WO2015174798A1 - 근육노화 진단 및 치료를 위한 마이크로rna - Google Patents
근육노화 진단 및 치료를 위한 마이크로rna Download PDFInfo
- Publication number
- WO2015174798A1 WO2015174798A1 PCT/KR2015/004929 KR2015004929W WO2015174798A1 WO 2015174798 A1 WO2015174798 A1 WO 2015174798A1 KR 2015004929 W KR2015004929 W KR 2015004929W WO 2015174798 A1 WO2015174798 A1 WO 2015174798A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mirna
- seq
- fragment
- composition
- expression level
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Definitions
- the present invention relates to microRNA as a muscle aging diagnostic marker, and more particularly, the present invention relates to at least one miRNA selected from the group consisting of microRNA-136, microRNA-337, microRNA-127, microRNA-411, and microRNA-34, or a combination thereof.
- the present invention relates to a muscle aging diagnostic composition comprising an agent for measuring the expression level of a fragment, a muscle aging diagnostic kit including the composition, and a method for diagnosing muscle aging comprising measuring the expression level of the miRNA or a fragment thereof.
- Physiological aging is, for example, aging inevitably accompanied by changes in hair, skin, eyes, bones, brain, and the like, and a decrease in exercise capacity and energy metabolism.
- a decrease in muscle strength and endurance caused by aging deteriorates daily living ability.
- a decrease in energy metabolism may cause an imbalance between energy intake and energy consumption, which may cause lifestyle diseases such as obesity and diabetes.
- muscle atrophy in which muscle mass or strength of muscle decreases may include disuse muscle atrophy or sarcopenia, and when muscle atrophy occurs, muscle function is accompanied. Decreases.
- elderly people are observed to have muscular atrophy and muscular strength due to age, and are liable to be damaged or fractured, and when placed under the restriction of activities such as stabilization or cast fixation for the treatment and treatment thereof, Decreased muscle function falls into a vicious cycle.
- Aging is driven by genetic and environmental factors, but it is believed that it is possible to slow it down by improving environmental factors, including lifestyle, such as eating and exercising. As a means of preventing the decline in motor performance, muscle atrophy and muscle function accompanying aging, particularly in the elderly, proper exercise or rehabilitation is required.
- miRNA is one of the ones that have received a lot of attention as a major factor regulating various life phenomena including aging.
- miRNA is a short non-coding RNA consisting of about 22 nucleotide sequences, a genome found in plants and various animals. miRNAs are known to regulate the expression of more than 30% protein-producing genes by interfering with transcription or disrupting the transcription of complementary messenger RNA (mRNA) at post-transcriptional stages.
- mRNA complementary messenger RNA
- Such aging-related miRNAs are expected to be usefully used for the search for substances for the prevention and treatment of diseases caused by aging of various organs such as skin aging, heart and brain. There is no known use of.
- the present inventors have made diligent research efforts to develop a method for diagnosing muscle aging, thereby confirming that muscle aging can be diagnosed by detecting that the expression levels of various miRNAs in the aged skeletal muscle may be changed.
- the invention was completed.
- One object of the present invention is muscle aging comprising an agent for measuring the expression level of one or more miRNAs or fragments thereof selected from the group consisting of miRNA-136, miRNA-337, miRNA-127, miRNA-411 and miRNA-34. It is to provide a diagnostic composition.
- Another object of the present invention to provide a kit for diagnosing muscle aging comprising the composition.
- Another object of the present invention is to measure the expression level of one or more miRNA or fragment thereof selected from the group consisting of miRNA-136, miRNA-337, miRNA-127, miRNA-411 and miRNA-34 muscle It is to provide a method for diagnosing aging.
- miRNAs including miRNA-136, miRNA-337, miRNA-127, miRNA-411, and miRNA-34 provided by the present invention, not only decrease muscle atrophy due to aging and subsequent muscle function, but also decrease energy metabolism accordingly.
- 1 is a diagram showing the difference in muscle mass of skeletal muscle between young and aged mice.
- FIGS. 2A to 2D are schematic diagrams illustrating analysis of small RNA transcriptomes expressed in skeletal muscles of young mice and skeletal muscles of senescent mice derived by next generation sequencing (NGS).
- NGS next generation sequencing
- Figure 3 is a comparison of the difference in expression levels of the final miRNA found from skeletal muscle of young and aging mice by high throughput small-RNA sequencing.
- Figure 4 is a diagram comparing the difference in the expression level of the final miRNA found from skeletal muscle of young and aging mice by real-time quantitative PCR (real-time quantitative PCR) method.
- the present invention measures the expression level of one or more miRNA or fragment thereof selected from the group consisting of miRNA-136, miRNA-337, miRNA-127, miRNA-411 and miRNA-34 It provides a composition for diagnosing muscle aging, comprising a formulation to.
- miRNA refers to non-coding RNA having a nucleotide sequence of 22 or less, and regulates gene expression by degrading target mRNA or inhibiting translation of target mRNA.
- the miRNA includes a variety of miRNA, but specifically miRNA-136, miRNA-337, miRNA-127, miRNA- 411 and miRNA-34 may be included.
- miRNA-136 biologically inhibits glioma by inhibiting the expression of anti-apoptotic genes AEG-1 (astrocyte elevated gene-1) and Bcl-2 (B-cell lymphoma-2).
- a miRNA known to promote apoptosis of glioma cells located at the locus of mouse chromosome 12, on the same locus as miRNA-337, miRNA-127 and miRNA-411 It is miRNA which forms a cluster by being present.
- it may be a polynucleotide having a nucleotide sequence of SEQ ID NO: 1.
- fragment may include a segment of a sequence which is deleted when compared to a reference sequence of a miRNA, or is identical in position to a reference sequence, and the term “reference sequence” of the present invention. Is a sequence designated to be used as a basis for sequence comparison.
- the miRNA-136 fragment of the present invention may preferably be a polynucleotide having a sequence of SEQ ID NO: 2 or SEQ ID NO: 3.
- miRNA-337 used in the present invention, biologically, regulates the expression of TGF-beta receptor 2 (TGFBR 2) and plays an important role in chondrogenesis.
- Aggrecan (AGC1) MiRNA is known to be applicable to the treatment of arthritis by affecting the expression of cartilage-specific genes, such as miRNA-136 and miRNA-127, located on the left side of mouse chromosome 12. And miRNAs that form clusters by being present at the same locus as miRNA-411 and the like.
- it may be a polynucleotide having a nucleotide sequence of SEQ ID NO: 4.
- the miRNA-337 fragment of the present invention may preferably be a polynucleotide having a sequence of SEQ ID NO: 5 or SEQ ID NO: 6.
- miRNA-127 refers to a miRNA that is known to biologically target BCL 6 (B-cell lymphoma 6) gene to regulate cell proliferation and senescence.
- the miRNA is located on the chromosome 12 locus and forms a cluster by being present at the same locus as miRNA-136, miRNA-337 and miRNA-411.
- it may be a polynucleotide having a nucleotide sequence of SEQ ID NO: 7.
- the miRNA-127 fragment of the present invention may be a polynucleotide having a sequence of SEQ ID NO: 8 or SEQ ID NO: 9.
- miRNA-411 is biologically up-regulated in Facioscapulohumeral Muscular Dystrophy (FSHD) myoblasts and inhibits myogenic factors, thereby muscle differentiation.
- miRNAs are known to play an important role in regulating myogenesis, located on the mouse chromosome 12 locus and clustered on the same locus as miRNA-136, miRNA-337 and miRNA-127 It is a miRNA forming a cluster.
- it may be a polynucleotide having a nucleotide sequence of SEQ ID NO: 10.
- MiRNA-411 fragment of the present invention preferably may be a polynucleotide having a sequence of SEQ ID NO: 11 or SEQ ID NO: 12.
- miRNA-34 is composed of miRNA-34a, miRNA-34b, miRNA-34c, and the like, and biologically, the miRNA-34 family is pathologically characterized by thickening and destruction of cardiomyocytes, It is a miRNA known to enhance cardiac function by weakening the cardiac remodeling process, which is characterized by destruction of collagen that connects cardiomyocytes.
- the miRNA-34 may include miRNA-34a or miRNA-34c, preferably miRNA-34a is a polynucleotide having a nucleotide sequence of SEQ ID NO: 13, and a miRNA-34c is a nucleotide sequence of SEQ ID NO: 16 It may be a nucleotide.
- MiRNA-34a fragment of the present invention preferably SEQ ID NO: 14 or SEQ ID NO: 15, and miRNA-34c fragment may be a polynucleotide having a sequence of SEQ ID NO: 17 or SEQ ID NO: 18.
- muscle aging used in the present invention is meant to encompass muscle decline caused by aging, for example, a decrease in muscle function (muscle strength, muscle endurance, muscle wits, etc.), muscle atrophy, and the like. This means that the muscle mass decreases due to the reduction or reduction of muscle cells.
- diagnosis refers to confirming the presence or characteristic of a pathological condition.
- diagnosis may be interpreted as confirming the progression or onset of muscle aging.
- the composition for diagnosing muscle aging is miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA -369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 and miRNA-92 will further comprise an agent for measuring the expression level of one or more miRNAs or fragments thereof selected from the group consisting of Can be.
- the miRNA-146 miRNA-146a, miRNA-148 is miRNA-148a, miRNA-190 is miRNA-190a, miRNA-193 is miRNA-193a, miRNA-196 is miRNA-196b, miRNA- 92 may include miRNA-92b.
- the sequence of miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 and miRNA-92b or a fragment thereof may be composed of the nucleotide sequences disclosed in Table 1 above.
- the miRNAs may be nucleotide sequences of SEQ ID NOs: 1 to 69, and the nucleotide sequences of SEQ ID NOs: 1 to 69 may be used as diagnostic markers for diagnosing the progress or development of muscle aging.
- the sequence may be modified to some extent in diagnosing the progress or development of muscle aging.
- base sequences that maintain homology of at least 80%, preferably at least 90%, more preferably at least 95%, and most preferably at 98% by such artificial modifications are desired in the present invention.
- it is possible to significantly compare the expression level difference between normal individuals and aging individuals as a diagnostic marker for muscle aging it will be readily understood that it is equivalent to the nucleotide sequence of the present invention.
- the term "marker or diagnostic marker” refers to a substance capable of diagnosing an aging cell or an individual having an aging disease from a normal cell or a normal individual.
- Organic biomolecules such as polypeptides, proteins or nucleic acids (eg, mRNA, etc.), lipids, glycolipids, glycoproteins or sugars (monosaccharides, disaccharides, oligosaccharides, etc.) that exhibit an increase or decrease in advanced or diseased cells or individuals.
- the muscle aging diagnostic marker of the present invention is a miRNA or a fragment of the miRNA that shows a difference in expression level specifically in muscle aging cells as compared to cells of normal cells or tissues.
- the term "agent for measuring the level of miRNA or fragment thereof” refers to an agent used in a method for confirming the expression of miRNA or fragment thereof contained in a sample, preferably RT-PCR, Competitive RT-PCR, Real-time RT-PCR, RNase protection assay (RPA), Northern blotting, Gene Chip Assay It may be a primer or a probe that can specifically bind to a target gene to be used, but is not particularly limited thereto.
- primer refers to a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming complementary templates and base pairs, and for template strand copying. By a short nucleic acid sequence that functions as a starting point. Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures.
- probe refers to a nucleic acid fragment such as RNA or DNA, which may correspond to a short base of several to long bases capable of specific binding with a gene or mRNA, and oligonucleotide. Probes, single stranded DNA (single stranded DNA) probes, double stranded DNA (double stranded DNA) probes, RNA probes and the like can be produced in the form of, and can be labeled for easier detection.
- Primers or probes of the invention can be synthesized chemically using phosphoramidite solid support methods, or other well known methods. Such nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, eg, uncharged linkages such as methyl phosphonate, phosphotriester, phosph Modifications to poroamidates, carbamates, etc.) or charged linkers (eg, phosphorothioates, phosphorodithioates, etc.).
- derived miRNA that can be used as a marker for diagnosing muscle aging.
- the miRNA is a young mouse using a next generation sequence (NGS) method, which is a new sequencing method that can simultaneously analyze a large amount of DNA sequences using a Sollexa or SOLID sequencer.
- NGS next generation sequence
- Downregulated miRNAs in skeletal muscle of aging mice include miRNA-136, miRNA- 337, miRNA-127, and miRNA-411, as well as miRNA-143, miRNA-144, miRNA-148a, miRNA-190a, miRNA-193a, and miRNA-434 And miRNAs that are upregulated, including miRNA-34a and miRNA-34c, including miRNA-146a, miRNA-185, miRNA-196b, miRNA-215, miRNA-223, miRNA-369, miRNA-483, It was confirmed that miRNA-615, miRNA-155, miRNA-203 and miRNA-92b and the like (Fig. 3).
- the various miRNAs could be confirmed that the expression level decreases or increases as muscle aging progresses, including miRNA-136, miRNA-337, miRNA-127, miRNA-411 and miRNA-34 of the present invention.
- miRNA-136, miRNA-337, miRNA-127, miRNA-411 and miRNA-34 of the present invention Using the agent to measure the expression level of the various miRNA was found that can effectively diagnose muscle aging.
- the present invention provides a muscle aging diagnostic kit comprising the composition for diagnosing muscle aging.
- the diagnostic kit of the present invention includes miRNA-143, miRNA-144, miRNA-146, including miRNA-136, miRNA-337, miRNA-127, miRNA-411 and miRNA-34 from samples of individuals suspected of developing aging of muscle. miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA- 434 and miRNA-92 or may be used to diagnose muscle aging by measuring the expression level of the fragment corresponding to the miRNAs, but is not particularly limited, primers for measuring the expression level of the various miRNA or the corresponding fragments Or probes as well as one or more other constituent compositions, solutions or devices suitable for analytical methods.
- the diagnostic kit for measuring the expression level of fragments corresponding to the miRNAs may be a kit containing the necessary elements necessary to perform RT-PCR.
- the RT-PCR kit includes a test tube or other appropriate container, reaction buffers (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), Taq-polymerases and reverse transcriptases, in addition to each primer pair specific for the gene.
- reaction buffers pH and magnesium concentrations vary
- dNTPs deoxynucleotides
- Taq-polymerases reverse transcriptases
- enzymes DNase, RNAse inhibitors, DEPC-water (DEPC-water)
- DEPC-water DEPC-water
- It may also comprise primer pairs specific for the genes used as quantitative controls.
- a kit of the present invention may contain the necessary elements necessary to perform a gene chip assay.
- the gene chip analysis kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and a reagent, a preparation, an enzyme, or the like for preparing a fluorescent probe.
- the substrate may comprise cDNA corresponding to the quantitative control gene or fragment thereof.
- the present invention provides a method for diagnosing muscle aging using the diagnostic composition or kit, specifically, (a) miRNA-136, miRNA-337, miRNA-127, miRNA- in a biological sample isolated from an individual. Measuring the expression level of one or more miRNAs or fragments thereof selected from the group consisting of 411 and miRNA-34; And (b) comparing the expression level of the measured miRNA or fragment thereof with the expression level of the miRNA or fragment thereof of the normal control sample.
- the expression level of at least one miRNA or fragment thereof selected from the group consisting of miRNA-136, miRNA-337, miRNA-127 and miRNA-411 is expressed in the corresponding miRNA or fragment thereof in a normal control sample. If less than the level, determining that muscle aging has progressed; Or (c) when the expression level of the miRNA-34 or a fragment thereof is higher than the expression level of the miRNA-34 or a fragment thereof in the normal control sample, the method may further include determining that muscle aging has progressed. .
- the miRNA-34 may be a method of miRNA-34a or miRNA-34c.
- the step of measuring the expression level of miRNA is reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (competitive RT-PCR), real time quantitative RT-PCR (real time quantitative RT-PCR), Or RNase protection method, Northern blotting or gene chip.
- RT-PCR reverse transcriptase polymerase reaction
- competitive RT-PCR competitive reverse transcriptase polymerase reaction
- real time quantitative RT-PCR real time quantitative RT-PCR
- RNase protection method Northern blotting or gene chip.
- the muscle aging diagnostic method using the diagnostic composition or kit is miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA- in step (a).
- (c) the expression level of one or more miRNAs or fragments thereof selected from the group consisting of miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193, and miRNA-434 is equivalent to that of a normal control sample.
- the method may further include determining that the muscle aging has progressed.
- the present invention is administered a candidate substance that is expected to be able to prevent or treat the progression or onset of muscle aging, miRNA-136, miRNA-337, miRNA-127, miRNA- It provides a method for screening an agent for the prevention or treatment of muscle aging comprising measuring the expression level of at least one miRNA or fragment thereof selected from the group consisting of 411 and miRNA-34.
- the method for screening an agent for preventing or treating muscle aging of the present invention comprises: (a) miRNA-136, miRNA-337, miRNA-127, miRNA-411, and miRNA from a sample of an experimental animal that develops muscle aging as a control group.
- MiRNA-136, miRNA-337, miRNA-127, miRNA-411 and miRNA-34 of the present invention in cells, more preferably in muscle cells, in the absence of candidate agents capable of preventing or treating muscle aging Measuring the expression level of one or more miRNAs or fragments thereof selected from the group consisting of: and further, the miRNA-136, miRNA-337, miRNA-127, miRNA-411 and miRNA-34 of the present invention in the presence of the candidate By comparing the levels of one or more miRNAs or fragments thereof selected from the group consisting of and comparing the two to the miRNA-136, miRNA-337, miRNA-127 and miRNA-411 of the present invention when the candidate substance is present.
- a substance in which the expression level of at least one miRNA or fragment thereof selected from the group consisting of is increased above that in the absence of the candidate, or the expression level of the miRNA-34 or a fragment thereof in the absence of the candidate Substances that decrease below levels can be predicted as agents for the prevention of muscle aging.
- miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193 and miRNA-136, miRNA-337, miRNA-127 and miRNA-411 which are down-regulated miRNAs in skeletal muscle of senescent mice
- Substances that increase the expression level, such as miRNA-434 or fragments corresponding to the miRNAs, can be predicted as agents for preventing or treating muscle aging.
- miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615 in addition to miRNA-34, a miRNA that is upregulated in skeletal muscle of senescent mice
- miRNA-34 a miRNA that is upregulated in skeletal muscle of senescent mice
- Substances that reduce the expression level of miRNA-155, miRNA-203 and miRNA-92 or fragments corresponding to the miRNAs can be predicted as agents for preventing or treating muscle aging.
- the present invention provides an enhancer for targeting at least one miRNA or fragment thereof selected from the group consisting of miRNA-136, miRNA-337, miRNA-127 and miRNA-411; Or it provides a composition for inhibiting muscle aging comprising an inhibitor targeted to miRNA-34 or a fragment thereof as an active ingredient.
- the composition for inhibiting muscle aging targets at least one miRNA selected from the group consisting of miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193, and miRNA-434 or fragments corresponding to miRNAs thereof.
- miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615 in addition to miRNA-34, a miRNA that is upregulated in skeletal muscle of senescent mice Inhibitors targeting miRNA-155, miRNA-203 and miRNA-92 or fragments corresponding to the miRNAs can inhibit muscle aging by reducing the expression level of the miRNA and the corresponding fragments.
- Enhancers targeting the miRNAs or fragments thereof may be, but are not limited to, compounds or mimic forms specific to the miRNAs or fragments thereof.
- inhibitors targeting the miRNAs or fragments thereof may preferably be in the form of siRNA, aptamers, antisense oligonucleotides, ribozymes or compounds specific to, but not limited to, the miRNAs or fragments thereof. .
- mimic is a polynucleotide that mimics miRNA action and may be therapeutically targeted by the analog.
- RNA refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing, and thus, can effectively inhibit expression of a target gene, and thus, efficiently knockdown or gene therapy methods. Can be used as
- aptamer refers to a nucleic acid molecule having a single stranded oligonucleotide and having a size of about 20 to 60 nucleotides and having binding activity to a predetermined target molecule. Depending on the sequence, it may have various three-dimensional structures, and may have high affinity with a specific substance, such as an antigen-antibody reaction. Aptamers can inhibit the activity of a given target molecule by binding to the desired target molecule.
- the aptamers of the invention may be RNA, DNA, modified nucleic acids or mixtures thereof, and may also be in linear or cyclic form.
- antisense refers to a molecule designed to interfere with gene expression and to recognize or bind to a specific desired target polynucleotide sequence.
- Antisense molecules typically include oligonucleotides or oligonucleotide analogs capable of specifically binding to a target sequence present on an RNA molecule.
- oligonucleotide refers to a molecule consisting of DNA, RNA or DNA / RNA hybrids
- oligonucleotide analogue refers to a molecule containing an oligonucleotide-like structure
- ribozyme refers to an RNA molecule having enzymatic activity, and refers to a nucleic acid molecule capable of catalyzing a chemical reaction within or between molecules.
- the ribozymes available in the present invention can be any of the different types of ribozymes that catalyze nuclease or nucleic acid polymerase type reactions based on the ribozymes found in natural systems, and are engineered to catalyze specific reactions in vivo. Ribozymes are also available. Ribozymes can cleave RNA or DNA substrates and cleave RNA substrates for the purposes of the present invention. Ribozymes typically cleave nucleic acid substrates through cleavage followed by recognition and binding of the target substrate, which recognition is mostly based on base pair interactions, and thus may have features that allow for target specific cleavage.
- muscle mass was compared between young mice (6 months old) and aged mice (24 months old).
- mice 6 young male C57BL / 6 mice (6 months) and 6 aging male C57BL / 6 mice (24 months old) were purchased from the Laboratory Animal Resource Center (Korea Research Institute of Bioscience and Biotechnology). Before sacrifice for four types of muscle dissection: soleus muscle (SOL), extensor digitorum longus (EDL), tibialis anterior (TA), and gastrocnemius (gastroc.) The body weight of the mice was recorded. Each muscle mass was recorded and gastrocnemius (gastroc.) was collected immediately for the next microRNA (miRNA) profiling experiment.
- SOL soleus muscle
- EDL extensor digitorum longus
- TA tibialis anterior
- gastrocnemius gastroc.
- TA tibialis anterior
- gastroc gastrocemius
- small RNA sequencing analyzes and compares whole genome-wide miRNAs expressed in skeletal muscle of young mice and skeletal muscle of aging mice It was.
- total RNA was extracted and miRNA libraries were prepared according to Illumina library preparation protocol (Illumina Inc., San Diego, CA, USA). Each library was indexed with Illumina adapters (6-base barcodes). Small RNA libraries were size fractionated on a 6% TBE urea polyacrylamide gel and 140 to 160 base pair fractions were excised from the gel. Obtained and purified. Purified miRNA libraries were quantified using Agilent DNA 1000 chip. All indexed samples were pooled and sequenced in one lane of Illumina GAIIx (36 bp reads).
- the raw small RNA sequencing is translated into a reference genome before sequencing mapping, and quality translation of the nucleotide sequence is performed by FastQC (http: //www.bioinformatics.babraham). .ac.uk / projects / fastqc), and the adapter sequence attached to the 3 'end was removed with an in-house Perl script. After trimming the adapter sequence, the fragment size read size distribution was analyzed by the R (http://www.r-project.org.) Script.
- the adapter-trimmed, compact ribonucleic acid read is a UCSC Genome Browser (http :) with BWA (http://bio-bwa.sourceforge.net.) Software with default options.
- RNA RNA
- miRNA microRNA
- tRNA transfer RNA
- rRNA ribosomal RNA
- Mapping positions and annotation information are compared and sequenced into RNA types that match all mapped sequence fragments, and the relative frequency for expression of each RNA type is assessed based on the number of sequence fragments specified.
- RNAs include small nuclear RNA (snRNA), small cytoplasmic RNA (scRNA), signal recognition particle RNA (srpRNA), and ribosomal RNA (rRNA). , Transfer RNA (tRNA), and RNA interacting with the pituitary protein (piwi-interacting RNA; piRNA).
- snRNA small nuclear RNA
- scRNA small cytoplasmic RNA
- srpRNA signal recognition particle RNA
- rRNA ribosomal RNA
- tRNA Transfer RNA
- piRNA RNA RNA interacting with the pituitary protein
- PiRNA found in germ cells was found to be up-regulated in skeletal muscle of senescent mice (FIG. 2C).
- the top 10 miRNAs were classified into the top 10 final miRNAs. Accounted for (FIG. 2D). Of the top 10 final miRNAs analyzed above, the remaining miRNAs, except for the majority, miR-10b, were identified as miRNAs that have already been reported for their role in muscle.
- miRNAs associated with aging of skeletal muscle To search for miRNAs associated with aging of skeletal muscle, high throughput small-RNA sequencing revealed the final miRNA with at least five sequence fragments from skeletal muscle of young and aging mice. Of these, 20 miRNAs were up-regulated and 19 miRNAs were down-regulated in aged muscles (> 1.5 fold difference, t- test, p ⁇ 0.05). Among the miRNAs selected were miRNAs such as miRNA-206, miRNA-434, miRNA-34, which have been previously reported in connection with muscle aging.
- mRNA messenger RNA
- Reference genome sequences from mice ( Mus musculus ) were obtained from the University of California, Santa Cruz Genome Browser Gateway (assembly ID: mm10). Reference standard genome indices were designed using Bowtie2-build components from Bowtie2 (ver. 2.0) and SAMtools (ver. 0.1.18). Tophat2 (ver. 2.0.8) was applied to a tissue sample for mapping sequence fragments to reference standard genomes. Gene expression was calculated using fragments per kilobase of transcript per million fragments mapped (FPKM) for each gene using a standard sequence gene (mm10) model downloaded from the UCSC Browser gateway. Converted to log 2 for further analysis.
- FPKM fragments per kilobase of transcript per million fragments mapped
- the expression levels of miRNA-136, miRNA-337, miRNA-127 and miRNA-411 of the present invention are Compared with the expression level in the muscle of young mice, it was confirmed that the expression level in aging muscles is down-regulated.
- the expression level of miRNA-34 of the present invention was compared with the expression level in the muscles of young mice, it was confirmed that the expression level in aging muscles is up-regulated.
- the muscle aging is diagnosed by detecting that the miRNAs, including miRNA-136, miRNA-337, miRNA-127, miRNA-411, and miRNA-34 of the present invention, are upregulated or down-regulated according to muscle aging. I could confirm that I could.
- Real-time quantitative PCR was performed to re-evaluate the difference in expression of the final miRNAs detected from skeletal muscles of young and aging mice by high throughput small-RNA sequencing.
- each reverse transcriptase (RT) reaction consists of a 50 nM stem-loop RT primer, 0.25 mM dNTP, 3.33 units / ul MultiScribe RT enzyme, and 0.25 units / ul RNase inhibitor. 10 ng of total RNA was isolated using mir Vana miRNA isolation kit containing RT buffer (Applied Biosystems). The reaction was incubated at 16 ° C. for 30 minutes, 42 ° C. for 30 minutes, 85 ° C. for 5 minutes and the reaction was stopped at 4 ° C.
- Each quantitative PCR (qPCR) reaction consists of 1.33ul of reverse transcription product, 1ul of 20 ⁇ primers from TaqMan MicroRNA assay, probe mix, and 0.5ul of H-Taq DNA polymerase and 10ul of buffer mixture (40 mM Tris-HCL (pH 8.4), 100 mM KCl, 6 mM MgCl 2 , 0.5 mM dNTP, and 10% DMSO).
- the reaction was incubated at 95 ° C. for 10 minutes on a 96 well plate using the Bio-Rad CFX96 System, followed by 40 cycles of PCR for 15 seconds at 95 ° C. and 1 minute at 60 ° C., respectively.
- TaqMan® Universial reverse primer was used as the reverse primer, and the forward primers are shown in Table 4 below.
- the detection start cycle (Ct) was defined as the number of fractional cycles in which the fluorescence emission had a fixed threshold.
- U6 small nuclear RNA (snRNA) served as an endogenous control for normalization.
- miRNA-136, miRNA-337, miRNA-127 and miRNA-411 of the present invention confirmed that the expression level in the aging muscle is down-regulated by sequencing, real-time quantitative PCR In addition, the expression level in aging muscles was down-regulated compared to the expression level in the muscles of young mice.
- miRNA-34, miRNA-34, miRNA-155, miRNA-155, and miRNA-203 which were found to be up-regulated in sensitized muscle by sequencing, were subjected to real-time quantitative PCR. Compared with the expression level in the muscles of young mice through, re-proving that the expression level is upregulated in the aging muscle (Fig. 4A).
- miRNA-148 and miRNA-434 which were confirmed to be down-regulated in aging muscles by sequencing, were compared with the expression levels in muscles of young mice through real-time quantitative PCR. Downregulation of expression levels in muscle was re-validated (FIG. 4B).
- miRNAs including miRNA-136, miRNA-337, miRNA-127, miRNA-411 and miRNA-34 of the present invention, can be used as muscle aging markers.
- miRNAs including miRNA-136, miRNA-337, miRNA-127, miRNA-411 and miRNA-34 of the present invention, can be used as muscle aging markers.
- miRNAs including miRNA-136, miRNA-337, miRNA-127, miRNA-411 and miRNA-34 of the present invention, can be used as muscle aging markers.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 근육노화 진단 마커로서의 마이크로RNA에 관한 것으로서, 보다 구체적으로 본 발명은 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34로 이루어진 군으로부터 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 제제를 포함하는 근육노화 진단용 조성물, 상기 조성물을 포함하는 근육노화 진단용 키트 및 상기 miRNA 또는 이의 단편의 발현 수준을 측정하는 단계를 포함하는 근육노화 진단방법에 관한 것이다. 본 발명에서 제공하는 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34를 비롯한 다양한 miRNA는 노화에 따른 근위축 및 그에 수반하는 근기능의 저하뿐만 아니라, 이에 따른 에너지 대사의 저하로 비만이나 당뇨병 등의 질환까지도 수반할 수 있는, 근육노화의 진행 또는 발병 여부, 그리고 노화 정도를 진단할 수 있는 마커로 사용될 수 있으므로, 근육노화 진단 키트 개발 및 근육노화 억제 물질을 탐색하는데 있어서, 탁월한 효과가 있는 마커로 널리 활용될 수 있다.
Description
본 발명은 근육노화 진단 마커로서의 마이크로RNA에 관한 것으로서, 보다 구체적으로 본 발명은 microRNA-136, microRNA-337, microRNA-127, microRNA-411 및 microRNA-34로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 제제를 포함하는 근육노화 진단용 조성물, 상기 조성물을 포함하는 근육노화 진단용 키트 및 상기 miRNA 또는 이의 단편의 발현 수준을 측정하는 단계를 포함하는 근육노화 진단방법에 관한 것이다.
노화는 생리학적 노화와 병적 노화로 크게 나뉘어진다. 생리학적 노화는 가령에 수반하여 필연적으로 일어나는 노화로서, 모발, 피부, 눈, 뼈, 뇌 등의 변화, 운동 능력이나 에너지 대사의 저하가 생긴다.
한편, 노화에 의해 생기는 근력이나 지구력의 저하는 일상의 생활 능력을 저하시킨다. 또한, 에너지 대사의 저하는 에너지 섭취와 에너지 소비의 불균형을 초래하여, 비만이나 당뇨병 등의 생활 습관병의 원인이 될 수도 있다.
일반적으로, 근육의 근질량이나 근력이 감소하는 근위축(muscular atrophy)에는, 폐용성 근위축(disuse muscle atrophy)이나 사르코페니아(Sarcopenia) 등을 들 수 있는데, 근위축이 일어나면, 그에 수반하여 근기능의 저하가 나타나게 된다. 특히, 고령자는 가령에 의한 근위축이나 근력의 저하가 관찰되어, 근육 손상이나 골절이 되기 쉬워지며, 이의 치료 및 요양을 위한 안정 상태나 깁스 고정 등의 활동 제한하에 놓여지면, 폐용성 근위축이나 근기능의 저하가 급속히 진행되는 악순환에 빠지게 된다.
노화는 유전적 요인이나 환경적 요인에 의해 진행되지만, 식사 및 운동과 같은 생활 습관을 비롯한 환경적 요인을 개선함으로써 늦추는 것은 가능하다고 여겨지고 있다. 노화에 수반하는 운동 능력 저하나 근위축이나 근기능의 저하를 방지하는 수단으로서, 특히 고령자의 경우에는 적당한 운동 또는 재활요법(rehabilitation)의 실천이 요망된다.
아울러, 최근에는 운동이나 이학요법 뿐만 아니라, 노화를 억제할 수 있는, 보다 구체적으로 근위축 및 그에 수반하는 근기능의 저하 등의 근육노화를 억제할 수 있는 성분 탐색 연구가 행해지고 있다.
이와 더불어, 근위축 및 그에 수반하는 근기능의 저하 뿐만 아니라, 이에 따른 에너지 대사의 저하로 비만이나 당뇨병 등의 질환까지도 수반할 수 있는 근육노화의 여부 및 정도를 진단하거나, 상기 근육노화 억제 물질을 탐색하는데 있어서 탁월한 효과가 있는 진단 마커의 개발이 절실하다.
최근, 노화를 비롯한 다양한 생명현상을 조절하는 주요한 인자로 알려져 많은 관심을 받고 있는 것들 중 하나로 마이크로RNA(microRNA; miRNA)가 있다. miRNA는 약 22개의 염기서열로 이루어진 짧은 암호화되지 않은(non-coding) RNA로서, 식물에서부터 다양한 동물들에서 발견되는 유전체이다. miRNA는 전사 이후의 단계에서 상보적인 메신저RNA(messenger RNA; mRNA)의 전사과정을 방해하거나 mRNA를 분해하게 함으로써, 30% 이상의 단백질 생산 유전자 발현을 조절하는 것으로 알려져 있다. 이 miRNA는 다양한 생물학적 과정에 관여한다는 것이 많은 연구들을 통해 밝혀졌으며, 최근에는 세포, 조직 및 한 개체의 수명 등 여러 노화과정에 miRNA 발현 변화가 중요한 역할을 한다고 보고되고 있다.
아직까지 miRNA가 노화 질환에 어떤 역할을 하는지는 잘 알려져 있지는 않으나, 노화과정에 있어서 miRNA의 발현 변화에 대한 연구가 활발히 진행되고 있다. 예컨대, 피부 노화에 대한 징후(예를 들어, 주름)를 감소시키기 위한, 노화 관련 유전자 및 miRNA를 기재한 문헌(미국공개특허, 제2011-0301091호), 마우스의 노화된 간(liver) 및 뇌(brain) 등의 기관에서 발현되는 노화와 관련된 유전자 및 miRNA의 발현량 변화 및 역할에 대해 기재한 문헌(Smith-Vikos T. et al., J Cell Sci., 125(1):7-17, 2012) 및 마우스의 노화된 심장에서 발현되는 노화와 관련된 miRNA 및 miRNA 클러스터(cluster)의 발현량 변화에 대해 기재한 문헌(Zhang X. et al., PLoS One., 7(4):e34688, 2012) 등이 보고된 바 있다.
이러한 노화와 관련된 miRNA는 피부 노화, 심장 및 뇌 등의 다양한 기관의 노화에 따른 질환의 예방 및 치료를 위한 물질 탐색 용도로 유용하게 활용될 수 있을 것으로 기대하고 있으나, 아직까지는 근육노화 진단 마커로서 miRNA의 용도에 대해서는 밝혀진 바가 없다.
본 발명자들은 근육노화를 진단할 수 있는 방법을 개발하기 위하여 예의 연구 노력한 결과, 노화된 골격근에서 다양한 miRNA의 발현량이 변화될 수 있음을 검출함으로써, 이를 통해 근육노화를 진단할 수 있음을 확인하고 본 발명을 완성하였다.
본 발명의 하나의 목적은 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 제제를 포함하는 근육노화 진단용 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 조성물을 포함하는 근육노화 진단용 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 단계를 포함하는 근육노화 진단방법을 제공하는 것이다.
본 발명에서 제공하는 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34를 비롯한 다양한 miRNA는 노화에 따른 근위축 및 그에 수반하는 근기능의 저하 뿐만 아니라, 이에 따른 에너지 대사의 저하로 비만이나 당뇨병 등의 질환까지도 수반할 수 있는, 근육노화의 진행 또는 발병 여부, 그리고 노화 정도를 진단할 수 있는 마커로 사용될 수 있으므로, 근육노화 진단 키트 개발 및 근육노화 억제 물질을 탐색하는데 있어서, 탁월한 효과가 있는 마커로 널리 활용될 수 있다.
도 1은 어린(young) 마우스와 노화(aged) 마우스 간의 골격근(skeletal muscle)의 근량 차이를 나타낸 도이다.
도 2a 내지 2d는 차세대 염기서열(next generation sequencing; NGS) 방법으로 도출된 어린 마우스의 골격근과 노화 마우스의 골격근에 발현하는 소형 리보핵산 전사체(small RNA transcriptome)의 분석 개요를 나타낸 도이다.
도 3은 고속대량(high throughput) 소형-RNA 서열분석법(sequencing)으로 어린 마우스와 노화 마우스의 골격근으로부터 발견된 최종 miRNA의 발현량 차이를 비교한 도이다.
도 4는 실시간 정량 PCR(real-time quantitative PCR) 방법으로 어린 마우스와 노화 마우스의 골격근으로부터 발견된 최종 miRNA의 발현량 차이를 비교한 도이다.
상기 목적을 달성하기 위한 하나의 양태로서, 본 발명은 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 제제를 포함하는, 근육노화 진단용 조성물을 제공한다.
본 발명에서 사용되는 용어 "miRNA"란, 염기서열이 22개 이내의 암호화되지 않은(non-coding) RNA로서, 타겟 mRNA를 분해하거나 타겟 mRNA의 전사(translation)를 억제하여 유전자 발현을 조절한다. 본 발명의 목적상, 상기 miRNA의 발현 수준을 측정함으로써 근육이 노화되었는지 여부를 확인할 수 있고, 상기 miRNA에는 다양한 miRNA가 포함되나, 구체적으로는 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34가 포함될 수 있다.
본 발명에서 사용되는 용어 "miRNA-136"이란, 생물학적으로, 항 세포사멸 유전자인 AEG-1(astrocyte elevated gene-1)과 Bcl-2(B-cell lymphoma-2)의 발현을 저해하여 신경교종 세포(glioma cell)의 세포 사멸(apoptosis)을 촉진하는 것으로 알려져 있는 miRNA로, 마우스 염색체 12(chromosome 12) 좌에 위치해 있으며, miRNA-337, miRNA-127 및 miRNA-411 등과 동일한 좌(locus)에 존재함으로써 클러스터(cluster)를 형성하고 있는 miRNA이다. 바람직하게는 서열번호 1의 염기서열을 가지는 폴리뉴클레오타이드일 수 있다.
본 발명에서 사용되는 용어 "단편"이란, miRNA의 참조서열(reference sequence)과 비교할 때 결실되거나, 참조 서열과 상응하는 위치와 동일한 서열의 분절을 포함하는 것일 수 있으며, 본 발명의 용어 "참조서열"이란, 서열 비교의 근거로서 사용되도록 지정된 서열이다.
본 발명의 miRNA-136 단편은, 바람직하게는 서열번호 2 또는 서열번호 3의 서열을 가지는 폴리뉴클레오티드일 수 있다.
본 발명에서 사용되는 용어 "miRNA-337"이란, 생물학적으로, TGF-베타 수용체 2(TGFBR 2)의 발현을 조절하여 연골 형성(chondrogenesis)에 있어서 중요한 역할을 하며, 아그레칸(aggrecan; AGC1)과 같은 연골 특이 유전자(cartilage-specific gene) 발현에 영향을 주어 관절염(arthritis) 치료에 적용될 수 있는 것으로 알려져 있는 miRNA로, 마우스 염색체 12(chromosome 12) 좌에 위치해 있으며, miRNA-136, miRNA-127 및 miRNA-411 등과 동일한 좌(locus)에 존재함으로써 클러스터(cluster)를 형성하고 있는 miRNA이다. 바람직하게는 서열번호 4의 염기서열을 가지는 폴리뉴클레오타이드일 수 있다.
본 발명의 miRNA-337 단편은, 바람직하게는 서열번호 5 또는 서열번호 6의 서열을 가지는 폴리뉴클레오티드일 수 있다.
본 발명에서 사용되는 용어 "miRNA-127"이란, 생물학적으로, BCL 6(B-cell lymphoma 6) 유전자를 타겟으로 하여 세포 증식(proliferation)과 노화(senescence)를 조절하는 것으로 알려져 있는 miRNA로, 마우스 염색체 12(chromosome 12) 좌에 위치해 있으며, miRNA-136, miRNA-337 및 miRNA-411 등과 동일한 좌(locus)에 존재함으로써 클러스터(cluster)를 형성하고 있는 miRNA이다. 바람직하게는 서열번호 7의 염기서열을 가지는 폴리뉴클레오타이드일 수 있다.
본 발명의 miRNA-127 단편은, 바람직하게는 서열번호 8 또는 서열번호 9의 서열을 가지는 폴리뉴클레오티드일 수 있다.
본 발명에서 사용되는 용어 "miRNA-411"이란, 생물학적으로, 안면견갑상완근이영양증(Facioscapulohumeral Muscular Dystrophy; FSHD) 근원세포(myoblast)에서 상향 조절되고, 근원성 인자(myogenic factor)를 저해함으로써, 근육분화(myogenesis)를 조절하는데 있어서 중요한 역할을 하는 것으로 알려져 있는 miRNA로, 마우스 염색체 12(chromosome 12) 좌에 위치해 있으며, miRNA-136, miRNA-337 및 miRNA-127 등과 동일한 좌(locus)에 존재함으로써 클러스터(cluster)를 형성하고 있는 miRNA이다. 바람직하게는 서열번호 10의 염기서열을 가지는 폴리뉴클레오타이드일 수 있다.
본 발명의 miRNA-411 단편은, 바람직하게는 서열번호 11 또는 서열번호 12의 서열을 가지는 폴리뉴클레오티드일 수 있다.
본 발명에서 사용되는 용어 "miRNA-34"란, miRNA-34a, miRNA-34b 및 miRNA-34c 등으로 구성되며, 생물학적으로, miRNA-34 패밀리(family)는 병리학적으로 심근세포의 비후 및 파괴, 심근세포 사이를 연결하는 콜라겐의 파괴 등의 특징을 보이는 심장 리모델링(cardiac remodeling) 과정을 약화시켜, 심장 기능을 증진시키는 것으로 알려져 있는 miRNA이다.
본 발명에서 상기 miRNA-34는 miRNA-34a 또는 miRNA-34c를 포함할 수 있으며, 바람직하게는 miRNA-34a는 서열번호 13의 염기서열을, 그리고 miRNA-34c는 서열번호 16의 염기서열을 가지는 폴리뉴클레오타이드일 수 있다.
본 발명의 miRNA-34a 단편은, 바람직하게는 서열 번호 14 또는 서열번호 15, 그리고 miRNA-34c 단편은, 서열번호 17 또는 서열번호 18의 서열을 가지는 폴리뉴클레오티드일 수 있다.
표 1
microRNA | 서열 |
서열번호 1(miRNA-136) | GAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUAAGCUCCAUCAUCGUCUCAAAUGAGUCUUC |
서열번호 2(miRNA-136-3p) | AUCAUCGUCUCAAAUGAGUCUU |
서열번호 3(miRNA-136-5p) | ACUCCAUUUGUUUUGAUGAUGG |
서열번호 4(miRNA-337) | CAGUGUAGUGAGAAGUUGGGGGGUGGGAACGGCGUCAUGCAGGAGUUGAUUGCACAGCCAUUCAGCUCCUAUAUGAUGCCUUUCUUCACCCCCUUCA |
서열번호 5(miRNA-337-3p) | UUCAGCUCCUAUAUGAUGCCU |
서열번호 6(miRNA-337-5p) | GAACGGCGUCAUGCAGGAGUU |
서열번호 7(miRNA-127) | CCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGG |
서열번호 8(miRNA-127-3p) | UCGGAUCCGUCUGAGCUUGGCU |
서열번호 9(miRNA-127-5p) | CUGAAGCUCAGAGGGCUCUGAU |
서열번호 10(miRNA-411) | UGGUACUUGGAGAGAUAGUAGACCGUAUAGCGUACGCUUUAUCUGUGACGUAUGUAACACGGUCCACUAACCCUCAGUAUCA |
서열번호 11(miRNA-411-3p) | UAUGUAACACGGUCCACUAACC |
서열번호 12(miRNA-411-5p) | UAGUAGACCGUAUAGCGUACG |
서열번호 13(miRNA-34a) | CCAGCUGUGAGUAAUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGUAUUAGCUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACAUUGU |
서열번호 14(miRNA-34a-3p) | AAUCAGCAAGUAUACUGCCCU |
서열번호 15(miRNA-34a-5p) | UGGCAGUGUCUUAGCUGGUUGU |
서열번호 16(miRNA-34c) | AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACAGCCAGGUAAAAAGACU |
서열번호 17(miRNA-34c-3p) | AAUCACUAACCACACAGCCAGG |
서열번호 18(miRNA-34c-5p) | AGGCAGUGUAGUUAGCUGAUUGC |
서열번호 19(miRNA-143) | CCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGG |
서열번호 20(miRNA-143-3p) | UGAGAUGAAGCACUGUAGCUC |
서열번호 21(miRNA-143-5p) | GGUGCAGUGCUGCAUCUCUGG |
서열번호 22(miRNA-144) | GGCUGGGAUAUCAUCAUAUACUGUAAGUUUGUGAUGAGACACUACAGUAUAGAUGAUGUACUAGUC |
서열번호 23(miRNA-144-3p) | UACAGUAUAGAUGAUGUACU |
서열번호 24(miRNA-144-5p) | GGAUAUCAUCAUAUACUGUAAGU |
서열번호 25(miRNA-146a) | AGCUCUGAGAACUGAAUUCCAUGGGUUAUAUCAAUGUCAGACCUGUGAAAUUCAGUUCUUCAGCU |
서열번호 26(miRNA-146a-3p) | CCUGUGAAAUUCAGUUCUUCAG |
서열번호 27(miRNA-146a-5p) | UGAGAACUGAAUUCCAUGGGUU |
서열번호 28(miRNA-148a) | AGCCAGUUUGGUCUUUUGAGACAAAGUUCUGAGACACUCCGACUCUGAGUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCUCUAGAGGCUGUGGUC |
서열번호 29(miRNA-148a-3p) | UCAGUGCACUACAGAACUUUGU |
서열번호 30(miRNA-148a-5p) | AAAGUUCUGAGACACUCCGACU |
서열번호 31(miRNA-185) | AGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCAGGGGCUGGCUUUCCUCUGGUCCUU |
서열번호 32(miRNA-185-3p) | AGGGGCUGGCUUUCCUCUGGU |
서열번호 33(miRNA-185-5p) | UGGAGAGAAAGGCAGUUCCUGA |
서열번호 34(miRNA-190a) | CUGUGUGAUAUGUUUGAUAUAUUAGGUUGUUAUUUAAUCCAACUAUAUAUCAAGCAUAUUCCUACAG |
서열번호 35(miRNA-190a-3p) | ACUAUAUAUCAAGCAUAUUCCU |
서열번호 36(miRNA-190a-5p) | UGAUAUGUUUGAUAUAUUAGGU |
서열번호 37(miRNA-193a) | GAGAGCUGGGUCUUUGCGGGCAAGAUGAGAGUGUCAGUUCAACUGGCCUACAAAGUCCCAGUCCUC |
서열번호 38(miRNA-193a-3p) | AACUGGCCUACAAAGUCCCAGU |
서열번호 39(miRNA-193a-5p) | UGGGUCUUUGCGGGCAAGAUGA |
서열번호 40(miRNA-196b) | AACUGGUCGGUGAUUUAGGUAGUUUCCUGUUGUUGGGAUCCACCUUUCUCUCGACAGCACGACACUGCCUUCAUUACUUCAGUUG |
서열번호 41(miRNA-196b-3p) | UCGACAGCACGACACUGCCUUC |
서열번호 42(miRNA-196b-5p) | UAGGUAGUUUCCUGUUGUUGGG |
서열번호 43(miRNA-215) | AGCUCUCAGCAUCAACGGUGUACAGGAGAAUGACCUAUGAUUUGACAGACCGUGCAGCUGUGUAUGUCUGUCAUUCUGUAGGCCAAUAUUCUGUAUGUCACUGCUACUUAAA |
서열번호 44(miRNA-215-3p) | UCUGUCAUUCUGUAGGCCAAU |
서열번호 45(miRNA-215-5p) | AUGACCUAUGAUUUGACAGAC |
서열번호 46(miRNA-223) | UCUGGCCAUCUGCAGUGUCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCCUAUCAG |
서열번호 47(miRNA-223-3p) | UGUCAGUUUGUCAAAUACCCCA |
서열번호 48(miRNA-223-5p) | CGUGUAUUUGACAAGCUGAGUUG |
서열번호 49(miRNA-369) | GGUACUUGAAGGGAGAUCGACCGUGUUAUAUUCGCUUGGCUGACUUCGAAUAAUACAUGGUUGAUCUUUUCUCAGUAUC |
서열번호 50(miRNA-369-3p) | AAUAAUACAUGGUUGAUCUUU |
서열번호 51(miRNA-369-5p) | AGAUCGACCGUGUUAUAUUCGC |
서열번호 52(miRNA-483) | GAGGGGGAAGACGGGAGAAGAGAAGGGAGUGGUUUUUGGGUGCCUCACUCCUCCCCUCCCGUCUUGUUCUCUC |
서열번호 53(miRNA-483-3p) | UCACUCCUCCCCUCCCGUCUU |
서열번호 54(miRNA-483-5p) | AAGACGGGAGAAGAGAAGGGAG |
서열번호 55(miRNA-615) | UCGGGAGGGGCGGGAGGGGGGUCCCCGGUGCUCGGAUCUCGAGGGUGCUUAUUGUUCGGUCCGAGCCUGGGUCUCCCUCUUCCCCCCAUCCC |
서열번호 56(miRNA-615-3p) | UCCGAGCCUGGGUCUCCCUCUU |
서열번호 57(miRNA-615-5p) | GGGGGUCCCCGGUGCUCGGAUC |
서열번호 58(miRNA-155) | CUGUUAAUGCUAAUUGUGAUAGGGGUUUUGGCCUCUGACUGACUCCUACCUGUUAGCAUUAACAG |
서열번호 59(miRNA-155-3p) | CUCCUACCUGUUAGCAUUAAC |
서열번호 60(miRNA-155-5p) | UUAAUGCUAAUUGUGAUAGGGGU |
서열번호 61(miRNA-203) | GCCUGGUCCAGUGGUUCUUGACAGUUCAACAGUUCUGUAGCACAAUUGUGAAAUGUUUAGGACCACUAGACCCGGC |
서열번호 62(miRNA-203-3p) | GUGAAAUGUUUAGGACCACUAG |
서열번호 63(miRNA-203-5p) | AGUGGUUCUUGACAGUUCAACA |
서열번호 64(miRNA-434) | UCGACUCUGGGUUUGAACCAAAGCUCGACUCAUGGUUUGAACCAUUACUUAAUUCGUGGUUUGAACCAUCACUCGACUCCUGGUUCGAACCAUC |
서열번호 65(miRNA-434-3p) | UUUGAACCAUCACUCGACUCCU |
서열번호 66(miRNA-434-5p) | GCUCGACUCAUGGUUUGAACCA |
서열번호 67(miRNA-92b) | GGUGGGCGGGAGGGACGGGACGUGGUGCAGUGUUGUUCUUUCCCCUGCCAAUAUUGCACUCGUCCCGGCCUCCGGCCCCCUCG |
서열번호 68(miRNA-92b-3p) | UAUUGCACUCGUCCCGGCCUCC |
서열번호 69(miRNA-92b-5p) | AGGGACGGGACGUGGUGCAGUGUU |
본 발명에서 사용되는 용어 "근육노화"란, 노화에 수반하여 생기는 근육의 쇠퇴, 예를 들어 근기능(근력, 근지구력, 근순발력 등) 저하나 근위축 등을 포괄하는 의미로서, 상기 근위축이란 근세포의 감소나 축소에 의해 근량이 저하되는 것을 의미한다.
본 발명에서 사용되는 용어 "진단"이란, 병리 상태의 존재 또는 특징을 확인하는 것을 의미한다. 본 발명에 있어서, 상기 진단은 근육노화의 진행 또는 발병 여부를 확인하는 것으로 해석될 수 있다.
본 발명에서 상기 근육노화 진단용 조성물은 miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 제제를 추가로 포함할 수 있다.
본 발명에서 상기 miRNA-146은 miRNA-146a를, miRNA-148은 miRNA-148a를, miRNA-190은 miRNA-190a를, miRNA-193은 miRNA-193a, miRNA-196은 miRNA-196b를, miRNA-92는 miRNA-92b를 포함할 수 있다.
이에 제한되지는 않으나, 상기 miRNA-143, miRNA-144, miRNA-146a, miRNA-148a, miRNA-185, miRNA-190a, miRNA-193a, miRNA-196b, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92b의 서열 또는 이들의 단편의 서열은 상기 표 1에 개시한 염기서열로 이루어진 것일 수 있다.
본 발명에서 상기 miRNA들은 서열번호 1 내지 69로 기재된 염기서열일 수 있으며, 상기 서열번호 1 내지 69로 기재된 염기서열은 근육노화의 진행 또는 발병 여부를 진단할 수 있는 진단 마커로 활용될 수 있으며, 상기 서열은 근육노화의 진행 또는 발병 여부를 진단하는데 있어서 일정정도 변형이 가능하다. 본 기술 분야의 당업자라면 이러한 인위적인 변형에 의해 80% 이상, 바람직하게는 90% 이상, 보다 바람직하게는 95% 이상, 가장 바람직하게는 98%의 상동성이 유지되는 염기서열이 본 발명에서 목적하는 근육노화 진단 마커로서 정상 개체와 노화 개체 간에 발현량 차이를 유의있게 비교 가능하는 한, 본 발명의 상기 염기서열과 균등한 것임을 쉽게 이해할 것이다.
본 발명에서 사용되는 용어 "마커 또는 진단 마커(diagnosis marker)"란 근육노화 세포 또는 근육노화 질환을 가진 개체를 정상세포 또는 정상 개체와 구분하여 진단할 수 있는 물질로, 정상 세포에 비하여 근육노화가 진행 또는 발병된 세포 또는 개체에서 증가 또는 감소를 보이는 폴리펩티드, 단백질 또는 핵산(예: mRNA 등), 지질, 당지질, 당단백질 또는 당(단당류, 이당류, 올리고당류 등) 등과 같은 유기 생체 분자들을 포함한다. 본 발명의 목적상, 본 발명의 근육노화 진단 마커는 정상 세포 또는 조직의 세포에 비하여, 근육노화 세포에서 특이적으로 발현 수준의 차이를 보이는 miRNA 또는 해당 miRNA의 단편이다.
본 발명에서 사용되는 용어 "miRNA 또는 이의 단편의 수준을 측정하는 제제"란, 시료에 포함된 miRNA 또는 이의 단편의 발현 여부를 확인하는 방법에 사용되는 제제를 의미하는데, 바람직하게는 RT-PCR, 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블럿팅(Northern blotting), 유전자 칩 분석법 등의 방법에 사용되는 표적 유전자에 특이적으로 결합할 수 있는 프라이머 또는 프로브가 될 수 있으나, 특별히 이에 제한되지는 않는다.
본 발명에서 사용되는 용어 "프라이머"란, 짧은 자유 3말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성이 개시할 수 있다.
본 발명에서 사용되는 용어 "프로브"란, 유전자 또는 mRNA와 특이적 결합을 이룰 수 있는 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하는데, 올리고뉴클레오티드(oligonucleotide) 프로브, 단쇄 DNA(single stranded DNA) 프로브, 이중쇄 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있고, 보다 용이하게 검출하기 위하여 라벨링될 수 있다.
본 발명의 프라이머 또는 프로브는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체 (예: 메틸 포스포네이트, 포스소트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체 (예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.
구체적으로, 본 발명의 일 실시예에서는 근육노화를 진단할 수 있는 마커로서 활용될 수 있는 miRNA를 도출하였다. 상기 miRNA는, 솔렉사(Solexa) 또는 SOLID 시퀀서를 이용하여 DNA의 염기서열을 대량으로 동시에 분석할 수 있는 새로운 염기서열 분석 방법인, 차세대염기서열(next generation sequence; NGS) 방법을 이용하여 어린 마우스와 노화 마우스의 골격근에 발현하는 miRNA의 발현량을 추정함으로써, 노화 마우스 골격근 특이 miRNA를 도출하였다.
표 2 및 표 3에 개시한 바와 같이, 어린 마우스와 노화 마우스의 골격근에서 발현되는 miRNA의 비교 결과, 노화 마우스의 골격근에서 특이적으로, 그 발현량이 하향 조절 또는 상향 조절되는 miRNA를 도출할 수 있었다.
노화 마우스의 골격근에서 하향 조절되는 miRNA에는 miRNA-136, miRNA-337, miRNA-127 및 miRNA-411을 비롯하여 miRNA-143, miRNA-144, miRNA-148a, miRNA-190a, miRNA-193a 및 miRNA-434 등이 있음을 확인할 수 있었고, 상향 조절되는 miRNA에는 miRNA-34a 및 miRNA-34c를 비롯하여 miRNA-146a, miRNA-185, miRNA-196b, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203 및 miRNA-92b 등이 있음을 확인할 수 있었다(도 3).
또한, 상기와 같이 도출되어진, 어린 마우스와 노화 마우스의 골격근에서 발현되는 miRNA들의 발현량 차이 재검증을 위하여, 실시간 정량 PCR(real-time quantitative PCR)을 수행해 본 결과, 마찬가지로 노화 마우스의 골격근에서 miRNA-136, miRNA-337, miRNA-127 및 miRNA-411을 비롯하여 miRNA-148a 및 miRNA-434 등의 발현량이 하향 조절됨을 확인할 수 있었고, miRNA-34a를 비롯하여 miRNA-146a, miRNA-155, miRNA-203 및 miRNA-92b 등이 상향 조절됨을 확인할 수 있었다(도 4).
이러한 결과를 통하여, 상기 다양한 miRNA들은 근육노화가 진행됨에 따라 발현량이 감소 또는 증가함을 확인할 수 있었고, 본 발명의 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34를 비롯한 상기 다양한 miRNA의 발현 수준을 측정하는 제제를 이용하면 근육노화를 효과적으로 진단할 수 있음을 알 수 있었다.
상기 목적을 달성하기 위한 다른 실시양태로서, 본 발명은 상기 근육노화 진단용 조성물을 포함하는 근육노화 진단용 키트를 제공한다.
본 발명의 진단 키트는 근육노화의 발병이 의심되는 개체의 시료로부터 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34을 비롯하여 miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92 또는 상기 miRNA들에 해당하는 단편의 발현 수준을 측정함으로써 근육노화를 진단하는데 사용될 수 있는데, 특별히 이에 제한되지 않으나, 상기 다양한 miRNA 또는 이에 해당하는 단편의 발현 수준을 측정하기 위한 프라이머 또는 프로브 뿐만 아니라 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치가 포함될 수도 있다.
구체적인 일례로서, 본 발명의 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34 또는 이들의 단편, 그리고 miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92 또는 상기 miRNA들에 해당하는 단편의 발현 수준을 측정하기 위한 진단 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. RT-PCR 키트는, 상기 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한, 정량 대조구로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다.
다른 일례로서, 본 발명의 키트는 유전자 칩 분석법을 수행하기 위해 필요한 필수 요소를 포함할 수 있다. 유전자 칩 분석용 키트는, 유전자 또는 그의 단편에 해당하는 cDNA가 프로브로 부착되어 있는 기판, 및 형광표식 프로브를 제작하기 위한 시약, 제제, 효소 등을 포함할 수 있다. 또한, 기판은 정량 대조구 유전자 또는 그의 단편에 해당하는 cDNA를 포함할 수 있다.
또 다른 양태로서, 본 발명은 상기 진단용 조성물 또는 키트를 이용한 근육노화 진단방법을 제공하는데, 구체적으로, (a) 개체로부터 분리된 생물학적 시료에서 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 단계; 및 (b) 상기 측정된 miRNA 또는 이의 단편의 발현 수준과 정상 대조군 시료의 해당 miRNA 또는 이의 단편의 발현 수준을 비교하는 단계를 포함한다.
더욱 구체적으로, (c) 상기 miRNA-136, miRNA-337, miRNA-127 및 miRNA-411로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준이 정상 대조군 시료의 해당 miRNA 또는 이의 단편의 발현 수준보다 감소하는 경우, 근육노화가 진행된 것으로 판정하는 단계; 또는 (c) 상기 miRNA-34 또는 이의 단편의 발현 수준이 정상 대조군 시료의 miRNA-34 또는 이의 단편의 발현 수준보다 증가하는 경우, 근육노화가 진행된 것으로 판정하는 단계를 추가로 포함하는 방법일 수 있다. 덧붙여, 상기 miRNA-34는 miRNA-34a 또는 miRNA-34c인 것인 방법일 수 있다.
아울러, miRNA의 발현 수준을 측정하는 단계는 역전사효소 중합효소반응(RT-PCR), 경쟁적 역전사효소 중합효소반응(competitive RT-PCR), 실시간 역전사효소 중합효소반응(real time quantitative RT-PCR), RNase 보호 분석법(RNase protection method), 노던 블랏팅(Northern blotting) 또는 유전자 칩에 의하여 측정되는 것인 방법일 수 있다.
덧붙여, 상기 진단용 조성물 또는 키트를 이용한 근육노화 진단방법은 상기 (a) 단계에서 miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 단계를 추가로 포함하는 방법일 수 있다.
구체적으로, (c) miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193 및 miRNA-434로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준이 정상 대조군 시료의 해당 miRNA 또는 이의 단편의 발현 수준보다 감소하는 경우, 근육노화가 진행된 것으로 판정하는 단계; 또는 (c) miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203 및 miRNA-92로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준이 정상 대조군 시료의 해당 miRNA 또는 이의 단편의 발현 수준보다 증가하는 경우, 근육노화가 진행된 것으로 판정하는 단계를 추가로 포함하는 방법일 수 있다.
이때, 상기 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편, 그리고 miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92 또는 상기 miRNA들에 해당하는 단편의 발현 수준을 측정하는 방법은 상술한 바와 동일하다.
상기 목적을 달성하기 위한 또 다른 실시양태로서, 본 발명은 근육노화의 진행 또는 발병을 예방 또는 치료할 수 있을 것으로 예상되는 후보물질을 투여하고, miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 단계를 포함하는 근육노화의 예방 또는 치료용 제제를 스크리닝하는 방법을 제공한다.
구체적으로, 본 발명의 근육노화 예방 또는 치료용 제제를 스크리닝하는 방법은 (a) 대조군인 근육노화가 발병된 실험동물의 시료로부터 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 단계; (b) 상기 실험동물에서 근육노화를 치료할 수 있을 것으로 예상되는 후보물질을 투여하는 단계; (c) 실험군인 상기 후보물질이 투여된 실험동물의 시료로부터 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 단계; 및, (d) 대조군에서 측정된 miRNA-136, miRNA-337, miRNA-127 및 miRNA-411로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 수준을 실험군에서 측정된 것과 비교하여, 대조군에서 측정된 것보다도 실험군에서 측정된 것이 높은 수준을 나타내는 경우; 또는 대조군에서 측정된 miRNA-34 또는 이의 단편의 수준을 실험군에서 측정된 것과 비교하여, 대조군에서 측정된 것보다도 실험군에서 측정된 것이 낮은 수준을 나타내는 경우, 상기 후보물질을 근육노화의 진행 또는 발병을 방지하는 예방용 제제 또는 근육노화를 치료하는 치료용 제제로서 사용할 수 있는 것으로 판정하는 단계를 포함한다.
근육노화를 예방 또는 치료할 수 있는 후보 물질의 부재 하에 세포, 보다 바람직하게는 근육줄기세포(satellite cell)에서의 본 발명의 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하고, 또한, 상기 후보 물질의 존재 하에서 본 발명의 상기 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 수준을 측정하여 양자를 비교한 후, 상기 후보 물질이 존재할 때의 본 발명의 상기 miRNA-136, miRNA-337, miRNA-127 및 miRNA-411로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준이 상기 후보 물질의 부재 하에서의 수준보다 증가시키는 물질, 또는 상기 miRNA-34 또는 이의 단편의 발현 수준이 상기 후보 물질의 부재 하에서의 수준보다 감소시키는 물질을 근육노화의 예방용 제제로 예측할 수 있다.
또한, 노화 마우스의 골격근에서 하향 조절되는 miRNA인, miRNA-136, miRNA-337, miRNA-127 및 miRNA-411 외에, miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193 및 miRNA-434 또는 상기 miRNA들에 해당하는 단편 등의 발현 수준을 증가시키는 물질을 근육노화 예방용 또는 치료용 제제로 예측할 수 있다.
아울러, 노화 마우스의 골격근에서 상향 조절되는 miRNA인, miRNA-34 외에, miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203 및 miRNA-92 또는 상기 miRNA들에 해당하는 단편 등의 발현 수준을 감소시키는 물질을 근육노화 예방용 또는 치료용 제제로 예측할 수 있다.
상기 목적을 달성하기 위한 또 다른 실시양태로서, 본 발명은 miRNA-136, miRNA-337, miRNA-127 및 miRNA-411로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편을 표적으로 한 증진제; 또는 miRNA-34 또는 이의 단편을 표적으로 한 억제제를 유효성분으로 포함하는 근육노화 억제용 조성물을 제공한다.
상기 근육노화 억제용 조성물은 miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193 및 miRNA-434로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 miRNA들에 해당하는 단편 등을 표적으로 한 증진제; 또는 miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203 및 miRNA-92 또는 상기 miRNA들에 해당하는 단편 등을 표적으로 한 억제제를 포함할 수 있다.
구체적으로, 노화 마우스의 골격근에서 하향 조절되는 miRNA인, miRNA-136, miRNA-337, miRNA-127, miRNA-411 외에, miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193 및 miRNA-434 또는 상기 miRNA들에 해당하는 단편 등을 표적으로 한 증진제는 상기 miRNA 및 이에 해당하는 단편들의 발현 수준을 증가시킴으로써, 근육노화를 억제할 수 있다.
아울러, 노화 마우스의 골격근에서 상향 조절되는 miRNA인, miRNA-34 외에, miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203 및 miRNA-92 또는 상기 miRNA들에 해당하는 단편 등을 표적으로 한 억제제는 상기 miRNA 및 이에 해당하는 단편들의 발현 수준을 감소시킴으로써, 근육노화를 억제할 수 있다.
상기 miRNA들 또는 이의 단편을 표적으로 한 증진제에는, 이에 제한되지는 않으나 바람직하게는, 상기 miRNA들 또는 이의 단편에 특이적인 화합물 또는 그 유사체(mimic) 형태일 수 있다.
또한, 상기 miRNA들 또는 이의 단편을 표적으로 한 억제제에는, 이에 제한되지는 않으나 바람직하게는, 상기 miRNA들 또는 이의 단편에 특이적인 siRNA, 앱타머, 안티센스 올리고뉴클레오티드, 리보자임 또는 화합물 형태일 수 있다.
본 발명에서 사용되는 용어 "유사체(mimic)"란, miRNA 작용을 모방하는 폴리뉴클레오티드로서, 상기 유사체에 의해 치료적으로 표적이 될 수 있다.
본 발명에서 사용되는 용어 "siRNA"란, RNA 방해 또는 유전자 사일런싱(silencing)을 매개할 수 있는 핵산 분자로서, 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운(knockdown) 방법 또는 유전자 치료 방법으로 사용될 수 있다.
본 발명에서 사용되는 용어 "앱타머(aptamer)"란, 단일가닥 올리고 뉴클레오티드로서, 20~60 뉴클레오티드 정도의 크기이며, 소정의 표적 분자에 대한 결합 활성을 갖는 핵산 분자를 말한다. 서열에 따라 다양한 3차원 구조를 가지며, 항원-항체 반응처럼 특정 물질과 높은 친화력을 가질 수 있다. 앱타머는 소정의 표적 분자에 대하여 결합함으로써, 소정의 표적 분자의 활성을 저해할 수 있다. 본 발명의 앱타머는 RNA, DNA, 변형된(modified) 핵산 또는 이들의 혼합물일 수 있으며, 또한 직쇄상 또는 환상의 형태일 수 있다.
본 발명에서 사용되는 용어 "안티센스"란, 유전자 발현을 방해하고 특정한 원하는 표적 폴리뉴클레오티드 서열을 인지하거나 결합할 수 있도록 설계된 분자를 말한다. 안티센스 분자는 전형적으로 RNA 분자 상에 존재하는 표적 서열에 특이적으로 결합할 수 있는 올리고뉴클레오티드 또는 올리고뉴클레오티드 유사체를 포함한다.
본 발명에서 사용되는 용어 "올리고뉴클레오티드"란, DNA, RNA 또는 DNA/RNA 하이브리드로 구성된 한 분자이며, "올리고뉴클레오티드 유사체"란 용어는, 올리고뉴클레오티드-유사 구조를 포함하는 한 분자이다.
본 발명에서 사용되는 용어 "리보자임(ribozyme)"이란, 효소 활성이 있는 RNA 분자를 의미하는 것으로서, 화학적 반응을 분자 내적으로나 또는 분자 사이에서 촉매할 수 있는 핵산 분자를 의미한다. 본 발명에서 이용할 수 있는 리보자임으로는 천연 시스템에서 발견되는 리보자임을 토대로 한 뉴클레아제나 핵산 중합효소 타입 반응을 촉매하는 리보자임의 상이한 유형들 모두 가능하며, 생체 내 특이한 반응을 촉매하기 위해 공학적으로 처리되는 리보자임도 이용 가능하다. 리보자임은 RNA 또는 DNA 기질을 절단할 수 있으며, 본 발명의 목적상 RNA 기질을 절단할 수 있다. 리보자임은 전형적으로 표적 기질의 인식 및 결합과 이어지는 절단을 통하여 핵산 기질을 절단하게 되는데, 이러한 인식은 대부분 염기쌍 상호작용을 토대로 하므로, 표적 특이적 절단이 가능한 특징을 가질 수 있다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1: 근육 조직 샘플 준비 및 근육 근량 측정
골격근에서 노화(aging)에 관한 연구를 수행하기 위해, 어린(young) 마우스(6개월령)와 노화(aged) 마우스(24개월령) 간의 근육 근량(muscle mass)을 비교하였다.
구체적으로, 6마리의 어린 수컷 C57BL/6 마우스(6개월)와 6마리의 노화 수컷 C57BL/6 마우스(24개월령)는 실험동물자원센터(한국생명공학연구원)에서 구입하였다. 족저근(soleus muscle; SOL), 장지신근(extensor digitorum longus; EDL), 전경골근(tibialis anterior; TA), 및 비복근(gastrocnemius; gastroc.) 4가지 종류의 근육 해부(dessection)를 위해 희생시키기 전에, 마우스의 체중을 기록하였다. 각각의 근육량(muscle mass)을 기록하고, 비복근(gastrocnemius; gastroc.)은 다음 단계의 마이크로RNA(miRNA) 프로파일링(profiling) 실험을 위해 즉시 수집하였다.
도 1에 나타난 바와 같이, 어린 마우스(6개월령)와 노화 마우스(24개월령) 간의 근육 근량을 비교해 본 결과, 어린 마우스에 비해 노화 마우스의 전경골근(tibialis anterior; TA), 및 비복근(gastrocnemius; gastroc.) 둘 다에서 두드러진 근육량 손실이 나타났으며, 특히, 32개월령까지 나이에 따라 골격근인 비복근의 근육량이 점진적으로 감소하는 것을 확인할 수 있었다.
이러한 결과는 근육소실이 근육노화의 주요 특징 중 하나임을 의미한다.
실시예 2: 마이크로RNA(miRNA) 서열분석(sequencing) 및 데이터 분석
근육 노화의 분자적 메카니즘을 도출하기 위하여, 소형 리보핵산(small RNA) 서열분석(sequencing)으로 어린 마우스의 골격근과 노화 마우스의 골격근에 발현하는 전체 유전체 마이크로RNA(genome-wide miRNA)를 분석, 비교하였다.
구체적으로, 제조업자의 프로토콜에 따라 mirVAna miRNA isolation kit(Ambion, Austin, TX)를 사용하여, 비복근(gastrocnemius; gastroc.)(n=12)으로부터 소형 리보핵산이 풍부한(small RNA-enriched) 토털 RNA(total RNA)를 추출하였고, miRNA 라이브러리는 Illumina library preparation protocol(Illumina Inc., San Diego, CA, USA)에 따라 준비하였다. 각각의 라이브러리는 Illumina 어댑터(adaptor)(6-염기 바코드(base barcode))로 색인화 하였다. 소형 리보핵산(small RNA) 라이브러리는 6% TBE 유레아 폴리아크릴아마이드 겔(TBE urea polyacrylamide gel)에서 크기별로 나누고(size fractionation), 140 내지 160 염기 쌍(base pair) 부분(fraction)은 겔로부터 절개하여 얻고 정제하였다. 정제된 miRNA 라이브러리는 Agilent DNA 1000 chip을 이용하여 정량화하였다. 모든 색인화된 샘플은 Illumina GAⅡx(36 bp 단편(reads))의 하나의 레인(lane)에서 풀링(pooling)하고 서열분석(sequencing)하였다.
가공되지 않은 소형 리보핵산(raw small RNA) 서열분석 맵핑(mapping)전에 참조 표준 유전체(reference genome)로 해독하고, 염기 서열의 질(quality)적 해독은 FastQC(http://www.bioinformatics.babraham.ac.uk/projects/fastqc)로 평가하였으며, 3' 말단에 부착된 어댑터 시퀀스는 내부(in-house)의 펄 스크립트(PERL script)로 제거하였다. 어댑터 시퀀스 트리밍(trimming) 후, 단편 크기(read size) 분배(distribution)는 R(http://www.r-project.org.) 스크립트로 분석하였다. 어댑터 시퀀스를 트리밍한(adapter-trimmed) 소형 리보핵산 단편(read)은 디폴트 옵션(default option)을 가진 BWA(http://bio-bwa. sourceforge.net.) 소프트웨어를 따른 UCSC Genome Browser(http://genome. ucsc.edu)로부터 다운로드된 참조 표준 유전체 mm10에 맵화(mapped)하였다(Li & Durbin 2009). 맵화한 서열 단편을 RNA 계열(class)로 구분하기 위해, 마이크로RNA(microRNA; miRNA), 운반RNA(transfer RNA; tRNA), 리보솜RNA(ribosomal RNA; rRNA )및 다른 비번역 RNA(non-coading RNA)를 계열화 하기 위한 UCSC Genome Browser와 fRNAdb(http://www.ncrna.org/frnadb.)로부터의 주석 파일(annotation file)에서 소형 리보핵산과 반복서열(repeats)의 게놈 위치 정보(genomic position information)를 사용하여 수행하였다. 맵핑 위치(mapping position)와 주석 정보(annotation information)를 비교하여, 모든 맵화된 서열 단편과 부합되는 RNA 타입으로 계열화하고, 각각의 RNA 타입의 발현에 대한 상대적 빈도는 지정한 서열 단편 수에 기초하여 평가하였다. 토털 소형 RNA 서열분석 테이터에서 주요 miRNA 발현 부분을 결정하기 위해, 6마리의 어린 마우스 샘플의 풀링(pooling)된 서열 단편 셋트로부터 발현된 상위 10개의 miRNA를 선택하고, 풀링(pooling)된 어린 마우스와 노화된 마우스의 서열 단편 셋트에서 상기 가장 많은 10개의 miRNA와 적은 부분을 차지하는 서열 단편에 대한 상대적 비율(portion)을 평가하였다. 이미 알려진 miRNA(miRBase ver. 20)에 대해서는 파이썬(Python) 스크립트를 사용하여 맵화된 서열 단편으로부터 각각의 전구체(precursor)와 최종 miRNA(mature microRNA)에 대한 FPKM(fragments per kilobase of transcript per million fragments mapped)을 계산하였다. 새로운 miRNA 탐색을 위해, 디폴트 파라미터(default parameter)를 가진 mirDeep2 소프트웨어를 사용하였고, MiRBase는 알려진 miRNA를 배제하기 위해 사용하였다. 시궁쥐(Rattus norvegicus)는 근연종으로써 사용하였다.
도 2a 내지 2d에 나타난 바와 같이, 대부분의 서열(sequence)은 22nt(nucleotide)에서 피크를 가지는 20 내지 23 nt 길이인(도 2a), 최종 miRNA(mature miRNA)가 96.9% 로 나타났으며, 나머지 3.1%의 small RNA는 소형 핵RNA(small nuclear RNA; snRNA), 소세포질 RNA(small cytoplasmic RNA; scRNA), 신호-인식입자RNA(signal recognition particle RNA; srpRNA), 리보솜RNA(ribosomal RNA; rRNA), 운반RNA(transfer RNA; tRNA), 및 피위 단백질과 상호작용하는 RNA (piwi-interacting RNA; piRNA)인 것으로 나타났다(도 2b). 생식 세포(germ cell)에서 발견되는 piRNA는 노화 마우스의 골격근에서 상향조절(up-regulation) 되는 것으로 확인되었다(도 2c). 또한, 어린 마우스와 노화 마우스의 골격근에서 최종 miRNA의 존재비(abundance)를 확인하기 위해, 상위 10개의 miRNA로 구분해 본 결과, 골격근에서 가장 높게 발현하는 상위 10개의 최종 miRNA가 전체 miRNA의 75%를 차지하는 것으로 나타났다(도 2d). 상기 분석한 상위 10개의 최종 miRNA 중, 대부분을 차지하고 있는 miR-10b를 제외한, 나머지 miRNA는 이미 근육에서의 역할이 보고된 바 있는 miRNA인 것으로 확인되었다.
실시예 3: 리보핵산(RNA) 서열분석(sequencing) 및 데이터 분석
골격근의 노화와 관련된 miRNA를 탐색하기 위하여, 고속대량(high throughput) 소형-RNA 서열분석법(sequencing)으로 어린 마우스와 노화 마우스의 골격근으로부터 최소 5개의 서열 단편을 가지는, 최종 miRNA를 발견하였다. 이들 중, 노화된 근육에서 20개의 miRNA는 상향 조절(up-regulation)되었고, 19개의 miRNA는 하향 조절(down-regulation)되었다(>1.5 배 차이, t-test, p<0.05). 선택된 miRNA 중에는 이전에 근육 노화와 관련되어 보고된 바 있는 miRNA-206, miRNA-434, miRNA-34 등의 miRNA도 포함되어 있었다.
보다 구체적으로, 토털 RNA는 제조업자의 프로토콜에 따라 RNeasy Fibrous Tissue Mini Kit(Qiagen)을 사용하여 어린 쥐와 노화된 쥐의 비복근(gastrocnemius; gastroc.)(n=5)으로부터 추출하였다. RNA의 질(quality)과 안정성(integrity)은, 아가로스 겔 전기영동(agarose gel electrophoresis)을 수행하고, 브롬화 에티듐(ethidium bromide; EtBr) 염색하여 자외선 (ultraviolet light) 하에서 육안 시험(visual examination)으로 확인하였다. 시퀀싱 라이브러리는 제조업자의 프로토콜에 따라 TruSeq RNA Sample Preparation kit v2(Illumina, CA, USA)를 사용하여 준비하였다. 간단하게, 메신저 RNA(messenger RNA; mRNA)는 토털 RNA로부터 폴리-T-올리고 부착 마그네틱 비드(poly-T oligo-attached magnetic bead)를 사용하여 정제하고, 단편화(fragmentation)하여 cDNA로 전환하였다. 어댑터(adapter)를 결찰(ligation)한 다음, 단편(fragment)은 중합효소 연쇄 반응(polymerase chain reaction; PCR)로 증폭하였고, 서열분석(sequencing)은 Genome Analyzer Ⅱx(Illumina)를 사용하여 쌍으로 된 말단 서열 단편(2×76 bp)으로 수행하였다.
생쥐(Mus musculus)로부터 얻은 참조 표준 유전체(reference genome) 서열(sequence)은 캘리포니아 대학교 Santa Cruz Genome Browser Gateway (assembly ID: mm10)로부터 얻었다. 참조 표준 유전체 색인은 Bowtie2(ver. 2.0)과 SAMtools(ver. 0.1.18)의 Bowtie2-build 구성요소(component)를 사용하여 설계하였다. Tophat2(ver. 2.0.8)는 참조 표준 유전체에 대한 서열 단편을 맵화하기 위한 조직 샘플(tissue sample)에 적용하였다. 유전자 발현은 UCSC Browser gateway로부터 다운로드한 표준 시퀀스 유전자(Refseq gene, mm10) 모델(model)을 사용하여 각각의 유전자에 대한 FPKM(fragments per kilobase of transcript per million fragments mapped)을 계산하였고, 각각의 FPKM은 추가 분석을 위해 log2로 변환하여 도출하였다.
도 3에 나타난 바와 같이, 어린 마우스와 노화 마우스의 골격근으로부터 발견된 최소 5개의 서열 단편을 가지는 최종 miRNA 중, 본 발명의 miRNA-136, miRNA-337, miRNA-127 및 miRNA-411의 발현 수준은 어린 마우스의 근육에서의 발현량과 비교하여, 노화 근육에서의 발현량이 하향 조절되는 것을 확인할 수 있었다. 또한, 본 발명의 miRNA-34의 발현 수준은 어린 마우스의 근육에서의 발현량과 비교하여, 노화 근육에서의 발현량이 상향 조절되는 것을 확인할 수 있었다.
추가적으로, 하기 표 2 및 하기 표 3에 나타난 바와 같이, 본 발명의 miRNA-34를 포함하여, 노화된 근육에서 20개의 상향 조절(up-regulation)되는 miRNA와 본 발명의 miRNA-136, miRNA-337, miRNA-127 및 miRNA-411을 포함하여, 하향 조절(down-regulation)되는 19개의 miRNA를 확인할 수 있었다(>1.5 배 차이, t-test, p<0.05).
이러한 결과를 통하여 본 발명의 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34을 비롯한, 상기 miRNA들이 근육노화에 따라 상향 조절 또는 하향 조절되는 것을 검출함으로써, 근육노화를 진단할 수 있다는 것을 확인할 수 있었다.
실시예 3-1: 최종 miRNA(mature microRNA) 발현 분석 검증
고속대량(high throughput) 소형-RNA 서열분석법(sequencing)으로 어린 마우스와 노화 마우스의 골격근으로부터 탐색된 최종 miRNA의 발현량 차이 재검증을 위하여, 실시간 정량 PCR(real-time quantitative PCR)을 수행하였다.
보다 구체적으로, miRNA 발현 분석을 위한, TaqMan MicroRNA assay는 제조업자가 제시한 프로토콜에 따라 수행하였다(Applied Biosystems). 간단하게, 각각의 역전사 효소(reverse transcriptase; RT) 반응(reaction)은 50 nM stem-loop RT 프라이머, 0.25mM dNTP, 3.33 units/ul MultiScribe RT 효소, 및 0.25 units/ul RNase 저해제(inhibitor)와 1 × RT 버퍼(buffer)가 포함되어 있는 mirVana miRNA isolation kit를 사용하여 10 ng의 토털 RNA를 분리하였다(Applied Biosystems). 상기 반응은 16℃에서 30분, 42℃에서 30분, 85℃에서 5분 동안 인큐베이션하고, 4℃에서 반응을 정지시켰다. 각각의 정량 PCR(quantitative PCR; qPCR) 반응은 1.33ul의 역전사 산물, TaqMan MicroRNA assay의 20× 프라이머 1 ul, 프로브 믹스(probe mix), 및 H-Taq DNA polymerase 0.5 ul 그리고 10ul의 버퍼 혼합물(40 mM Tris-HCL(pH 8.4), 100 mM KCl, 6 mM MgCl2, 0.5 mM dNTP, 및 10% DMSO)을 포함하여 이루어졌다. 상기 반응은 Bio-Rad CFX96 System을 사용하여, 96 웰 플레이트 상에서 95℃에서 10분 동안 인큐베이션하고, 95℃에서 15초, 60℃에서 1분 동안, 각각 40 사이클(cycle)의 PCR을 수행하였다. 이때, PCR 반응 단계에서, 역방향 프라이머로는 TaqMan® Universial reverse primer를 사용하였고, 정방향 프라이머는 하기 표 4에 나타난 바와 같다. 감지 시작 주기(threshold cycle, Ct)는 형광 발광이 고정된 역치(threshold)를 띄는 부분 주기(fractional cycle) 수로 정의하였다. U6 snRNA(small nuclear RNA)는 표준화(normalization)를 위한 내생의 대조군(endogenous control)로서 제공되었다.
표 4
microRNA | 프라이머 서열 | 서열번호 |
miRNA-136-5p primer | ACUCCAUUUGUUUUGAUGAUGG | 70 |
miRNA-337-3p primer | UUCAGCUCCUAUAUGAUGCCU | 71 |
miRNA-127-3p primer | UCGGAUCCGUCUGAGCUUGGCU | 72 |
miRNA-34a-5p primer | UGGCAGUGUCUUAGCUGGUUGU | 73 |
miRNA-146a-5p primer | UGAGAACUGAAUUCCAUGGGUU | 74 |
miRNA-148a-3p primer | UCAGUGCACUACAGAACUUUGU | 75 |
miRNA-411-5p primer | UAGUAGACCGUAUAGCGUACG | 76 |
miRNA-92b-3p primer | UAUUGCACUCGUCCCGGCCUCC | 77 |
miRNA-155-5p primer | UUAAUGCUAAUUGUGAUAGGGGU | 78 |
miRNA-203-3p primer | GUGAAAUGUUUAGGACCACUAG | 79 |
miRNA-434-3p primer | UUUGAACCAUCACUCGACUCCU | 80 |
miRNA-434-5p primer | GCUCGACUCAUGGUUUGAACCA | 81 |
도 4에 나타난 바와 같이, 서열분석(sequencing)에 의하여 노화 근육에서의 발현량이 하향 조절되는 것이 확인된 본 발명의 miRNA-136, miRNA-337, miRNA-127 및 miRNA-411이, 실시간 정량 PCR을 통해서도 어린 마우스의 근육에서의 발현량과 비교하여, 노화 근육에서 발현량이 하향 조절됨이 재입증되었다.
또한, 서열분석(sequencing)에 의하여 노화 근육에서의 발현량이 상향 조절되는 것이 확인된 miRNA-34를 비롯하여, miRNA-92, miRNA-146, miRNA-155 및 miRNA-203의 경우에도, 실시간 정량 PCR을 통하여 어린 마우스의 근육에서의 발현량과 비교한 결과, 노화 근육에서 발현량이 상향 조절됨이 재입증되었다(도 4의 A).
아울러, 서열분석(sequencing)에 의하여 노화 근육에서의 발현량이 하향 조절되는 것이 확인된 miRNA-148, miRNA-434의 경우에도, 실시간 정량 PCR을 통하여 어린 마우스의 근육에서의 발현량과 비교한 결과, 노화 근육에서 발현량이 하향 조절됨이 재입증되었다(도 4의 B).
따라서, 상기 실시간 정량 PCR 결과를 통하여, 본 발명의 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34를 비롯한, 상기 miRNA들이 근육노화 마커로 사용될 수 있음을 다시 한번 명확하게 알 수 있었다.
Claims (31)
- miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 제제를 포함하는, 근육노화 진단용 조성물.
- 제1항에 있어서, 상기 miRNA-136은 서열번호 1의 염기서열로 이루어진 것인, 조성물.
- 제1항에 있어서, 상기 miRNA-136의 단편은 서열번호 2 또는 3의 염기서열로 이루어진 것인, 조성물.
- 제1항에 있어서, 상기 miRNA-337은 서열번호 4의 염기서열로 이루어진 것인, 조성물.
- 제1항에 있어서, 상기 miRNA-337의 단편은 서열번호 5 또는 6의 염기서열로 이루어진 것인, 조성물.
- 제1항에 있어서, 상기 miRNA-127은 서열번호 7의 염기서열로 이루어진 것인, 조성물.
- 제1항에 있어서, 상기 miRNA-127의 단편은 서열번호 8 또는 9의 염기서열로 이루어진 것인, 조성물.
- 제1항에 있어서, 상기 miRNA-411은 서열번호 10의 염기서열로 이루어진 것인, 조성물.
- 제1항에 있어서, 상기 miRNA-411의 단편은 서열번호 11 또는 12의 염기서열로 이루어진 것인, 조성물.
- 제1항에 있어서, 상기 miRNA-34는 miRNA-34a 또는 miRNA-34c인 것인, 조성물.
- 제10항에 있어서, 상기 miRNA-34a는 서열번호 13의 염기서열로 이루어진 것인, 조성물.
- 제10항에 있어서, 상기 miRNA-34c는 서열번호 16의 염기서열로 이루어진 것인, 조성물.
- 제10항에 있어서, 상기 miRNA-34a의 단편은 서열번호 14 또는 15의 염기서열로 이루어진 것인, 조성물.
- 제10항에 있어서, 상기 miRNA-34c의 단편은 서열번호 17 또는 18의 염기서열로 이루어진 것인, 조성물.
- 제1항에 있어서, 상기 miRNA 또는 이의 단편의 발현 수준을 측정하는 제제는 상기 miRNA 또는 이의 단편에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 것인, 조성물.
- 제15항에 있어서, 상기 miRNA-136의 단편에 특이적으로 결합하는 프라이머는 서열번호 70의 염기서열을 포함하는 것인, 조성물.
- 제15항에 있어서, 상기 miRNA-337의 단편에 특이적으로 결합하는 프라이머는 서열번호 71의 염기서열을 포함하는 것인, 조성물.
- 제15항에 있어서, 상기 miRNA-127의 단편에 특이적으로 결합하는 프라이머는 서열번호 72의 염기서열을 포함하는 것인, 조성물.
- 제15항에 있어서, 상기 miRNA-411의 단편에 특이적으로 결합하는 프라이머는 서열번호 76의 염기서열을 포함하는 것인, 조성물.
- 제15항에 있어서, 상기 miRNA-34의 단편에 특이적으로 결합하는 프라이머는 서열번호 73의 염기서열을 포함하는 것인, 조성물.
- 제1항에 있어서, miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 제제를 추가로 포함하는 것인, 조성물.
- 제1항 내지 제21항 중 어느 한 항의 조성물을 포함하는, 근육노화 진단용 키트.
- 제22항에 있어서, 상기 키트는 RT-PCR 키트 또는 유전자 칩 키트인 것인 근육노화 진단용 키트.
- (a) 개체로부터 분리된 생물학적 시료에서 miRNA-136, miRNA-337, miRNA-127, miRNA-411 및 miRNA-34로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 단계; 및(b) 상기 측정된 miRNA 또는 이의 단편의 발현 수준과 정상 대조군 시료의 해당 miRNA 또는 이의 단편의 발현 수준을 비교하는 단계를 포함하는, 근육노화 진단방법.
- 제24항에 있어서, (c) 상기 miRNA-136, miRNA-337, miRNA-127 및 miRNA-411로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준이 정상 대조군 시료의 해당 miRNA 또는 이의 단편의 발현 수준보다 감소하는 경우 근육노화가 진행된 것으로 판정하는 단계를 추가로 포함하는, 방법
- 제24항에 있어서, (c) 상기 miRNA-34 또는 이의 단편의 발현 수준이 정상 대조군 시료의 miRNA-34 또는 이의 단편의 발현 수준보다 증가하는 경우 근육노화가 진행된 것으로 판정하는 단계를 추가로 포함하는, 방법.
- 제 24항에 있어서, 상기 miRNA-34는 miRNA-34a 또는 miRNA-34c인 것인, 방법.
- 제24항에 있어서, 상기 miRNA의 발현 수준을 측정하는 단계는 역전사효소 중합효소반응(RT-PCR), 경쟁적 역전사효소 중합효소반응(competitive RT-PCR), 실시간 역전사효소 중합효소반응(real time quantitative RT-PCR), RNase 보호 분석법(RNase protection method), 노던 블랏팅(Northern blotting) 또는 유전자 칩에 의하여 측정되는 것인, 방법.
- 제24항에 있어서, 상기 (a) 단계에서 miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 단계를 추가로 포함하는, 방법.
- 제29항에 있어서, (c) miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193 및 miRNA-434로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준이 정상 대조군 시료의 해당 miRNA 또는 이의 단편의 발현 수준보다 감소하는 경우 근육노화가 진행된 것으로 판정하는 단계를 추가로 포함하는, 방법.
- 제29항에 있어서, (c) miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203 및 miRNA-92로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준이 정상 대조군 시료의 해당 miRNA 또는 이의 단편의 발현 수준보다 증가하는 경우 근육노화가 진행된 것으로 판정하는 단계를 추가로 포함하는, 방법.
Applications Claiming Priority (10)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2014-0058383 | 2014-05-15 | ||
KR1020140058382A KR20150131556A (ko) | 2014-05-15 | 2014-05-15 | 근육노화 진단 및 치료를 위한 마이크로rna-337 |
KR10-2014-0058382 | 2014-05-15 | ||
KR1020140058383A KR20150131557A (ko) | 2014-05-15 | 2014-05-15 | 근육노화 진단 및 치료를 위한 마이크로rna-127 |
KR10-2014-0058381 | 2014-05-15 | ||
KR10-2014-0058385 | 2014-05-15 | ||
KR1020140058385A KR20150131559A (ko) | 2014-05-15 | 2014-05-15 | 근육노화 진단 및 치료를 위한 마이크로rna-34 |
KR1020140058381A KR20150131555A (ko) | 2014-05-15 | 2014-05-15 | 근육노화 진단 및 치료를 위한 마이크로rna-136 |
KR10-2014-0058384 | 2014-05-15 | ||
KR1020140058384A KR20150131558A (ko) | 2014-05-15 | 2014-05-15 | 근육노화 진단 및 치료를 위한 마이크로rna-411 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2015174798A1 true WO2015174798A1 (ko) | 2015-11-19 |
Family
ID=54480266
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2015/004929 WO2015174798A1 (ko) | 2014-05-15 | 2015-05-15 | 근육노화 진단 및 치료를 위한 마이크로rna |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2015174798A1 (ko) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110387411A (zh) * | 2018-04-23 | 2019-10-29 | 长庚医疗财团法人高雄长庚纪念医院 | 用于检测狼疮性肾炎或评估狼疮性肾炎风险的方法及其应用 |
KR102293039B1 (ko) * | 2020-02-27 | 2021-08-26 | 서울대학교산학협력단 | 근육 노화 진단용 miRNA 마커 및 이를 이용한 진단방법 |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20070287678A1 (en) * | 2005-06-23 | 2007-12-13 | Yale University | Anti-aging micrornas |
WO2012105826A1 (en) * | 2011-02-01 | 2012-08-09 | Erasmus University Medical Center Rotterdam | Use of micrornas in diagnosis and therapy of aging |
-
2015
- 2015-05-15 WO PCT/KR2015/004929 patent/WO2015174798A1/ko active Application Filing
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20070287678A1 (en) * | 2005-06-23 | 2007-12-13 | Yale University | Anti-aging micrornas |
WO2012105826A1 (en) * | 2011-02-01 | 2012-08-09 | Erasmus University Medical Center Rotterdam | Use of micrornas in diagnosis and therapy of aging |
Non-Patent Citations (4)
Title |
---|
DRUMMOND ET AL.: "Aging differentially affects human skeletal muscle microRNA expression at rest and after an anabolic stimulus of resistance exercise and essential amino acids", AMERICAN JOURNAL OF PHYSIOLOGY-ENDOCRINOLOGY AND METABOLISM, vol. 295, no. 6, 2008, pages E1333 - E1340, XP055236898 * |
KIM ET AL.: "Genome-wide profiling of the microRNA-mRNA regulatory network in skeletal muscle with aging", AGING, vol. 6, no. 7, July 2014 (2014-07-01), pages 524 - 544, XP055236901 * |
MERCKEN ET AL.: "Age-associated miRNA alterations in skeletal muscle from rhesus monkeys reversed by caloric restriction", AGING, vol. 5, no. 9, 2013, pages 692 - 703, XP055236890 * |
VIGNIER ET AL.: "Distinctive serum miRNA profile in mouse models of striated muscular pathologies", PLOS ONE, vol. 8, no. Issue No. 2, 2013, pages 1 - 14, XP003030093 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110387411A (zh) * | 2018-04-23 | 2019-10-29 | 长庚医疗财团法人高雄长庚纪念医院 | 用于检测狼疮性肾炎或评估狼疮性肾炎风险的方法及其应用 |
KR102293039B1 (ko) * | 2020-02-27 | 2021-08-26 | 서울대학교산학협력단 | 근육 노화 진단용 miRNA 마커 및 이를 이용한 진단방법 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Arthur-Farraj et al. | Changes in the coding and non-coding transcriptome and DNA methylome that define the Schwann cell repair phenotype after nerve injury | |
Cardelli | The epigenetic alterations of endogenous retroelements in aging | |
Kim et al. | Genome-wide profiling of the microRNA-mRNA regulatory network in skeletal muscle with aging | |
Ratneswaran et al. | Osteoarthritis year in review: genetics, genomics, epigenetics | |
Huang et al. | Genome-wide DNA methylation profiles and their relationships with mRNA and the microRNA transcriptome in bovine muscle tissue (Bos taurine) | |
Krawetz et al. | A survey of small RNAs in human sperm | |
US20180340228A1 (en) | Diagnostic mirna markers for parkinson's disease | |
US10138520B2 (en) | Diagnostic miRNA markers for Alzheimer | |
Begue et al. | DNA methylation assessment from human slow-and fast-twitch skeletal muscle fibers | |
EP3354749A1 (en) | Method and kit for dna typing of hla gene | |
KR102029775B1 (ko) | 비근침윤성 방광암 진단용 바이오마커 및 이의 용도 | |
Tang et al. | Analysis of alternative splicing events by RNA sequencing in the ovaries of Xiang pig at estrous and diestrous | |
Lv et al. | Effects of MiR-146a on repair and inflammation in rats with spinal cord injury through the TLR/NF-kappaB signaling pathway | |
Villalobos-Comparán et al. | A pilot genome-wide association study in postmenopausal Mexican-Mestizo women implicates the RMND1/CCDC170 locus is associated with bone mineral density | |
CN109913458B (zh) | circRNA及其在检测缺氧缺血性脑损伤中的应用 | |
WO2015174798A1 (ko) | 근육노화 진단 및 치료를 위한 마이크로rna | |
KR20170051747A (ko) | 피부 주름 발생 민감도 진단용 단일염기다형성 마커 및 이의 용도 | |
Grzemski et al. | and Genes are Not Promising Markers for Obesity in Labrador Retriever Dogs | |
KR20150131555A (ko) | 근육노화 진단 및 치료를 위한 마이크로rna-136 | |
Zhu et al. | Comparative profiling of the resistance of different genotypes of mannose-binding lectin to Mycoplasma pneumoniae infection in Chinese Merino sheep based on high-throughput sequencing technology | |
KR20150131556A (ko) | 근육노화 진단 및 치료를 위한 마이크로rna-337 | |
WO2022021500A1 (zh) | 预测猪日龄的生物标志物及预测方法 | |
US20190277856A1 (en) | Methods for assessing risk of increased time-to-first-conception | |
KR20150131557A (ko) | 근육노화 진단 및 치료를 위한 마이크로rna-127 | |
CN113444808B (zh) | Loc114108859及其新用途 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15792278 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 15792278 Country of ref document: EP Kind code of ref document: A1 |