10 cell Mus musculus skin melanoma
  • B16F10 cells were used because immune reactions were caused by species differences.
  • B16F10 cells were transformed with KRS WT-myc and KRS D12A-myc and grown for 24 hours. After 24 hours, 4xl0 4 cells are injected into the skin behind the ear of LysM-GFP (Lysozyme M-GFP) mouse (GFP expressed in macrophage and neutrophil). After injection, macrophage and neutrophil gathered during the time course.
  • KRS proteins KRS-WT, KRSAN12
  • KRS exosomes were used to identify various inflammatory cytokine secret ions.
  • Mouse CRG-2 is a protein belonging to cxc chemokine that enhances macrophage recruitment.
  • IL-6 acts on cancer cells to lower E-cadherin.
  • KRS exosomes KRS expressed Inflammatory reactions caused by exosomes are expected to play a role in cancer eel 1 metastasis, and KRS, which plays an important role in eX0S0 me activity, may play an important role in cancer metastasis.
  • the present invention includes an amino acid sequence represented by SEQ ID NO: 1 and is secreted from cancer cells lysyl TNA synthase (KRS) fragment, microvesicle comprising the KRS fragment and cancer diagnosis using them
  • KRS lysyl TNA synthase
  • the present invention relates to a method for screening a cancer metastasis inhibitor and to provide information necessary for the present invention.
  • the present invention can be usefully used for developing a diagnostic kit or cancer metastasis inhibitor for providing information for cancer diagnosis. Big.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Biophysics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)

Abstract

본 발명은 서열번호 1로 표시되는 아미노산 서열을 포함하며 암세포로부터 분비되는 라이실 티알엔에이 합성효소 (KRS) 단편, 상기 KRS 단편을 포함하는 마이크로베지클 및 이들을 이용하여 암 진단에 필요한 정보를 제공하고 암 전이 억제제를 스크리닝하는 방법에 관한 것으로, 본 발명은 암 진단에 필요한 정보를 제공하기 위한 진단 키드 개발 또는 암 전이 억제제 개발에 유용하게 이용될 수 있어 산업상 이용가능성이 크다.

Description

【명세서】
【발명의 명칭】
신규한 라이실 티알엔에이 합성효소 단편 및 이를 포함하는 마이크로베지클 【기술분야】
<ι> 본 출원은 2014년 5월 28일에 출원된 대한민국 특허출원 게 10-2014-0064612 호를 우선권으로 주장하고， 상기 명세서 전체는 본 출원의 참고문헌이다.
<2> 본 발명은 신규한 라이실 티알엔에이 합성효소 단편 및 이를 포함하는 마이 크로베지클에 관한 것으로， 보다 상세하게는 서열번호 1로 표시되는 아미노산 서열 을 포함하며 암세포로부터 분비되는 라이실 티알엔에이 합성효소 (KRS) 단편， 상기 KRS 단편을 포함하는 마이크로베지클 및 이들을 이용하여 암 진단에 필요한 정보를 제공하고 암 전이 억제제를 스크리닝하는 방법에 관한 것이다.
<3>
【배경기술】
<4> 암 (또는 종양)은 비정상적이고 비제어성이며 무질서한 세포증식의 산물이다. 특히， 파괴적인 성장성 침투성 및 전이성이 있다면 악성으로 분류된다. 침투성이 란 주위 조직을 침투 또는 파괴하는 성질로서， 일반적으로 조직의 경계를 이루는 기저층을 파괴시켜 종양이 국부적으로 전파되는 것을 의미하며， 종종 체내의 순환 계로도 유입된다. 전이란 일반적으로 림프관 ( lymphot ic) 또는 혈관에 의해 원발 위 치와는 다른 곳으로 종양 세포가 퍼지는 것을 의미한다. 전이는 또한 장액성 체강 또는 다른 공간을 통해 직접 신장하여 종양 세포를 이동시키는 것을 의미하기도 한 다. 이러한 암을 치료하기 위해서는， 먼저 치료 이전의 단계에서 높은 정확도와 특 이도를 가진 암의 진단 방법의 개발이 무엇보다 중요하며， 나아가 암 (및 이의 전 이)에 대한 예후를 예측하여 맞춤형 진단 및 치료가 요구되고 있다.
<5>
<6> 한편， 사이토킨은 많은 세포에서 분비되는데， 그 중에서도 특히 면역세포에 서 분비된다. 또한 사이토킨은 세포의 증식, 분화, 이동， 세포자살 등을 조절하는 세포 간 신호를 전달한다. 사이토킨들은 세포 내에서는 기능이 없기 때문에， 효과 가 있기 위해서는 분비가 돼야만 한다. 대부분의 사이토킨들은 소포체로 향하는 시 그널 펩티드 서열을 아미노 말단에 포함하고 있다. COP I I 복합체가 사이토킨들을 소포체에서 골지체로 운반하면, 사이토킨들은 세포 외로 분비된다. 즉， 세포 내에 존재하는 전형적인 (classical ) 사이토킨들， 예를 들어 TNF-alpha, TGF-beta, IL1- beta는 세포 내의 기능이 없고， 시그널 펩티드 서열을 가지고선 ER-golgi를 거쳐서 세포 외부로 분비 되어서 기능을 한다.
<7> 비 전형적인 (non-classical) 사이토킨들은 세포 내에서도 기능을 하기 때문 에， 아미노 말단에 시그널 펩티드 서열을 갖고 있지 않다. 이런 이유로， 비 전형적 인 사이토킨들은 비 보편적인 분비 경로를 통해 분비되는데， 비 보편적인 분비 경 로로는 분비 매개 운반체， 외포작용 (microvesicle shedding), 액소좀 방출， 분비성 라이소좀 등이 있다. 상기 비 전형적 분비경로들 중에서 엑소좀은 세포 내 단백질， mRNA, micro RNA 등의 세포 내 분자들을 운반한다. 액소좀은 직경 30-100 nm인 막 유래 마이크로베지클이다. 액소좀은 다포성소체 (MVBs) 내부에서 기원하여, 세포막 에서 유래한 엔도좀과 흔합되어 세포 외로 방출된다. 여러 세포들 중 암세포와 면 역 세포들은 세포 간 상호작용을 매개하기 위해 액소좀을 방출한다.
<8> K S는 단백질 합성을 위하여 동족의 (cognate) 아미노산 및 tRNA를 접합시키 는 aminoacyl-t-RNA synthetases (ARSs)^ 속한다. 이들 원시 효소들은 촉매적 활성 외에도 다면적 (pleiotropic) 특징을 갖는다 (Park, S. G. , Ewalt, K. L. & Kim, S. Functional expansion of arainoacyl-tRNA synthetases and their interacting factors- new perspectives on housekeepers . Trends Biochem. Sci . 30 , 569-574 (2005)). 이에 반해, KRS를 포함한 몇몇 포유류의 ARS는 구성 단백질의 다양한 기 능을 조절하기 위하여， 분자 저장소 (molecular reservoir)로서 작용하는 (Ray, P. S. , Arif, Α. & Fox, P. Macromolecular com lexes as depots for releasable regulatory proteins. Trends Biochem. Sci. 32, 158-164 (2007)) 거대분자 복합체 를 형성한다 (Lee, S. W. , Gho, B. H.,Park, S. G. & Kim, S. Aminoacyl-tR A synthetase complexes: beyond translation. J . Cell. Sci . 117, 3725ᅳ 3734 (2004)； Han, J. M. , Kim, J. Y. & Kim, S. Molecular network and functional impl icat ions of macromolecular tRNA synthetase com 1 ex . Biochem. Biophys . Res. Co腦 un. 303， 985-993 (2003)).
<9> KRS 단백질은 cancer cell에서 secretion되어서 macrophage를 통한 TNF- alpha secret ion과 macrophage migration을 증가시켜서 염증반웅을 일으킨다고 알 려져 있다. KRS는 serum starvation시에 secretion이 일어나고 TNF-alpha를 동시에 처리 했을 때 secret ion이 증가되는 것으로 알려져 있다. 이러한 KRS가 어떻게 secret ion이 되는 가에 대해선 아직 알려진 바가 없다 .
<ιο> [비특허문헌 1] K. Choe, Y. Hwang, H. Seo, and P. Kim, "In vivo high spatiotemporal resolution visualization of circulating T lymphocytes in high endothelial venules of lymph nodes. ,"
J. Biomed. φί . ,vol .18,no.3,p.036005 ' Mar .2013.
<n> [비특허문헌 2] N. Faust , F. Varas, L. M. Kelly, S. Heck, and T. Graf,
"Insertion of enhanced green fluorescent protein into the lysozyme gene creates mice with green fluorescent granulocytes and macrophages , " vol . 96, no. 2, pp. 719726, 2000.
<12>
【발명의 상세한 설명】
【기술적 과제】
<13> 이에 본 발명자들은 KRS의 분비기작에 관하여 연구하던 중， 세포 외 분비를 위하여 KRS가 caspase— 8에 의해 필수적으로 절단되고 상기 절단에 의해 생성된 KRS 단편이 엑소좀을 통해 세포 외로 분비된다는 신규한 사실을 규명하여， 상기 KRS 단 편과 이를 포함하는 마이크로베지클 (특히 액소좀)의 암 진단 및 암 전이 억제제 스 크리닝 용도를 확인하고 본 발명을 완성하였다.
<14>
<15> 따라서 본 발명의 목적은 서열번호 1로 표시되는 아미노산 서열을 포함하며， 암세포로부터 분비되는 라이실 티알엔에이 합성효소 단편을 제공하는 것이다.
<16>
<17> 본 발명의 다른 목적은 상기 라이실 티알엔에이 합성효소 단편을 포함하는 암세포에서 분비되는 마이크로베지클을 제공하는 것이다.
<18>
<19> 본 발명의 다른 목적은 (a) 암이 의심되는 개체로부터 채취한 생물학적 시료 에서 마이크로베지클을 분리하는 단계; (b) 상기 (a) 단계의 마이크로베지클을 파 쇄하여 서열번호 1의 라이실 티알엔에이 합성효소 단편 수준 또는 상기 단편을 암 호화하는 유전자의 발현 수준을 측정하는 단계; 및 (c) 상기 단편 수준 또는 상기 단편을 암호화하는 유전자의 발현 수준을 정상 대조군 시료의 상기 단편 수준 또는 상기 단편을 암호화하는 유전자의 발현 수준과 비교하는 단계를 포함하는 암 진단 에 필요한 정보를 제공하는 방법을 제공하는 것이다.
<20>
<2i> . 본 발명의 또 다른 목적은 (A) 라이실 티알엔에이 합성효소 (KRS) 또는 이의
C-터미널 영역을 포함하는 KRS 단편， 신테닌 (syntenin) 및 시험제제를 접촉시키는 단계; (B) 상기 KRS 또는 이의 단편과 신테닌의 결합수준의 변화를 측정하는 단계; 및 (C) 상기 KRS 또는 이의 단편과 신테닌의 결합수준을 변화시킨 시험제제를 암세 포에 접촉시켜， 상기 암세포로부터 서열번호 1의 라이실 티알엔에이 합성효소 단편 을 포함하는 마이크로베지클이 분비되는지 여부를 확인하는 단계를 포함하는 암 전 이 억제제 스크리닝 방법올 제공하는 것이다.
<22>
【기술적 해결방법】
<23> 본 발명의 목적의 달성하기 위해 , 본 발명은 서열번호 1로 표시되는 아미노 산 서열을 포함하며， 암세포로부터 분비되는 라이실 티알엔에이 합성효소 단편을 제공한다.
<24>
<25> 본 발명의 다른 목적을 달성하기 위해， 본 발명은 상기 라이실 티알엔에이 합성효소 단편을 포함하는 암세포에서 분비되는 마이크로베지클을 제공한다.
<26>
<27> 본 발명의 다른 목적을 달성하기 위해， 본 발명은 (a) 암이 의심되는 개체로 부터 채취한 생물학적 시료에서 마이크로베지클을 분리하는 단계; (b) 상기 (a) 단 계의 마이크로베지클을 파쇄하여 서열번호 1의 라이실 티알엔에이 합성효소 단편 수준 또는 상기 단편을 암호화하는 유전자의 발현 수준을 측정하는 단계; 및 ( c ) 상기 단편 수준 또는 상기 단편을 암호화하는 유전자의 발현 수준을 정상 대조군 시료의 상기 단편 수준 또는 상기 단편을 암호화하는 유전자의 발현 수준과 비교하 는 단계를 포함하는 암 진단에 필요한 정보를 제공하는 방법을 제공한다.
<28>
<29> 본 발명의 또 다른 목적을 달성하기 위해， 본 발명은 (A) 라이실 티알엔에이 합성효소 (KRS) 또는 이의 C-터미널 영역을 포함하는 KRS 단편, 신테닌 (syntenin) 및 시험제제를 접촉시키는 단계; (B) 상기 KRS 또는 이의 단편과 신테닌의 결합수 준의 변화를 측정하는 단계; 및 (C) 상기 KRS 또는 이의 단편과 신테닌의 결합수준 을 변화시킨 시험제제를 암세포에 접촉시켜， 상기 암세포로부터 서열번호 1의 라이 실 티알엔에이 합성효소 단편을 포함하는 마이크로베지클이 분비되는지 여부를 확 인하는 단계를 포함하는 암 전이 억제제 스크리닝 방법을 제공한다.
<30>
<31> 이하 본 발명을 상세히 설명한다 .
<32>
<33> <34> 다른 정의가 없는 한 본 명세서에 사용된 모든 기술적 및 과학적 용어는 당 업자들에 의해 통상적으로 이해되는 동일한 의미를 가진다. 다음의 참고문헌은 본 발명의 명세서에 사용된 여러 용어들의 일반적인 정의를 갖는 기술 (ski l l )의 하나 를 제공한다. Singleton et al . , DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY (2d ed. 1994)； THE CAMBRIDGE DICTIONARY OF SCIENCE AND TECHN0L0GY(Walker ed.， 1988)； 및 Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY. 또한 다음의 정의는 본 발명의 실시를 위해 독자 (reader) 에게 도움을 주기 위해 제공된다.
<35>
<36> 본 명세서에서 용어 "단백질' '은 "폴리펩티드 (polypept ide) " 또는 "펩티드
(pept ide) ' '와 호환성 있게 사용되며， 예컨대, 자연상태의 단백질에서 일반적으로 발견되는 바와 같이 아미노산 잔기의 중합체를 말한다.
<37>
<38> 본 발명에서 "핵산'' 또는 "폴리뉴클레오티드" 는 단일 -또는 이중-가닥의 형 태로 된 데옥시리보뉴클레오티드 또는 리보뉴클레오티드를 말한다. 다른 제한이 없 는 한, 자연적으로 생성되는 뉴클레오티드와 비슷한 방법으로 핵산에 흔성화되는 자연적 뉴클레오티드의 공지된 아날로그도 포함된다.
<39>
<40> 본 발명은 서열번호 1로 표시되는 아미노산 서열을 포함하며， 암세포로부터 분비되는 라이실 티알엔에이 합성효소 단편 (KRS 단편)을 제공한다.
<41>
<42> 본 발명에서 "KRS"는 당업계에 라이실 티알엔에이 합성효소로 알려져 있는 전장 (全長) 폴리펩티드를 말한다. 상기 KRS는 당업계에 라이실 티알엔에이 합성효 소로 알려진 것이라면 그 구체적 아미노산 서열이 특별히 제한되지 않으나， 예를 들어 서열번호 2(Genbank Accession No . NP_005539.1) , 서열번호 3(Genbank Accession No . NP_001123561.1) 등을 포함한다. 본 발명에서 KRS는 바람직하게 서 열번호 2(Genbank Accession No. NP_005539.1)로 표시되는 아미노산 서열로 이루어 지는 폴리펩티드를 의미하는 것 일 수 있다. "
<43>
<44> 본 발명에서 용어 "KRS 단편" 은 상기 KRS 폴리펩타이드 전장 서열에 대한 일부 단편을 의미하는 것으로서， 본 발명의 KRS 단편은 바람직하게 공지의 인간 KRSCGenbank Accession No . NP_005539.1)의 N-말단으로부터 1 내지 12번째 아미노 산이 결실된 형태의, 서열번호 1로 표시되는 단편을 의미한다. 본 발명자는 암세포 로부터 기존에 KRS 단백질로 알려진 폴리펩타이드의 전장 서열이 분비되는 것이 아 니라， KRS가 세포 내에서 가공되어 일부 영역이 절단된 KRS 단편 (서열번호 1) 형태 로 분비되고 이때 엑소좀 등의 마이크로베지클을 그 분비 수단으로 이용하며， 이러 한 과정은 암 전이의 미세환경 조성에 관여하는 상기 K S 유래 성분이 활성을 나타 내는데 있어서 필수 블가결하다는 사실을 밝혔으며， 이는 본 발명에서 최초로 공개 하는 것이다. 이는 본 발명의 명세서 실시예에 잘 나타나 있다.
<45>
<46> 본 발명은 바람직하게 , 서열번호 1로 표시되는 아미노산 서열로 이루어지며 암세포로부터 분비되는 라이실 티알엔에이 합성효소 단편을 제공하며， 상기 본 발 명의 KRS 단편은 이의 기능적 동등물을 포함하는 의미 일 수 있다.
<47> 상기 기능적 동등물이란 서열번호 1로 표시되는 아미노산 서열과 적어도 70¾ 이상， 바람직하게는 80% 이상， 보다 바람직하게는 90% 이상의 서열 상동성 (즉， 동 일성)을 갖는 폴리펩티드를 말한다. 예를 들면, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100 )의 서열 상동성을 갖는 폴리펩 티드를 포함하는 것으로, 서열번호 1로 표시되는 폴리펩티드와 실질적으로 동질의 생리활성을 나타내는 폴리펩티드를 말한다. 상기 기능적 동등물은 서열번호 1의 아 미노산 서열 중 일부가 부가， 치환 또는 결실의 결과 생성될 것 일 수 있다. 상기 에서 아미노산의 치환은 바람직하게는 보존적 치환이다. 천연에 존재하는 아미노산 의 보존적 치환의 예는 다음과 같다 지방족 아미노산 (Gly, Ala, Pro) , 소수성 아미 노산 ( l ie, Leu, Val ) , 방향족 아미노산 (Phe, Tyr , Trp) , 산성 아미노산 (Asp, Glu) , 염기성 아미노산 (Hi s , Lys , Arg, Gin, Asn) 및 황함유 아미노산 (Cys , Met ) . 또한 상기 기능적 동등물에는 본 발명의 KRS 단편 폴리펩티드의 아미노산 서열상에서 아 미노산의 일부가 결실된 변형체도 포함된다. 상기 아미노산의 결실 또는 치환은 바 람직하게는 본 발명의 폴리펩티드의 생리활성에 직접적으로 관련되지 않은 영역에 위치해 있다. 또한 아미노산의 결실은 바람직하게는 KRS 단편 폴리펩티드의 생리활 성에 직접 관여하지 않는 부분에 위치한다. 아울러 상기 KRS 단편 폴리펩티드의 아 미노산 서열의 양 말단 또는 서열 내에 몇몇의 아미노산이 부가된 변형체도 포함된 다. 또한 본 발명의 기능적 동등물의 범위에는 본 발명에 따른 폴리펩티드의 기본 골격 및 이의 생리 활성을 유지하면서 폴리펩티드의 일부 화학 구조가 변형된 폴리 펩티드 유도체도 포함된다. 예를 들어， 본 발명의 폴리펩티드의 안정성， 저장성， 휘발성 또는 용해도 등을 변경시키기 위한 구조변경이 이에 포함된다.
<48>
<49> 본 명세서에서 서열 상동성 및 동질성은 KRS 단편의 아미노산 서열 (서열번호
1)과 후보 서열을 정렬하고 갭 (gaps)을 도입한 후 KRS 단편의 아미노산 서열에 대 한 후보 서열의 아미노산 잔기의 백분율로서 정의된다. 필요한 경우， 최대 백분율 서열 동질성을 수득하기 위하여 서열 동질성의 부분으로서 보존적 치환은 고려하지 않는다. 또한， KRS 단편의 아미노산 서열의 N-말단， C-말단 또는 내부 신장， 결손 또는 삽입은 서열 동질성 또는 상동성에 영향을 주는 서열로서 해석되지 않는다. 또한， 상기 서열 동질성은 두 개의 폴리펩티드의 아미노산 서열의 유사한 부분을 비교하기 위해 사용되는 일반적인 표준 방법에 의해 결정할 수 있다. BLAST 또는 FASTA와 같은 컴퓨터 프로그램은 두 개의 폴리펩티드를 각각의 아미노산이 최적으 로 매칭되도록 정렬한다 (하나 또는 두 서열의 전장서열을 따라 또는 하나 또는 두 서열의 예측된 부분을 따라) . 상기 프로그램은 디펄트 오프닝 페널티 (defaul t opening penalty) 및 디필트 갭 페널티 (defaul t gap penal ty)를 제공하며 컴퓨터 프로그램과 함께 연계되어 사용될 수 있는 PAM250 표준 스코링 매트릭스 Dayhof f et al . , in At las of Protein Sequence and Structure , vol 5， supp 3， 1978)와 같 은 스코링 매트릭스를 제공한다. 예를 들어， 백분율 동질성은 다음과 같이 계산할 수 있다. 일치하는 서열 ( ident ical matches)의 총 수에 100을 곱한 다음 대웅되는 스팬 (matched span) 내의 보다 긴 서열의 길이와 두 서열을 정렬하기 위해 보다 긴 서열 내로 도입된 갭 (gaps)의 수의 합으로 나눈다.
<50>
<5i> 본 발명에 따른 KRS 단편은 천연에서 추출하거나 유전공학적 방법에 의해 작 제될 수 있다. 예를 들면， 통상적인 방법에 따라 상기 KRS 단편 또는 이의 기능적 동등물올 암호화하는 핵산 (예를들어， 서열번호 5의 폴리뉴클레오타이드 서열)을 작 제한다. 상기 핵산은 적절한 프라이머를 사용하여 PCR 증폭함으로써 작제할 수 있 다. 다른 방법으로 당업계에 공지된 표준 방법에 의해, 예컨대， 자동 DNA 합성기 (Biosearch 또는 Appl ied Biosys terns 사에서 판매하는 것)을 사용하여 DNA 서열을 합성할 수도 있다. 작제된 핵산은 이에 작동가능하게 연결되어 (operat ively l inked) 핵산의 발현을 조절하는 하나 이상의 발현 조절 서열 (expression control sequence) (예: 프로모터， 인핸서 등)올 포함하는 백터에 삽입시키고， 이로부터 형 성된 재조합 발현 백터로 숙주세포를 형질전환 시킨다. 생성된 형질전환체를 상기 핵산이 발현되기에 적절한 배지 및 조건 하에서 배양하여， 배양물로부터 상기 핵산 에 의해 발현된， 실질적으로 순수한 폴리펩티드를 회수한다. 상기 회수는 당업계에 공지된 방법 (예컨대 , 크로마토그래피 )을 이용하여 수행할 수 있다. 상기에서 "실질 적으로 순수한 폴리펩티드 (substantially pure polypeptide)"라 함은 본 발명에 따 른 폴리펩티드가 숙주세포로부터 유래된 어떠한 다른 단백질도 실질적으로 포함하 지 않는 것을 의미한다. 본 발명의 폴리펩티드 합성을 위한 유전공학적 방법은 다 음의 문헌을 참고할 수 있다: Maniatis et al . , Molecular Cloning; A laboratory Manual , Cold Spring Harbor laboratory, 1982； Sambrook et al . , Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Press, N.Y. , Second(1998) and Third(2000) Edit ions Gene Expression Technology, Method in Enzymology, Genetics and Molecular Biology, Method in Enzymology, Guthrie & Fink(eds.), Academic Press , San Diego, Calif, 1991； 및 Hitzeman et al . , J. Biol . Chem. , 255:12073-12080, 1990.
<52> 또한, 본 발명의 폴리펩티드는 당업계에 공지된 화학적 합성 (Creighton,
Proteins; Structures and Molecular Principles, . H. Freeman and Co. , NY, 1983)에 의해 쉽게 제조될 수 있다. 대표적인 방법으로서 이들로 한정되는 것은 아 니지만 액체 또는 고체상 합성， 단편 응축, F-M0C 또는 T-B0C 화학법이 포함된다 (Chemical Approaches to the Synthesis of Peptides and Proteins, Williams et al., Eds. , CRC Press, Boca Raton Florida, 1997； A Practical Approach, At her t on & Sheppard, Eds. , IRL Press, Oxford, England, 1989) .
<53>
<54> 본 발명은 상기 라이실 티알엔에이 합성효소 단편을 포함하는 암세포에서 분 비되는 마이크로베지클을 제공한다.
<55>
<56> 본 발명에서 용어 '마이크로베지클' 은 세포막 성분으로 이루어진 지질 이중 층에 의해 내부와 외부가 구분되며 세포의 세포막 지질과 단백질， 핵산 및 기타 세 포 성분 등을 가지고 있고 원래 세포보다 크기가 작은 소낭입자를 의미한다.
<57>
<58> 본 발명에서 서열번호 1의 KRS 단편이 이의 세포외 분비 수단으로서 이용하 는 마이크로베지클은 액소좀， 액소좀 형태의 마이크로베지클 (exosome-like microvesicle, 엑소좀 유사 마이크로베지클), e ididimosomes , argosomes , promininosomes , prostasomes , dexosomes , texosomes , archeosomes 및 OTicosomes로 이루어진 군에서 선택되는 어느 하나의 마이크로베지클일 수 있다. 바람직하게 본 발명에서 마이크로베지클은 액소좀 또는 엑소좀 형태의 마이크로베지클 (exosome- l ike microvesi c le) 일 수 있으며, 가장 바람직하게는 액소좀인 것을 특징으로 한 다- 본 발명의 상기 마이크로베지클은 바람직하게 lOnm 내지 lOOOnm의 직경을 가 지는 것일 수 있고, 더욱 바람직하게는 lOnm 내지 200nm의 직경을 가지는 것 일 수 있고， 가장 바람직하게는 50nm 내지 150nm의 직경을 가지는 것일 수 있다. 본 발명의 KRS 단편 및 이를 포함하는 마이크로베지클은 암세포로부터 분비 되는 것이 특징으로， 상기 암은 유방암， 대장암， 폐암， 소세포폐암, 위암， 간암， 혈액암, 골암, 췌장암， 피부암, 두부 또는 경부암， 피부 또는 안구내 혹색종， 자궁 암， 난소암， 직장암， 항문부근암， 결장암， 유방암， 나팔관암종， 자궁내막암종, 자 궁경부암, 질암， 음문암종， 호지킨병， 식도암， 소장암， 내분비선암， 갑상선암， 부 갑상선암, 부신암， 연조직 육종， 요도암, 음경암， 전립선암， 만성 또는 급성 백혈 병， 림프구 림프종， 방광암, 신장암, 수뇨관 암, 신장세포 암종， 신장골반 암종, CNS종양， 1차 CNS 림프종, 척수 종양， 뇌간신경교종 및 뇌하수체 선종으로 이루어 지는 군에서 선택되는 하나 이상일 수 있으나, 이에 제한되지 않는다. 본 발명의 마이크로베지클은 in vivo상에서 생체 내 암세포로부터 자연적 으로 분비되나， 본 발명의 마이크로베지클을 다량으로 수득하기 위하여 하기와 같 은 단계를 포함하는 제조방법을 통해 in vitro 상에서도 분비를 유도할 수 있다; ( 1) 암세포에 기아 (starvat ion) 스트레스를 처리하는 단계; 및 (2) 상기 단계의 세 포에서 분비된 마이크로베지클을 수집하는 단계. 상기 ( 1) 단계에서는 암세포에 기아 (starvat ion) 스트레스를 부여하여, 세포 내에서 서열번호 1의 RS 단편을 생성 촉진하고 이들의 분비 기작을 활성화한다. 세포에 기아 스트레스를 부여하는 방법은 당업계에 공지되어있으며, 예를 들 어 혈청을 제거한 배지 (serum free-medi a)에서 암 세포를 배양하는 것 일 수 있다. 본 발명의 마이크로베지클을 분비할 수 있는 암 종류에 대해서는 전술한 바와 같 다.
또한 상기 ( 1) 단계에서는 상기 기아 스트레스와 더불어 TNF-alpha 를 처리 하는 공정이 추가적으로 수행될 수 있다. <69>
<70> 상기 (2) 단계는 상기 ( 1)단계의 세포로부터 생성되어 세포 외로 분비된 마 이크로베지클만을 분리 수득하는 단계이다. 상기 ( 1) 단계에서 세포에 기아 (starvat ion) 스트레스를 주며 배양된 세포 배양배지를 회수하여， 본 발명의 KRS 단편이 포함되어있는 것으로 추정되는 특정 크기 또는 /및 밀도의 구조물 (입자) 분 획을 회수한다.
<71> 흔합물로부터 목적하는 크기 또는 /및 밀도의 입자만을 분리 수득하는 방법은 당업계에 잘 알려져 있으며, 예를들어 밀도 구배， 원심분리 (ex . 초원심분리， 밀도 기울기원심법 등)， 여과 (ex . 특정 직경의 f i l ter를 사용하는 방법 등) , 투석， 및 자유 유동 전기 이동법 등이 포함된다. 상기 여러 가지 방법들을 하나 이상， 수회 반복 수행하여 목적하는 입자크기의 수득물을 얻을 수 있다.
<72> 한가지 실시 양태에서， 상기 (2) 단계에서는 전술한 방법을 통하여 10nm 내 지 lOOOnm의 직경을 가지는 마이크로베지클들올 수득하는 것이 바람직하다. 더욱 바람직하게는 10nm 내지 200nm의 직경을 가지는 마이크로베지클들을 수득할 수 있 으며， 가장 바람직하게는 50nm 내지 150rai의 직경을 가지는 마이크로 베지클들을 수득하는 것이 바람직하다.
<73>
<74> 또 한가지 실시 양태에서, 상기 (2) 단계에서는 전술한 방법을 통하여 1.09 g/ml 내지 1. 19g/ml의 밀도를 가지는 마이크로베지클들을 수득하는 것이 바람직할 수 있다. 가장 바람직하게는 1.09 g/ml 내지 1. 18g/ml의 밀도를 가지는 마이크로베 지클들을 수득하는 것이 바람직할 수 있다.
<75>
<76> 본 발명의 서열번호 1로 표시되는 KRS 단편은 마이크로베지클 (특히， 액소좀) 의 형태로 암세포에서 특이적으로 세포 외로 분비되므로 생체에서 암의 진단 마커 용도로서 이용될 수 있다. 뿐만 아니라 암 세포로부터의 자연적 작제물인 본 발명 의 마이크로베지클은 서열번호 1의 K S 단편을 세포 밖으로 분비하는 운반체로서, 암의 미세환경과 관련하여 주변 대식세포 및 호증구 (대식세포 /호중구)의 소집 및 암전이와 관련된 사이토카인의 분비를 촉진하여 암 조직 주변에 암 전이 환경을 조 성한다. 따라서 본 발명의 마이크로베지클은 암 진단 또는 암 전이의 진단을 위한 바이오마커로서 기능할 수 있다. 따라서 본 발명은 상기 서열번호 1의 아미노산 서 열로 이루어지는 KRS 단편 또는 상기 KRS 단편을 포함하는 마이크로베지클을 포함 하는 암 진단 또는 암의 전이 진단 마커 조성물을 제공한다. <77>
<78> 본 발명에서 용어 "진단" 은 질병 발생의 예측 및 질병 발생위험도를 결정하 거나 도출시키는데 사용되는 모든 유형의 분석을 포함한다.
<79>
<80> 본 발명에서 용어 "암 진단 마커" 란 암 조직 및 세포에서 발현되고 이의 발 현 여부를 확인함으로써 암의 발병을 확인할 수 있는 물질, 바람직하게는 정상조직 과 암 조직에서 유의한 차이를 보이는 단백질 또는 mRNA 등과 같은 유기 생체 분자 를 의미한다. 또한 본 발명에서 용어 "암의 전이 진단 마커 " 란 전이 (metastas i s) 의 징후를 보이는 암 세포에서 발현되고 이의 발현 여부를 확인함으로서 암의 전이 가능성 여부를 확인할 수 있는 물질， 바람직하게는 정상조직과 암 조직에서 유의한 차이를 보이는 단백질 또는 mRNA 등과 같은 유기 생체 분자를 의미한다. 본 발명의 목적상, 암 진단 마커 또는 암전이 진단 마커는 다양한 암 조직 및 세포에서만 특 이적으로 발현되는 서열번호 1로 표시되는 KRS 단편 또는 이를 포함하는 마이크로 베지클이며, 서열번호 1로 표시되는 KRS 단편 또는 이를 포함하는 마이크로베지클 이 세포 외로 분비되었는지 여부를 확인함으로써 암을 진단할 수 있다.
<81>
<82> 기존에 암을 진단하는 일반적인 방법은 초기 전이 상태에서 암이 발생된 것 으로 추정되는 조직의 일정부분을 떼어내어 조사하는 생검 (biopsy)인데， 정확한 생 검부위를 결정하는 것은 쉽지 않은 단점이 있다. 뿐만 아니라 조직 샘플링 시의 침 습정도에 따라 개체에 추가적인 손상 및 2차적 병증을 야기 (즉， 합병증)할 수 있다 는 위험성이 있다. 즉， 생물학적 마커에 대하여 대다수는 세포 내부에서 발현상태 를 유지하고 있으며， 이는 종종 해당 환부 조직의 채취를 위한 침습을 필요로 하 고， 상기 조직의 침습적 샘플링은 개체에 추가적인 병리상태를 야기 및 심화시킬 위험성이 존재한다.
<83> 그러나 본 발명의 마커는 암세포로부터 특수한 과정을 거쳐 가공 및 분비되 므로， 본 발명의 상기 마커를 대상으로하여 암 및 이의 전이 가능성 여부 진단에 이용하는 경우에는, 기존처럼 암의 환부로부터 직접적으로 조직을 채취하지 않고 도， 이보다 덜 침습적인 방법인 액체 생검 ( l iquid biopsy) 등의 방법으로도 암 (또 는 이의 전이 가능성) 여부를 진단 할 수 있다는 장점이 있다. 상기 액체 생검은 종양 환자의 생체 고형조직 대신 체액을 이용한 검사이다. 액체 생검은 기존 생체 조직검사에 비해 시료 채취가 간단하며, 환자의 고통 및 감염 위험성 등이 적은 것 으로 알려져 있다. <84>
<85> 또한， 본 발명은 상기 본 발명의 마커 (서열번호 1로 표시되는 KRS 단편 또는 이를 포함하는 마이크로베지클)의 존재 여부와， 그 양， 패턴 또는 양자 모두를 검 출하는 물질 (시약)을 포함하는 암 진단용 조성물을 제공한다. 상기 마커의 존재 여 부와, 그 양， 패턴 또는 양자 모두를 검출하는 물질은 본 발명의 마커에 특이적인 항체 일 수 있다.
<86> 본 발명의 한 실시 양태에서 , 서열번호 1로 표시되는 KRS 단편을 마커로 이 용하는 경우， 이의 존재 여부와， 그 양， 패턴 또는 양자 모두를 검출하는 것은 단 백질 수준에서의 검출 또는 상기 마커를 코딩하는 유전자 수준에서의 검출을 모두 포함하는 의미일 수 있으나， 본원에서는 바람직하게 단백질 수준에서의 검출을 의 미한다 . 이때 단백질 수준에서 검출할 수 있는 시약은 모노클로날 항체， 폴리클로 날 항체， 기질, 업타머， 수용체， 리간드 또는 보조인자, 또는 질량분광분석기 검출 용 시약 등을 포함하며， 이에 제한되지 않는다 .
<87> 상기 검출에 사용되는 물질 (시약)은, 본 발명의 서열번호 1로 표시되는 KRS 단편 또는 이를 포함하는 마이크로베지클을 전술한 바와 ¾은 방법으로 제조하여 이에 대한 분석을 기반으로 제작 및 선별될 수 있다.
<88> 또한 본 발명은 암 진단용 키트로서， 본 발명에 따른 마커를 검출하기 위한 시약과 이의 분석을 위한 장치 또는 알고리즘이 내장된 컴퓨터를 포함하는 암 진단 용 키트를 제공한다.
<89>
<90> 한가지 실시 양태에서， 상기 본 발명의 마커를 이용하여 암 (또는 암 전이 가 능성 여부) 진단에 필요한 정보를 제공하는 방법은 하기의 단계를 포함하여 수행되 는 것 일 수 있다;
<9i> ( a) 암이 의심되는 개체로부터 채취된 생물학적 시료에서 마이크로베지클을 분리하는 단계 ;
<92> (b) 상기 ( a) 단계의 마이크로베지클을 파쇄하여 서열번호 1의 라이실 티알 엔에이 합성효소 단편 수준 또는 상기 단편을 암호화하는 유전자의 발현 수준을 측 정하는 단계 ; 및
<93> ( C ) 상기 단편 수준 또는 상기 단편을 암호화하는 유전자의 발현 수준을 정 상 대조구 시료의 상기 단편 수준 또는 상기 단편을 암호화하는 유전자의 발현 수 준과 비교하는 단계 .
<94> <95> 이하 각 단계별로 설명한다 .
<96>
<97> (a) 단계에서는 암이 의심되는 개체로부터 채취된 생물학적 시료에서 마이크 로베지클을 분리한다.
<98>
<99> 본 발명에서 용어 '개체 (subject)' 란 암 진단 대상이 되는 동물을 의미하는 것으로， 바람직하게는 포유동물， 특히 인간을 포함하는 동물일 수 있다. 상기 개체 는 치료가 필요한 환자 (patient)일 수 있다.
<100>
<101> 상기 생물학적 시료는 암이 의심되는 개체로부터 분리 수득되는 것으로서， 본 발명에서 세포로부터 분비된 마이크로베지클을 수득할 수 있는 시료라면 그 종 류가 특별히 제한되지 않으며， 예를 들어 암종의 조직， 세포， 전혈 (혈액), 혈장, 혈청， 침, 안구액, 뇌척수액, 땀, 뇨, 젖， 복수액, 활액， 복막액， 림프액 등일 수 있으나 이에 한정되는 것은 아니다. 가장 바람직하게 상기 생물학적 시료는 뇨， 혈 액, 혈청 또는 림프액 일 수 있다. 시료는 검출에 사용하기 전에 전처리 할 수 있 다. 예를 들어， 여과， 증류， 추출， 농축， 방해 성분의 불활성화， 시약의 첨가 등을 포함할 수 있다.
<102>
<103> 상기 (a) 단계에서는 시료로부터 목적하는 마이크로베지클을 분리하며, 이때 흔합물로부터 목적하는 크기 또는 /및 밀도의 입자만을 분리 수득하는 방법은 당업 계에 잘 알려져 있다. 예를들어 밀도 구배 (ex. 피콜 (Ficoll), 글리세를 (Glycerol), 수크로즈 (Sucrose), 읍티프렙 (Opt i Prep™ ) 등에 의한 밀도 구배), 원심분리 (ex. 초 원심분리， 밀도기울기원심법 등)， 여과 (ex. 겔 여과 (gel filtration) 또는 한외여 과 (ultrafiltration) 등 특정 직경의 filter를 사용하는 방법 등), 투석， 및 자유 유동 전기 이동법 등이 포함된다. 상기 여러 가지 방법들을 하나 이상， 수회 반복 수행하여 목적하는 입자크기의 수득물을 얻을 수 있다.
<104> 한가지 실시 양태에서， 상기 (a) 단계에서는 전술한 방법을 통하여 10nm 내 지 lOOOnm의 직경을 가지는 마이크로베지클들을 수득하는 것이 바람직하다. 더욱. 바람직하게는 10nm 내지 200nm의 직경을 가지는 마이크로베지클들을 수득할 수 있 으며， 가장 바람직하게는 가장 바람직하게는 50nm 내지 150nm의 직경을 가지는 마 이크로 베지클들을 수득하는 것이 바람직하다.
<105> <i06> 또 한가지 실시 양태에서ᅳ 상기 ( a) 단계에서는 전술한 방법을 통하여 1.09 g/ml 내지 1.19g/ml의 밀도를 가지는 마이크로베지클들을 수득하는 것이 바람직할 수 있다. 가장 바람직하게는 1.09g/ml 내지 1.18 g/ml의 밀도를 가지는 마이크로베 지클들을 수득하는 것이 바람직할 수 있다.
<107>
<i08> (b) 단계에서는 상기 (a)단계에서 분리수득한 마이크로베지클을 파쇄하고,
서열번호 1의 KRS 단편 수준 ( level ) 또는 상기 단편을 암호화하는 유전자의 발현수 준을 측정하며 , (c) 단계에서는 상기 단편 수준 또는 상기 단편을 암호화하는 유전 자의 발현 수준을 정상 대조구 시료의 상기 단편 수준 또는 상기 단편을 암호화하 는 유전자의 발현 수준과 비교한다.
<109>
<πο> 상기에서 암세포가 KRS (단편)를 세포 외로 분비할 시에， 마이크로베지클 (특 히， 액소좀)올 이용한다는 것올 설명한 바 있다. 따라서 개체로부터 수득된 생물학 적 시료로부터 분리한 마이크로베지클에서 서열번호 1의 KRS 단편이 높은 수준으로 검출된다면 (특히， 정상 대조구 시료와 대비하여)， 상기 개체는 암의 발병 및 진행 상태를 경험하고 있을 가능성이 매우 높다.
<111>
<ι ΐ2> 상기 서열번호 1의 KRS 단편 수준의 검출은 당업계에 공지된 다양한 면역분 석 방법을 통해 실시될 수 있다. 예를 들어, 상기 KRS 단편 수준의 검출 및 이의 양적 변화는 방사능면역분석, 방사능면역침전， 면역침전， EL ISA (enzyme- l inked immunosorbent assay) , 캡처 -ELISA, 억제 또는 경쟁 분석， 그리고 샌드위치 분석등 을 사용할 수 있고， 이외에도 오우크테로니 (Ouchter lony) 면역 확산법， 로케트 (rocket ) 면역전기영동, 조직면역염색， 보체 고정 분석법 (Complement Fixat ion Assay) , 유세포분석 (Fluorescence Act ivated Cel l Sorter , FACS) , 웨스턴 블랏， 단 백질 칩 (protein chip) 등이 사용될수 있으나， 이에 한정되는 것은 아니다.
<ι ΐ3> 또한 상기 KRS 단편을 암호화하는 유전자의 발현 수준은 당업계에 공지된 다 양한 방법을 통해 실시될 수 있다. 예를 들어， mRNA 발현수준은 RT-PCR(Sambrook 등, Molecular Cloning. A Laboratory Manual , 3rd ed. Cold Spring Harbor Press(200D ) , 경쟁적 역전사 중합효소반응 (Compet it ive RT-PCR) , 실시간 역전사 중합효소반웅 (Real-t ime RT-PCR) , RNase 보호 분석법 (RPA; RNase protect ion assay) , 노던 블롯팅 (Peter B. Kaufraa et al . , Molecular .및 Cel lular Methods in Biology 및 Medicine, 102-108, CRC press) , cDNA 마이크로어레이를 이용한 흔성화 반웅 (Sambrook 등， Molecul ar Cloning. A Laboratory Manual , 3rd ed. Cold Spr ing Harbor Press(2001) ) 또는 인 시투 ( in si tu) 흔성화 반웅 (Sambrook 등， Molecular Cloning . A Laboratory Manual , 3rd ed. Cold Spr ing Harbor Press(2001) ) , DNA 칩 등을 이용하여 실시할 수 있으나， 이에 제한되지 않는다.
<114>
<115> 한편， 본 발명은
<ι ΐ6> (A) 라이실 티알엔에이 합성효소 (KRS) 또는 이의 C-터미널 영역을 포함하는
KRS 단편, 신테닌 (syntenin) 및 시험제제를 접촉시키는 단계;
<ι ΐ7> (B) 상기 KRS 또는 이의 단편과 신테닌의 결합수준의 변화를 측정하는 단계;
<i i8> (C) 상기 KRS 또는 이의 단편과 신테닌의 결합수준을 변화시킨 시험제제를 암세포에 접촉시켜, 상기 암세포로부터 서열번호 1의 라이실 티알엔에이 합성효소 단편을 포함하는 마이크로베지클이 분비되는지 여부를 확인하는 단계를 포함하는 암 전이 억제제 스크리닝 방법을 제공한다.
<119>
<120> 본 발명자는 본 발명의 마이크로베지클 (특히 KRS exosome)이 암 세포로부터 분비되어 주변 조직에 암 전이 (metastasi s)환경을 조성하며， 상기 마이크로베지클 의 분비에 신테닌이 중요하게 작용한다는 사실을 규명하였다. 구체적으로， KRS가 세포 내에서 N-terminal이 잘리는 과정을 통해 신테닌-1( 3 1 61^ 11-1)과의 결합이 증가되고 이렇게 신테닌과 결합이 증가하는 것은 KRS exosome 분비에 중요함을 규 명하였으며, 상기 분비된 KRS exosome이 macrophage 및 neutrophi l의 소집 (recrui tment )에 작용하고 cancer metastasi s를 촉진하는 사이토카인들의 분비를 증가시켜 암 전이에 중요한 역할을 한다. 따라서, 본 발명은 KRS 단편과 이를 포함 하는 마이크로베지클의 전술한 분비 특성에 기반하여 상기 (A) 내지 (C)단계를 포 함하는 암 전이 억제제 스크리닝 방법을 제공하며， 이하 단계별로 설명한다.
<121>
<122> 상기 (A) 단계에서는 ( i ) 라이실 티알엔에이 합성효소 (KRS) 또는 이의 C-터 미널 영역을 포함하는 K S 단편과 ( Π ) 신테닌 및 ( iii ) 시험제제를 접촉시키는 단 계이다.
<123>
<124> 상기 KRS 는 당업계에 라이실 티알엔에이 합성 효소로 알려진 것이라면 그 아미노산 서열이 특별히 제한되지 않으며, 예를들어 서열번호 2(Genbank Accession No . NP_005539.1) , 서열번호 3(Genbank Accession No . NP_001123561.1) 등이 당업 계에 알려져있다. 상기 (A) 단계에서 KRS는 이의 기능적 동등물도 포함하는 의미이 다.
<125>
<126> 상기 (A) 단계에서 사용되는 KRS 단편은 KRS폴리펩타이드 전장서열에 대한 조각 (단편) 중에서도 KRS의 C-터미널 영역을 포함하는 단편인 것을 특징으로 한다. 상기 KRS의 C-터미널 영역은 바람직하게 서열번호 6으로 표시되는 아미노산 서열 (VGTSV)로 이루어지는 것 일 수 있으나， 이에 제한되지 않는다.
<127> 바람직하게 상기 (A) 단계에서 사용가능한 KRS 단편 (KRS C-터미널 영역을 포 함)은 서열번호 1의 아미노산 서열로 이루어지는 것 일 수 있으나 이에 제한되지 않는다. 또한 상기 (A) 단계에서의 KRS 단편은 이의 기능적 동등물도 포함하는 의 미이다.
<128>
<129> 상기 신테닌 (syntenin)은 바람직하게 서열번호 4의 아미노산 서열을 포함하 는 신테닌 -l(syntenin-l) 폴리펩티드일 수 있으나， 이에 제한되지 않는다.
<130>
<i3 i> 본 발명에서 "제제 (agent ) " 또는 "시험 제제 (test agent )"라 함은 임의의 물 질 (substance) , 분자 (molecule)， 원소 (element ) , 화합물 (compound)， 실재물 (ent ity) 또는 이들의 조합을 포함한다. 예컨대， 이에 제한되지는 않으나, 단백질， 폴리펩티드， 소 유기 물질 (smal l organic molecule) , 다당류 (polysaccharide)， 폴 리뉴클레오티드 등을 포함한다. 또한 자연 산물 (natural product ) , 합성 화합물 또 는 화학 화합물 또는 2개 이상의 물질의 조합일 수도 있다. 다르게 지정되지 않는 한, 제제， 물질 및 화합물은 호환성 있게 ( interchangeably) 사용할 수 있다.
<132> 보다 구체적으로 본 발명의 스크리닝 방법으로 스크리닝 될 수 있는 시험 제 졔는， 폴리펩티드， 베타-턴 미메틱 (beta-turn mimet ics) , 다당류， 인지질， 호르몬， 프로스타글란딘， 스테로이드， 방향족 화합물， 헤테로사이클릭 화합물， 벤조디아제 핀 (benzodiazepines )， 을리고머릭 N一치환 글리신 (ol ig이 neric N— subst ituted glycines) , 을리고카르바메이트 (ol igocarbamates) , 당류 (saccharides)， 지방산， 퓨 린， 피리미딘 또는 이들의 유도체， 구조적 아날로그 또는 조합을 포함한다. 어떤 시험 제제는 합성 물질일 수 있으며, 다른 시험 제제는 천연물질일 수 있다. 상기 시험 제제는 합성 또는 자연 화합물의 라이브러리를 포함하는 광범위하고 다양한 출처로부터 얻어질 수 있다. 조합 (combinatorial ) 라이브러리는 스텝 -바이 -스텝 방 식으로 합성될 수 있는 여러 종류의 화합물로 생산 될 수 있다. 다수의 조합 라이 브러리의 화합물들은 ESUencoded synthetic libraries) 방법 (WO 95/12608, W093/06121, WO 94/08051, WO 95/395503 및 W0 95/30642)에 의해 제조될 수 있다. 펩티드 라이브러리는 파지 디스플레이 방법 0TO91/18980)에 의해 제조될 수 있다. 박테리아， 곰광이, 식물 및 동물 추출물 형태의 자연 화합물의 라이브러리는 상업 적인 출처로부터 얻거나 또는 필드 (field)에서 수집될 수 있다. 공지된 약리학적 (pharmacological) 제제가 구조적 아날로그를 제조하기 위하여 아실화， 알킬화， 에 스테르화 반웅 (esterification), 아미드화 반응 (amidi f ication)과 같은 지시되거나 (direct) 무작위한 화학적 수식에 적용될 수 있다.
<133> 상기 시험 제제는 자연적으로 생성되는 단백질 또는 그의 단편일 수 있다.
이런 시험 제제는 자연 출처 (natural source), 예컨대， 세포 또는 조직 용해물로부 터 수득될 수 있다. 폴리펩티드 제제의 라이브러리는 예컨대， 통상적인 방법에 의 해 생성되거나 상업적으로 입수할 수 있는 cDNA 라이브러리로부터 수득될 수 있다. 상기 시험 제제는 펩티드， 예컨대， 약 5-30개， 바람직하게는 약 5-20개, 보다 바람 직하게는 약 7-15개의 아미노산을 가지는 펩티드일 수 있다. 상기 펩티드는 자연적 으로 생성되는 단백질， 랜덤 펩티드 또는 "바이어스 (biased)" 랜덤 펩티드의 절단 물일 수 있다.
<134> 또한 상기 시험 제제는 "핵산"일 수 있다. 핵산 시험 제제는 자연적으로 생 성되는 핵산, 랜덤 핵산， 또는 "바이어스 (biased)" 랜덤 핵산일 수 있다. 예컨대， 원핵 또는 진핵 게놈의 절단물을 위에서 기재한 바와 유사하게 사.용될 수 있다. <135> 또한 상기 시험 제제는 소분자 (예: 약 1,000 이하와분자량을 갖는 분자)일 수 있다. 소분자의 조절 제제를 스크리닝하기 위한 방법에는 바람직하게는 고속 분 석 어세이 (high throughput assay)가 적용될 수 있다. 많은 어세이가 상기 스크리 닝에 유용하다 (Shultz, Bioorg. Med. Chem. Lett. , 8:2409-2414, 1998； Weller, Mol.Drivers. , 3： 61-70, 1997； Fernandes , Curr. Opin. Chem. Biol. , 2:597-603, 1998； and Sittampalam, Curr. Opin. Chem. Biol. , 1:384-91, 1997) .
<136>
<137> 본 발명의 방법에 스크리닝되는 시험 제제의 라이브러리는 신테닌과 KRS 또 는 이의 단편이나 아날로그에 대한 구조 연구를 근거로 제조될 수 있다. 이런 구조 연구는 신테닌 또는 KRS (또는 KRS 단편)에 결합할 가능성이 있는 시험 제제의 규명 을 가능하게 한다. 신테닌 또는 KRS (또는 KRS 단편)의 3차원적 구조는 여러 방법, 예컨대ᅳ 결정학 구조 및 분자적 모델링 (crystal structure and molecular modeling)으로 연구될 수 있다. X-선 결정학 (X-ray crystal lography)을 이용하는 단백질 구조 연구 방법이 문헌에 잘 알려져 있다: Physical Bio-Chemistry, Van Holde, K. E. (Prent ice-Hall, New Jersey 1971), pp.221-239, and Physical Chemistry with Applications to the Life Sciences , D. Eisengerg & D.Crothers(Benjamin Cummings, Menlo Park 1979) . 신테닌 또는 KRS의 구조에 대한 컴퓨터 모델링은 스크리닝하기 위해 시험 제제의 디자인을 위한 다른 수단을 제공 한다. 분자적 모델링 방법은 문헌에 개시되어 있다: U.S. Pat. No. 612,894 and U.S. Pat. No. 5,583,973. 또한 단백질 구조는 중성자 회절 (neutron diffraction) 및 NMR(nuclear magnetic resonance)에 의해 결정될 수 있다: Physical Chemistry, 4th Ed. Moore, W. J . (Prent ice-Hal 1 , New Jersey 1972) and NMR of Proteins and Nucleic Acids, K. Wuthr ich(Wi ley-Inter science, New York 1986) .
<138>
<139> 본 명세서에서 용어 "접촉 (contacting)"은 이의 일반적인 의미이며, 2개 이 상의 제제 (예: 2개의 폴리펩티드)를 결합 (combine)시키거나， 제제와 세포 (예; 단백 질과 세포)를 결합시키는 것을 말한다. 접촉은 시험관 내 (in vitro)에서 일어날 수 있다. 예컨대， 시험관 (test tube) 또는 다른 컨테이너 (container)에서 2개 이상의 제제를 결합시키거나 시험 제제와 세포 또는 세포 용해물과 시험 제제를 결합시키 는 것이다. 또한 접촉은 세포 또는 인시투 (in situ)에서 일어날 수도 있다. 예컨 대， 2개의 폴리펩티드를 암호화하는 재조합 폴리뉴클레오티드를 세포 내에서 공동 발현 (coexpresion)시킴으로써 세포 또는 세포 용해물에서 2개의 폴리펩티드를 접촉 시키는 것이다.
<140>
<i4i> 상기 (B) 단계에서는 상기 (A) 단계에서 시험제제와 함께 접촉시킨 상기 KRS 또는 이의 단편과 신테닌의 결합수준의 변화를 측정하며， 측정 결과로부터 상기 KRS또는 이의 단편과 신테닌의 결합수준이 변화된 시험제제를 선별한다.
<142>
<143> 상기 용어 '결합' 은 KRS 전체 또는 서열번호 1의 아미노산 서열을 가지는 이의 단편과 신테닌 단백질의 직접적 또는 간접적 결합일 수 있다. 상기 간접적 결 합은 두 단백질간의 결합이 다른 매개인자를 통하여， 또는 매개인자와 함께 복합체
(complex)를 이루는 것을 의미한다.
<144>
<145> 본 발명에서 상기 KRS 또는 이의 단편과 신테닌의 결합 수준의 변화는 바람 직하게 결합 수준 ( level )의 감소일 수 있다.
<146>
<147> 상기 결합수준의 감소는 상기 KRS 또는 이의 단편과 신테닌의 결합을 제거， 방지， 또는 억제하는 것을 의미한다. 구체적으로， 상기 결합수준의 감소는 시험제 제가 상기 KRS 또는 이의 단편과 신테닌을 제거， 생성 방지 또는 생성 억제하여 KRS 또는 이의 단편과 신테닌의 발현된 수준을 변화시키거나， 또는 시험제제가 K S 또는 이의 단편과 신테닌에 경쟁적 또는 비경쟁적으로 결합하여 둘 간의 상호 작용 (결합) 수준을 변화시키는 방법, 또는 이미 세포내에 생성된 KRS 또는 이의 단 편-신테닌 단백질 복합체에 대하여 시험제제에 의해 상기 복합체의 KRS 또는 이의 단편과 신테닌 사이의 상호작용 (결합)올 제거하는 방법 둥에 의하여 이루어질 수 있다. 상기 경쟁적으로 결합하는 것은 KRS 또는 이의 단편과 신테닌이 서로 상호작 용 (결합)하는 부위에 시험제제가 결합하여 KRS 또는 이의 단편과 신테닌의 상호작 용을 제거， 방지, 또는 억제하는 것을 의미하며， 본 발명에서 신테닌은 KRS 또는 이의 단편의 C-터미널 영역에서 상호작용하는 것이 특징이다. 비경쟁적으로 결합하 는 것은 KRS 또는 이의 단편과 신테닌이 서로 상호작용 (결합)하는 부위 외의 부위 에 시험제제가 결합하여 KRS 또는 이의 단편과 신테닌의 상호작용을 제거， 방지 또 는 억제하는 것을 말한다. 즉, 본원 발명은 부작용을 일으키지 않는 범위 내에서, KRS 또는 이의 단편과 신테닌의 발현 및 본연의 기능들을 억제함과 동시에 (흑은 비의존적으로) KRS 또는 이의 단편과 신테닌의 세포내 상호작용 (결합)수준올 억제 또는 감소시키는 시험제제를 스크리닝하는 것이다.
<148> 바람직하게 본 발명의 결합수준의 감소는 바람직하게 시험제제가 KRS 또는 이의 단편과 신테닌에 경쟁적 또는 비경쟁적으로 결합하여 둘 간의 상호작용 (결합) 수준을 변화시키는 방법, 또는 이미 세포내에 생성된 KRS 또는 이의 단편—신테닌 단백질 복합체에 대하여 시험제제에 의해 상기 복합체의 KRS 또는 이의 단편과 신 테닌 사이의 상호작용 (결합)을 제거되는 방법으로 이루어질 수 있다.
<149> 상기 시험제제들은 반드시 KRS 또는 이의 단편과 신테닌의 발현 및 본연의 기능들을 기능적으로 억제할 필요는 없으며， KRS 또는 이의 단편과 신테닌의 상호 작용 (결합)을 억제하는 정도면 층분하다.
<150> 상기 본 발명의 스크리닝 방법은 표지된 시험관 내 단백질-단백질 결합 어세 이 (시험관 내 풀 -다운 어세이)， EMSA,단백질 결합을 위한 면역어세이， 기능적 어세 이 (인산화 어세이 등)， 효모 -2 하이브리드 어세이， 비면역침전 어세이， 면역 침전 웨스턴 블럿 어세이, 면역-공동-위치화 어세이 등 당업계에 공지된 다양한 방법으 로 수행될 수 있으며, 상기한 바에 의해 제한되지 않는다.
<i5i> 예컨대， 박테리아 리프레서 LexA 또는 효모 GAL4의 DNA-결합 도메인 및 효모
GAL4 단백질의 트랜스액티베이션 (transact ivaton) 도메인에 각각 융합된， KRS 또는 이의 단편과 신테닌， 또는 이들 단백질의 일부 또는 상동체 (homologues)를 발현하 는 효모를 이용하여 효모 -2 하이브리드 어세이를 수행할 수 있다 (KIM, M. J . et al . , Nat . Gent . , 34 : 330-336 , 2003) . KRS 또는 이의 단편과 신테닌의 상호작용은 LexA 단백질 또는 GAL4의 DNA-결합 도메인에 결합된 조절 서열을 가지고 있는 프로 모터의 통제 하에서 리포터 유전자의 발현을 유도하는 트랜스엑티베이터를 재구성 하게 한다.
<152> 상기 리포터 유전자로는 위에서 기재한 바와 같이 당업계에 공지된 임의의 검출가능한 폴리펩티드를 암호화하는 유전자 (예: CAT(chlorampheni col acetyl transferase) , 루시퍼라제, 베타-갈락토시다제, 베타-글루코시타제， 알칼린 포스파타제 및 GFP(green f luorescent protein) 등 를 사용할 수 있다. 만약 KRS 또는 이의 단편과 신테닌, 또는 이들 단백질의 일부 또는 상동체의 결합이 시험 제 제에 의해 저해되거나 약화되는 경우, 상기 리포터 유전자는 발현되지 않거나 정상 조건에 비해 덜 발현된다.
<153> 또한 리포터 유전자로는 효모의 성장을 가능하게 하는 단백질 (즉， 상기 리 포터 유전자가 발현되지 않을 때 효모의 성장이 억제된다)을 암호화하는 것으로 선 택될 수 있다. 예를 들면， 아미노산 또는 질소 염기를 위한 생합성 과정에 관계있 는 효소를 암호화하는 영양요구성 (auxotropi c) 유전자 (예: ADE3 , HIS3 등의 효모 유전자 또는 다른 종 유래의 동등 유전자)일 수 있다. 이 시스템에서 발현된 KRS 또는 이의 단편과 신테닌， 또는 이들 단백질의 일부 또는 상동체의 결합은 시험 제 제에 의해 저해되는 경우 리포터 유전자는 발현되지 않는다. 따라서， 상기 조건 하에서 효모의 성장은 정지되거나 느려진다. 이러한 리포터 유전자의 발현에 의한 효과는 육안이나 장치 (예: 현미경)를 통하여 관찰될 수 있다.
<154>
<155> 상기 (C) 단계에서는 상기 (B)단계에서 선별된 제제 (즉, 상기 KRS 또는 이의 단편과 신테닌의 결합수준이 변화된 시험제제)를 암세포에 접촉시키고， 상기 암세 포로부터 서열번호 1의 KRS 단편이 포함된 마이크로베지클이 분비되는지 여부를 확 인하고， 상기 마이크로베지클이 분비가 감소 (억제)된 시험제제를 선별하는 단계이 다.
<156> <i57> 상기 (C) 단계에서는 서열번호 1의 KRS 단편이 포함된 마이크로베지클이 분 비되는지 여부를 확인하기 위하여， 서열번호 1로 표시되는 KRS 단편 또는 이를 포 함하는 마이크로베지클의 존재 여부와， 그 양, 패턴 또는 양자 모두를 검출하는 물 질 (시약)들을 사용할 수 있다. 상기 시약에 대해서는 전술한 바와 같으며， 상기 시 약을 사용하여 해당 표적 물질을 검출하는 방법에 대해서는 당업계에 잘 알려져있 다.
<158> 구체적으로 상기 (C) 단계는， 상기 (b) 단계에서 선별된 시험제제를 암세포 에 처리하여 일정 시간 배양한 후， 세포 배양이 끝난 배양배지를 회수하고 이로부 터 마이크로베지클을 분리하여， 상기 마이크로베지클에 서열번호 1의 KRS 단편 수 준을 측정하는 방식으로 수행될 수 있다. 시료로부터 목적하는 마이크로베지클을 분리하고 상기 마이크로베지클로부터 서열번호 1의 KRS 단편 수준을 검출하는 방법 에 대해서는 전술한 바를 참조로 할 수 있다.
<159>
<160> 본 발명의 암 전이 억제제 스크리닝 방법은 상기 (A) 내지 (C) 단계 후에， 추가적으로 하기의 (D) 단계를 수행할 수 있다;
<i6i> (D) 상기 (C) 단계에서 서열번호 1의 KRS 단편이 포함된 마이크로베지클의 분비를 억제 하는 것으로 확인된 시험제제를 암을 가지고 있는 동물에 투여하여 암 전이의 예방 또는 치료 효과 (즉， 암 전이 억제 효과)를 나타내는지 검사하는 단계.
<162>
<163> 상기 (D) 단계에서 동물은 인간이 아닌 동물 (non-human animal )을 의미하는 것으로서， 바람직하게 비인간 포유동물 일 수 있다.
<164>
【유리한 효과】
<165> 본 발명에서 제공하는 라이실 티알엔에이 합성효소 (KRS) 단편 및 상기 KRS 단편을 포함하는 마이크로베지클은 암 세포가 세포 외로 분비하는 특이적인 마커로 서 암 진단에 필요한 정보를 제공하므로， 이를 이용하여 용이하게 암을 진단할 수 있다. 뿐만 아니라 본 발명은 상기 KRS 단편 및 이를 포함하는 마이크로베지클의 암세포로부터의 분비 특성에 기반한 암 전이 억제제 스크리닝 방법을 제공하며， 이 는 암 전이 현상을 특이적으로 억제하는 물질의 개발에 유용하게 이용될 수 있다.
<166>
【도면의 간단한 설명】
<167> 도 la는 KRS가 세포 외로 분비될 시에 N-termi al이 절단됨을 western blot 방법을 이용하여 확인한 결과이다. Myc-K S 또는 KRS-myc을 발현하도록 HCT116 세 포를 형질전환하고 24시간 후에， 상기 형질전환체를 TNF-a(10 ng/ml)가 첨가되었 거나 첨가되지 않은 무혈청배지 (serum starvation media)에서 12시간동안 배양하였 다. 분비된 단백질을들 TCA에 의하여 침전시키고 항 -myc 항체를 이용한 western blot으로 조사하였다 (WCL: whole cell lysate).
<168>
<i69> 도 lb는 strep-KRS-myc 플라스미드를 이용하여 KRS가 세포 외로 분비될 시에
N-termial이 절단됨을 확인한 결과이다. strep-KRS—myc 플라스미드를 HCT116 세포 에 형질전환 시킨후 24시간 후에， 이렇게 생성된 형질전환체를 TNF-a(10 ng/ml)가 첨가되었거나 첨가되지 않은 무혈청배지 (serum starvation media)에서 12시간동안 배양하였다. 분비된 단백질을들 TCA에 의하여 침전시키고 항 -STREP 항체 및 항- myc 항체를 이용한 western blot으로 조사하였다 (WCL:whole cell lysate ).
<170>
<i7i> 도 lc는 KRS 단백질에서 12-13a.a 사이가 절단됨을 확인한 결과이다. Myc-
KRS wild type 및 myc— AN12(13-597a.a mutant)를 HCT116 세포에 형질전환시키고 24시간 후에， 이렇게 생성된 형질전환체를 TNF-a (10 ng/ml)가 첨가되었거나 첨가 되지 않은 무혈청배지 (serum starvation media)에서 12시간동안 배양하였다. 분비 된 단백질을 TCA에 의하여 침전시키고 항 -myc 항체를 이용한 western blot으로 조 사하였다 (WCL:whole cell lysate ).
<172>
<i73> 도 Id는 serum starvation 조건， 또는 serum starvat ion + TNF-a lpha 처리 조건에 대하여 시간별로 KRS가 절단되는 양을 확인한 결과이다. GFP-KRS를 과발현 시킨 후 24시간 후에 HCT116세포를 TNF-a (10 ng/ml)가 첨가되었거나 첨가되지 않 은 무혈청배지 (serum starvation media)에서 0분， 30분 60분 동안 배양하였고, 그 후 whole cell lysate에서 GFP-KRS 및 GFP 단백질 (truncated GFP, GFP-KRS 결합체 중에서 KRS N-말단에서 절단이 일어나므로)을 항 -GFP 항체를 이용한 western blot 으로 검출한 결과를 나타낸다.
<174>
<175> 도 le는 serum starvation 처리 시간 시간에 따른 KRS의 절단을 lucif erase assay로 확인한 결과이다. 구체적으로 N-renil la— KRS-C-reni 1 la vector를 이용하 여, 기아 (serim stravation) 조건에 의하여 KRS가 절단되는지를 확인하였다. N- renilla-KRS-C-renilla 백터와 firefly lucif erase 백터를 HCT116 cell에 형질전환 시킨 후 24시간 후에， 각 시간별 (0시간， 3시간, 6시간)로 무혈청 배지 (serum starvation media)에서 배양하였다. 그 후 각 샘플에서의 reni 1 la/firefly lucif erase activity를 즉정하였다.
<176>
<177> 도 2a는 BioEdit를 이용하여 KRS 다중정렬 (Mult iple— al ignment )한 결과를 나 타낸다. 본 도면에 Caspase— cleavage consensus 및 eukaryot e~spec i f i c expans i on domain 이 표시되었다.
<178>
<179> 도 2b는 Pan-caspase inhibitor의 처리에 의한 KRS secretion 여부를 western blot으로 확인한 결과이다. Pan-caspase inhibitor인 Z-VAD-FMK를， starved HCT116 cell에 14uM 처리하고 12시간동안 배양한 후， KRS 분비를 항 -KRS항 체를 이용한 western blot방법으로 조사한 결과를 나타낸다 (WCL: whole cell lysate) .
<180>
<i8i> 도 2c는 Pan— caspase inhibitor의 처리에 의한 KRS 절단 여부를 western blot으로 확인한 결과이다. KRS의 세포내 절단이 Pan-caspase inhibitor에 의하여 억제된다는 것을 보여주는 결과로， GFP-KRS를 과발현시킨 세포를 14uM pan-caspase inhibitor(Z-VAD-FMK)가 포함된 무 -혈청 (serum free starvation) 배지에서 1시간동 안 배양한 후， K S의 절단을 항 -GFP 항체를 이용한 western blot으로 검출한 결과 를 나타낸다.
<182>
<183> 도 2d는 caspase에 의해서 인식되는 KRS sequence의 부분적인 mutation
(D12A)을 통한 K S의 secretion 여부를 western blot으로 확인한 결과이다. 즉， KRS-myc wild type (WT) 또는 D12A mutant (KRS WT의 12번째 Asp를 Ala로 치환한 변이체) 를 사용하여 K S 분비가 caspase 의존적으로 이루어지는지 테스트한 결과 로서， c-terminal에 myc이 tagging된 KRS WT 또는 D12A mutant가 발현되도록 HCT116 세포를 형질전환시킨 후 24시간 후에， 무혈청 기아 배지에서 12시간 배양한 후, KRS의 분비를 항 -myc항체를 이용한 western blot방법으로 조사한 결과를 나타 낸다 (WCL:whole cell lysate).
<184>
<i85> 도 2e는 caspase에 의해서 인식되는 KRS sequence의 부분적인 mutation
(D12A)을 통한 KRS의 절단 여부를 western blot으로 확인한 결과이다. GFP-KRS WT 또는 이의 D12A mutant를 과발현하도록 HCT116 세포를 형질전환시킨 후 24시간 후 에, 상기 형질전환체들을 무혈청 기아 배지에서 1시간 동안 배양하고， GFP-K S 및 cleaved GFP를 항 -GFP 항체를 이용한 western blot으로 검출한 결과를 나타낸 다.
<186>
<187> 도 2f는 caspase-3, -6， -8, ᅳ9를 억제하는 inhibitor의 처리에 의한 K S secretion 여부를 western blot으로 확인한 결과이다. caspase-3, -6， -8， ᅳ9를 억 제하는 각각의 inhibitor인 Z-VAD-DQMD (3), Z-VAD-VEID (6), Z—VAD— IETD (8) 및 Z-VAD-LEHD (9)가 처리된 무혈청 기아 배지에서 HCT116세포를 12시간 배양한 후， KRS가 세포 외로 분비되는지 여부를 항 -KRS항체를 이용한 western blot방법으로 조 사한 결과를 나타낸다 (WCL:whole cell lysate).
<188>
<i89> 도 2g는 caspase-3, -6， -8， -9 siRNA 처리에 의한 KRS secretion 여부를 western blot으로 확인한 결과이다. caspase-3, -6， -8， -9 각각에 특이적인 siRNA 또는 non-specific siRNA control로 형질전환 시킨 후 48시간 후에 HCT116 cell을 무혈청 기아 배지에서 12시간 배양한 후, KRS 분비 여부를 항 -KRS항체를 이용한 western blot방법으로 조사한 결과를 나타낸다 (WCL:whole cell lysate).
<190>
<i9i> 도 2h는 serum starvation 조건에서 Caspase—3, -6， -8， —9의 발현량을 western blot으로 확인한 결과이다. HCT116 cell을 각 시간별로 무혈청 기아 배지 에서 배양한후, 단백질 용해물로부터 각 caspase의 발현 수준을 조사하였다.
<192>
<193> 도 2i는 caspase-8의 과발현 조건에서 KRS가 절단되는 양을 western blot으 로 조사하여, caspase-8의 증가가 KRS의 N-terminal 절단을 증가시킴을 확인한 결 과를 나타낸다. HCT116 세포에 Caspase-8 및 GFP-KRS를 과발현시킨 후 24시간 후에 1시간동안 무혈청 배지에서 배양한 후， 세포 내 (intracellular space) KRS의 절단 을 항 -GFP 항체를 이용한 western blot으로 확인한 결과를 나타낸다.
<194>
<195> 도 3a는 KRS의 C-terminal에서 PDZ binding motif 의 다중정렬 (Multiple alignment) 결과를 나타낸다.
<196>
<197> 도 3b는 starvation 조건 또는 /및 TNF-alpha 처리시에 KRS와 syntenin-1의 결합을 면역침전 및 western blot으로 조사한 결과로서, KRS와 syntenin-1 사이의 상호작용은 기아조건에 의하여 유도됨을 확인하였다. HCT116세포를 무혈청 기아조 건 또는 TNFᅳ alpha가 포함된 무혈청 기아 배지에서 1시간동안 배양한 후， syntenin-1에 대하여 면역침전 ( IP)시고, 항—KRS항체를 이용하여 웨스턴 블롯을 수 행하여 K S와 syntenin-1 사이의 상호작용을 조사하였다.
<198>
<199> 도 3c는 caspase— 8 inhibi tor 처리시에 KRS와 syntenin-1의 binding을 western blot으로 조사한 결과로서 KRS—syntenin-Ι의 상호작용은 caspase-8 inhibi tor 처리에 의하여 감소됨올 확인하였다. 세포들을 caspase-8 inhibi tor (Z- VAD-IETD)가 처리되거나 처리되지 않은 무혈청 배지에서 배양한 후， syntenin-1에 대하여 면역침전 ( IP)시고， 항 -KRS항체를 이용하여 웨스턴 블롯을 수행하여 KRS와 syntenin-1 사이의 상호작용을 조사하였다.
<200>
<201> 도 3d는 D12A mutant 를 이용하여 KRS와 syntenin-1 사이의 상호작용을 조사 한 결과를 나타낸다. C-terminus myc가 tag된 KRS WT 및 D12A mutant를 세포에 형 질전환하여 과발현 시키고 24시간 후에， 무혈청 배지에서 1시간 배양한 후， 항 -myc 항체를 사용하여 침전시킨 후， KRS와 결합한 syntenin-1 을 western blot으로 조사 하였다 (mock: empty vector를 세포에 도입한 대조군) .
<202>
<203> 도 3e는 KRS와 syntenin-1의 상호작용 (결합)을 BiFC(Bimolecular f luorescence com lementat ion) assay로 확인한 결과이다. KRS WT-VN173 또는 D12A mutnat-VN173과 syntenin— 1-VC15를 세포에 형질전환하여 과발현 시키고 24시 간 후에, 상기 형질전환체를 무혈청 기아 배지에서 4시간 배양한 후 형광현미경으 로 검출하였다. 이때 실험군 중 하나에는 Caspase-8 inhibi tor를 처리하였다. f lag-K S 는 항 -f lag-항체에 의하여 검출되었다.
<204>
<205> 도 3f는 syntenin-1 특이적 siRNA 처리에 의한 KRS secret ion 여부를 western blot으로 조사한 결과로서， KRS 분비는 syntenin-1 의존적임을 확인하였 다. HCT116 cel l에 Syntenin-1 특이적 siRNA를 처리하여 Syntenin-1의 발현을 억제 한 후 48시간 후에， 상기 세포를 무혈청 배지에서 12시간동안 배양하였고, 그 후 분비된 KRS를 TCA로 침전시킨 후 항 -KRS항체를 사용한 웨스턴 블롯으로 검출하였다 (con: siRNA control 처리， syn: syntenin-1 특이적 siRNA 처리， WCL : whole cel l lysate) .
<206>
<207> 도 3g는 KRS의 c-terminal을 잘라 버린 deletion mutant( AC5(l-592a.a)) 와 syntenin-1의 결합을 western blot으로 확인한 결과이다. KRS WT 및 c-terainal deletion mutant(^c5(l-592a.a))를 사용하여 syntenin— 1과의 상호작용 및 KRS 분 비를 조사하였다. HCT116 세포를 KRS WT-myc 또는 deletion mutant( AC5(1- 592a. a)) -myc으로 형질전환 시키고， 24시간 후에 세포 용해물을 항 -syntenin-1 항 체를 사용하여 면역침전 (IP)시킨 후, 상기 침전물에서 syntenin-1과 결합된 KRS를 항 -myc 항체를 이용한 웨스턴 블랏으로 조사하였다 (WCL: whole cell lysate).
<208>
<209> 도 3h는 KRS deletion mutan Ac5(l-592a.a))의 KRS 분비에 대한 영향을 western blot으로 확인한 결과이다. HCT116 세포를 KRS WT 및 deletion mutant (A c5(l-592a.a))로 형질전환 시키고 24시간 후에 무혈청 배지에서 12시간 배양한다. 배양배지로 분비된 단백질을 TCA로 침전시킨 후 항 -myc항체를 사용하여 분비된 KRS 의 양을 웨스턴 블롯으로 검출하였다.
<210>
<2ΐι> 도 4a는 KRS가 secretion된 media로부터 분리된 마이크로베지클들의 전자현 미경 이미지를 나타낸다. HCT116 cell들은 무혈청 배지에서 12시간동안 배양되었 고， 100,000g에서 원심분리하여 세포 외로 분비된 마이크로베지클들을 분리한 후， 전자현미경을 이용하여 이미지를 확인하였다.
<212>
<213> 도 4b는 K S가 secretion 된 media로부터 분리된 마이크로베지클들의 평균 size를 나타낸다. HCT116 세포를 무혈청 배지에서 12시간동안 배양한 후， 배양배지 로부터 분리된 마이크로베지클들을 100,000g 원심분리법을 이용하여 분리하였다. 분리된 마이크로베지클들의 size를 Dynamic light scattering를 이용하여 측정하였 다.
<214>
<215> 도 4c는 KRS가 검출된 마이크로베지클들의 density를 opt i -prep gradient assay로 확인한 결과이다. HCT116 세포를 무혈청 배지에서 12시간 동안 배양한 후， 배양 배지로부터 분리된 마이크로베지클들을 opti— prep gradient에 loading 하여 총 9개의 분획을 수득하였고， 이들올 항 -KRS 항체 및 항 -Syntenin-1항체를 이용한 웨스턴 블랏 방법으로 분석하였다. <216>
<2i7> 도 4d는 si-syntenin 처리 후 KRS exosome secret ion을 western blot으로 조 사하예 KRS exosome의 분비가 syntenin-1에 의존적임을 확인한 결과이다. HCT116 세포에 Syntenin-1 특이적인 siRNA를 처리하여 이의 발현을 억제시키고 48시간 후 어 1， 상기 세포를 무혈청 배지에서 12시간동안 배양하였다. 100,000g에서 원심분리 하여 분비된 액소좀들을 정제하고， 웨스턴 블롯으로 단백질을 조사하였다 (si-Con: 유전자 발현에 영향을 미치지 않는 siRNA control 처리， si_syn: syntenin-1 특이 적 siRNA 처리, WCL: whole cell lysate)
<218>
<2i9> 도 4e는 KRS deletion mutant ( Ac5( l-592a . a) )≤1 KRS exosome secretion에 대한 영향을 western blot으로 확인한 결과이다. KRS WT-myc 또는 deletion mutant(Ac5(l-592a.a))-myc을 이용하여 syntenin-1과의 상호작용과 KRS exosome 분비에 대한 영향을 확인하였다. HCT116 cell에 KRS WT-myc 또는 deletion mutant ( Ac5(l-592a.a))-myc 를 형질전환시키고 24시간 후에， 상기 형질전환체들을 무혈청 배지에서 12시간동안 배양하였다. 정제된 액소좀들을 웨스턴블롯으로 분석하였다 (WCL: whole eel 1 lysate) .
<220>
<22i> 도 4f는 D12A mutation의 KRS exosome secret ion에 대한 영향을 western blot으로 확인한 결과이다. KRS 절단 (truncation)과 KRS exosome 분비와의 상호 관 계를 알아보기 위하여 D12A mutant를 이용하였다. Oterminus myc tagging KRS WT 또는 이의 D12A mutant를 HCT116 세포에 형질전환하여 과발현시키고， 24시간 후에 상기 형질전환체들을 무 -혈청 배지에서 12시간동안 배양한 후， 100,000g에서 원심 분리하여 exosome을 분리수득한 뒤 이의 단백질을 웨스턴블롯으로 확인하였다 (WCL: whole eel 1 lysate) .
<222>
<223> 도 5a는 대식세포에 KRS WT, truncated KRS( N12(13-597a.a)) 또는 KRS exosome의 처리에 따른 TNF-alpha 분비를 TNF-alpha EL ISA 방법으로 조사한 결과 를 나타낸다. RAW 264.7 세포들은 ΙΟΟηΜ의 KRS WT, truncated KRS(AN12(13- 597a. a))단백질 및 KRS exosome (0.05, 0.5, 5ug)과 함께 배양되었으며， 분비된 TNF-alpha 를 분석하였다.
<224>
<225> 도 5b는 대식세포에 KRS WT, truncated KRS( N12(13-597a.a)) 또는 KRS exosome의 처리에 따른 세포 이동 (cell migration)을 확인한 결과로서， KRS ' exosome 처리에 따른 세포 이동을 wound-healing assay 방법으로 조사하였다. RAW 264.7 세포 단층을 한번 긁은 후 ΙΟΟηΜ KRS 단백질 (WT, AN12 각각) 또는 KRS exosome (0.05, 0.5, 5ug)을 농도별로 처리하였다. 12시간 후에， 현미경으로 상기 세포들의 이동 상황을 관찰하였다.
<226>
<227> 도 6a는 si -con 또는 si -KRS 처리된 HCT116 세포로부터 액소좀을 정제하여 샘플을 제작하고 면역블랏팅을 수행한 결과를 나타낸다.
<228>
<229> 도 6b는 RAW 264.7 세포를 ΙΟΟηΜ AN12 KRS 단백질과 함께 배양하거나 Si- con 또는 Si-KRS 처리된 HCT116 세포로부터 정제한 엑소좀 (5ug/ml)들과 함께 배양 하였을때， TNF-alpha ELISA방법으로 TNF-alpha 의 분비를 분석한 결과를 나타낸다.
<230>
<231> 도 6c는 R 264.7 세포를 ΙΟΟηΜ AN12 KRS 단백질과 함께 배양하거나 Si- con 또는 Si-KRS 처리된 HCT116 세포로부터 정제한 액소좀 (5ug/ml )들과 함께 배양 하였을때， transwel 1 migration assay방법으로 cell migration effect를 분석한 결 과를 나타낸다 (왼쪽은 현미경 관찰결과 이미지를 나타내며， 오른쪽은 이동 세포의 비율올 정량화 하여 나타내었다).
<232>
<233> 도 6d는 KRS WT-myc 또는 D12A mutant -my c 각각을 과발현시킨 B16F10 세포들 을 이용하여 수득한 생체 내 이미지 (intravital image, 왼쪽) 및 상기 이미지에서 의 초록형광 강도를 정량화하여 나타낸 결과 (오른쪽)이다. 상기 B16F10 세포를 마 우스 귀에 주입한 후， Omin, 30min, 60min, 90min에서 시간별로 이미지를 수득한 결과를 보여준다 (빨강: 세포， 초록: 대식세포 및 호중구).
<234>
<235> 도 6e는 ΙΟΟηΜ KRS 단백질 (WT, AN12 각각) 또는 KRS exosome(5ug/ml )처리된 대식세포에서 분비된 각 사이토카인들의 수준 (level)을 luminex screening assays (bead-based multiplex kits)를 이용하여 평가한 결과를 나타낸다 (Cont: 비처리 대 조군， Exo: KRS exosome 처리군) .
<236>
【발명의 실시를 위한 형태】
<237> 이하 본 발명을 상세히 설명한다 . <238> 단， 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실 시예에 한정되는 것은 아니다.
<239>
<240> <실험방법>
<241> 1. 세포 배양 및 재료
<242> HCT116 세포들은 10% FBS(fetal bovine serum), 50Ug/mL의 페니실린 및 스 트렙토마이신이 보충된 RPMI 배지 (25mM HEPES 및 L-Ghitamine과 함께, Hyclone)를 이용하여 37 °C, 5% C02 인큐베이터에서 배양되었다. RAW264.7 세포들은 10%
FBS( fetal bovine serum), 50 μ g/mL 페니실린 및 스트렙토마이신이 보층된 High glucose DMEM 배지 (2.5g porecine trypsin,- 4.00mM L-glutamate, 400mg/L Glutamaine 및 Sodium pyruvate와 함께 , Hyclone)를 이용하여 37°C， 5% C02인큐베 이터에서 배양되었다. 인간 TNF— alpha(Sigma, USA)는 무혈청조건 (serum-free condition) 하에서 10ng/ml의 농도로 처리되었다. syntenin-1에 대한 si-RNA는 santacuz로부터 수득하였다 (sc-42164) . KRS에 대한 si-RNA는 invitrogen으로부터 수득하였다; KRS si-RNA sequence (Cat. No /Lot No. 10620318-277773 C07, C08 ： KARS shss 105656 ： GGGAAGACCCAUACCCACACAAGUU , AACUUGUGUGGGUAUGGGUCUUCCC) . caspase -3, -6, -8, -9 각각에 특이적인 si-RNA는 Sigma-aldrich로부터 수득하였 다. Stealth universal RNAi (Santa cruz)는 비-특이적 대조군으로서 사용되었고, Lipofectamine™ 2000 Trans feet ion reagent (Invitrogen, Cat. No. 18324— 012)를 제조사의 프로토콜에 따라 사용하여 형질전환 (트렌스펙션)하였다. caspase-3 inhibitor(Cat No. 219002) , caspase-6 inhibitor(Cat No. 218757), caspase-8 inhibitor(Cat No. 368055) , caspase-9 inhibitor (Cat No. 218776)는 calbiochem으 로부터 수득되었다. 그리고 상기 caspase inhibitor들은 무혈청조건 (serum-free condition) 하에서 14uM의 농도로 처리되었다.
<243>
<244> 2. 웨스턴 블롯 및 면역침전
<245> 150mM NaCl, lOmM NaF, 12mM beta-glycerophophate, ImM EDTA, 1% NP-40,
10% glyerol 및 protease inhibitor를 포함하는 50mM Tris-HCKpH 7.4)buffer를 세 포에 가하여 용해하였다. 30분 후에， 상층액을 SDS sample buffer에 용해시키고， SDS-PAGE로 분리하였다. 내생 KRS(endogenous KRS)의 면역블랏팅을 수행하기 위하 여 항 -KRS 항체를 사용하였다. Hsp90, syntenin-1, GFP, myc, caspase-3, -6, -8， -9, syntenin-1에 대한 항체들은 santa cruz—사로부터 구입하였으며, alix에 대한 항체는 cell signaling으로부터 구입하였다. 항 -KRS 항체는 서열번호 2로 표시되는 KRSCGenbank Accession No. NP_005539.1)단백질을 뉴질랜드 흰토끼에 주입하여 면 역반응을 일으킨 후, 이에 대한 항체를 수득하는 통상적인 과정으로 제작하였다. <246> 면역침전을 위하여， 세포들은 150mM NaCl, 0.5% NP-40, 2mM EDTA, 5% glycerol 및 protease inhibitor(Calbiochem, San diego, CA, USA)를 함유하는 50mM HEPES (pH7.4) buffer로 4°C에서 용해되었다. 단백질 추출물은 각각의 단백질 특이적 항체와 4t에서 교반하며 배양되었다. 그리고 protein G agarose를 첨가하 였다. protein G agarose를 첨가하고 4시간 후에， 원심분리하여 침전 샘플을 수득 하였다. 차가운 용해 버퍼 (lysis buffer)를 사용하여， 침전 샘플들을 5분동안 3회 세척하였다. 상기 침전물들은 SDS-PAGE에 의하여 분리되었다.
<247>
<248> 3. KRS분비 검사
<249> HCT116 세포들을 10% FBS(Hyclone)가 함유된 RPMI 배지에서 배양하였으며，
60讓 dish에 대하여 60% confluency가 될 때까지 배양하였다. 상기 세포들은 2회 PBS 세척된 후 serum-free RPMI배지에서 배양하며 lOng/ml TNF-α가 12시간동안 처 리되었다. 세포배양액의 상층액을 조심스럽게 회수한 후 500g에서 10분동안 원심분 리하였고， 이렇게 생성된 상층액을 다시 10,000g에서 30분동안 원심분리하여 membrane organelle을 제거하였다. 그리고 나서 상층액에 12% TCA가 첨가된 후 4°C 12시간동안 배양되어 침전처리되었다. 침전 처리 후， 상층액은 18,000g에서 15분동 안 원심분리되었고， 이때 상층부는 폐기하고 남은 펠렛을 lOOmM HEPES ph8.0으로 중화한 후 5 X sample buffer를 가하여 SDS—PAGE로 분리하였다. 상기 SDS-PAGE로 분리한산물은 항 -KRS 항체로 웨스턴 블롯팅하였다.
<250>
<25i> 4. Human Full length KRS 및 Truncated KRS Protein(AN12 KRS)의 준비
<252> 서열번호 2의 Human KRS를 코딩하는 cDNA를 EcoRI 및 Xh이의 제한효소를 이 용하여 pET-28a(Novagen)에 서브클론 (subclone)하였고, 그 후 Escherichia coli BL21 (DE3)에 도입하여 과발현시켰다. 그리고나서 nickel affinity (Invitrogen) 및 Mono Q ion-exchange chromatography를 제조사의 프로토콜에 따라 사용하여 his-tagged KRS를 정제하였다. LPS(lipopolysaccharide)를 제거하기위하여， KRS가 함유된 용액을 pyrogen-free buffer에 투석하였다. 여전히 잔재하는 LPS를 제거하 기 위해서， 상기 KRS 용액을 20% glycerol이 포함된 PBS에 다시 한번 투석하였고, Pos i dyne membrane (Pal 1 Gel man Laboratory)을 통해 여과하였다. <253>
<254> 5. 면역형광염색 (Immunof luorescent staining)
<255> HCT116세포에 KRS-VN173 plasmid 및 syntenin_l_VC155 plasmid를 모두 형질 도입한 푸， 기아 조건 (starvat ion condition, serum-free condi t ion)에서 4시간동 안 배양하였다. 상기 HCT116세포들을 9隱 covers lip 위에 위치시킨 후 4% paraformaldehyde 이용하여 고정시키고, 차가운 PBS로 짧게 세척하였다. 5¾ BSA blocking buffer 로 1시간동안 배양한 후, 10분동안 DAPI 염색을 수행하였다. 다시 차가운 PBS로 5분씩 6번 세척한 후， slide glass에 마운팅 시킨다 (mounting). 그 후 표본을 공초점 레이저 주사 현미경 (confocal Laser Scanning Microscopy Al, nikon)으로 관찰하였다.
<256>
<257> 6. 마이크로베지클 분리
<258> HCT116 cell을 각각의 처리 조건 (특히， serum-starvation condidion)에서 특정 시간 배양한 후， 그 배지를 분리하여 연속적인 원심분리를 한다. 500g(10분)， 10,000g(30분)， 100,000g(90분) 총 3번을 하여 마이크로베지클 펠렛을 형성한다. 마이크로베지클 단백질의 양은 Bradford assay를 이용했다.
<259>
<260> 7. opti-prep gradient 원심분리
<26i> 마이크로베지클의 밀도를 측정하기 위해， 100,000 g로 펠렛화된 마이크로베 지클을 연속적인 opti-prep gradient 구배에 깔아준 후, 150,000g에서 15시간 동안 원심분리해준다. 9개의 분획들을 수득하여， 굴절률로 밀도를 측정한 후， SDS-PAGE sample buffer로 재현탁 (resuspend)하여 특이 항체들을 이용하여 면역 블롯팅을 하 였다.
<262>
<263> 8.전자현미경 관찰
<264> 음성 염색을 위해 분리된 마이크로베지클들올 PBS로 5배 희석했다. 그 후， 5
^를 글로방전 (Glow-discharged/Harrick Plasma, U.S)된 탄소 코팅 격자에 3분 동 안 공기 중에서 넣은 후， 1¾ uranyl acetate로 격자 음성 염색을 실시한다 (Jung, H. S., et.al., Mol .Biol el 1： 19； 3234-3242, 2008 참조). 상기 방법을 모든 시 료에 적용한다. 면역-전자현미경을 위해서 마이크로베지클을 polyclonal anti-KRS 항체와 6시간 이하로 섞어준 후， 6nm 금색 입자 (JIRE, U.K.)를 입힌 토끼 2차 항체 와 결합시킨다. 그 후, 얼음위에 12시간 동안 놓아둔 후， 위에 설명한대로 음성염 색올 시킨다. 격자는 120 kV로 작동하는 Technai G2 Spirit Twin TEM(FEI , USA)으 로 실험한다. 이미지는 4K X 4K Ultrascan 895 CCD (Gat an, U.S)로 기록했다.
<265>
<266> 9.동적광산란법 (Dynamic light scattering)
<267> 분비된 마이크로베지클들을 수득하여 PBS로 재현탁 (resuspend)시켜준 후， 입 자 크기를 광산란분광광도계 ELS— Z Otsuka Electronics, Japan)를 이용하여 측정했 다. 측정은 20°C에서 5분동안 동적평형을 이룬 후 automatic mode에서 이뤄졌다. 데이터는 multiple narrow mode에서 제조업체의 소프트웨어를 이용하여 진행됐다.
<268>
<269> 10. BiFCᅳ Renilla Lucif erase assay
<270> 루시퍼라아제 (lucif erase) 활성을 측정하기 위하여 Renilla Lucif erase
Reporter Assay Sys t em (Pr omega, Madison, WI)을 이용하였다. 또한 firefly luciferase vector를 대조군으로 이용하였다. 루시퍼라아제 활성은 FLUOstar 0PTIMA(BMG LABTECH)를 이용하여 계산되었다. BiFC-reniUa luciferase KRS plasmid 및 firefly luciferase plasimd가 도입된 후， 세포들은 기아조건 (serum free media)에서 배양되었다. 배지를 제거한 후， 세포들은 PBS를 이용하여 세척되 었다. Lysis buffer (Promega, Madison, WI) 80ul/well 를 각 well에 첨가한 후， 상 온에서 15분동안 부드럽게 흔들어주었다. 세포 용해물 (cell lysate)들은 회수되어 luciferase assay에 사용되었다. 먼저， 20ul의 세포 용해물을 2 white opaque 96- well plate (Falcon, 353296)에 옮겼다. 그리고 Firefly 및 Renilla luciferin은 모든 각각의 2 white opaque 96-well plate에 옮겨졌다. 각 well에 injector dispensing assay reagent가 투여된 푸에， 각각의 luminescence reading을 위하여， 2초간의 사전측정 지연 기간 (2-second pre-measurement delay) 및 그 후에 10초의 즉정시간 (10-second measurement period)미 부여되었다. Luciferase assays는 세포 의 수 및 형질전환 효율성을 정규화하기위하여 Reni 11 a/Firefly의 비율에 기반하여 분석되었다.
<271>
<272> 11. wound healing assay
<273> RAW264.7 세포들을 coverslip위에 분주하여 95%이상 포화되도록 배양하였다.
그 후 RAW 264.7 monolayer에 스크래치 (scratch)를 내어서 상처를 제작한 후, 여기 에 ΙΟΟηΜ KRS proteins (WT, AN12) 또는 KRS exosome(0.05, 0.5， 5ug)을 농도별로 처리하고 12시간동안 배양하였다. 그 후 현미경으로 세포들의 morphology를 관찰하 였다.
<274>
<275> 12. TNF-alpha 분비 ELISA assay
<276> RAW264.7 세포 (2 X 104)를 10% FBS 및 1% 항생제가 포함된 DMEM를 함유하는
24well plate에서 I2시간동안 배양하였고, 2시간동안 serum-free media에서 세포 절식 (starvation, 기아)시켰다. KRS 단백질 (FT, AN12 각각) ΙΟΟηΜ 및 KRS exosomes (0.05， 0.5， 5ug) 각각을 첨가하여 6시간동안 처리하였고， 그 후 3,000 g 에서 5분동안 원심분리하여 세포 배지를 회수하였다. TNF-alpha ELISA kit (Pharmingen, BD Science)를 제조사의 프로토콜에 따라 사용하여， 세포로부터 분비 된 TNF-alpha를 검출하였다.
<277>
<278> 13. Transwel 1 migration assay
<279> Costar 사로부터 transwel 1 cell culture chamber 24-wel 1 pi ate (6.5mm insert with 5.0uM polycarbonate membrane)를 구입하여 사용하였다 . 5uM insert들 은 0.5mg/mL의 gelat in(Sigma) 10uL 으로 코팅되었고, UV 하에서 하룻밤동안 건조 되었다. RAW264.7 세포들은 Serum— Free DMEM에 현탁된 후 lX105 cell의 정도로 상기 insert에 첨가되었으며， 그리고 각각의 well에 BSA (ΙΟΟηΜ), KRS( Ν12)(100ηΜ) , si -control 또는 si_K S 처리된 세포로부터 정제한 엑소좀 (5ug/ml)을 처리하여 5% C02 incubator에서 37°C, 8시간 배양되었다. 상기 insert들을 차가운 PBS를 사용하여
2회 세척하였으며， 세포들을 70% Methanol, 30% PBS가 함유된 용액으로 30분동안 고정하였다. 다음으로， 상기 insert들은 PBS로 3회 세척되었으며， hematoxylin (Sigma) 으로 30분동안 염색되었다. 상기 insert들은 증류수로 3회 세척되었으며， 비 -이동 세포들은 면봉을 이용하여 제거하였다. 면도날을 이용하여 멤브레인 (membrane)을 채취하고 Gel Mount (Biomeda)를 이용하여 마이크로슬라이드 위에 마 운팅 (mounting)하였다. Top view program이 장착된 Optinity microscope 를 사용하 여 이동세포의 이미지를 수득하였다.
<280>
<281> 14. 생체 내 이미징 (Intravital imaging)
<282> 14.1 이미징 시스템 및 이미징 과정
<283> KRS에 의해 대식세포 /호중구 소집 (macrophage/neutrophi 1 recruitment )°1 증 가되는 것을 시각화하기 위하여， K. Choe et al. , 2013의 이전 연구와 동일한 공초 점 레이저 현미경 (Custom— bui It laser-scanning confocal microscope)을 사용하였 다. 488 nm (MLD488 60 mW, Cobolt), 561 nm (Jive™50mW,Cobolt ) 및
640nm(MLD640100m , Cobo 11 ) °11 대한 3개의 CW laser가 여기원 (excitat ion source)으 로 사용되었다. 2D scanning을 시행하기 위하여， fast-rotat ing polygonal mirror (MC-5 , aluminum coated, Lincoln Laser) 및 galvanometer (6230H, Cambridge Technology)가 이용되었다. 삼색의 형광 신호를 동시에 검출하기 위하여 High- sensitive photomultiplier tube(R9110, Hamamatsu)가 사용되었다. 3개의 검출 채 널들은 dichroic mirrors (FFO 1-442/46-25, FF02-525/50-25, FFO 1-585/40-25, FF01-685/40-25, Semrock) 및 bandpass filters (FF484-FDi01, FF560-Di01, FF649-Di01, Semrock)에 의하여 분할되었다. PMT 로부터 수득된 전기적 신호들은 8-bit 3-channel frame grabber (Solios, Matrox)에 의하여 디지털화 되었다. 20X (LUMFLN60XW, NA1.1, Olympus)에서 수득된 이미지들의 F0V(Field of views)는
500x500 rn 였다. 512x512 pixel의 이미지들을 상기 이미징 시스템으로부터 수득 후， Matlab (Mathworks)으로 XY-shift compensation되었다. 정확하게 샘플 위치를 조정하기 위해， 이미징 과정동안 Ιμηι의 해상도를 갖는 motorized XYZ translational stage (MPC-200-R0E , Sutter Instrument)가사용되었다.
<284>
<285> 14.2 동물 모델
<286> 본 연구에서는， 대식세포 및 호중구에서 GFP 형광을 내생적으로 발현하는
LysM-GFP (Lysozyme M-GFP) 마우스가 사용되었다 (N. Faust et al., 2000) . 12-20주 령의 수컷 LysM-GFP 마우스들에 Zoletil®(30 mg/kg) 및 xylazine (Rompun® , 10 mg/kg)을 복강내주사하여 깊게 마취시켰다. 이미징 과정동안 마우스의 체온은 homeothermic controller (PhysioSuite™, Right Temp™, Kent Scientific) 를 사용 하여 37°C로 유지되었다. 털 제거에 의해 면역 반웅이 일어날 가능성을 제거하기위 하여， 이미징하기 적어도 12시간 전에 마우스 귀 피부를 면도하였다.
<287>
<288> 14.3 세포를 이용한 생체 이미징 (Intravital imaging)
<289> 종양 세포에 의하여 증가된 KRS의 분비가 미치는 영향을 조사하기 위하여，
B16F10 세포들을 KRS-myc, D12A-myc 또는 empty vector로 Lipofectamine 3000 (Invitrogen, 11668027)을 사용하여 형질전환하였다. 상기 형질전환된 B16F10세포 들은 친유성 형광 염료인 Vybrant DiD solution (V-22887, Life Technologies)으로 형광표지되었으며， 이 과정은 세포 배지 1ml 당 5yL DiD 용액을 첨가하고 1시간동 안 배양함으로서 수행되었다. PBS로 3회 세척한 후에, 표지된 세포들올 PBS용액에 현탁하여 준비하였다 (0.4 mi l l ion cel ls/ u D . 31G microinjector를 사용하여 4xl04 cel l들을 마우스 귀 피부내로 주사하였다. 상기 세포 주사위치를 따라서 대식세포 / 호중구 소집을 시각화하기 위하여， 주사 후 90분까지 30분의 간격으로 t ime-lapse image를 찍었다.
<290>
<29i> 15. Luminex screening assays (bead-based mul itplex kits)
<292> RAW 246.7 세포들은 10% FBS 및 ) 항생제가 포함된 DMEM 배지를 사용하여
12 wel l-plate에서 12시간동안 배양되었고, 2시간동안 serum-free media에서 세포 절식 (starvat ion)되었다. 서로 다른 양의 KRS 단백질 (각각 WT, AN12)과 KRS exosome (5ug) 을 배지에 첨가하였다. 12시간 후에， condit ioned media 를 수집하 였고, 3 ,000g에서 10분동안 원심분리를 통해 스핀다운하였다. Mul i tplex assay를 수행하기 위하여， TNF-alpha, mCRG-2, IL-6 , mIL-lbeta, mIL-12, mIL-10 , MMP9, INF-gamma, mMIP3a 및 CXCL10에 대한 premixed bead들을 R&D Science 로부터 구입 하여 제조사의 프로토콜에 따라 사용하였다. 각각의 샘플들은 BioRad Bioplex 200 system 및 software에 의하여 분석되었다.
<293>
<294> <실시예 1>
<295> K S의 분비시 N-terminal의 절단
<296> KRS 단백질은 cancer cel l에서 secret ion되어서 macrophage를 통한 TNF- alpha secret ion과 macrophage migrat ion을 증가시켜서 염증반응을 일으킨다고 알 려져 있다. KRS는 serum starvat ion시에 secret ion이 일어나고 TNF— alpha를 동시에 처리 했을 때 secret ion이 증가되는 것으로 알려져 있다. 이러한 KRS가 어떻게 secret ion이 되는 가에 대해선 아직 알려진 바가 없다. 본 발명에서는 Myc-KRS, K S-myc plasmid를 HCT116 eel I에 transfect ion 시킨 후 KRS의 secret ion을 western blot으로 관찰 했을 때， KRS가 secret ion될 시에 N-terminal이 절단되는 것을 확인하였다 (도 la 참조) . 이와 같은 결과를 다시 확인하기 위해서 strep-tag 가 KRS의 N-terminal에, myc-tag가 KRS의 c-terminal에 tagging 되어있는 plasmid 를 만들어낸 후 실험을 하였다. 실험 결과， serum starvat ion 처리했을 때와 serum starvat ion과 TNF-alpha를 함께 처리했을 때 KRS의 N-terminal이 절단되는 것을 다 시 한번 확인 하였다 (도 lb 참조) . 본 발명에서는 잘리는 부분을 확실히 하기 위해 서, 예비 실험을 한 결과 12-13a. a 사이가 잘린다는 것을 확인 하였고， 이를 확인 하기 위하여 myc-KRS WT( 1-597) 또는 myc—KRS mut ant ( 13-597 , 본 발명에서 로 도 표기하며 서열번호 1의 펩타이드를 의미)를 cell에 transfection 한 후 secretion 실험을 하였다. 그 결과, 12-13a.a사이가 잘린다는 것을 다시 한번 확인 하였다 (도 lc 참조). KRS는 앞서 이야기 한 바와 같이 starvation 때 secretion 되 고 starvation + TNF-alpha 처리시에 secretion이 증가된다. 본 발명의 도 lb에서 와 같이, starvation과 T F—alpha를 처리한 2가지의 경우에서 KRS가 잘리는 양이 일정한 것으로 확인되었다. 이를 다시 한번 확인하고 KRS를 절단 (truncation)하는 신호를 확실히 하기 위해 GFP-KRS를 이용하였다. HCT116 cell에 GFP-KRS를 transfection 한 후， starvation과 TNF-alpha 처리하였다. 시간대 별로 starvation 과 TNF-alpha 처리시， 동일한 양이 잘리는 것으로 확인되었다 (도 Id 참조). 이를 통해 starvation이 KRS를 자르는 신호임을 확인하였다. Starvation 시에 KRS가 잘 리는 것을 확실히 하기 위해서 N-renilla- RS-C-renilla plasmid를 이용하였다. 이 는 평상시엔 KRS N-terminal의 renilla 반쪽과 KRS C-terminal의 renilla 나머지 반쪽이 결합하여서 renilla luciferase activity를 가지지만 어느 한쪽이 없을 시 엔 activity를 가질 수 없게 되는 구조이다. HCT116 cell에 N-reni 1 la-KRS—C- reni 11a plasmid와 firefly luciferase plasmid를 transfection 한 후 실험을 진행 하였다. 실험 결과, starvation 시간대 별로 renilla luciferase activity가 줄었 음을 확인 할 수 있었고， 상기 결과로 KRS N-terminal이 절단되는 것을 확인하였다 (도 le 참조). 이와 같은 결과를 통해서 잘리는 과정이 KRS를 secretion 시키는 데 필수적인 부분임을 증명하였다.
<297>
<298> <실시예 2>
<299> Cascase-8에 의해서 절단되는 KRS
<300> 수많은 protease가 cell 안에 존재 하고 특정 protease들은 자신들이 인식할 수 있는 특정 sequence를 인식하여서 잘리는 과정을 수행한다. 본 발명에서는 KRS 를 자르는 protease를 찾기 위해서 먼저 KRS sequence에 특정 sequence가 있는지 확인하였다. Multiple alignment 결과, higher eukaryotes에서 보존 되어 있는 caspase에 의해 잘릴 수 있는 sequence를 발견하였다 (도 2a 참조). Caspase의 KRS 에 대한 효과를 확인하기 위해서 pan-caspase inibitor를 이용 하였다. Pan- caspase inhibitor를 처리한 후 KRS secretion과 KRS 잘리는 것이 줄어들 것인가를 확인하였다. Pan-caspase inhibitor를 처리한 결과， KRS의 secretion과 KRS가 잘리 는 것이 감소한 것을 확인 할 수 있었다 (도 2b 및 도 2c 참조). Caspase에 의해서 인식되는 KRS sequence의 부분적인 mutat ion (D12A)을 통해서 caspase에 의해서 인 식 될 수 없는 KRS의 secret ion과 잘리는 과정의 감소를 확인해 보았다 . 실험 결 과， D12A mutant의 경우 secret ion과 잘리는 과정이 감소함을 알 수 있었다 (도 2d 및 2e 참조) . 2가지 실험을 통해서 caspase가 KRS를 자르는 과정에 관여하고 caspase에 의해서 잘리는 것이 KRS의 secret ion을 증가 시킴을 알 수 있었다. 여러 가지 caspase 중에서 KRS가 가지고 있는 sequence의 경우 3， 6， 8에 의해서 잘릴 수 있는 가능성을 가지고 있다. 특정하게 Caspase-3, -6， -8, -9를 억제하는 inhibitor를 처리하고선 KRS secret ion을 확인해 보았다. 실험결과 caspase-8 inhibi tor만이 KRS의 secret ion을 억제시키는 것을 알 수 있었다 (도 2f 참조) . 또 한， siR A를 이용하여 특정 caspase 단백질의 발현 양을 감소시킨 후， KRS secret ion을 확인 한 결과에서도 inhibitor를 가지고 실험한 결과와 동일하게 caspase-8을 감소시킨 경우에만 KRS의 secret ion이 감소되는 것을 확인하였다 (도 2g 참조) , Caspase-8이 starvat ion 환경에서 일어나는 KRS secret ion 시에 KRS를 자르는 역할을 한다면 starvat ion 환경에서 양적인 변화나 act ivity에 변화가 있올 것이다. KRS를 secret ion 시키는 starvat ion 조건에서 caspase-8은 시간이 지남에 따라 다른 caspase-3, -6, -9와는 다르게 그 양이 증가하는 것을 확인할 수 있었다 (도 2h 참조) . Caspase-8을 과발현시킨 후 GFP-KRS를 이용하여서 잘리는 양을 확인 했을 때， caspase-8의 양이 증가 할수록 잘리는 KRS의 양이 증가함을 알 수 있었다 (도 2i 참조) . 상기와 같은 실험 결과를 통해 starvat ion 환경에서 caspaseᅳ 8이 증 가하여서 KRS를 자른다는 것을 증명하였다. 이와 같은 실험들을 통해 우리는 caspase-8이 KRS를 자르는 역할을 하고， 이는 KRS가 secret ion에 필수 적인 중요한 과정임을 확인하였다. 상기 결과들을 통해서 KRS가 secret ion 될 시에 N—terminal 13a. a 앞 부분이 잘려지게됨과 이 과정이 KRS secret ion에 중요한 key point 임을 증명하였다.
<301>
<302> <실시예 3>
<303> 절단된 KRS의 svntenin— 1과의 결합
<304> 본 발명에서는 caspase-8에 의해서 잘려지는 과정이 왜 KRS secret ion에 중 요한 것일까 라는 질문에 해답을 찾기 위해서 KRS의 cytokine act ivi ty를 측정하였 다. ILl-beta같은 단백질의 경우, 잘리는 과정이 cytokine act ivi ty를 좌우하기 때 문이다ᅳ 실험결과, KRS의 경우 WT과 AN12 mutant (13-597a. a)의 cytokine act ivi ty 가 동일하게 나왔다. 다음으로 KRS의 잘리는 과정이 KRS와 다른 단백질 간의 binding affinity를 좌우 할 것이라고 생각했다. KRS는 이미 이전 논문을 통해서 syntenin-1 단백질과 결합 할 수 있음이 증명 되었다. Syntenin-1은 세포 내에서 결합된 단백질을 이동시키는 역할을 하는 trafficking 단백질이다. 최근에는 exosome biogenesis에 중요한 역할을 한다고 알려져 있다. KRS는 c—terminal의 특 정 sequnce를 가지고서 syntenin-1과 결합하게 된다. 이러한 KRS의 C-terminal은 구조상 N-terminal에 의해서 가려질 수 있는 가능성이 있다. 따라서 N-terminal이 잘려진 KRS의 경우, syntenin-1과 결합하는 sequence가 좀 더 드러나게 되고 syntenin과의 결합 친화도 (binding affinity)가 증가 될 수 있을 것이다. Multiple-alignment를 통해서 이 부분 또한 caspase-8에 의해서 잘려지는 부분과 동일하게 higher eukaryotes에서 보존되어 있는 것을 확인하였다 (도 3a 참조). 또 한 starvation 또는 / 및 TNF-alpha 처리시에 KRS와 syntenin-1의 binding이 증가됨 을 확인하였고 (도 3b 참조)， starvation시의 KRS와 syntenin 간의 binding의 증가 는 caspase-8 inhibitor를 처리했을 때에 줄어드는 것을 확인하였다 (도 3c 참조). Caspase-8에 의해서 잘리지 않는 D12A의 경우， WT보다 syntenin-1과 binding 하는 양이 적었다 (도 3d 참조). 이를 다시 한번 확인하기 위해서 BiFC(Bimolecular fluorescence com lementation) assay 기법을 사용하였다. 상기 기법은 반으로 2 개진 venus 단백질이 각각 KRS와 syntenin에 반반씩 붙어서 발현되는 KRS-vnl73, syntenin— vc 155 plasmid를 이용해서 KRS와 syntenin이 결합했을 시에만 venus (green) 형광빛이 나오도록 하는 방법이다. 실험결과， starvation 시엔 BiFC 형광을 확인할 수 있었으며， caspase-8 inhibitor 처리했을 때와 D12A를 사용했을 때엔 BiFC 형광을 확인 할 수 없었다 (도 3e 참조). 이와 같은 결과로 잘리는 과정 이 KRS-syntenin binding을 증가시킴을 확인 할 수 있었다. 이렇게 KRS와 binding 이 증가되는 syntenin이 KRS secret ion에 미치는 영향에 대해 실험을 하였다. Si- syntenin을 이용하여 syntenin단백질을 줄인 결과, KRS secret ion은 syntenin을 줄 이 않은 것에 비해 확연하게 감소하였다 (도 3f 참조). 또한 실제로 KRS의 c- terminal이 syntenin과의 binding에 중요한지 확인하기 위해 K S의 c-terminal을 잘라 버린 deletion mutant (서열번호 2의 full length 서열에 대하여 1-592 a. a에 해당， Ac5로도 표기)를 제작하여 syntenin과의 binding을 확인 하였다. Deletion Mutant (1— 592a .a, Ac5)의 syntenin과의 binding 할 수 있는 능력은 WT에 비해 현 저히 떨어짐을 확인 하였다 (도 3g 참조). Syntenin과 결합할 수 없는 KRS deletion mutant(l-592a.a, Ac5)와 KRS WT을 이용하여 secretion 정도를 확인하였다. 확인 결과， deletion mutant(Ac5)의 경우 WT에 비해 secretion 되는 양이 적었다 (도 3h 참조). 이를 통해서 N-terminal이 잘리는 과정은 KRS의 c-terminal에 존재하는 syntenin binding mot if를 드러나게 함으로서 syntenin과 KRS의 binding이 증가되 게 됨을 밝혔고 이렇게 증가된 syntenin과의 binding은 KRS secretion에 중요함을 증명하였다.
<305>
<306> <실시예 4>
<307> Exosome secretion pathway를 통한 절단된 KRS의 분비
<308> KRS가 세포외로 분비되는'수단을 알아보기 위하여， 먼저 KRS가 secretion 된 media에서 vesicle만 분리하여 전자현미경 분석을 하였다. 전자현미경 분석 결과， cup-shape 모양이 나타났다 (도 4a 참조). 이는 알려진 exosome의 morphology와 같 다. 엑소좀 (Exosome)은 전자 현미경 분석 시에 cup-shape 모양이 나타나고, diameter는 50— 150nm정도이며 density는 1.15 - 1.19g/ml의 범위에 속하는 특징을 가지고 있다. 분리된 vesicle의 dameter는 평균 147.3nm로 이 또한 exosome의 특성 과 일치하는 것을 확인하였다 (도 4b 참조). 마지막으로 opti-prep gradient assay 를 사용하여 density를 확인 하였을 때， KRS가 검출된 vesicle은 1.09-1.15g/ml 정 도의 density를 가진다. 또한 syntenin이 같은 vesicle에 존재함을 확인하였다 (도 4c 참조). 이러한 결과를 통해서 KRS는 syntenin과 함께 exosome으로 secretion 됨 을 증명하였다. KRS의 exosome secret ion과 syntenin과의 관계를 확인하기 위해서 si -syntenin 처리 후 KRS exosome secret ion을 확인하였다. 그 결과， KRS의 exosome을 통한 secret ion은 si-syntenin을 처리했을 시에 감소하였다 (도 4d 참조 ) . Syntenin과 binding 하지 못하는 deletion mutant ( A c5, 1一 592a. a)를 사용하여 exosome secret ion을 확인 한 결과， WT에 비해 deletion mutant( C5, l-592a.a)의 경우 exosome secret ion이 줄어들었다 (도 4e 참조). 상기 2가지의 실험을 통해서 syntenin이 단지 KRS와 같은 exosome에 존재하는 것이 아니라 KRS exosome secretion에도 관여함을 알게 되었다. 상기 도 3a 내지 도 3h에서와 같이， KRS가 절단되는 과정이 syntenin과의 binding을 증가 시켜줌을 증명하였다. 따라서 마지 막으로 절단되지 않은 D12A mutant의 exosome secret ion올 KRS WT과 함께 비교 하 였다. D12A mutant는 KRS WT에 비하여 그 secretion이 되는 양이 현저하게 감소하 였다 (도 4f 참조). 따라서 이와 같은 결과를 종합해 볼 때， syntenin은 KRS exosome secretion에 중요하며， 절단되는 과정은 syntenin올 통한 KRS exosome secret ion에 필수적인 역할을 함을 알수 있었다.
<309> <310> <실시예 5>
<3ii> KRS의 절단에 의한 KRS exosome activity의 강화
<3i2> 본 발명의 발명자들은 절단된 KRS가 exosome을 통해서 secret ion이 되는 것 을 확인하였다. Exosome은 cell-cell signaling의 매개체로 알려져 있다. Exosome 은 특정 protein과 mi-RNA, tRNA 등 다양한 정보를 가지고 있다. 이런 exosome의 특성상 cell에서 다른 cell로 이러한 정보가 넘어가고, 넘어간 정보로 인해 cell은 본래와는 다른 역할을 하게 된다. KRS exosome의 기능을 확인하기. 위해서， 먼저 KRS WT, truncated KRS( AN12(13-597a.a)) 및 KRS exosome 각각을 macrophage에 5 시간 처리하여, 이들의 TNF-alpha secretion 효과를 확인하였다. 그 결과, KRS exosome이 KRS 단백질들과 같은 TNF-alpha secretion 증가효과가 있는 것을 확인하 였다 (도 5a 참조). 이와 같은 결과는 KRS 단백질과 KRS exosome이 같은 효과를 가 지는 것을 증명한다. 이를 다시 한번 증명하기 위해서， macrophage 세포를 사용하 여서 migration의 증가를 확인하였다. Wound-healing assay 결과， KRS 단백질 (WT, AN12(13-597a.a) 각각)과 KRS exosome을 처리하고 12hr 후에 macrophge의 migration이 증가됨을 확인 하였다 (도 5b 참조). KRS exosome은 KRS 단백질과 동일 한 효과를 나타내었다. 2가지 실험 결과를 종합했올 때， KRS exosome에 포함되어있 는 KRS 단편이 KRS exosome의 activity에 관여함 증명하였고 이는 KRS의 잘리는 과 정이 결과적으로 KRS exosome의 activity에도 중요함을 알 수 있다. 따라서 caspase-8에 의해서 KRS는 절단되고 이는 syntenin과의 binding을 강화시켜서 exosome으로의 이동을 증가시켜서 KRS exosome의 activity가 강화된다.
<313>
<314> <실시예 6>
<3i5> AN12 KRS 및 이를 포함하는 분비성 엑소좀의 암 전이 효과
<316> 도 5에서 확인한 바와 같은 exosome으로 인한 Inflammation 효과에서 KRS의 중요성을 파악하기 위해서， 먼저 cell에 si-RNA(si-con, si -KRS 각각)를 처리하였 다. si-RNA 처리 48시간 후 cell을 serum free starvation media에서 12시간 키웠 다. 이 media에서 exosome을 정제한 후， 각각의 exosome에 존재하는 단백질을 분석 하였다 (이하, 편의상 si -con를 처리한 세포의 media에서 정제한 exosome을 si -con exosome, siᅳ KRS를 처리한 세포의 media에서 정제한 exosome을 si-KRS exosome이라 고 명명함). 분석결과， exosome에 존재하는 KRS 단백질은 si-KRS를 처리한 cell에 서 정제한 exosome에서 즐어든 것을 확인하였다 (도 6a).
<3i7> 줄어든 KRS 단백질만큼 exosome inflammation effect가 줄어드는 것을 확인 하기 위해 macrophage에서의 TNFᅳ alpha secretion^- migration effect를 확인하였 다 (도 6b， 도 6c). 확인 결과, si-KRS exosome을 macrophgae에 처리했을 때， si- con exosome에 비해 macrophage의 TNF-alpha secretion0] 줄어들었고， migration 효과도 줄어듬을 알 수 있었다 (도 6b, 도 6c). 따라서 KRS는 exosome inflammation activity에 중요한 부분을 차지한다.
이러한 exosome effect에 중요한 KRS의 효과를 실제 세포와 동물모델에서 확 인하기 위해서 Intravital confocal visualization of macrophage and neutrophil recruitment 실험을 실시하였다. 실험을 위하여 먼저 B16F10 cell (Mus musculus skin melanoma)을 이용하였다. 일반적인 human cancer cell을 이용하여 mouse 실험 을 할 경우, 종 차이에 의한 면역반웅이 일어나기 때문에 B16F10 cell을 이용하였 다. B16F10 cell에 KRS WT-myc, KRS D12A-myc 를 형질전환 시키고 24시간을 키웠 다. 24시간 후, 각각의 세포를 LysM-GFP (Lysozyme M-GFP) mouse (macrophage와 neutrophil에 GFP가 발현되는 mouse)의 귀 뒤쪽 피부에 4xl04개의 세포를 주입한다. 주입 후 time course동안 macrophage와 neutrophil이 모여드는 것을 확인하였다. 확인 결과， KRS WT-myc을 형질전환시킨 세포를 주입한 경우 KRS D12A-myc 을 주입 했을 때보다 최대 2배정도 많은 macrophage와 neutrophil이 모여드는 것을 확인 할 수 있었다 (도 6d). 이 결과를 통해서 우리는 다시 한번 KRS가 exosome을 통한 cancer related inflammation에 중요함을 밝혔다.
이러한 KRS에 의한 inflammation의 정확한 mechanism을 확인하기 위해서
KRS 단백질 (KRS-WT, KRSAN12), KRS exosome을 이용하여 다양한 inflammatory cytokine secret ion을 확인하였다. 도 6e에서 보는 바와 같이 KRS단백질과 KRS exosome은 macrophage에서 TNF-alpha 뿐만 아니라 IL-6, mCRG-2, MMP9을 secretion 시켰다. Mouse CRG—2는 cxc chemokine에 속하는 단백질로 macrophage recruitment 를 강화 시키는 역할을 한다. 실제 tumor microenvironment에서 많은 수의 macrophage는 cancer metastasis와 poor prognosis와 연관 관계가 있다는 보고가 있다. IL-6는 cancer cell에 작용하여 E-cadherin을 낮추게 된다. E-cadherin의 감 소는 cancer metastasis에 중요한 과정 증 하나이며, 이는 cancer cell motility 증가시켜주는 Epithel ial— mesenchymal transition (EMT) mechanism의 중요한 marker 하나이다. MMP9은 extracellular matrix degradation과 vascular remodeling에 중요한 역할을 한다. 따라서 KRS가 발현된 exosome (즉， KRS exosome) 에 의해서 macrophage로부터 secret ion된 cytokine들은 모두 cancer cell의 metastasis를 도와주는 역할을 하고 있다는 것을 알수 있다. 즉 KRS가 발현된 exosome에 의해서 일어난 inflammation 반웅은 cancer eel 1 metastasis^- 도와 주 는 역할을 할 것이라 예상되며， eX0S0me activity에 중요한 역할을 하는 KRS는 cancer metastasis에 중요한 역할을 할 것으로 생각된다.
【산업상 이용가능성】
이상 살펴본 바와 같이， 본 발명은 서열번호 1로 표시되는 아미노산 서열을 포함하며 암세포로부터 분비되는 라이실 티알엔에이 합성효소 (KRS) 단편， 상기 KRS 단편을 포함하는 마이크로베지클 및 이들을 이용하여 암 진단에 필요한 정보를 제 공하고 암 전이 억제제를 스크리닝하는 방법에 관한 것으로， 본 발명은 암 진단에 필요한 정보를 제공하기 위한 진단 키트 개발 또는 암 전이 억제제 개발에 유용하 게 이용될 수 있어 산업상 이용가능성이 크다.

Claims

【청구의 범위】
【청구항 11
서열번호 1로 표시되는 아미노산 서열을 포함하며， 암세포로부터 분비되는 라이실 티알엔에이 합성효소 단편 .
【청구항 2]
제 1항의 라이실 티알엔에이 합성효소 단편을 포함하는 암세포에서 분비되는 마이크로베지클.
【청구항 3】
제 2항에 있어서， 상기 마이크로베지클은 액소좀인 것을 특징으로 하는 마이 크로베지클.
【청구항 4】
제 2항에 있어서, 상기 암은 유방암, 대장암， 폐암， 소세포폐암， 위암, 간암， 혈액암, 골암, 췌장암, 피부암， 두부 또는 경부암， 피부 또는 안구내 흑색종， 자궁 암， 난소암， 직장암, 항문부근암， 결장암， 유방암， 나팔관암종， 자궁내막암종， 자 궁경부암， 질암, 음문암종， 호지킨병, 식도암, 소장암， 내분비선암, 갑상선암， 부 갑상선암， 부신암, 연조직 육종， 요도암, 음경암， 전립선암, 만성 또는 급성 백혈 병， 림프구 림프종, 방광암， 신장암， 수뇨관 암， 신장세포 암종， 신장골반 암종， CNS종양, 1차 CNS 림프종, 척수 종양， 뇌간신경교종 및 뇌하수체 선종으로 이루어 지는 군에서 선택되는 하나 이상인 것을 특징으로 하는 마이크로베지클.
【청구항 5】
(a) 암이 의심되는 개체로부터 채취된 생물학적 시료에서 마이크로베지클을 분리하는 단계 ;
(b) 상기 (a) 단계의 마이크로베지클을 파쇄하여 제 1항의 라이실 티알엔에이 합성효소 단편 수준 또는 상기 단편을 암호화하는 유전자의 발현 수준을 측정하는 단계; 및
(c) 상기 단편 수준 또는 상기 단편을 암호화하는 유전자의 발현 수준을 정 상 대조구 시료의 상기 단편 수준 또는 상기 단편을 암호화하는 유전자의 발현 수 준과 비교하는 단계를 포함하는 암 진단에 필요한 정보를 제공하는 방법 .
【청구항 6]
(A) 라이실 티알엔에이 합성효소 (KRS) 또는 이의 C-터미널 영역을 포함하는 KRS 단편, 신테닌 (syntenin) 및 시험제제를 접촉시키는 단계;
(B) 상기 KRS 또는 이의 단편과 신테닌의 결합수준의 변화를 측정하는 단계;
(C) 상기 KRS 또는 이의 단편과 신테닌의 결합수준을 변화시킨 시험제제를 암세포에 접촉시켜， 상기 암세포로부터 계 2항의 마이크로베지클이 분비되는지 여부 를 확인하는 단계 ;
를 포함하는 암 전이 억제제 스크리닝 방법 .
【청구항 7】
제 6항에 있어서， 상기 (A) 단계의 라이실 티알엔에이 합성효소 (KRS)의 C-터 미널 영역은 서열번호 6으로 표시되는 아미노산 서열로 이루어진 것을 특징으로 하 는 암 전이 억제제 스크리닝 방법.
【청구항 8]
제 6항에 있어서， 상기 (A)단계의 KRS 단편은 서열번호 1의 아미노산 서열로 이루어지는 것을 특징으로 하는 암 전이 억제제 스크리닝 방법.
【청구항 9】
제 6항에 있어서， 상기 (A)단계의 신테닌은 서열번호 4의 아미노산 서열을 포 함하는 폴리펩티드인 것을 특징으로 하는 암 전이 억제제 스크리닝 방법.
【청구항 10]
제 6항에 있어서, 상기 방법은
(D) 상기 (C) 단계에서 제 2항의 마이크로베지클 분비를 억제하는 것으로 확 인된 시험제제를 암을 가지고 있는 동물에 투여하여 암 전이의 예방 또는 치료 효 과를 나타내는지 검사하는 단계 ;
를 추가적으로 포함하는 것을 특징으로 하는 암 전이 억제제 스크리닝 방법.
PCT/KR2015/005371 2014-05-28 2015-05-28 신규한 라이실 티알엔에이 합성효소 단편 및 이를 포함하는 마이크로베지클 WO2015183019A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/361,698 US20170073659A1 (en) 2014-05-28 2016-11-28 Novel lysyl trna synthetase fragment and microvesicles comprising same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2014-0064612 2014-05-28
KR20140064612 2014-05-28

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/361,698 Continuation US20170073659A1 (en) 2014-05-28 2016-11-28 Novel lysyl trna synthetase fragment and microvesicles comprising same

Publications (1)

Publication Number Publication Date
WO2015183019A1 true WO2015183019A1 (ko) 2015-12-03

Family

ID=54699281

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/005371 WO2015183019A1 (ko) 2014-05-28 2015-05-28 신규한 라이실 티알엔에이 합성효소 단편 및 이를 포함하는 마이크로베지클

Country Status (3)

Country Link
US (1) US20170073659A1 (ko)
KR (1) KR101787468B1 (ko)
WO (1) WO2015183019A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102318328B1 (ko) * 2020-04-13 2021-10-27 고려대학교 산학협력단 Gcc2 단백질을 과발현하는 엑소좀 기반 암 진단 또는 예후 예측용 마커 조성물
KR102184428B1 (ko) * 2020-05-25 2020-11-30 주식회사 씨케이엑소젠 중배엽줄기세포 유래의 엑소좀 생산방법 및 이로부터 제조된 배양액

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011153277A2 (en) * 2010-06-01 2011-12-08 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of lysyl-trna synthetases

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9127268B2 (en) 2009-12-11 2015-09-08 Atyr Pharma, Inc. Aminoacyl tRNA synthetases for modulating inflammation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011153277A2 (en) * 2010-06-01 2011-12-08 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of lysyl-trna synthetases

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI [O] 26 February 2014 (2014-02-26), SANTOS-CORTEZ: "lysine--tRNA ligase isoform 2", XP055241695, retrieved from ncbi Database accession no. NP_005539.1 *
KEPP, OLIVER ET AL.: "Lysyl tRNA synthetase is required for the translocation of calreticulin to the cell surface in immunogenic death", CELL CYCLE, vol. 9, no. 15, 2010, pages 3072 - 3077 *
KEPP, OLIVER ET AL.: "Molecular determinants of immunogenic cell death elicited by anticancer chemotherapy", CANCER AND METASTASIS REVIEWS, vol. 30, no. 1, 2011, pages 61 - 69, XP019885784, ISSN: 1573-7233 *
PARK, SANG GYU ET AL.: "Human lysyl-tRNA synthetase is secreted to trigger proinflammatory response", PNAS, vol. 102, no. 18, 2005, pages 6356 - 6361, XP008147456, ISSN: 0027-8424 *
WANG, FENG ET AL.: "Regulated capture by exosomes of mRNAs for cytoplasmic tRNA synthetases", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 288, no. 41, 2013, pages 29223 - 29228, XP055241315, ISSN: 0021-9258 *

Also Published As

Publication number Publication date
US20170073659A1 (en) 2017-03-16
KR101787468B1 (ko) 2017-11-15
KR20150137028A (ko) 2015-12-08

Similar Documents

Publication Publication Date Title
US20220283168A1 (en) Method for the detection of cancer cells by localization of peptides in nucleus as compared to cytoplasm
Mazroui et al. Caspase-mediated cleavage of HuR in the cytoplasm contributes to pp32/PHAP-I regulation of apoptosis
JP6463685B2 (ja) 合成致死性および癌の治療
SG174071A1 (en) Genes and polypeptides relating to breast cancers
US20090311681A1 (en) Pharmacodiagnostic test targeting oncology and neurodegeneration
Zhang et al. RNF43 ubiquitinates and degrades phosphorylated E-cadherin by c-Src to facilitate epithelial-mesenchymal transition in lung adenocarcinoma
KR100732298B1 (ko) 유비키틴 ｃ-말단 가수분해제-ｌ1을 이용한 암전이 진단용조성물
KR101787468B1 (ko) 신규한 라이실 티알엔에이 합성효소 단편 및 이를 포함하는 마이크로베지클
WO2008023841A1 (en) Breast cancer-associated gene, melk, and its interactions with bcl-g
KR102039624B1 (ko) BAG2 및 Cathepsin B 상호결합 억제 물질 스크리닝 방법
EP1959022B1 (en) Detection of uterine leiomyosarcoma using lmp2
US10718029B2 (en) Treatment targeting oncology and neurodegeneration
KR20160083742A (ko) Emt 저해제 스크리닝 방법
Thomsen et al. Fused in sarcoma (FUS) interacts with the cytolinker protein plectin: implications for FUS subcellular localization and function
US9193774B2 (en) Traceability of cellular cycle anomalies targeting oncology and neurodegeneration
Kaida et al. A Truncated Form of the p27 Cyclin-Dependent Kinase Inhibitor Translated from Pre-mRNA Causes G2-Phase Arrest
KR101471272B1 (ko) ＣｙｐＤ를 포함하는 보르테조밉 내성 진단용 바이오 마커 조성물 및 이를 이용한 진단 키트
Akiva et al. Identification of IFITM3 and MGAT1 as novel interaction partners of BRI3by yeast two-hybrid screening
Bonacci et al. Mechanisms of USP18 deISGylation revealed by comparative analysis with its human paralog USP41
Nam et al. The novel human HtrA2 ortholog in zebrafish: New molecular insight and challenges into the imbalance of homeostasis
KR101179651B1 (ko) 피부 편평세포암 진단 또는 예후 마커인 ｎｑｏ-1 및 이의 용도
KR101188693B1 (ko) 피부 편평세포암 진단 또는 예후 마커인 ＰｒｘⅠ 및 이의 용도
US20160195533A1 (en) Method for screening emt inhibitor
JP2002534357A (ja) 効果の高い抗腫瘍剤を得るための物質ならびに相当する方法
Henderson Identifying the targets of Protein Phosphatase-1cy2 in the mouse testis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15799438

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15799438

Country of ref document: EP

Kind code of ref document: A1