WO2015159068A1 - Therapeutic - Google Patents

Therapeutic Download PDF

Info

Publication number
WO2015159068A1
WO2015159068A1 PCT/GB2015/051132 GB2015051132W WO2015159068A1 WO 2015159068 A1 WO2015159068 A1 WO 2015159068A1 GB 2015051132 W GB2015051132 W GB 2015051132W WO 2015159068 A1 WO2015159068 A1 WO 2015159068A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
dna
spacer
antibiotic
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2015/051132
Other languages
English (en)
French (fr)
Inventor
Yoshikazu Mikawa
Conrad Lichtenstein
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nemesis Bioscience Ltd
Original Assignee
Nemesis Bioscience Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=53008804&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2015159068(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from GBGB1406674.0A external-priority patent/GB201406674D0/en
Priority claimed from GB201413719A external-priority patent/GB201413719D0/en
Priority claimed from GB201418508A external-priority patent/GB201418508D0/en
Priority to JP2016563122A priority Critical patent/JP6849435B2/ja
Priority to AU2015248621A priority patent/AU2015248621B2/en
Priority to CA2945573A priority patent/CA2945573A1/en
Priority to ES15718982T priority patent/ES2827279T3/es
Priority to DK15718982.0T priority patent/DK3132034T3/da
Priority to US15/303,925 priority patent/US20170037414A1/en
Priority to EP20190714.4A priority patent/EP3766971A1/en
Priority to SI201531414T priority patent/SI3132034T1/sl
Priority to CN201580030368.5A priority patent/CN106536739B/zh
Application filed by Nemesis Bioscience Ltd filed Critical Nemesis Bioscience Ltd
Priority to EP15718982.0A priority patent/EP3132034B1/en
Priority to PL15718982T priority patent/PL3132034T3/pl
Publication of WO2015159068A1 publication Critical patent/WO2015159068A1/en
Anticipated expiration legal-status Critical
Priority to US16/057,897 priority patent/US20180362990A1/en
Priority to AU2020277257A priority patent/AU2020277257A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli

Definitions

  • the invention relates to recombinant polynucleotides, compositions and methods for interfering with antibiotic resistance genes, and/or replicons carrying such genes, in microorganisms in order to disable antibiotic resistance in the microorganisms.
  • Antibiotics originally isolated from microorganisms such as Streptomyces, are a powerful way to treat infectious disease.
  • AMR anti-microbial resistance
  • One common route to AMR has been the acquisition of resistance genes evolved in the original antibiotic-producing microorganisms, via horizontal transmission on plasmid vectors.
  • Such plasmids have in some instances acquired multiple antibiotic resistance genes carried by transposable elements and integrons.
  • Host-encoded mutations that modify the bacterial protein target or prevent entry of the antibiotic have also occurred.
  • Resistance mechanisms fall into four classes: (1 ) enzymes that degrade antibiotics, including beta-lactamases that break the beta-lactam ring of the penicillin family of antibiotics;
  • enzymes that modify antibiotics include aminoglycoside phosphotransferases that phosphorylate aminoglycoside antibiotics such as kanamycin; chloramphenicol acetyl- transferase (CAT) that acetylate chloramphenicol;
  • aminoglycoside phosphotransferases that phosphorylate aminoglycoside antibiotics such as kanamycin
  • chloramphenicol acetyl- transferase (CAT) that acetylate chloramphenicol
  • efflux pumps that actively export antibiotics from cytoplasm out of the cell, such as the tetracycline efflux pump that is expressed in the presence of tetracycline, plus other pumps, conferring multidrug resistance, that are capable of exporting a range of antibiotics; and
  • beta-lactams are bactericidal because they inhibit penicillin- binding proteins (PBPs) that are required for peptidoglycan biosynthesis and bacterial cell wall integrity and PBP mutants with reduced binding to beta-lactams will not be inhibited.
  • PBPs penicillin- binding proteins
  • non-antibiotic bactericides have been used.
  • infection by bacteriophage was developed in the 1920's and although largely discontinued with the discovery of antibiotics, has been retained in certain countries.
  • Current approaches use virulent, lytic bacteriophage that kill bacteria, including antibiotic resistant bacteria, but this opens the way for selection of bacterial variants that are resistant to bacteriophage infection.
  • preparations containing a mixture of different strains of bacteriophage are being used.
  • Another disadvantage of the use of such lytic bacteriophage in patients suffering from sepsis is that cell lysis and death by lytic bacteriophage can release endotoxins from the cell into the blood and can cause endotoxin shock.
  • compositions and methods for combating antibiotic resistant microorganisms are required.
  • a recombinant polynucleotide comprising a clustered regularly interspaced short palindromic repeat (CRISPR) array nucleic acid sequence having or transcribing an RNA guide molecule with a spacer sequence sufficiently complementary to a target sequence of an antibiotic resistance gene in a microorganism for the antibiotic resistance gene to be inactivated in the presence of a CRISPR associated (Cas) DNA-binding polypeptide or a functional equivalent or a modified version thereof, thereby sensitising the microorganism to the antibiotic.
  • CRISPR clustered regularly interspaced short palindromic repeat
  • a delivery vehicle for introducing a polynucleotide into a microorganism, such as an antibiotic-resistant microorganism
  • the delivery vehicle comprises a recombinant polynucleotide for inactivation of DNA carrying a gene encoding an antibiotic resistance enzyme which confers antibiotic resistance to the microrganism
  • the recombinant polynucleotide comprises a clustered regularly interspaced short palindromic repeat (CRISPR) array nucleic acid sequence having or transcribing an RNA guide molecule with a spacer sequence sufficiently complementary to a target DNA sequence of the antibiotic resistance gene for the antibiotic resistance gene to be targeted and inactivated in the presence of a CRISPR associated (Cas) DNA-binding polypeptide or a functional equivalent or a modified version thereof, thereby sensitising the microorganism to the antibiotic, wherein the delivery vehicle is a non-virulent or a lysogenic bacteriophage.
  • CRISPR CRISPR associated
  • One general aim of the present invention is inactivation of DNA carrying a gene encoding an antibiotic resistance enzyme using a CRISPR/Cas system.
  • An advantage of the invention is that one or more existing antibiotics can be used to treat infectious disease, as
  • microorganisms become re-sensitised to the antibiotics or are prevented from acquiring antibiotic resistance.
  • the target sequence of an antibiotic resistance gene may be a sequence flanking the gene itself which, if disrupted, inactivates the antibiotic resistance gene.
  • the invention may encompass a target sequence in the plasmid.
  • the present invention will not require new drug development and the concomitant regulatory approval required for each new drug. Rather, the invention provides a tool which can be applied to target and inactivate relevant antibiotic resistance genes directly rather than the gene products. For example, a gene encoding an antibiotic resistance enzyme, or a gene encoding a protein regulating the uptake and export of an antibiotic by altering the membrane permeability and efflux pump expression, respectively, can be targeted.
  • the CRISPR/Cas system is an RNA-mediated genome defense pathway that is part of a natural bacterial and archaeal immune system against nucleic acid invaders, analogous to the eukaryotic RNAi pathway (see for example Grissa et al., 2007, BMC Informatics 8: 172; Horvath & Barrangou, 2010, Science, 327: 167-170; Gasiunas et al., 2012, Proc. Natl Acad. Sci. USA 109: E2579; Marraffini & Sontheimer, 2008, Science, 322: 1843-1845; Garneau et.al.,2010, Nature 468: 67).
  • Natural CRISPR systems contain a combination of Cas genes as well as non-coding RNA elements capable of programming the specificity of the CRISPR- mediated nucleic acid cleavage.
  • Three types (l-lll) of CRISPR systems have been identified thus far in a wide range of bacterial and archaeal hosts.
  • Each CRISPR locus is composed of a series of short DNA direct repeats separated by non-repetitive spacer sequences.
  • the spacer sequences in nature, typically originate from foreign genetic elements such as bacteriophage and plasmids.
  • the series of repeats plus non-repetitive spacer sequences is known as a CRISPR array.
  • the CRISPR array is transcribed and hybridised with repeat complementary tracrRNA followed by cleavage within the direct repeats and processed into short mature dual tracrRNA:crRNAs containing individual spacer sequences, which direct Cas nucleases to a target site (also known as a "protospacer").
  • a target site also known as a "protospacer”
  • the Type II CRISPR/Cas9 system carries out a targeted DNA double- strand break ("DSB") in four steps. Firstly, two RNAs, the pre-crRNA array and tracrRNA, are transcribed from the CRISPR locus.
  • tracrRNA hybridises to the repeat regions of the pre-crRNA and mediates the processing of pre-crRNA into mature crRNAs (also referred to herein as "RNA guide molecules gRNA" containing individual or monomer spacer sequences.
  • mature crRNAs also referred to herein as "RNA guide molecules gRNA” containing individual or monomer spacer sequences.
  • the mature crRNA:tracrRNA complex directs Cas9 protein in the form of a ribonucleoprotein to the target DNA via base-pairing between the spacer on the crRNA and the target site on the target DNA.
  • Cas9 mediates cleavage of target DNA and creates a DSB.
  • modified CRISPR constructs are used to target antibiotic resistance genes.
  • the recombinant polynucleotide of the invention using such a construct is also referred to herein as an "assassin construct" which is used to effect inactivation of such genes.
  • CRISPR technology The main focus of using CRISPR technology to date has been for use as a DNA editing tool for reverse genetics, primarily in eukaryotes.
  • WO2007/025097 describes the use of CRISPR technology for modulating resistance in a cell against an invading target nucleic acid or a transcription product thereof, especially against invading bacteriophages.
  • Methods for downregulating prokaryotic gene expression using CRISPR technology to target mRNA transcribed by the genes have been suggested for example in WO2010/075424.
  • WO2012/164565 describes a CRISPR system from Lactoccocus and use of the system for modulating resistance of a cell against an invading target nucleic acid or a transcription product thereof.
  • the present invention concerns inter alia inactivation in an antibiotic-resistant microorganism of genes involved in conferring the antibiotic resistance.
  • the RNA guide molecule may mediate binding of the Cas DNA- binding polypeptide or its functional equivalent or its modified version to the antibiotic resistance gene. This mirrors the natural system described above.
  • the Cas DNA-binding polypeptide or its functional equivalent or its modified version of the invention may also be capable of binding to RNA or other nucleic acid molecules.
  • the requirement for the Cas DNA-binding polypeptide or its functional equivalent or its modified version to be capable of binding DNA does in some aspects of the invention does not exclude the polypepeptide or its functional equivalent or its modified version being capable of binding RNA or other nucleic acid molecules.
  • the Cas DNA- binding polypeptide or its functional equivalent or its modified version may be referred to as a Cas nucleic acid-binding polypeptide or its functional equivalent or its modified version.
  • the microorganism may have a natural endogenous, or introduced engineered, Cas DNA-binding polypeptide or functional equivalent or modified version.
  • the recombinant polynucleotide of the invention is not required to encode the Cas DNA-binding polypeptide or functional equivalent or modified version.
  • the recombinant polynucleotide of the invention may further comprise a nucleic acid sequence which encodes the Cas DNA-binding polypeptide or its functional equivalent or modified version.
  • the recombinant polynucleotide of the invention does not encode the Cas DNA-binding polypeptide or its functional equivalent or modified version but may be used in conjunction with a separate polynucleotide which does.
  • Other means for introducing the Cas DNA-binding polypeptide or its functional equivalent or its modified version into the microorganism may be used.
  • An exemplar Cas DNA-binding polypeptide according to the invention is Cas9 or a functional equivalent thereof or a modified version thereof.
  • the CRISPR array nucleic acid sequence may have or transcribe additional RNA guide molecules each comprising a spacer sequence sufficiently complementary to a target sequence of the antibiotic resistance gene or one or more additional antibiotic resistance genes.
  • the or each RNA guide molecule may be transcribed from its own promoter sequence.
  • a set of a number of RNA guide molecules may be transcribed from one promoter sequence and optionally in combination with one or more other such sets.
  • a set of four RNA guide molecules may be transcribed from one promoter sequence, for example in combination with one or more other such sets of guide molecules.
  • RNA guide molecules allows different antibiotic resistance (or other types of) genes in a microorganism to be targeted and inactivated simultaneously.
  • the recombinant polynucleotide according to various aspects of the invention may additionally or alternatively be designed to include an RNA guide molecule (such as a further RNA guide molecule) targeting a gene involved in pathogenicity or other aspects of microbial metabolism.
  • an RNA guide molecule such as a further RNA guide molecule
  • certain pathogens form biofilms that make it difficult for antibiotics to gain access to them.
  • One or more genes involved in bacterial metabolism for biofilm production may be targeted.
  • RNA guide molecules to different targets should be more or less equally
  • each RNA guide molecule may be used (instead of relying on a long polycistronic RNA guide molecule [or precursor crRNA] transcription).
  • the CRISPR array nucleic acid sequence may have or transcribe one or more RNA guide molecules each comprising a spacer sequence sufficiently complementary to a target sequence of one or more beta-lactamase genes.
  • the one or more RNA guide molecules may target one or more or all of the genes selected from the group consisting of : NDM, VIM, IMP, KPC, OXA, TEM, SHV, CTX, OKP, LEN, GES, MIR, ACT, ACC, CMY, LAT, and FOX.
  • the one or more RNA guide molecules may comprise a spacer sequence sufficiently complementary to target sequences of the beta lactam family of antibiotic resistance genes, including one or more or all of the following: a first spacer sequence sufficiently complementary to target sequences for NDM-1 , -2, -10; a second spacer sufficiently complementary to target sequences for VIM-1 , -2, -4, -12, -19, -26, -27- 33, 34; a third spacer sufficiently complementary to target sequences for IMP-32, -38, -48; a fourth spacer sufficiently complementary to target sequences for KPC- 1 , -2 , -3 , -4 , -6 , -7 , -8 , - 1 1 , -12 , -14 , -15 , -16, -17; a fifth spacer sufficiently complementary to target sequences for OXA-48; a sixth spacer sufficiently complementary to target sequences for TEM-1 ,-1 B, -3, - 139, -162, -183,
  • the antibiotic resistance gene to be inactivated may be located on a chromosome, or on an extrachromosomal replicating DNA molecule known as a replicon and including plasmids and bacteriophage.
  • the CRISPR/Cas system used according to an aspect of the invention generates a DSB in the target sequence.
  • a DSB can lead to degradation and hence loss of the chromosome or replicon suffering such a DSB.
  • the target sequence is located on a bacterial chromosome then the cell may die directly as a consequence of the DSB.
  • some plasmids (including natural plasmids) carry killing functions that only become toxic if the cell loses the plasmid, which is a natural mechanism to ensure faithful inheritance of plasmids in dividing cells.
  • a plasmid carrying the target sequence of the antibiotic resistance gene also carries such a killing function, and the plasmid is lost as a result of the DSB generated, the cell may die (see Sengupta & Austin, 201 1 , Infect. Immun. 79: 2502-2509).
  • the Cas DNA-binding polypeptide may in certain aspects be substituted by a modified Cas DNA-binding polypeptide comprising a recombinase catalytic domain, wherein the modified Cas DNA-binding polypeptide does not generate DSBs but creates a deletion and reseals a site in the target sequence.
  • the modified Cas DNA-binding polypeptide may for example be a modified Cas9 protein comprising a recombinase catalytic domain.
  • the recombinant polynucleotide according to various aspects of the invention may further comprise a nucleotide sequence which encodes a gene conferring a selective advantage to the microorganism, for example thereby increasing the efficiency of delivery of the
  • the gene may confer a growth advantage over non-infected siblings, or genes encoding a bacteriocin - these are protein toxins produced by bacteria to kill or inhibit growth of other bacteria - and corresponding immunity polypeptide may be used.
  • the selective advantage to the microorganism may include or be one which prevents or diminishes the effect of loss of a replicon due to a DSB caused by Cas DNA-binding polypeptide.
  • the nucleotide sequence which encodes a gene conferring a selective advantage to the microorganism may encode an antitoxin that neutralises the effect of a toxin or killer function carried by a replicon on which the target sequence is located.
  • the nucleotide sequence which encodes a gene conferring a selective advantage to the microorganism may encode one or more proteins that are encoded by a replicon subject to degradation due to a DSB caused by Cas DNA-binding polypeptide.
  • a delivery vehicle for introducing a polynucleotide into a microorganism, in which the delivery vehicle comprises the recombinant polynucleotide as defined herein.
  • the delivery vehicle may be a bacteriophage.
  • the delivery vehicle may be a plasmid such as a conjugative plasmid or other plasmid replicon, a nucleotide vector, linear double-stranded DNA (dsDNA), an RNA phage or an RNA molecule.
  • the delivery vehicle may be a non-virulent bacteriophage, such as bacteriophage M13, a filamentous phage that infects Escherichia coli cells, replicates and is secreted from the bacterial host cell without killing the bacterial host, which continues to grow and divide more slowly.
  • bacteriophage M13 a non-virulent bacteriophage
  • filamentous phage that infects Escherichia coli cells, replicates and is secreted from the bacterial host cell without killing the bacterial host, which continues to grow and divide more slowly.
  • Another suitable filamentous phage is NgoPhi6 isolated from Neisseria gonorrhoeae that is capable of infecting a variety of Gram negative bacteria without killing the host.
  • lysogenic phage may be used that do not always kills host cells following infection, but instead infect and become dormant prophage.
  • This invention may thus use a novel system to inactivate antibiotic resistance genes in bacteria primarily using bacteriophage that do not kill bacteria, and/or conjugative plasmids and/or direct DNA transformation, as the delivery mechanisms for the recombinant polynucleotide of the invention.
  • a composition comprising the recombinant polynucleotide as defined herein, or the delivery vehicle as defined herein.
  • the composition may be a pharmaceutical composition, a non-pathogenic microorganism such as a commensal bacterium for example in a probiotic formulation, or a dietary supplement.
  • a "pharmaceutical composition” refers to a preparation of one or more of the active agents (such the recombinant polynucleotide or the delivery vehicle as described herein) with other chemical components such as physiologically suitable carriers and excipients.
  • the purpose of a pharmaceutical composition is to facilitate administration of the active agent to an organism.
  • compositions of the present invention may, if desired, be presented in a pack, dispenser device or kit, each of which may contain one or more unit dosage forms containing the active agent(s).
  • the pack, dispenser device or kit may be accompanied by instructions for administration.
  • composition as defined herein for use as a medicament.
  • composition as defined herein for use in the treatment or prevention of an infection caused by an antibiotic-resistant microorganism comprising an antibiotic resistance gene targeted by the RNA guide molecule of the recombinant polynucleotide.
  • the invention further provides a method of treating or preventing an infection in a subject caused by an antibiotic-resistant microorganism comprising an antibiotic resistance gene, in which the method comprises the step of introducing into the microorganism a therapeutically effective amount of the composition as defined herein where the RNA guide molecule targets the antibiotic resistance gene, thereby inactivating the antibiotic resistance gene and sensitising the microorganism to the antibiotic.
  • composition may be administered topically or orally.
  • composition may be administered by intravenous, parenteral, ophthalmic or pulmonary administration.
  • compositions of the present invention for administration topically can be in a form suitable for topical use such as, for example, an aerosol, cream, ointment, lotion or dusting powder.
  • Compositions provided herein may be formulated for administration by inhalation.
  • the compositions may be in a form as an aerosol, a mist or a powder.
  • compositions described herein may be delivered in the form of an aerosol spray presentation from pressurised packs or a nebuliser, with the use of a suitable propellant such as for example dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a dosage unit may be determined by providing a valve to deliver a metered amount.
  • the subject may be a plant, a fish, a bird, a reptile or a mammal (such as a human).
  • the delivery vehicle may be transferred from the microorganism directly into another microorganism (such as antibiotic-resistant microorganism) by plasmid conjugation or bacteiophage infection.
  • the method may further comprise a step of simultaneously or subsequently administering to the subject an antibiotic to which a microorganism has become sensitised.
  • a further aspect of the invention provides a method of inactivating antibiotic resistance in a microorganism, the method comprising introducing into the microorganism of the recombinant polynucleotide as defined herein, or the delivery vehicle as defined herein.
  • the method may be an in vivo method applied to a subject, or an in vitro method.
  • a host cell comprising the recombinant polynucleotide defined here.
  • the host cell may, for example, be a commensal bacterium.
  • Microorganisms targeted by various aspects of the invention may be on a body surface, localised (for example, contained within an organ, at a site of a surgical wound or other wound, within an abscess), or may be systemic. Included is the treatment of bacterial infections that are amenable to therapy by topical application for example using
  • the present invention also encompasses coating of surfaces other than body surfaces with the recombinant polynucleotide, delivery vehicle or composition of the present invention, for example wound dressings or medical device surfaces.
  • FIG. 1 CRISPR/Cas9-mediated bacterial immunisation against antibiotic resistant genes on a plasmid: I, CRISPR/Cas locus, where boxes denote different spacer sequences targeting different antibiotic resistance genes; II, gRNA-Cas9 where boxes denote different gRNAs targeting each antibiotic resistance gene; III, plasmid harbouring antibiotic resistance gene; IV, target recognition and positioning of Cas9; V, cleaved plasmid, VI: bacteriophage.
  • Injection - CRISPR/Cas9 is injected into the bacterial cell along with phage DNA by bacteria-specific phage infection.
  • Lysogenisation - Phage DNA is lysogenised and integrates into the bacterial host chromosome (B. chr.).
  • crRNA biogenesis and assembly of Cas9 - Pre-crRNA is transcribed and hybridised with tracrRNA and processed to make mature crRNA:tracrRNA (an RNA guide molecule, or "gRNA”), which is assembled with Cas9. 4.
  • gRNA-Cas9 complexes recognise target DNA on the plasmid. 5. Cleavage - The gRNA-Cas9 complexes cleave DNA at the sites recognised by crRNAs. 6. Inactivation - This leads to inactivation of the production of antibiotic resistant enzymes; 7. Sensitive - Thus, the bacterial cell becomes sensitive to various antibiotics.
  • Figure 2 Preventing non-pathogenic bacteria and asymptomatic pathogens from a future encounter with antibiotic resistance genes: I, CRISPR/Cas locus, exemplified here as present in the bacterial chromosome (B. Chr.) and where boxes denote different spacer sequences targeting different antibiotic resistance genes; II, gRNA-Cas9, where boxes denote different gRNAs targeting each antibiotic resistance gene; III, relaxase -an enzyme that makes a strand-specific, sequence-specific nick in double-stranded DNA to initiate conjugal transfer of plasmid DNA; IV, bacteriophage, V, plasmid; VI, double-stranded DNA; VII, single-stranded DNA. Three entry pathways to encounter future antibiotic resistance genes are shown.
  • Transformation- Entry of naked DNA carrying antibiotic resistance gene into the bacterial cell 2. Bacteriophage-mediated transduction- Phage carrying antibiotic resistance gene infects a bacterial cell. 3 Conjugation- Plasmid carrying antibiotic resistance gene is conjugally transferred from a donor bacterial cell to a recipient bacterial cell. When these antibiotic resistance genes are introduced into the "immunised" cell; it is pre-armed with a CRISPR/Cas locus encoding a gRNA-Cas9 that finds the specific target sequence on the antibiotic resistance gene and cleaves it to disrupt the gene.
  • FIG. 3 Re-sensitising symptomatic pathogens to antibiotics: I, CRISPR/Cas locus in the bacterial chromosome (B. Chr.), where boxes denote different spacer sequences targeting each antibiotic resistance gene; II, gRNA-Cas9, where boxes denote different gRNAs targeting each antibiotic resistance gene; III, antibiotics; IV, protein synthesis is disrupted by cleaving corresponding gene; V, plasmid.
  • the pathogen contains plasmid DNA that provides various antibiotic resistance agents such as 1. Efflux pumps- capable of pumping antibiotics out of the bacterial cell, 2 Antibiotic degradation enzymes-and 3. Antibiotic modification enzymes. Each antibiotic resistant agent is disrupted (X) by gRNA-Cas9-mediated site-specific cleavage of corresponding genes.
  • FIG. 4 Three possible CRISPR/Cas delivery routes: I, CRISPR/Cas locus where boxes denote different spacer sequences targeting each antibiotic resistance gene; II, relaxase -an enzyme that makes a strand-specific, sequence-specific nick in double-stranded DNA to initiate conjugal transfer of plasmid DNA; III, bacteriophage; IV, plasmid; V, double-stranded DNA; VI, single-stranded DNA. This figure shows three possible delivery routes of
  • CRISPR/Cas9 expression construct 1. Transformation- Entry of naked DNA carrying CRISPR/Cas9 into the bacterial cell via a DNA receptor on the cell surface, followed by integration (4) into the bacterial chromosome (B. Chr.) , 2. Bacteriophage-mediated transduction- Phage carrying CRISPR/Cas9 infects a bacterial cell, followed by
  • FIG. 1 Structure of bidirectional antibiotic resistant transmission model (see also Am J Epidemiol. 2013;178(4):508-520) and the effect of antibiotic resistance gene inactivation therapy: A, Antibiotic Resistance is Dominant; B, Antibiotic Sensitivity is Dominant; S, Susceptible, AS, Antibiotic Sensitive; AR, Antibiotic Resistant; T,
  • Antibiotic resistance genes in an antibiotic resistant state and the encounter of antibiotic resistance genes in a sensitive state are disrupted for example by gRNA-mediated Cas9 cleavage.
  • Antibiotic resistance gene inactivation therapy converts the bidirectional model (A) to an almost unidirectional conversion model (B) by increasing the conversion rate from antibiotic resistant to sensitive and decreasing the conversion rate from antibiotic sensitive to resistant.
  • the area of each square represents the population density of each state.
  • the width of the arrows is proportional to the magnitude of each parameter (transmission, recovery and conversion), i.e. transmission of antibiotic resistant bacteria is assumed to be higher than antibiotic sensitive bacteria in this figure.
  • FIG. 6 Structure of superinfection antibiotic resistant transmission model and the effect of antibiotic resistance gene inactivation therapy:
  • the bidirectional antibiotic resistance transmission model depicted in Figure 5 can additionally or alternatively be described by the following superinfection antibiotic resistance transmission model (see also Am J Epidemiol. 2013;178(4):508-520, as for Figure 5).
  • the antibiotic resistance genes are disrupted for example by gRNA-mediated Cas9 cleavage, this allows the population shift from the antibiotic resistant state to the antibiotic sensitive state via the superinfection state.
  • Disruption of antibiotic resistance genes increases the conversion rate from the antibiotic resistant to the sensitive state.
  • This figure gives a comparison of the relative population density before (Figure 6A) and after (Figure 6B) applying the CRISPR-Cas system.
  • the population is composed of S, Susceptible; Iw, sensitive; Iz, resistant; and Iwz, superinfection state.
  • the area of each circle is proportional to the relative population density in each state.
  • initial density in each state is assumed to be identical (0.25 each, represented by a thin-lined circle).
  • Thick lined circles represent the population density at the equilibrium state.
  • CRISPR-Cas system is clearly contributing to an increase of the population in the susceptible state, thus the recovery rate in the equilibrium state (i.e. S is expanding in B) and to reduce the population in the resistant state (i.e. Iz is shrinking in B).
  • the width of the arrows is proportional to the magnitude of each parameter (infection, recovery and state conversion), i.e.
  • the infection of antibiotic resistant bacteria is assumed to be lower than that of antibiotic sensitive bacteria in this figure. Recovery from the infection of the antibiotic sensitive pathogens is higher than that from the infection of the antibiotic resistant pathogens, because antibiotics are effective on the sensitive strains. In the presence of antibiotics, the antibiotic sensitive pathogens are converted to the antibiotic resistant pathogens much more than the reverse conversion because of the antibiotic selection pressure. The aim of the treatment is to reverse these conversion parameters and to drive the antibiotic resistant pathogen population to the sensitive state.
  • FIG. 7 Structure of CRISPR locus: This figure shows CRISPR locus containing six spacers targeting six different regions. Each crRNA is transcribed monocistronically from the same promoters denoted P to control the transcription level identical for each target. Each crRNA transcript starts with a leader sequence L and terminates with a terminator sequence T. Transcripts of each pre-crRNA are shown as arrows and boxes containing different spacer sequences are indicated by unique shading.
  • FIG. 8 Mapping short bacterial off-target sequence on the bla gene sequence.
  • the figure shows the local alignment of bacterial short sequences (SEQ ID NOs: 3-5, 8-14, 17-23 and 26-33) mapped to the beta lactamase gene.
  • Beta lactamase sequence (SEQ ID NOs: 1 - 2, 6-7, 15-16 and 24-25) is shown in grey in the top of each panel, PAM (protospacer adjacent motif) sequence is shown in black.
  • Base pairing region with crRNA is underlined
  • off-target seed sequence on the bacterial genome is italicised.
  • Off-target seed sequence, including PAM sequence is indicated by two vertical lines. Two numbers on the sequence of beta lactamase gene are the expected two base positions where the phosphodiester bond is cleaved by Cas9 (see Example 1 below).
  • Figure 9 Predicted crRNA secondary structure. With reference to Figure 8 and Example 1 , predicted secondary structures of the crRNA sequences using mFold are shown. The sequences of CR05, CR30, CR70 and CR90 shown in Figure 9 correspond to SEQ ID NOs: 34-37, respectively.
  • Figure 10 Expected cleavage positions on beta-lactamase gene from pBR322 (SEQ ID NO: 38). Two protospacer sequences, which are base-pairing with crRNA spacer sequences, are underlined (protospacer strand). Two anti-protospacer sequences, which are displaced when protospacer sequences are base pairing with crRNA spacer sequences, are bold italicised (anti-protospacer strand). Associated PAM sequences are indicated either boxed small letters (on protospacer strand) or boxed capital letters (on anti-protospacer strand). Expected cleavage positions are indicated by asterisks. Leader sequence is underlined from 1 st to 69th base and highlighted in grey.
  • FIG. 11 Photograph of electrophoretically separated DNA products on a 0.8% agarose gel showing PCR amplicons generated in Example 2 from each of the three regions plus the EcoRV digested vector pACYC184.
  • the marked lanes are as follows: 1 * - NEB (N3232S) 1 Kb molecular markers, 2 ⁇ g/lane; 2 - Fragment 1 , tracrRNA-Cas9 region : 4758 bp; 3 * - NEB (N3232S) 1 Kb molecular markers, 0.75 ⁇ g/lane; 4 - pACYCI 84 uncut; 5 - pACYCI 84 EcoRV cut : 4245 bp; 6 - pACYCI 84 EcoRV cut : 4245 bp; T - NEB (N3232S) 1 Kb molecular markers, 0.12 ⁇ g/lane; 8 - Fragment 2, leader and first direct repeat region : 276 bp; 9 *
  • FIG. 12 Plasmid map of pNB100 constructed in Example 2. The plasmid map was drawn by SnapGene viewer ver. 2.4.3 free version (http://www.snapgene.com). Two direct repeats (DR) are shown as narrow white rectanglular boxes adjacent to the 3' end of leader sequence.
  • Figure 13 Photographs show results of "Nemesis symbiotic activity" (NSA) according to an embodiment of the invention by bacterial cell mating (see Example 2).
  • the left plate shows JA200 pNT3 x DH5a pNB100 in Ap100Cm35, while the right plate shows JA200 pNT3 x DH5a pNB102 in Ap100Cm35, both plated at 5 x 10 7 cells /ml.
  • FIG. 14 Photographs show results of NSA according to another embodiment of the invention by plasmid transformation (see Example 2). Left: LB Cm35 plate. Colonies 1 - 40 are DH5a pBR322 transformed with pNB102; Colonies 45-60 are DH5a pBR322 transformed with pNB100. All colonies show resistance to Cm carried on plasmids pNB100 and pNB102; Right: LB Ap100 plate. Note that colonies 1 -40 have lost ApR following transformation with pNB102 carrying the spacer region targeted against the beta-lactamase gene carried on the plasmid pBR322 in strain NBEcOOI , thereby demonstrating Nemesis symbiotic activity. pNB100 lacking this spacer region but carrying the Cas9 gene is unable to inactivate the beta-lactamase gene.
  • Figure 15 Shows a phagemid of Ngophi6.
  • ORF1 1 and ORF7 of Ngophi6 are deleted from Ngophi6 genome. Coding sequences are represented by the arrows indicating the translation polarity of each ORF.
  • the corresponding gene nomencrature of each Ngophi6 phage ORF to M13 are ORF1 (g II), ORF2 (gV), ORF4 (gVIII), ORFV (gVIII), ORF8 (gVI), ORF9 (gl).
  • M13 gene nomencretures are in the parenthesis.
  • MCS Multiple cloning site.
  • the location of Ngophi6 and M13mp18 are indicated by the large two open arrows.
  • Figure 16 Shows a set of spacer sequences (SEQ ID NOs: 39-60) that encode 20 guide RNA molecules targeted against 1 17 different bla genes identified in the NCBI ARDB database for Klebsiella pneumoniae (see Example 5).
  • Candidate spacer sequences were identified to disrupt all the Klebsiella pneumoniae beta lactamase genes found in the ARDB database.
  • Beta lactamase gene sequences are collected from the ARDB database with the keyword Klebsiella pneumoniae. Redundant sequences were removed and unique sequences used for multiple sequence alignment using web program Clustal Omega.
  • One canonical sequence was chosen from each cluster and the 20 nt spacer sequences predicted by the web program Jack Lin's CRISPR/Cas9 gRNA finder were collected.
  • Beta lactam antibiotics are classified into four classes, penams, cephems, carbapenems and monobactams.
  • One antibiotic name is listed as an example under each class.
  • the beta lactamase which can open the beta lactam ring is indicated by R.
  • carbapenem is inactivated by KPC.
  • the spacer sequence 5'-TTGTTGCTGAAGGAGTTGGG should be employed into spacer array to inactivate KPC genes.
  • the spacer sequence for CMY-a can also be employed for LAT-b cleavage. The example of spacer sequences are shown from 5' to 3' direction.
  • Figure 17 Shows a set of spacer sequences (SEQ ID NOs: 61 -77) that encode 17 guide RNA molecules targeted against 154 different bla genes identified in the CARD database for Klebsiella pneumoniae (see Example 5).
  • Candidate spacer sequences were identified to disrupt all the Klebsiella pneumoniae beta lactamase genes found in the CARD database. This table was created with the same method explained in the figure legend in Figure 16. The example of spacer sequences are shown from 5' to 3' direction.
  • FIG. 18 Map of a modified Cas DNA-binding polypeptide, Cas9R.
  • Resolvase and Cas9 are indicated by arrows. The direction of the arrowhead represents the transcription polarity.
  • Functional domain names of Cas9 are shown in the boxes below Cas9 open arrow.
  • This Cas9 is the endonuclease activity deficient mutant dCas9, with amino acid substitutions D10A in RuvCI domain, H840A in HNH domain (as described by Tsai et al. [2014, Nature Biotechnology 32: 569-576]).
  • a mutant Tn3 resolvase as described by Proudfoot et al.
  • RuvCI, II, III, HNH and PI (PAM interaction) domains are nuclease domains
  • REC1 a and REC1 b are recognition domains of repeat and anti-repeat RNA, respectively.
  • REC2 domain does not have any contact to the protospacer-gRNA heteroduplex.
  • CRISPR spacer sequences S1 , S2, S3 and S4 are arrayed under the expression of one CRISPR leader sequence and are required to bring about the Cas9R-mediated recombination event by the mutant Tn3 resolvase leading to the deletion and re-ligation of the target sequence.
  • Tn3R Tn3 Resolvase
  • R Direct repeat
  • L Leader sequence.
  • FIG 19 Schematic showing site-specific positioning of resolvase by gRNA directed Cas9.
  • the open arrow in step I is the target antibiotic resistance gene on the plasmid for inactivation.
  • Each recombination site A (A1 , A2) and B (B1 , B2) are recognised by gRNA independently and correctly positioned resolvases are dimerised in close proximity (step II).
  • 5 Dimers in each recombination site A1 +A2 and B1 +B2 are tetramerised to form a synapse (step III).
  • the synaptic complex (III) is enlarged, gRNAs are presented as dotted arrows designated S1 , S2, S3 and S4.
  • horizontal parallel arrows represent DNA containing the recombination site A1 +A2 and the thick horizontal parallel arrows represent DNA containing the recombination sites B1 +B2.
  • the arrowhead shows the 3' end of the DNA sequence.
  • Short black block arrows are locations of each of the PAM sequences.
  • Figure 20 Schematic showing exchanging half site of the recombination site A1+A2 and B1 +B2 followed by strand resolution and sealing break point.
  • Half-site of recombination A1 and B1 are exchanged and ligated and resolved.
  • the region of the target 20 antibiotic gene is resolved as a circular DNA, while the rest of the chromosomal or plasmid replicon is re-circularised (step IV).
  • Short black block arrows are locations of each PAM sequences after resolution.
  • CTXM-b 1 , 3, 10, 12, 15, 19, 22, 32, 52, 54, 59, 60, 62, 68, 71 , 80, 81 , 99, 141 , 147;
  • TEM-c 1 , 1 B, 3, 139, 162, 183, 192, 197, 198, 209;
  • KPC-d 1 , 2, 3, 4, 6, 7, 8, 1 1 , 12, 14, 15, 16, 17 ;
  • VIM-e 1 , 2, 4, 19, 26, 27, 33, 34;
  • IMP-f 4, 8, 32, 38;
  • NDM-g 1 , 9, 10 (see Example 7).
  • Figure 22 Shows a table giving the sequences (SEQ ID NOs: 86-98) of the oligonucleotides used in the construction of plasmids pNB200, 202, 203, 104A, 104B and 108 (see Example 7).
  • FIG 23 Plasmid map of pNB104A constructed in Example 7.
  • the plasmid map was drawn by SnapGene viewer ver. 2.4.3 free version (http://www.snapgene.com).
  • the tetramer spacer concatemer (Figure 29A) was digested with Bsa ⁇ , whose restriction site is located in A1 and A2, and ligated to Bsa ⁇ spacer cloning sites on pNB202 to give pNB203.
  • the single promoter and spacer region (6221 -7001 ) on pNB104A is shown.
  • P Promoter
  • L Leader
  • R Direct repeat
  • S Spacer
  • T Tail.
  • the concatenated spacers (targeted against NDM, IMP, VIM and KPC) are located downstream of the single promoter.
  • FIG. 24 Plasmid map of pNB104B constructed in Example 7.
  • the plasmid map was drawn by SnapGene viewer ver. 2.4.3 free version (http://www.snapgene.com).
  • the single promoter regions (6221 -6987) on pNB104B is shown.
  • P Promoter
  • L Leader
  • R Direct repeat
  • S Spacer
  • T Tail.
  • the concatenated spacers (targeted against OXA-48, SHV, TEM and CTX-M) are located under expression from the single promoter.
  • FIG. 25 Plasmid map of pNB108 constructed in Example 7.
  • the plasmid map was drawn by SnapGene viewer ver. 2.4.3 free version (http://www.snapgene.com).
  • the octamer spacer concatemer (Figure 29B) was digested with Bsa ⁇ , whose restriction site is located in A1 and A2, and ligated to Bsa ⁇ spacer cloning sites on pNB100 to give pNB108.
  • the single promoter and spacer region (6221 -7225) on pNB108 is shown.
  • P Promoter
  • L Leader
  • R Direct repeat
  • S Spacer
  • T Tail.
  • the concatenated spacers (targeted against NDM, IMP, VIM, KPC, OXA-48, SHV, TEM and CTX-M) are located under the single promoter.
  • FIG. 26 Plasmid map of pNB200 constructed in Example 7.
  • the plasmid map was drawn by SnapGene viewer ver. 2.4.3 free version (http://www.snapgene.com).
  • the dual promoter cassette was synthesised by PCR from the template pNB100 with primer pair NB018 and NB019, the amplicon was digested with Bbv ⁇ and ligated to the Bsa ⁇ site of pNB100 to give pNB200, the small Bsa ⁇ fragment of pNB100, from position 5776-5741 (see Figure 12) is replaced in the process.
  • the dual promoter and two spacer cloning region (6221 -7382) on pNB200 is shown.
  • P Promoter
  • L Leader
  • R Direct repeat
  • S Spacer
  • T Tail.
  • the restriction enzymes Bsa ⁇ and Sap ⁇ are utilised to clone upstream and downstream spacer sequences, respectively.
  • FIG. 27 Plasmid map of pNB202 constructed in Example 7.
  • the plasmid map was drawn by SnapGene viewer ver. 2.4.3 free version (http://www.snapgene.com).
  • the tetramer spacer concatemer (Figure 29A) was digested with Sap ⁇ , whose restriction site is located in B1 and B2, and ligated to Sap ⁇ spacer cloning sites on pNB200 to give pNB202.
  • the dual promoter and spacer regions (6221 -7329) on pNB202 is shown.
  • P Promoter
  • L Leader
  • R Direct repeat
  • S Spacer
  • T Tail.
  • the concatenated spacers (targeted against OXA-48, SHV, TEM and CTX-M) are located downstream of the second promoter.
  • FIG 28 Plasmid map of pNB203 constructed in Example 7.
  • the plasmid map was drawn by SnapGene viewer ver. 2.4.3 free version (http://www.snapgene.com).
  • the tetra spacer concatemer a+b+c+d shown in Figure 29A was digested with Bsa ⁇ , whose restriction site is located in A1 and A2, and ligated to Bsa ⁇ spacer cloning sites on pNB202 to give pNB203.
  • the dual promoter and spacer regions (6221 -7501 ) on pNB203 is shown.
  • P Promoter
  • L Leader
  • R Direct repeat
  • S Spacer
  • T Tail.
  • the concatenated spacers (targeted against NDM, IMP, VIM and KPC) are located downstream of the first promoter.
  • the concatenated spacers (targeted against OXA-48, SHV, TEM and CTX-M) are located downstream of the second promoter.
  • FIG 29A Tetramer spacer concatenation in Example 7.
  • the numbers associating oligos are corresponding to the primer numbers listed in Figure 22.
  • Oligos are pairewise annealed between 26 and 27, 28 and 34, 35 and 31 , 32 and 36 via a, c, e and g unique spacer region (I), respectively and extended in individual tubes (II).
  • Dimer concatemer from 26 and 27 concatenate spacer a and b.
  • Dimer concatemer from 28 and 34 concatenate spacer b, c and d.
  • Dimer concatemer from 32 and 36 concatenate spacer f, g and h (II).
  • Concatenated dimmers a+b and b+c+d, e+f and f+g+h are further hybridised via b and f spacer region, respectively and extended to concatenate four spacers a, b, c and d or e, f, g and h (III).
  • the tetramer spacer concatemer e+f+g+h was digested with Sap ⁇ , whose restriction site is located in B1 and B2, and ligated to Sap ⁇ spacer cloning sites on pNB200 to give pNB202.
  • Tetra spacer concatemer a+b+c+d was digested with Bsa ⁇ , whose restriction site is located in A1 and A2, and ligated to Bsa ⁇ spacer cloning sites on pNB202 to give pNB203.
  • a 20 mer spacer for NDM
  • b 20 mer spacer for IMP
  • c 20 mer spacer for VIM
  • d 20 mer spacer for KPC
  • e 20 mer spacer for OXA-48
  • f 20 mer spacer for SHV
  • g 20 mer spacer for TEM
  • h 20 mer spacer for CTX-M.
  • FIG. 29B Octamer spacer concatenation in Example 7.
  • the tetramer spacer concatemer a+b+c+d and e+f+g+h were amplified with primer pair NB026 and NB029, NB030 and NB033, respectively (V), and hybridise tetra concatemer via spacer d region followed by extension to yield octamer spacer a+b+c+d+e+f+g+h.
  • This octamer was digested with Bsa ⁇ and ligated to Bsa ⁇ , whose restriction site is located in A1 and A2, sand ligated to Bsa ⁇ spacer cloning sites on pNB100 to give pNB108.
  • a 20 mer spacer for NDM
  • b 20 mer spacer for IMP
  • c 20 mer spacer for VIM
  • d 20 mer spacer for KPC
  • e 20 mer spacer for OXA-48
  • f 20 mer spacer for SHV
  • g 20 mer spacer for TEM
  • h 20 mer spacer for CTX-M.
  • Figure 30 Photographs showing results of "Nemesis symbiotic activity” (NSA) according to an embodiment of the invention by bacterial cell mating (see Example 7).
  • top left plate shows JA200 pNT3 x DH5a pNB100 in Ap100Cm35
  • top right plate shows JA200 pNT3 x DH5a pNB102 in Ap100Cm35
  • Fig 30B shows NCTC13440 x DH5a pNB100, the top left plate and NCTC13353 x DH5a pNB100, the top right plate; and NCTC13440 x DH5a pNB104A the bottom left plate and NCTC13353 x DH5a pNB104B, the bottom right plate all in Ap100Cm35.
  • Fig 30C shows JA200 pNT3 x DH5a pNB100 (5-), NCTC13440 x DH5a pNB100 (2-) and NCTC13353 x DH5a pNB100 (4-), top left plate; and JA200 pNT3 x DH5a pNB108 (5/8), NCTC13440 x DH5a pNB108 (2/8) and NCTC13353 x DH5a pNB108 (4/8), top right plate and JA200 pNT3 x DH5a pNB100 (5+), bottom plate, all in Ap100Cm35.
  • antibiotic refers to a classical antibiotic that is produced by a microorganism that is antagonistic to the growth of other microorganisms and also encompasses more generally an antimicrobial agent that is capable of killing or inhibiting the growth of a microorganism, including chemically synthesised versions and variants of naturally occurring antibiotics.
  • the term "sufficiently complementary" means that the sequence identity of the spacer sequence and the target sequence is such that the RNA guide molecule comprising the spacer sequence is able to hybridise, preferably specifically and selectively, with the target sequence, thereby allowing for inactivation of the antibiotic resistance gene comprising the target sequence via the CRISPR/Cas system described herein.
  • the spacer sequence may have at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity over its entire length with the target sequence.
  • the term "functional equivalent” as used herein refers to a polypeptide which is capable of the same activity as a Cas DNA-binding polypeptide (or, as used herein, a Cas nucleic acid-binding polypeptide).
  • the “functional equivalent” may have the same qualitative biological property as the Cas DNA-binding polypeptide.
  • “Functional equivalents” include, but are not limited to, fragments or derivatives of a native Cas DNA-binding polypeptide and its fragments, provided that the equivalents have a biological activity in common with a corresponding native sequence polypeptide.
  • the functional equivalent may have at least 50%, 55%, 60% 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity over its entire length with a Cas DNA-binding polypeptide, for example Cas9 (Ferretti et al, 2001 , PNAS, 98 No. 8: 4658-4663, Gene ID: 901 176, Cas9 Gl: 15675041 ; SEQ ID NO: 99).
  • Cas DNA-binding polypeptide for example Cas9 (Ferretti et al, 2001 , PNAS, 98 No. 8: 4658-4663, Gene ID: 901 176, Cas9 Gl: 15675041 ; SEQ ID NO: 99).
  • Cas DNA-binding polypeptide encompasses a full-length Cas polypeptide, an enzymatically active fragment of a Cas polypeptide, and enzymatically active derivatives of a Cas polypeptide or fragment thereof.
  • Suitable derivatives of a Cas polypeptide or a fragment thereof include but are not limited to mutants, fusions, covalent modifications of a Cas protein or a fragment thereof.
  • modified Cas DNA-binding polypeptide encompasses Cas DNA-binding polypeptides as defined above except that the DSB catalytic function of the polypeptide is replaced by a DNA sealing function due for example to the presence of a recombinase catalytic domain. Further features of such modified Cas DNA-binding polypeptides are described herein. Sequence identity between nucleotide or amino acid sequences can be determined by comparing an alignment of the sequences. When an equivalent position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position. Scoring an alignment as a percentage of identity is a function of the number of identical amino acids or bases at positions shared by the compared sequences.
  • optimal alignments may require gaps to be introduced into one or more of the sequences to take into consideration possible insertions and deletions in the sequences.
  • Sequence comparison methods may employ gap penalties so that, for the same number of identical molecules in sequences being compared, a sequence alignment with as few gaps as possible, reflecting higher relatedness between the two compared sequences, will achieve a higher score than one with many gaps. Calculation of maximum percent identity involves the production of an optimal alignment, taking into consideration gap penalties.
  • Suitable computer programs for carrying out sequence comparisons are widely available in the commercial and public sector. Examples include MatGat (Campanella et al., 2003, BMC Bioinformatics 4: 29; program available from http://bitincka.com/ledion/matgat), Gap
  • sequence comparisons may be undertaken using the "needle" method of the EMBOSS Pairwise Alignment Algorithms, which determines an optimum alignment (including gaps) of two sequences when considered over their entire length and provides a percentage identity score.
  • Default parameters for amino acid sequence comparisons (“Protein Molecule” option) may be Gap Extend penalty: 0.5, Gap Open penalty: 10.0, Matrix: Blosum 62.
  • Default parameters for nucleotide sequence comparisons (“DNA Molecule” option) may be Gap Extend penalty: 0.5, Gap Open penalty: 10.0, Matrix: DNAfull.
  • a sequence comparison may be performed over the full length of the reference sequence.
  • the term "gene” refers to a DNA sequence from which a polypeptide is encoded or a non-coding, functional RNA is transcribed.
  • antibiotic resistance gene encompasses a gene, or the encoding portion thereof, which encodes a product or transcribes a functional RNA that confers antibiotic resistance.
  • the antibiotic resistance gene may be a gene or the encoding portion thereof which contributes to any of the four resistance mechanisms described above.
  • the antibiotic resistance gene may for example encode (1 ) an enzyme which degrades an antibiotic, (2) an enzyme which modifies an antibiotic, (3) a pump such as an efflux pump, or (4) a mutated target which suppresses the effect of the antibiotic.
  • polynucleotide refers to a polymeric form of nucleotide of any length, for example RNA (such as mRNA) or DNA.
  • RNA such as mRNA
  • DNA DNA
  • the term also includes, particularly for oligonucleotide markers, the known types of modifications, for example, labels which are known in the art, methylation, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications, such as, for example, those with unchanged linkages, e.g., methyl phosphates, phosphotriesters, phosphoamidates, carbamates, etc. and with charged linkages.
  • polypeptide refers to a polymer of amino acids. The term does not refer to a specific length of the polymer, so peptides, oligopeptides and proteins are included within the definition of polypeptide.
  • polypeptide may include post-expression modifications, for example, glycosylations, acetylations, phosphorylations and the like.
  • polypeptide include, for example, polypeptides containing one or more analogues of an amino acid (including, for example, unnatural amino acids), polypeptides with substituted linkages, as well as other modifications known in the art both naturally occurring and non-naturally occurring.
  • microorganism encompasses prokaryotes such as bacteria and archaea (for example, those belonging to the the Euryarchaeota and Crenarchaeota). Bacteria include both Gram positive and Gram negative bacteria. Some species of clinically significant, pathogenic fungi are included in the definition of microorganisms, for example members of the genus Candida, Aspergillus.. Cryptococcus, Histopiasrna, Pneumocystis and
  • an advantage of using a bacteriophage or conjugative plasmid that comprises the recombinant polynucleotide of the invention is that each serves as a "Trojan horse” that, following infection of the bacteriophage, or following plasmid conjugation, results in the insertion of the "assassin construct" into the target bacteria or other microorganism.
  • the assassin construct once inserted into the target microorganism also provides an immunisation of the cells against the future arrival of a plasmid harbouring antibiotic resistance genes (see Figure 2), in addition, of course to disrupting such genes already present (see Figures 1 and 3).
  • the assassin constructs then begin the process of degradation of the antibiotic resistance genes. If a DSB created by the Cas DNA-binding protein of the invention destroys a replicon carrying such an antibiotic resistant gene then a microorganism harbouring the antibiotic resistance gene may be killed directly by an assassin contruct. If the microorganism survives the DSB, the resistance gene will be inactivated, and a patient may then be treated with the antibiotic(s) to which the microorganism has now become sensitised.
  • This present invention provides potential agents for oral, topical and probiotic, dietary supplement delivery as well as an epidemiological tool to silently inactivate antibiotic resistance genes in pathogenic bacteria or other microorganisms (see Figure 3).
  • Patients scheduled for surgery, or other treatment in hospital may well be treated with recombinant bacteriophage carrying CRISPR/Cas9 (or other) assassin constructs targeted against antibiotic resistance genes prophylactically in advance of hospital admission. In this way, pathogens present in their microbiome can be directly killed or purged of antibiotic resistance genes in anticipation of any post-operative infection that might occur requiring treatment with antibiotics.
  • this present invention provides an epidemiological tool to silently inactivate antibiotic resistance genes in pathogenic bacteria.
  • a set of CRISPR/Cas9 assassins targeted against selected antibiotics may be constructed.
  • Variables are the bacteriophage (also referred to herein synonymously simply as "phage"), or conjugative plasmid, or DNA, delivery agent: a range of bacteriophage and plasmid agents may be developed that are specific to a range of important bacterial pathogens.
  • a single generalised bacteriophage or plasmid delivery agent needs to be modified to target different bacterial pathogens depends on the details of the specificity of the interactions of either the phage proteins involved in the phage life-cycle, or the plasmid biology and the pathogenic bacterial target.
  • lysogenic phage that infect hosts and become dormant as prophage, as well as non- virulent phage that replicate but do not kill the host, may be developed.
  • lysogenic phage specificity only the lysogenic life cycle of the phage and hence the specificity involved in (i) entry of the phage into the bacterial cell and (ii) its subsequent integration into an attachment site in the target chromosome is required. Integration may not be needed and may be replaced by using the phage to deliver a plasmid that can then excise, for example by cre-lox recombination, and replicate independently in the cell.
  • Non- virulent M13 phage and derivatives thereof may be used.
  • a functional lytic cycle in lysogenic phage may be retained such that low levels of entry into the lytic cycle in lysogenised bacteria will generate new phage that can go on to
  • Experiments may be performed in a model system (see Figure 1 ).
  • E. coli carrying multiple drug resistance, for example, to ampicillin, chloramphenicol, and kanamycin or targeted against commonly used antibiotics against which resistance is widespread.
  • Experiments may also be performed with a target pathogen, for example, Klebsiella pneumoniae carbapenemase ("KPC").
  • KPC Klebsiella pneumoniae carbapenemase
  • the phage delivery system (see for example Figure 2, route 2) may be suitable for the treatment of wounds and burns infected by antibiotic-resistant bacteria. Delivery of the assassin construct targeted against these antibiotics by two different E.coli lysogenic bacteriophage: bacteriophage lambda and bacteriophage Mu may be used.
  • Bacteriophage lambda has a specific integration site in the host chromosome known as the lambda attachment site. Bacteriophage Mu is able to integrate randomly into the host genome and has the advantage that no specific attachment sites in bacteria are required.
  • Phage may also be used to deliver a plasmid replicon containing the recombinant polynucleotide of the invention that excises by cre-lox recombination following infection as discussed above or by use of phage P1 that replicates as an episome.
  • the specificity involved in successful infection is recognition of a membrane protein on the bacterial cell surface. In the case of lambda this is the maltose permease protein that transports the sugar maltose into the bacterial cell. In the case of bacteriophage Mu the receptor is LPS.
  • Male-specific phage M13 that infect E.coli cells carrying the F-factor plasmid may also be used to deliver CRISPR/Cas9 constructs (or other assassin constructs of the invention) targeted against one or more antibiotic resistance genes.
  • M13 is a well studied phage, which replicates, but does not kill the bacterial host. Successful elimination of resistance to target antibiotics following the lyogenisation by recombinant bacteriophage, or infection by M13 recombinants carrying the assassin construct directed against these antibiotic resistance genes is evaluated.
  • Enterobacteriaceae carrying resistance to the same antibiotics may include Salmonella typhimurium, and Shigella flexneri in addition to Klebsiella pneumoniae discussed above.
  • modified phage are constructed with different genes encoding the tail fibre protein of the bacteriophage in order to allow it to interact with a different receptor present on the bacterial surface. Lysogenic phage, or male-specific phage, like M13, that are natural hosts of these bacteria may be used.
  • phage Mu carries an invertible G segment (regulated by a Mu-encoded site-specific recombinase, Gin) giving rise to two phage types G(+) able to infect E.coli K12 and G(-) able to infect Enterobacter cloacae, Citrobacter freundii Serratia marcescens and Erwinia carotovora.
  • Neisseria gonorrhoeae filamentous phage NgoPhi6, or modified forms thereof is the Neisseria gonorrhoeae filamentous phage NgoPhi6, or modified forms thereof.
  • the natural (wild type) phage has a wide host range for Gram negative bacteria (alpha, beta and gamma proteobacteria) - see Piekarowicz et al. (2014 J. Virol. 88: 1002 - 1010).
  • the natural phage is not lytic but lysogenic and has an integration site on the host genome.
  • the ability of the phage to integrate into the host chromosome is removed and the phage is engineered to replicate independently. The substitution of the left integration site L, CTTATAT with L', CATATAT will eliminate the integration event.
  • the M13 ori and M13 gene II can be used to mimic the M13 phage replication.
  • the modification may be kept to a minimum to maintain the ability of the progeny production from the infected bacteria.
  • the maximum packaging size is unknown, a phage DNA of around 12 Kb is experimentally demonstrated as packageable and phage progeny produced from the bacteria infected with this phage are infectable.
  • the length of the phage is around 4 microns, which is 4.4 times longer than M13 phage particle, and indicates the higher packaging capacity of DNA longer than M13 - i.e.
  • conjugative plasmids Delivery of the assassin constructs targeted against these antibiotics by selected broad-host range conjugative plasmids may be evaluated (see Figure 4, route 3).
  • the plasmids may be delivered by a benign non-pathogenic host.
  • the application here may be for the Gl tract as a probiotic and may be used prophylactically.
  • the possible lethal effects of DSBs caused by Cas DNA-binding protein are not a concern since the plasmid will not be transferred to the recipient.
  • Delivery by transformation of linear DNA Delivery of the assassin construct targeted against these antibiotics by linear double-stranded DNA transformation (see Figure 4, route 1 ) may also be performed.
  • the DNA is delivered via DNA receptor on the surface of the bacteria from the bacterial surrounding environment.
  • Example 1 The aim of Example 1 is to demonstrate a proof-of -concept for resurrection of antibiotic efficacy by introduction of a CRISPR/Cas9 construct in non-pathogenic bacterial strains of Escherichia coli.
  • a CRiSPR/Cas9 construct is made directly from genomic DNA isolated from the
  • Streptococcus pyogenes strain SF370 which is obtained from:
  • an equivalent CRISPR/Cas9 gene targeting construct is obtained from a pCas9 piasmid such as for example available from Addgene: http://www.addgene.org/42876/.
  • This piasmid carries the Cas9 gene plus a DNA sequences encoding tracrRNA and CRISPR array with a unique cloning site in order to introduce the spacer sequence desired to target a given DNA sequence for cleavage by the Cas9 endonuclease.
  • this existing pCas9 piasmid is described below.
  • Example 1 shows that bacteria carrying a beta-!actamase (bla) gene conferring resistance to the beta-lactam antibiotic, ampicillin become sensitive to ampicillin following introduction of a modified CRiSPR/Cas9 construct targeted against the Ma gene: the CRISPR/Cas9/anti-i?/a construct.
  • JM109 is (endA1 glnV44 thi-1 relA1 gyrA96 recA1 mcrB + A(lac-proAB) e14- [F' traD36 proAB + lacl q lacZAM15] hsdR17(r K m K + )).
  • pUC18 Or/ ' pMB1
  • pCas9 pACYC184-based vector with Or/ p15A, CRISPR locus plus Cas9 gene, CM R
  • pCRISPR On pMB1 , CRISPR, Kn R ).
  • Example 1 A in one strain E.coii DH5a and carrying pBR322 a medium copy piasmid or alternatively a low copy piasmid, the CRlSPR/Cas9/anti-£>/a construct is delivered, by naked DNA transformation in piasmid pCas9, designated pCas9::anti-£>/a.
  • the already present piasmid pBR322, or the low copy piasmid expresses the beta-iactarnase derived from bacterial transposon Tn3; pBR322 also carries resistance to tetracycline.
  • pCas9::anti-d/a carries resistance to chloramphenicol
  • selection for ceils maintaining pCas9::anti-d/a is achieved by addition of chloramphenicol to the growth medium.
  • DHSa ceils with pBR332, or a low copy piasmid are transformed with pCas9 (that is a piasmid in all respects like pCas3::anti-£>/a but Iacking anti-d/a which is the spacer sequence targeted against the bla gene: it is predicted that pCas9, in lacking the anis- bia would not be able to attack and inactivate the bla gene.
  • pCas9 is maintained by the presence of chloramphenicol.
  • Beta-!actamase activity can be detected by nitrocefin, which is a chromogenic derivative of cephalosporin, when the beia-lactam ring is hydrolysed, ultraviolet absorption of intact nitrocefin is shifted to around 500 nm, which allows visual detection of the presence of beta lactamase.
  • beta lactamase activity is seen directly challenging the bacteria on the LB plate containing ampiciliin, Total bacteria resistant to chloramphenicol is N 0 , ampiciliin resistant bacteria is N ai then CR!SPR/Cas9/anti-d/a-mediated inactivation of the h!a gene efficiency can be defined by measuring the fraction of the ampiciliin sensitive colony, 1 -Na/N0.
  • Example 1 B an M13 phage delivery system is used to introduce CRiSPR/Cas9/anti-6/a construct into the E, coli strain, JM109, expressing beta lactamase gene from a resident piasmid.
  • M13::CR!SPR/Cas9/anti-£>/a phage recombinant is prepared as follows: the
  • CRISPR/Gas9/anti-d/a construct is isolated from pCas9::anti-fe/a by digesting this construct with SaH and Xba ⁇ .
  • the digested fragment size is 5796 bp.
  • the fragment is cloned at Sail (GTCGAC) and Xba ⁇ (TCTAGA) site of M13mp18 RF I.
  • the entire size of the M13mp1 8 containing CR!SPR/Cas9/ anti-d/a construct is 13035 bp.
  • This M13 recombinant phage DNA is transformed to E.coli JM109, a bacterial strain carrying the F' piasmid and recombinant M13 phage extruded from the bacteria is purified and used to introduce the CRISPR/Cas9 construct to E.cois JM1 09 harbouring pBR322.
  • a negative control an equivalent
  • M13::CRISPR/Cas9 phage recombinant lacking anti-d/a region is prepared from pCas9 by restriction enzyme Sail and Xbal and the amplicon is cloned at SaH and Xba ⁇ site of M13mp1 8 RF S.
  • M1 3 infects the bacterial cells, it does not kill them, but the phage DNA replicates inside the cell and expresses phage genes.
  • M13::CR!SPR/Cas9/anti-£>/a phage recombinant should result in inactivation of the b!a gene, in contrast, in a negative control, to infection by an M13::CRiSPR/Cas9 phage recombinant lacking anti-d/a region. Because M13 phage infection slows down the rate of eel! growth, when infected ceils grown on a lawn of cells yield turbid plaques of slow growing infected cells.
  • the efficacy of CRI8PR/Cas9/anfi--d/a- mediated inactivation of the d/a gene efficiency is calculated by measuring the fraction of white colonies to red red colonies, when plaques are picked and grown as colonies to remove the background lawn. Plaques may also be picked and plated onto LB plate with/without ampiciliin to score the ratio of ampiciliin sensitive to ampiciliin resistant colonies that will result.
  • criterion No.2 is relaxed to allow a matched sequence up to the 12th nucleotide position in the target sequence (the first
  • NGG canonical PAM
  • SUBSTITUTE SHEET RULE 26 sequences are mapped against the bla gene followed by counting the seed sequence from the canonical PAM sequence. Choose the sequences whose seed sequence number is less than eight and whose Gibbs free energy is relatively large.
  • Table 1 This table also shows nucleotide length of the seed sequence of the off-target sequences on pCas9 and pBR322.
  • crRNA CR05 cleaves phosphodiester bond between 762nd base C and 763rd base C
  • CR30 cleaves phosphodiester bond between 198th base G and 199th base A
  • CR70 cleaves phosphodiester bonds between 575th base T and 576th base A
  • CR90 cleaves phosphodiester bonds between 221 st base T and 222nd base A on the beta-lactamase gene.
  • Sites of six base cutter restriction endonucleses are underlined, which are useful to screen the recombinants.
  • Cas 9 gene, CRISPR expression locus and tracrRNA (all from S. pyogenes)
  • tracrRNA The reverse complement of tracrRNA is in lowercase, Cas9 coding sequence (SEQ ID NO: 126) is boxed and direct repeat sequence in CRISPR is in bold. Promoter sequences were predicted by neural network algorithm (http://www.fruitfly.org/seq_tools/promoter.html). The two unique sites, Sal I (GTCGAC) and 6a I (TCTAGA) highlighted in bold italicised black are utilised to isolate the CRISPR/Cas9 construct for cloning into M13mp18. The pACYC184 backbone sequence is italicised.
  • Cas 9 gene, CRISPR expression locus and tracrRNA (all from S. pyogenes)
  • SUBSTITUTE SHEET RULE 26 Backbone vector pACYC184 sequence is italicised, sequence positions are numbered from G of EcoRI site underlined. The reverse complement of tracrRNA is in italicised bold located from 1844 to 1929, Cas9 initiation and termination codons are indicated by bold three letters, starting at nucleotide No. 2225 and ending at 6331 followed by leader sequence 6389-6483 indicated by italicised bold letters, first, second and third direct repeat sequences are underlined, between the first and second direct repeat in which spacer cloning region is located.
  • This spacer cloning region contains two inverted Bsa ⁇ sites indicated by bold italicised letters 5'-GAGACC-3' and 5'-GGTCTC-3' for creating 5' four bases protruding spacer cloning sites 5'-GTTT-3' and 5'-TTTT-3', respectively.
  • Promoter sequences were predicted as above, indicated by lower case for forward promoter for Cas9 and leader sequence and italicised lower case for reverse promoter for tracrRNA, the putative transcription start site is indicated by bold uppercase.
  • Recombinant selection should be performed in the presence of IPTG to induce transcription.
  • Bsa ⁇ recognition sites are underlined, lac operator 3 and 1 are bold italicised.
  • Tac promoter is in bold letters, -35 and -10 region in the promoter sequence are underlined, Shine- Dalgarno sequence is boxed, first dipeptide is in bold M and R followed by three consecutive termination codons italicised TAA. Tryptophan terminator signal sequence is employed, indicated by italicised letters.
  • tracrRNA hybridises to the direct repeat region of pre-crRNA indicated by upper case letters using the sequence underlined.
  • Bacterial RNase III cleaves the double-stranded RNA region at indicated position "
  • the first processing event may also be depicted as follows: tracrRNAs indicated by lower case letters hybridise to the direct repeat region of pre-crRNA indicated by upper case bold black letters. Bacterial RNase III cleaves the double-stranded RNA region at indicated position with arrows, which is first processing event. Phosphodiester bond between 22 nd and 23 rd base in the first and second direct repeat are cleaved. Italicised spacer sequence CR90 is boxed.
  • the 2nd cleavage point ( * ) is around 20 nt away from the 3' end of the spacer sequence. "Note that the 2nd processing event occurs at a specific distance from the 1 st cleavage within the repeats. Considering that spacer sequences are not identical among each other, it is thus likely that the 2nd processing event within the spacers is distance-dependent rather than sequence-dependent" (see Supplementary figure 2 legend in Nature. Mar 31 , 201 1 ;471 (7340):602-607). Although the above-referenced article does not particularly specify the enzyme and/or mechanism involved in this 2nd processing event, it is most likely Cas9 is involved in this 2nd cleavage. Considering this cleavage position within the spacer sequence, the whole spacer sequence is not contributing to the target recognition, instead only 20 nt spacer sequence is utilised for hybridisation.
  • the second processing event may also be depicted as follows: The 2nd cleavage point indicated by arrows around 20 nt away from the 3' end of the spacer sequence in the above figure.
  • the italicised spacer sequence CR90 is in box.
  • the part of the target beta-lactamase DNA sequence containing CR90 is shown. crRNA hybridises to its complementary sequence of the target region, Cas9 cleavage points are indicated by dot ".” and the PAM sequence tgg is indicated in the box.
  • the following experiments describe some proof-of-concept experiments performed to demonstrate that the CRISPR-Cas9 system can be used to inactivate antibiotic resistance in bacteria. They describe the construction of a generally applicable DNA cassette, described in the Examples to deliver the CRISPR-Cas9 system plus a derivative carrying a spacer sequence targeted against an antibiotic resistance gene for delivery by naked DNA transformation and bacteriophage infection and also to demonstrate inhibition of the spread of antibiotic resistance by plasmid conjugation.
  • pNB100 is a vector to express the CRISPR-Cas9 system in E.coli with the appropriate unique restriction site, Bsa I, to clone any desired spacer sequence between two direct repeats in the CRISPR locus.
  • the backbone of the vector is derived from pACYC184 and the CRISPR-cas9 locus is inserted into Eco RV site of the vector.
  • Three regions of the CRISPR-cas9 locus were amplified by PCR from the genomic DNA of Streptococcus pyogenes strain SF370, purchased from the ATCC, and assembled by Gibson assembly (Gibson DG, et.al. Nature Methods 2009; 6: 343-345) along with the pACYC184 vector in the reaction.
  • the sequence of the final construct was verified by Sanger sequencing.
  • the CRISPR-Cas9 activity was confirmed using a derivative of pNB100, pNB102, carrying a spacer sequence targeted against the beta lactamase genes of the bacterial transposons Tn3 and Tn1.
  • sequences are the three regions amplified by PCR. Underlined sequences are template-specific primer sequences, bold letters are overlapping sequences used for Gibson assembly.
  • Forward primer is from 854170 to 854193 and reverse primer is from 858867 to 858848 on
  • Forward primer is from 861221 to 861276 and reverse primer is from861613 to 861594 on S. pyogenes genomic DNA.
  • Decamer sequence from 861246-861255 GGTCTCCATT (SEQ ID NO: 142), which contains Bsa ⁇ recognition sequence on the genomic DNA, was substituted with GGTCCCAAAA (SEQ ID NO: 143) to destroy Bsa ⁇ recognition sequence and convert the 7th truncated direct repeat in the CRISPR array on the genome to the canonical 2nd direct repeat sequence in this vector.
  • the total number of nucleotides is 9578 bp.
  • the backbone vector pACYC184 sequence is italicised, sequence positions are numbered from G of EcoRI site (GAATTC) underlined.
  • tracrRNA is located at nucleotide No. from 1889 to 1974 indicated bold letters, Cas9 D initiation and termination codons are indicated by bold three letters, starting at
  • This spacer cloning region contains two inverted Bsa ⁇ sites indicated by bold italicised letters 5'-GAGACC-3' and 5'-GGTCTC-3' for creating 5' four bases protruding spacer cloning sites 5'-GTTT-3' and 5'-TTTT-3', respectively and one unique AatW (5'-GACGTC-3') site also indicated by bold italicised to reduce self-ligation in the event of incomplete Bsa ⁇ digestion.
  • a plasmid map of pNB100 is shown in Figure 12.
  • the desired spacer sequence can be cloned in the clockwise direction between Bsa ⁇ sites.
  • This vector contains the p15A origin at 1393-848 and cat (chloramphenicol resistant) gene at 219-9137.
  • Cutting positions of each restriction enzyme, indicated in the parentheses, refer to the position of the 5' cutting sites on the top strand within the recognition sequence.
  • pNB100 was digested with Bsa ⁇ and AatW followed by purification using Agencourt ampure beads.
  • the spacer sequence CR30 was employed from the discussion in B. Selection of spacer sequence from the target sequence in the Materials and Methods section above.
  • the CR30 sequence is as follows :
  • This double-stranded DNA cassette is generated by denaturation at 95 C for 1 min and re- annealing at -1 degree every min to 30 C in the 1 x T4 ligase buffer (50 mM Tris-HCI(pH 7.5 at 25 C), 10 mM MgCI2, 1 mM ATP 10 mM DTT) plus 50 mM NaCI following the kinase reaction to add a phosphate moiety in the 5' terminus of each oligo.
  • the annealed cassette contains 5' protruding four base compatible bases on both ends for the sites created on pNB102 by Bsa ⁇ digestion.
  • This CR30 cassette was ligated to pNB100 by T4 DNA ligase and transformed to DH5a competent cells (purchased from New England Biolabs). The
  • SUBSTITUTE SHEET RULE 26 transformants were selected on chloramphenicol LB plate and were screened by PCR with the bottom sequence of the CR30 cassette as a reverse primer and a forward primer CF1 : 5'-acgttgacgaatcttggagc, which anneals at 6209-6228 region on the recombinant plasmid to generate 409 bp PCR amplicon.
  • PCR positive clones were sequenced to confirm the CR30 spacer sequence and this recombinant clone is designated as pNB102 and used for in vitro beta lactamase-gene disruption experiments.
  • CR30 spacer anneals to the sense strand of beta lactamase-gene and cleaves the phosphodiester bonds between 188th and 189th nucleotide on the sense and antisense strand.
  • pNB102 was digested with unique restriction sites Sa/I and Xba ⁇ to generate two fragments 6044 bp and 3524 bp.
  • the fragment length was calculated from the 5' end of the restricted sites in the top strand within the restriction recognition sites.
  • the 6044 bp fragments containing CRISPR locus with CR30 spacer sequence in the CRISPR array was separated from the 3524 bp fragment and purified on the preparative 1 % agarose gel.
  • M13 mp18 was digested with Sal ⁇ -Xba ⁇ , followed by Agencourt ampure purification to remove the six bases Sal ⁇ -Xba ⁇ fragment from the reaction.
  • Nemesis symbiotics can prevent the spread of antibiotic resistance by inhibiting conjugal transfer of conjugative plasmids carrying antibiotic
  • the recipient cell DH5a (F- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG
  • the donor strain JA200 (F+ thr-1 , leu-6, DE(trpE)5, recA, lacY, thi, gal, xyl, ara, mtl) also carrying plasmid pNT3 is described by Saka et al. DNA Research 12, 63-68 (2005).
  • the plasmid pNT3 is a mobilisable plasmid carrying the bla gene of Tn1 .
  • a single colony of the donor JA200 pNT3 was picked from a Luria broth (LB) plate
  • DH5a pNB100 and DH5a pNB102 was picked from a LB plate containing 35 ⁇ g/mL Chloramphenicol and grown shaking at 37°C overnight in 1 mL LB with 35 ⁇ g/mL Chloramphenicol.
  • 50 ⁇ of cells were added to 1 mL LB in Eppendorf tubes and centrifuged 60 sec at 12500 rpm. Cells were resuspended in 50 ⁇ _ LB.
  • Photographs in Figure 13 show platings of the matings between: (A) JA200 pNT3 x DH5a pNB100 (as expected lacking Nemesis symbiotic activity); and (B) JA200 pNT3 x DH5a pNB102 (showing Nemesis symbiotic activity).
  • Mating mixtures were diluted 10 ⁇ -1 , 10 ⁇ -3, 10 ⁇ -5 in LB and 50 ⁇ of dilutions plated on LB, LB Ap100Cm35, LB Ap100 and LB Cm35 plates and plates incubated overnight at 37 °C.
  • the table below summarises the cell titres obtained.
  • the number of cells on LB Cm plus LB Ap plates should equal the number of cells on LB plates.
  • DH5a competent cells purchased from New England Biolabs were transformed with pBR322 (carrying the bla gene derived from Tn3) and selected on LB Ap100 plates. Competent cells of the derived strain DH5a pBR322 were then prepared using the CaCI2 protocol 25 (1 .1 16) as described by Sambrook and Russell in Molecular Cloning: A Laboratory Manual (3rd Edition, 2001 ) and subsequently transformed with plasmids pNB100, pNB102 and pACYCI 84 with selection for CmR.
  • Transformant colonies were then picked onto LB Cm35 and LB Ap100 plates. Primary transformants were replica toothpicked onto both LB Cm35 and LB Ap100 plates and incubated overnight at 37 °C.
  • the results, depicted in Figure 14, show that all colonies toothpicked from DH5a pBR322 transformed by pNB100 (lacking the bla gene target spacer sequence) remain resistant to ampicillin. In contrast all colonies toothpicked from DH5a pBR322 transformed by pNB102 have lost ampicillin resistance, so demonstrating Nemesis symbiotic activity.
  • the experiments above do not give a value for the fraction of primary transformants where NSA has inactivated the bla gene.
  • the aim of Exampie 3 is to extend the proof-of-concept for resurrection of antibiotic efficacy by introduction of a CRISPR/Cas9 construct in a pathogenic bacterial strain of Klebsiella pneumoniae.
  • Resistance to a newer class of beta-lactam antibiotics the Carbapenems has emerged in Enterobacteriaceae by the acquisition of new bla genes that encode beta- lactamases able to degrade even the Carbpenems.
  • Klebsiella pneumoniae strains with resistance to Carbapenems, KPC are important causes of morbidity and mortality among hospital-acquired and long-term care-associated infections. Noteworthy is the very high mortality (around 30-70%) among patients with bacteraemia or pulmonary infections.
  • Example 3 shows thai a Klebsiella pneumoniae carrying a beta- lactamase (bla) gene conferring resistance to the beta-lactam antibiotic, ampiciliin become sensitive to ampiciiliri following introduction of a modified CRISPR/Cas9 construct targeted against the bla gene.
  • the same CRISPR/Cas9/anti-i?/a construct used in Example 1 or Example 2 is used and is delivered to Klebsiella pneumoniae by conjugation with a donor strain carrying a conjugative plasmid with CRISPR/CasS/anti-d/a.
  • Ex-conjugant recipient Klebsiella pneumoniae carrying the plasmid with CRiSPR/Cas9/anti-6/a construct is selected for on appropriate media with counter-selection against the donor cell and Klebsiella pneumoniae cells that failed to receive the plasmid.
  • Example 1 and Example 2 efficacy of the CRISPR/Cas9/anti-£)/a contstruct is evaluated by comparison to a negative control of a Klebsiella pneumoniae ex-conjugant strain that received a plasmid with CRISPR/Cas9 (i.e. lacking the anti-o/a region).
  • the beta-laciamase activity can be detected by nitrocefin to count white versus red colonies.
  • beta lactamase activity is seen directly challenging the bacteria on the LB plate with/without ampiciliin and measuring the fraction of the ampiciliin sensitive colonies versus ampiciliin resistant ones.
  • the identical experiment to that described above is also evaluated using instead a
  • CRISPR/Cas9/anti-d/aCfc where the CRISPR/Cas9/anti-i)/aCi> construct carries a region, anti-d/aCo, targeted against a bla gene encoding a beta-lactamase able to break down carbapenems and present in that particular Klebsiella pneumoniae strain.
  • Example 4 provides delivery routes for the therapeutic constructs. These routes all apply to veterinary as well as human applications to be delivered orally, topically, probiotically and for use in surgical irrigation fluids and wound dressings.
  • Phage containing assassin construct as the active ingredient may be administered orally as a stabilised therapeutic preparation: either - administered before antibiotic therapy or administered in the form of an adjuvant complexed to an antibiotic.
  • Conjugative plasmids containing assassin construct as the active ingredient may be administered as a culture of commensal bacteria carrying these plasmids in order to transmit these plasmids to gut flora thereby generating prophylactic protection against future infection with antibiotic resistant bacterial pathogens.
  • Phage containing assassin construct as the active ingredient may be administered topically as a stabilised medication (ointment, spray, powder etc): either - administered before antibiotic topical medication; or administered in the form of a complex with an antibiotic medication.
  • Topical application of conjugative plasmids containing assassin construct as the active ingredient may be via a stabilised culture of commensal bacteria carrying these plasmids in order to transmit the plasmids to gut flora thereby generating prophylactic protection against future infection with antibiotic resistant bacterial pathogens.
  • Phage containing assassin construct as the active ingredient may be administered probiotically as a stabilised culture of commensal bacteria (e.g.
  • Lactobacillus spp carrying these plasmids in order to transmit the plasmids to gut flora thereby generating prophylactic protection against future infection with antibiotic resistant bacterial pathogens.
  • This may be the probiotic, prophylactic administration of such a preparation to patients in settings with a high risk of infection with antibiotic resistant bacterial pathogens such as hospitals, care homes, schools, transplantation centres etc.
  • Another example may be the administration of such a preparation to livestock via animal feeds, thereby limiting the rise and horizontal transmission of antibiotic resistant bacteria.
  • the use of the present invention in livestock thus represents one means for (indirect) prophylactic treatment of antibiotic resistant bacteria in humans.
  • Phage containing assassin construct as the active ingredient may be added to surgical irrigation fluids and also sprays for disinfecting fomites.
  • Stabilised commensal bacterial cultures containing conjugative plasmids incorporating assassin constructs may be added as coatings to surgical wipes and to wound dressings.
  • a construct is designed to include multiple RNA guide molecules where each RNA guide molecule is transcribed by its own promoter.
  • Figure 16 exemplifies a set of spacer sequences that we have identified encoding 20 guide RNA molecules targeted against 1 17 different bla genes identified in the NCBI ARDB database for Klebsiella pneumoniae.
  • the beta lactamase gene type, spacer sequence and antibiotic resistance profile in Klebsiella pneumoniae obtained from NCBI ARDB database are shown.
  • Beta lactamase gene sequences were collected from the ARDB database with the keyword Klebsiella pneumoniae. Redundant sequences were removed and unique sequences used for multiple sequence alignment using web program Clustal Omega.
  • One canonical sequence was chosen from each cluster and the 20 nt spacer sequences predicted by the web program Jack Lin's CRISPR/Cas9 gRNA finder collected.
  • Beta lactam antibiotics were classified into four classes, penams, cephems, carbapenem and monobactam.
  • One antibiotic name is listed in Figure 16 as an example under each class.
  • the beta lactamase which can open the beta lactam ring is indicated by R.
  • carbapenem is inactivated by KPC.
  • the spacer sequence 5'-TTGTTGCTGAAGGAGTTGGG SEQ ID NO: 45
  • the spacer sequence for CMY-a can be employed to LAT-b cleavage.
  • Figure 17 exemplifies a set of spacer sequences encoding 17 guide RNA molecules targeted against 154 different bla genes identified in the CARD database for Klebsiella pneumoniae. Beta lactamase gene type, spacer sequence and antibiotic resistance profile in Klebsiella pneumoniae obtained from the IIDR CARD database are shown.
  • Beta lactamase gene sequences were collected by filtering all the collected beta lactamase genes with the keyword Klebsiella pneumoniae and subjected to multiple sequence alignment using web program Clustal Omega.
  • One canonical sequence from each cluster was chosen and the 20 nt spacer sequences predicted by the web program Jack Lin's CRISPR/Cas9 gRNA finder collected.
  • the spacer sequence was chosen to maximise the ratio of the proto-spacer sequence found in the sequences belonging to the same branch.
  • the each of the example spacer sequences shown in the 4 th raw has the capability to disrupt the genes in the third column.
  • Beta lactam antibiotics are classified into four classes, penams, cephems, carbapenem and monobactam.
  • penams cephems
  • carbapenem monobactam.
  • the beta lactamase which can open the beta lactam ring is indicated by R.
  • carbapenem is inactivated by KPC.
  • the spacer sequence 5'-TTGTTGCTGAAGGAGTTGGG SEQ ID NO: 45
  • a modified Cas DNA-binding polypeptide is created that deletes and reseals rather than leaving a DSB.
  • DSBs caused by Cas DNA-binding polypeptide such as CRISPR-Cas9 can be lethal to the replicon targeted and can result in cell death rather than, for example, re- sensitisation to antibiotics, if an antibiotic resistance gene in the replicon is targeted for inactivation. Immediate cell death rather than such re-sensitisation to antibiotics for subsequent killing by antibiotic may increase selection pressure against delivery of the targeting constructs.
  • DSBs we may modify the Cas9 gene to allow the resealing of the targeted sequence after gene inactivation by introducing a deletion or inversion.
  • Tsai et al. (2014) have constructed a fusion between a catalytically inactive Cas9 (dCas9) protein to the wild-type nuclease domain of the restriction endonuclease Fok1 to increase the specificity of cleavage in eukaryotic cells.
  • Proudfoot et al. (201 1 ) have similarly fused zinc- finger DNA recognition domains to the catalytic domains of recombinases to programme site- specific recombination at designated DNA sequences.
  • the Cas9 resolvase fusion is directed to the desired sites determined by the Cas9 domain :guide RNA spacer sequences; and the fused resolvase is positioned at the recombination site.
  • a and B resolvases must dimerise at each recombination site.
  • two Cas9Rs need to be positioned in close proximity at each recombination site A1 A2 and B1 B2 as designated by the sequences encoded by the spacers S1 -S4.
  • the correct orientations of A1 relative to A2 and B1 relative to B2 will need to be determined experimentally.
  • Figures 19 and 20 show a schematic process as to how this Cas9R fusion resolvase resolves the synapse and parental replicon DNA is recircularised.
  • plasmids are constructed that carry the CRISPR-Cas9 system plus derivatives carrying spacer sequences, flanked by direct repeats, targeted against up to eight of the following beta-lactamase families of resistance genes: SHV, CTX-M, TEM, KPC, VIM, IMP, NDM and OXA.
  • spacer sequences flanked by direct repeats, targeted against up to eight of the following beta-lactamase families of resistance genes: SHV, CTX-M, TEM, KPC, VIM, IMP, NDM and OXA.
  • a single spacer is designed that will target a number of gene members of that family.
  • Figure 21 shows the eight spacer sequences that were designed to target the eight beta- lactamase families of resistance genes: SHV, CTX-M, TEM, KPC, VIM, IMP, NDM and OXA-48.
  • the primer sequences used in the construction of the plasmids are listed in a table in Figure 22.
  • a plasmid derivative of pNB100 ( Figure 12), pNB104A ( Figure 23), a generally applicable DNA cassette, is described in the Examples that carries the CRISPR- Cas9 system plus derivatives carrying spacer sequences, flanked by direct repeats, targeted against four beta-lactamase families of antibiotic resistance genes in bacteria and are expressed off one promotor: NDM, IMP, VIM and KPC.
  • plasmid derivative of pNB100, pNB104B ( Figure 24), a generally applicable DNA cassette, is described in the Examples that carries the CRISPR- Cas9 system plus derivatives carrying spacer sequences, flanked by direct repeats, targeted against four beta-lactamase families of antibiotic resistance genes in bacteria and are expressed off one promotor: OXA-48, SHV, TEM and CTX-M.
  • plasmid derivative of pNB100, pNB108 ( Figure 25), a generally applicable DNA cassette, is described in the Examples that carries the CRISPR- Cas9 system plus derivatives carrying spacer sequences, flanked by direct repeats, targeted against eight beta-lactamase families of antibiotic resistance genes in bacteria and are expressed off one promotor: SHV, CTX-M, TEM, KPC, VIM, IMP, NDM and OXA-48.
  • a plasmid derivative of pNB100 is constructed where spacer sequences can be expressed from a choice of two different promotors.
  • This plasmid, pNB200 ( Figure 26), carries a different unique restriction site downstream of each promotor to clone any desired spacer sequences flanked by their own direct repeats between two direct repeats in the CRISPR locus.
  • Derivatives of pNB200 are described that carry the CRISPR-Cas9 system plus derivatives carrying spacer sequences, flanked by direct repeats, targeted against eight beta-lactamase families of resistance genes: SHV, CTX-M, TEM, KPC, VIM, IMP, NDM and OXA-48.
  • the second promotor is used to express spacers flanked by direct repeats to target the four beta-lactamase families of resistance genes: OXA-48, SHV, TEM and CTX-M.
  • pNB203 Figure 28
  • both promotors are used: the first to express spacers flanked by direct repeats to target four beta-lactamase families of resistance genes: NDM, IMP, VIM and KPC and the second promotor to express spacers flanked by direct repeats to target four beta-lactamase families of resistance genes: OXA-48, SHV, TEM and CTX-M.
  • the tetramer spacer concatemer a+b+c+d shown in Figure 29A was digested with Bsa ⁇ , whose restriction site is located in A1 and A2, and ligated to Bsa ⁇ spacer cloning sites on pNB100.
  • the structure of the single promoter and spacer region (6221 -7001 ) on pNB104A is shown in Figure 23.
  • the four-space concatemer contains spacer sequences targeting NDM, IMP, VIM and KPC from the proximal to the distal end of the single promoter.
  • the tetramer spacer sequence concatemer e+f+g+h shown in Figure 29A was digested with Sap ⁇ , whose restriction site is located in B1 and B2, and ligated to Sap ⁇ spacer cloning sites on pNB200. While screening pNB202 screening this construct was found and confirmed by sequencing. A deletion event between the direct repeats adjacent to leader sequences had occurred and restored the direct repeat sequence to give pNB104B.
  • the single promoter regions (6221 -6987) on pNB104B is shown in Figure 24.
  • the concatenated spacers (targeted against OXA-48, SHV, TEM and CTX-M) are located under the single promoter.
  • the concatenated spacer array sequences A and B were amplified from the subcloned vector pCR Blunt M-TOPO_SpacerA and pCR Blunt M-TOPO_SpacerB with the primer set NB026 and NB029, NB030 and NB033, respectively.
  • At the 3' end of amplicon of spacer A and 5' end of amplicon of spacer B are 20 bases of overlapped sequence from KPC spacer sequence. These two amplicons were gel purified and used for PCR-based pairwise cycle extension reaction in the absence of the primer.
  • the extended material was re-amplified with primer set NB037 (5'-GGGCTGGCAAGCCACGTTTGGTG-3'; SEQ ID NO.
  • the transformants were selected on chloramphenicol LB plates and were screened by PCR with the reverse primer NB021 : 5'- GGTGACTGATGGCCACGT (SEQ ID NO: 149) and a forward primer NB020: 5'- CCAACTACCTCCCCTTGCTTAAC (SEQ ID NO: 148), which anneal at 6368-6385 region and 7203-7225 region, respectively on the recombinant plasmid to generate 858 bp PCR amplicon.
  • PCR-positive clones were sequenced to confirm the eight-spacer concatemer sequence and this recombinant clone is designated as pNB108 and used to demonstrate CRISPR/Cas9-mediated inactivation of targeted beta lactamase genes following DNA delivery to bacterial strains carrying such genes.
  • a plasmid map of pNB108 is shown in Figure 25.
  • the plasmid pNB200 contains two identical promotors for gRNA expression and carries a different unique restriction site Bsa ⁇ and Sap ⁇ downstream of each promotor to clone any desired spacer sequences flanked by their own direct repeats between two direct repeats in the CRISPR locus.
  • the desired structure of the CRISPR array locus in pNB200 consists two sets of cassettes harbouring promotor-leader-direct repeat-spacer cloning region-direct repeat-tail tandemly.
  • the forward primer NB018 anneals at the 5' end of the leader sequence to the promotor in pNB100 and introduces the first spacer cloning region, second direct repeat and tail sequence.
  • the reverse primer NB019 anneals at the 3' end of leader sequence in pNB100 and introduces a third direct repeat, second spacer cloning region. This amplicon is cloned between Bsal sites on pNB100 to give pNB200.
  • the amplified sequence (SEQ ID NO: 146) with primer NB018 and NB019 from pNB100 as template
  • the forward primer NB018 and the reverse primer NB019 are underlined and the initial annealing sites, for the first PCR cycle, are indicated by bold letters and italicised bold letters, respectively.
  • This amplicon was digested with Bbv (5'-GCAGCN8/N12) to create four bases compatible protruding 5' ends to Bsa ⁇ digested pNB100. Bbv ⁇ recognition sites are depicted by lower bold cases.
  • the PCR conditions to generate the dual promotor-leader cassette were:
  • the sequence of the modified CRISPR array in pNB200 (SEQ ID NO: 147) The total number of nucleotides of pNB200 is 9919 bp. The sequence in the modified region is shown below, which replaces the small Bsa ⁇ fragment in pNB100. The first and the second promotor sequences are underlined. Leader sequences are in bold case. Direct repeats are italicised and the spacer cloning region between direct repeats are indicated by italicised and underlined.
  • the first spacer array cloning region contains two inverted Bsa ⁇ sites indicated by bold italicised underlined letters 5'-GAGACC-3' and 5'-GGTCTC-3' for creating 5' four bases protruding spacer cloning sites 5'-GTTT-3' and 5'-TTTT-3' on the vector, respectively and one unique Aati ⁇ (5'-GACGTC-3') site also indicated by bold italicised underlined lettes to reduce self-ligation in the event of incomplete Bsa ⁇ digestion.
  • the second spacer cloning region contains two inverted Sap ⁇ sites indicated by bold italicised underlined letters 5'-GAAGAGC-3' and 5'-GCTCTTC-3' for creating 5' three bases protruding spacer cloning sites 5'-GTT-3' and 5'-TTT-3' on the vector, respectively.
  • a plasmid map of pNB200 is shown in Figure 26.
  • the desired spacer array sequences can be cloned in the clockwise direction between two Bsa ⁇ sites and two Sap ⁇ sites
  • the plasmid pNB201 contains the dual promotors of pNB200 from which it is derived but a spacer array sequence targeted to OXA-48, SHV, TEM and CTX-M beta lactamase gene families are expressed from the second promotor.
  • pNB202 was digested with Bsa ⁇ followed by agarose gel purification.
  • the concatenated spacer array sequence B was generated by PCR-mediated pair-wise oligo nucleotide concatenation.
  • This four-spacer concatemer array B was cloned to the pCR Blunt ll-TOPO vector, purchased from Life Technologies, and the sequence was confirmed.
  • Sap ⁇ cuts out spacer array sequence B as a subclone from the TOPO vector and yields 5' protruding three base compatible bases on both ends for the sites created on pNB200 by Sap ⁇ digestion.
  • This four-spacer concatemer B cassette was ligated to pNB200 by T4 DNA ligase and transformed to DH5a competent cells (purchased from New England Biolabs). The transformants were selected on chloramphenicol LB plate and were screened by PCR with the reverse primer NB021 : 5'- GGTGACTGATGGCCACGT (SEQ ID NO: 149) and a forward primer NB020: 5'- CCAACTACCTCCCCTTGCTTAAC (SEQ ID NO: 148), which anneal at 6368-6385 region and 7307-7329 region, respectively on the recombinant plasmid to generate 962 bp PCR amplicon.
  • PCR positive clones were sequenced to confirm the four-spacer concatemer B sequence and this recombinant clone is designated as pNB202 and used to demonstrate CRISPR/Cas9-mediated inactivation of targeted beta lactamase genes following DNA delivery to bacterial strains carrying such genes.
  • a plasmid map of pNB202 is shown in Figure 27.
  • the plasmid pNB203 contains the dual promotors of pNB200 but each promotor expresses four spacers.
  • the first promotor expresses spacer sequence targeted to NDM, IMP, VIM and KPC
  • the second promotor expresses OXA, SHV, TEM and CTX-M beta lactamase genes.
  • the plasmid pNB202 was digested with Bsa ⁇ followed by agarose gel purification.
  • the concatenated spacer array sequence A was cut out from pCR Blunt ll-TOPO vector harbouring spacer concatemer A with Bsa ⁇ .
  • Bsa ⁇ cuts out spacer region, which contains 5' protruding four base compatible bases on both ends for the sites created on pNB202 by Bsa ⁇ digestion.
  • This four-spacer concatemer A cassette was ligated to pNB202 by T4 DNA ligase and transformed to DH5a competent cells (purchased from New England Biolabs). The transformants were selected on chloramphenicol LB plate and were screened by PCR with the reverse primer NB021 : 5'- GGTGACTGATGGCCACGT and a forward primer NB020: 5'- CCAACTACCTCCCCTTGCTTAAC , which anneal at 6368-6385 region and 7479-7501 region, respectively on the recombinant plasmid to generate 1 134 bp PCR amplicon.
  • PCR positive clones were sequenced to confirm the four-spacer concatemer A and B sequence and this recombinant clone is designated as pNB203 and used to demonstrate CRISPR/Cas9-mediated inactivation of targeted beta lactamase genes following DNA delivery to bacterial strains carrying such genes.
  • a plasmid map of pNB203 is shown in Figure 28.
  • Each unit oligo contains the direct repeat flanking the appropriate spacer sequence at each end. Concatenation reactions are performed between pairwise oligos, i.e. the nearest neighbour unit oligos are concatenated first to generate two unit length oligo, then two unit length oligos are concatenated to generate four unit length of oligo etc.
  • FIG. 29 The schematic structure of tetramer and octamer spacer structures are shown in Figure 29.
  • S spacer
  • R direct repeat
  • a and B contain Bsa ⁇ site to create ligation compatible sites for cloning into pNB100 and downstream of the first promotor of pNB200.
  • C and D contain a Sap ⁇ site to create ligation a compatible site for cloning downstream of the second promotor of pNB200.
  • Each oligo has overlapped sequence in the 3' and 5' end to anneal to the nearest neighbour oligo except the first and the last oligo.
  • the first and the last oligo have the overlapping sequence to the second and the penultimate oligo in the 5' end only.
  • four oligos are synthesised.
  • oligo No.1 consists spacer 1 and 2 in the 5' and 3' ends.
  • Oligo No.2 contains reverse complement of spacer 2 and 3 in the 3' and 5' ends.
  • Oligo No.3 contains spacer 3 and 4 in the 5' and 3' ends.
  • Oligo No.4 contains reverse complement of spacer 4 in the 3' end.
  • oligo No.2 can link oligo No.1 and oligo No.3, oligo 4 anneals to 3' end of oligo No.3.
  • Oligo No.1 and oligo No. 2, oligo No. 3 and oligo No. 4 are concatenated in a separate tube using the following PCR reaction conditions.
  • NB026 and NB027, NB028 and NB034, NB035 and NB031 , NB032 and NB036 are concatenated.
  • Each concatenated product A1 , A2, B1 and B2 was gel purified and set up the second concatenation reaction using the purified A1 and A2, B1 and B2 dimer product in the following PCR condition.
  • Constructs that are able to inactivate target genes, including antibiotic resistant genes, via the CRISPR-Cas system, and which are an aspect of the present invention are also referred to herein as "Nemesis symbiotics".
  • the CRISPR-Cas9 plasmid derivatives, pNB104A, pNB104B, pNB202 and pNB203 all carry spacer insertions targeted against the selected families of beta-lactamase (bla) genes described, and so provide exemplars to demonstrate that a single plasmid construct possesses Nemesis symbiotic activity (NSA) and is therefore able to inactivate representative genes from all 8 different families of beta- lactam antibiotics.
  • the plasmid pNB104A see Fig.
  • pNB104B (see Fig. 24) and pNB202 (ss Fig. 27) are tested for their ability to inactivate representative genes members of the OXA, SHV, TEM and CTX-M families
  • pNB108 (see Fig. 25) and pNB203 (see Fig. 28) are tested for their ability to inactivate representative genes members of the SHV, CTX-M, TEM, KPC, VIM, IMP, NDM and OXA families.
  • the NSA assay described in Example 2 showed that DNA transformation of an E. coli strain, DH5a, also carrying the TEM-3 beta lactamase gene on the plasmid pBR322, with plasmid pNB102 converts the transformant to ampiciilin sensitivity (ApS).
  • the plasmid pNB102 encodes resistance to chloramphenicol and the DH5a (pBR322) transformants now carrying pNB102 were selected on LB Cm plates and then screened for ApS (see Fig. 14).
  • the plasmid pNB102 in expressing the CRISPR/Cas9 system with the spacer sequence encoding the gRNA targeting the TEM-3 gene, inactivated the TEM-3 gene.
  • plasmid derivatives of pBR322 are constructed where the TEM-3 is replaced by representative genes from the other 7 different families of beta-lactam antibiotics: SHV, CTX-M, KPC, VIM, IMP, NDM and OXA.
  • Such genes are obtained from suitable bacterial strains carrying such genes.
  • a set of E. coli and K. pneumoniae strains carrying representative genes from these seven different families of beta-lactam antibiotics were purchased from Culture Collections, Public Health England, Porton Down, Salisbury, SP4 OJG, UK. These are: NCTC13368, a K. pneumoniae strain carrying the SHV-18 gene; NCTC13353 an E. coli strain carrying the CTX-M-15 gene; NCTC13438 a K. pneumoniae strain carrying the KPC-3 gene;
  • NCTC13440 a K. pneumoniae strain carrying the VIM-1 gene
  • NCTC13476 an E. coli strain carrying an uncharacterised IMP gene
  • NCTC13443 a K. pneumoniae strain carrying the NDM-1 gene
  • NCTC13442 a K. pneumoniae strain carrying the OXA-48 gene. All seven genes encode beta lactamases that are also able to degrade and inactivate the penam class of antibiotics (see Fig. 16, 17). All strains were tested and, as expected, found to be resistant to the penam class antibiotic, ampicillin.
  • Beta lactamase coding sequences are amplified from the cell with appropriate forward and reverse primer set shown below:
  • NBKpDOl 13443 NDM-1 attgaaaaaggaagagtATGGAATTGCCC agtcccgctaGGTCTCaACCGTCAGCGCA
  • AATATTATGCACCC (SEQ ID NO: GCTTGTCGG (SEQ ID NO : 153) 152)
  • NBKp002 13442 OXA-48 attgaaaaggaagagtATGCGTGTATTA agtcccgctaGGTCTCaACCGCTAGGGAA
  • NBKpOQ4 13440 VIM-1 attgaaaaaggaagagtATGTTAAAAGTT agtcccgctaGGATGacctggctgACCGC
  • NBEcOlS 13476 IMP-4 attgaaaaaggaagagtATGAGCAAGTTA agtcccgctaGGTCTCaACCGTTAGTTGC
  • Each forward primer contains a 17 base sequence to restore the beta-lactamase promoter on pBR322, and each reverse primer contains Bsa ⁇ site (for NDM-1 , OXA-48, SHV-18, KPC-3, IMP-4 and CTX-M15) or Fok ⁇ site (for VIM-1 ) to create 5'-ACCG four base protruding 5' end.
  • Bsa ⁇ site for NDM-1 , OXA-48, SHV-18, KPC-3, IMP-4 and CTX-M15
  • Fok ⁇ site for VIM-1
  • the digested amplicons are ready to ligate using T4 ligase between the Ssp ⁇ and Bsa ⁇ sites on the plasmid pBR322 (purchased from New England Biolabs), after removal of the TEM-3 fragment.
  • Ssp ⁇ creates a blunt end
  • Bsa ⁇ creates a 5'-CGGT protruding end.
  • the reverse complement of the coding sequences of the each amplicons after restriction digestion are shown below.
  • the 5' protruding end is underlined and 3' end of the promotor sequence is in bold small letters.
  • NDM-1 (SEQ ID NO: 166)
  • OXA-48 (SEQ ID NO: 167)
  • VIM-1 (SEQ ID NO: 169) ACCGCTACTCGGCGACTGAGCGATTTTTGTGTGCTTTGACAACGTTCGCTGTGTGCTGGAGCAAGTC TAGACCGCCCGGTAGACCGTGCCCGGGAATGACGACCTCTGCTTCCGGGTAGTGTTTTTGAATCCGC TCAACGGAGGTGGGCCATTCAGCCAGATCGGCATCGGCCACGTTCCCCGCAGACGTGCTTGACAACT CATGAACGGCACAACCACCGTATAGCACGTTCGCTGACGGGACGTATACAACCAGATTGTCGGTCGA ATGCGCAGCACCAGGATAGAAGAGCTCTACTGGACCGAAGCGCACTGCGTCCCCGCTCGATGAGT CCTTCTAGAGAATGCGTGGGAATCTCGTTCCCCTCTGCCTCGGCTAGCCGGCGTGTCGACGGTGATG CGTACGTTGCCACCCCAGCCGCCCGAAGGACATCAACGCCGCCGACGCGGTCGTCATGAAAGTGCGT GGAGACTGCACGCGTTACGGGA
  • CTX-M-15 (SEQ ID NO: 172)
  • Plasmid DNA samples are isolated from these transformants and submitted to DNA sequence analysis to confirm that the correct sequence for each of the seven different beta lactamases genes is present in each construct giving the plasmids:
  • Nemesis symbiotic activity (NSA) assay by plasmid conjugation to test activity of constructs carrying multiple spacers targeting beta lactamase gene families
  • the plasmid conjugation assay described in Example 2 may also be used to test the Nemesis symbiotic activity of the new CRISPR/Cas9 plasmid constructs carrying spacer sequences targeting multiple families of beta lactamase genes.
  • the assay involves mating a donor cell carrying the beta lactamase gene on a conjugative plasmid, and hence ampicillin resistant, with a recipient cell carrying the Nemesis symbiotic on a non- mobilisable plasmid encoding chloramphenicol resistance. Exconjugants are selected on LB plates containing both 100 ⁇ g/ml_ ampicillin and 35 ⁇ g/mL chloramphenicol. Successful Nemesis symbiotic activity is seen in a reduction in the efficiency of transfer of the ampicillin resistance gene.
  • Example 2 As donors, the same strain used in Example 2 was used. This strain, JA200 (F+ thr-1 , leu- 6, DE(trpE)5, recA, lacY, thi, gal, xyl, ara, mtl), also carries plasmid pNT3 as described by Saka et al. (DNA Research 12, 63-68, 2005).
  • the plasmid pNT3 is a mobilisable plasmid carrying the TEM-1 beta lactamase gene of Tn1 . Conjugation of pNT3 and hence transfer of ampicillin resistance is effected by the transfer functions of the co-resident F+ plasmid.
  • the other potential donors are the set of E. coli and K. pneumoniae strains carrying representative genes from these seven different families of beta-lactam antibiotics that were purchased from Culture Collections, Public Health England, as described above. These strains need to be chloramphenicol sensitive in order to allow selection for exconjugants and were tested for growth on LB chloramphenicol 35 ⁇ g/mL plates.
  • NCTC13368 a K. pneumoniae strain carrying the SHV-18 gene
  • NCTC13438 a K.
  • NCTC13476 an E. coli strain carrying an uncharacterised IMP gene
  • NCTC13443 a K. pneumoniae strain carrying the NDM-1 gene
  • NCTC13442 a K. pneumoniae strain carrying the OXA-48 gene were all found to be resistant to chloramphenicol, but NCTC13353, an E. coli strain carrying the CTX-M-15 gene, and NCTC13440, a K. pneumoniae strain carrying the VIM-1 gene, were found to be chloramphenicol sensitive and were taken forward to be tested in matings with the recipients.
  • the strains used in Example 2 serve as controls for testing the new plasmid constructs.
  • the negative control is DH5a (F- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG 08OdlacZAM15 A(lacZYA-argF)U169, hsdR17(rK- mK+), ⁇ with the plasmid pNB100 encoding the CRISPR/Cas9 cassette but no spacer sequence targeting any antibiotic resistance gene; and the positive control is DH5a with the plasmid pNB102 encoding the CRISPR/Cas9 cassette as well as the spacer sequence targeting the TEM beta-lactamase family.
  • DH5a strains with the plasmids pNB104A, pNB104B and pNB108. These plasmids also encode the CRISPR/Cas9 cassette in addition to the spacer sequences, all driven off one promotor in the following order, proximal to distal from the promotor (pNB104A): NDM-IMP-VIM-KPC; (pNB104B): OXA- 48-SHV-TEM-CTX-M (pNB108): NDM-IMP-VIM-KPC-OXA-48-SHV-TEM-CTX-M. To set up the matings, colonies of donors were picked from LB Ap100 (ampicillin
  • Figure 30A shows the results from mating the donor carrying the TEM-1 beta lactamase (JA200 (F+ thr-1 , leu-6, DE(trpE)5, recA, lacY, thi, gal, xyl, ara, mtl)), and designated (5) in the figure, with the recipients DH5a pNB100, designated (-), DH5a pNB102, designated (+).
  • a loopful of each mating mixture was resuspended in 220 ⁇ of LB and 200 ⁇ of the cells were plated on LB Ap100Cm35 plates to select for exconjugants.
  • the cross between the donor of TEM-1 and the recipient with pNB100 gives efficient mating and a lawn of cells (Fig.
  • FIG. 30A, top left, 5-), and mating the donor of TEM-1 with the recipient with pNB102 encoding the single TEM spacer shows strong inhibition of transfer of the TEM-1 gene (see Fig. 30A, 5+, top right, where only a few isolated colonies are seen).
  • the mating of the donor carrying the TEM-1 gene with the recipient carrying pNB104 also shows strong inhibition of transfer of the TEM-1 gene and demonstrates that in the pNB104B construct, carrying the four spacers OXA-48-SHV-TEM-CTX-M 4, the TEM spacer is active.
  • Figure 30B shows the results from mating the strain NCTC13440, a K.
  • plate top right, 2/8, 4/8 and 5/8 gives strong inhibition of transfer of ampicillin resistance gene.
  • the bottom plate with 5+ shows strong inhibition of transfer of TEM-1 ampicillin resistance gene to the recipient carrying pNB102.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Communicable Diseases (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Mycology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicinal Preparation (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
PCT/GB2015/051132 2014-04-14 2015-04-14 Therapeutic Ceased WO2015159068A1 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
CN201580030368.5A CN106536739B (zh) 2014-04-14 2015-04-14 治疗剂
AU2015248621A AU2015248621B2 (en) 2014-04-14 2015-04-14 Therapeutic
EP15718982.0A EP3132034B1 (en) 2014-04-14 2015-04-14 Therapeutic
PL15718982T PL3132034T3 (pl) 2014-04-14 2015-04-14 Środek terapeutyczny
JP2016563122A JP6849435B2 (ja) 2014-04-14 2015-04-14 治療薬
CA2945573A CA2945573A1 (en) 2014-04-14 2015-04-14 Crispr systems for antibiotic-resistant microorganisms
ES15718982T ES2827279T3 (es) 2014-04-14 2015-04-14 Terapéutico
DK15718982.0T DK3132034T3 (da) 2014-04-14 2015-04-14 Terapeutikum
US15/303,925 US20170037414A1 (en) 2014-04-14 2015-04-14 Therapeutic
EP20190714.4A EP3766971A1 (en) 2014-04-14 2015-04-14 Therapeutic
SI201531414T SI3132034T1 (sl) 2014-04-14 2015-04-14 Zdravstveni pripomočki
US16/057,897 US20180362990A1 (en) 2014-04-14 2018-08-08 Therapeutic
AU2020277257A AU2020277257A1 (en) 2014-04-14 2020-11-27 Therapeutic

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
GB1406674.0 2014-04-14
GBGB1406674.0A GB201406674D0 (en) 2014-04-14 2014-04-14 Therapeutic
GB1413719.4 2014-08-01
GB201413719A GB201413719D0 (en) 2014-08-01 2014-08-01 Therapeutic
GB201418508A GB201418508D0 (en) 2014-10-17 2014-10-17 Therapeutic
GB1418508.6 2014-10-17

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/303,925 A-371-Of-International US20170037414A1 (en) 2014-04-14 2015-04-14 Therapeutic
US16/057,897 Division US20180362990A1 (en) 2014-04-14 2018-08-08 Therapeutic

Publications (1)

Publication Number Publication Date
WO2015159068A1 true WO2015159068A1 (en) 2015-10-22

Family

ID=53008804

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2015/051132 Ceased WO2015159068A1 (en) 2014-04-14 2015-04-14 Therapeutic

Country Status (13)

Country Link
US (2) US20170037414A1 (https=)
EP (2) EP3132034B1 (https=)
JP (2) JP6849435B2 (https=)
CN (1) CN106536739B (https=)
AU (2) AU2015248621B2 (https=)
CA (1) CA2945573A1 (https=)
DK (1) DK3132034T3 (https=)
ES (1) ES2827279T3 (https=)
HU (1) HUE051354T2 (https=)
PL (1) PL3132034T3 (https=)
PT (1) PT3132034T (https=)
SI (1) SI3132034T1 (https=)
WO (1) WO2015159068A1 (https=)

Cited By (57)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105463003A (zh) * 2015-12-11 2016-04-06 扬州大学 一种消除卡那霉素耐药基因活性的重组载体及其构建方法
US9340800B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College Extended DNA-sensing GRNAS
US9388430B2 (en) 2013-09-06 2016-07-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
WO2017112620A1 (en) * 2015-12-22 2017-06-29 North Carolina State University Methods and compositions for delivery of crispr based antimicrobials
US9701964B2 (en) 2015-05-06 2017-07-11 Snipr Technologies Limited Altering microbial populations and modifying microbiota
EP3219799A1 (en) 2016-03-17 2017-09-20 IMBA-Institut für Molekulare Biotechnologie GmbH Conditional crispr sgrna expression
WO2017197206A1 (en) * 2016-05-11 2017-11-16 The Regents Of The University Of Colorado, A Body Corporate Compositions and methods for altering bacterial fitness
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
WO2018205995A1 (en) * 2017-05-11 2018-11-15 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Creation of herbicide resistant gene and use thereof
US10136649B2 (en) 2015-05-29 2018-11-27 North Carolina State University Methods for screening bacteria, archaea, algae, and yeast using CRISPR nucleic acids
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10195273B2 (en) 2016-06-05 2019-02-05 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10450584B2 (en) 2014-08-28 2019-10-22 North Carolina State University Cas9 proteins and guiding features for DNA targeting and genome editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10711267B2 (en) 2018-10-01 2020-07-14 North Carolina State University Recombinant type I CRISPR-Cas system
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10760075B2 (en) 2018-04-30 2020-09-01 Snipr Biome Aps Treating and preventing microbial infections
US10787654B2 (en) 2014-01-24 2020-09-29 North Carolina State University Methods and compositions for sequence guiding Cas9 targeting
US20210205380A1 (en) * 2018-05-22 2021-07-08 Jichi Medical University Antibacterial phage, therapeutic composition, bactericidal agent, food, bacteria identification kit, therapeutic composition manufacturing method, bacteria elimination method, bacteria identification method, and animal therapeutic method
US11155823B2 (en) 2015-06-15 2021-10-26 North Carolina State University Methods and compositions for efficient delivery of nucleic acids and RNA-based antimicrobials
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11286480B2 (en) 2015-09-28 2022-03-29 North Carolina State University Methods and compositions for sequence specific antimicrobials
EP3817556A4 (en) * 2018-05-25 2022-03-30 Locus Biosciences, Inc. METHODS AND COMPOSITIONS FOR KILLING A TARGET BACTERIA
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11439712B2 (en) 2014-04-08 2022-09-13 North Carolina State University Methods and compositions for RNA-directed repression of transcription using CRISPR-associated genes
US20220290213A1 (en) * 2021-02-11 2022-09-15 Brigham Young University Composition, method, and system for a rapid, real-time pentaplex pcr assay for major beta-lactamase genes
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11466271B2 (en) 2017-02-06 2022-10-11 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11578333B2 (en) 2018-10-14 2023-02-14 Snipr Biome Aps Single-vector type I vectors
AU2019341000B2 (en) * 2018-09-12 2023-03-16 Institute For Basic Science Composition for inducing death of cells having mutated gene, and method for inducing death of cells having modified gene by using composition
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12076375B2 (en) 2022-06-29 2024-09-03 Snipr Biome Aps Treating and preventing E coli infections
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12203123B2 (en) 2018-10-01 2025-01-21 North Carolina State University Recombinant type I CRISPR-Cas system and uses thereof for screening for variant cells
US12264313B2 (en) 2018-10-01 2025-04-01 North Carolina State University Recombinant type I CRISPR-Cas system and uses thereof for genome modification and alteration of expression
US12264330B2 (en) 2018-10-01 2025-04-01 North Carolina State University Recombinant type I CRISPR-Cas system and uses thereof for killing target cells
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111052248B (zh) * 2017-09-05 2024-04-02 自适应噬菌体治疗公司 细菌菌株对治疗组合物的敏感性谱的确定方法
CA3099316A1 (en) * 2018-05-04 2019-11-07 Locus Biosciences, Inc. Methods and compositions for killing a target bacterium
CN111378660B (zh) * 2020-02-29 2021-08-06 浙江大学 一种靶向四环素抗性基因tetA的sgRNA及其敲除载体、载体构建方法和应用
WO2021231689A1 (en) * 2020-05-14 2021-11-18 Chan Zuckerberg Biohub, Inc. Phage-mediated delivery of genes to gut microbiome
CA3187281A1 (en) * 2020-06-15 2021-12-23 Laboratory Corporation Of America Holdings Methods for the diagnosis and treatment of biofilm-related infections
CN114540389B (zh) * 2020-11-26 2024-05-14 深圳华大生命科学研究院 一种制备基因工程病毒的方法及其应用
CN118421634A (zh) * 2024-07-02 2024-08-02 广州明迅生物科技有限责任公司 一种用于切割基因的sgRNA序列、表达载体、及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010075424A2 (en) * 2008-12-22 2010-07-01 The Regents Of University Of California Compositions and methods for downregulating prokaryotic genes

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK2341149T3 (en) * 2005-08-26 2017-02-27 Dupont Nutrition Biosci Aps Use of CRISPR-associated genes (Cas)
WO2012164565A1 (en) 2011-06-01 2012-12-06 Yeda Research And Development Co. Ltd. Compositions and methods for downregulating prokaryotic genes
EP2840140B2 (en) * 2012-12-12 2023-02-22 The Broad Institute, Inc. Crispr-Cas based method for mutation of prokaryotic cells
US10660943B2 (en) 2013-02-07 2020-05-26 The Rockefeller University Sequence specific antimicrobials
EP4074330A1 (en) * 2013-09-05 2022-10-19 Massachusetts Institute of Technology Tuning microbial populations with programmable nucleases
US9322037B2 (en) * 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
CN106459995B (zh) * 2013-11-07 2020-02-21 爱迪塔斯医药有限公司 使用统治型gRNA的CRISPR相关方法和组合物

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010075424A2 (en) * 2008-12-22 2010-07-01 The Regents Of University Of California Compositions and methods for downregulating prokaryotic genes

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BIKARD DAVID ET AL: "Exploiting CRISPR-Cas nucleases to produce sequence-specific antimicrobials", NATURE BIOTECHNOLOGY, vol. 32, no. 11, November 2014 (2014-11-01), pages 1146 - 1150, XP002742966 *
CITORIK ROBERT J ET AL: "Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases", NATURE BIOTECHNOLOGY, vol. 32, no. 11, 1 November 2014 (2014-11-01), pages 1141 - 1145+2PP, XP002742964 *
HUANG: "E. curi: A way of deactivating antibiotic resistance genes in E. coli", 1 April 2012 (2012-04-01), XP002742963, Retrieved from the Internet <URL:http://uscusj.weebly.com/uploads/4/9/5/1/4951238/jonathan__usj__v3.pdf> [retrieved on 20150803] *
YOSEF IDO ET AL: "Temperate and lytic bacteriophages programmed to sensitize and kill antibiotic-resistant bacteria.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 112, no. 23, 9 June 2015 (2015-06-09), pages 7267 - 7272, XP002742965, ISSN: 1091-6490 *

Cited By (157)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US12473573B2 (en) 2013-09-06 2025-11-18 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US9340800B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College Extended DNA-sensing GRNAS
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US12559737B2 (en) 2013-09-06 2026-02-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
US12584118B2 (en) 2013-09-06 2026-03-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US9388430B2 (en) 2013-09-06 2016-07-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US10190137B2 (en) 2013-11-07 2019-01-29 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US11390887B2 (en) 2013-11-07 2022-07-19 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10640788B2 (en) 2013-11-07 2020-05-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAs
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US12215365B2 (en) 2013-12-12 2025-02-04 President And Fellows Of Harvard College Cas variants for gene editing
US10787654B2 (en) 2014-01-24 2020-09-29 North Carolina State University Methods and compositions for sequence guiding Cas9 targeting
US11439712B2 (en) 2014-04-08 2022-09-13 North Carolina State University Methods and compositions for RNA-directed repression of transcription using CRISPR-associated genes
US12398406B2 (en) 2014-07-30 2025-08-26 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10450584B2 (en) 2014-08-28 2019-10-22 North Carolina State University Cas9 proteins and guiding features for DNA targeting and genome editing
US11753651B2 (en) 2014-08-28 2023-09-12 North Carolina State University Cas9 proteins and guiding features for DNA targeting and genome editing
US11400110B2 (en) 2015-05-06 2022-08-02 Snipr Technologies Limited Altering microbial populations and modifying microbiota
EP3563684A1 (en) * 2015-05-06 2019-11-06 Snipr Technologies Limited Altering microbial populations & modifying microbiota
JP2020058369A (ja) * 2015-05-06 2020-04-16 エスエヌアイピーアール・テクノロジーズ・リミテッドSnipr Technologies Limited 微生物集団の改変および微生物相の修飾
US10624349B2 (en) 2015-05-06 2020-04-21 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US12226430B2 (en) 2015-05-06 2025-02-18 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10582712B2 (en) 2015-05-06 2020-03-10 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10561148B2 (en) 2015-05-06 2020-02-18 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US12514867B2 (en) 2015-05-06 2026-01-06 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11612617B2 (en) 2015-05-06 2023-03-28 Snipr Technologies Limited Altering microbial populations and modifying microbiota
JP2018515138A (ja) * 2015-05-06 2018-06-14 エスエヌアイピーアール・テクノロジーズ・リミテッドSnipr Technologies Limited 微生物集団の改変および微生物相の修飾
US12502401B2 (en) 2015-05-06 2025-12-23 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10524477B2 (en) 2015-05-06 2020-01-07 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10506812B2 (en) 2015-05-06 2019-12-17 Snipr Technologies Limited Altering microbial populations and modifying microbiota
EP3291679B1 (en) * 2015-05-06 2021-12-15 SNIPR Technologies Limited Altering microbial populations & modifying microbiota
AU2023202066B2 (en) * 2015-05-06 2024-04-18 Snipr Technologies Limited Altering microbial populations & modifying microbiota
US12514869B2 (en) 2015-05-06 2026-01-06 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11642363B2 (en) 2015-05-06 2023-05-09 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US10463049B2 (en) 2015-05-06 2019-11-05 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11547716B2 (en) 2015-05-06 2023-01-10 Snipr Technologies Limited Altering microbial populations and modifying microbiota
AU2016257306B2 (en) * 2015-05-06 2019-06-27 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US9701964B2 (en) 2015-05-06 2017-07-11 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11844760B2 (en) 2015-05-06 2023-12-19 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11517582B2 (en) 2015-05-06 2022-12-06 Snipr Technologies Limited Altering microbial populations and modifying microbiota
US11147830B2 (en) 2015-05-06 2021-10-19 Snipr Technologies Limited Altering microbial populations and modifying microbiota
AU2019236694B2 (en) * 2015-05-06 2022-02-03 Snipr Technologies Limited Altering microbial populations & modifying microbiota
US11261451B2 (en) 2015-05-29 2022-03-01 North Carolina State University Methods for screening bacteria, archaea, algae, and yeast using CRISPR nucleic acids
US10136649B2 (en) 2015-05-29 2018-11-27 North Carolina State University Methods for screening bacteria, archaea, algae, and yeast using CRISPR nucleic acids
US11155823B2 (en) 2015-06-15 2021-10-26 North Carolina State University Methods and compositions for efficient delivery of nucleic acids and RNA-based antimicrobials
US12606834B2 (en) 2015-06-15 2026-04-21 North Carolina State University Methods and compositions for efficient delivery of nucleic acids and rna-based antimicrobials
US11286480B2 (en) 2015-09-28 2022-03-29 North Carolina State University Methods and compositions for sequence specific antimicrobials
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12344869B2 (en) 2015-10-23 2025-07-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
CN105463003A (zh) * 2015-12-11 2016-04-06 扬州大学 一种消除卡那霉素耐药基因活性的重组载体及其构建方法
US11542466B2 (en) 2015-12-22 2023-01-03 North Carolina State University Methods and compositions for delivery of CRISPR based antimicrobials
WO2017112620A1 (en) * 2015-12-22 2017-06-29 North Carolina State University Methods and compositions for delivery of crispr based antimicrobials
EP3219799A1 (en) 2016-03-17 2017-09-20 IMBA-Institut für Molekulare Biotechnologie GmbH Conditional crispr sgrna expression
WO2017158153A1 (en) 2016-03-17 2017-09-21 Imba - Institut Für Molekulare Biotechnologie Gmbh Conditional crispr sgrna expression
WO2017197206A1 (en) * 2016-05-11 2017-11-16 The Regents Of The University Of Colorado, A Body Corporate Compositions and methods for altering bacterial fitness
US10953090B2 (en) 2016-06-05 2021-03-23 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10195273B2 (en) 2016-06-05 2019-02-05 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10596255B2 (en) 2016-06-05 2020-03-24 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US12318445B2 (en) 2016-06-05 2025-06-03 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11291723B2 (en) 2016-06-05 2022-04-05 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11471531B2 (en) 2016-06-05 2022-10-18 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11471530B2 (en) 2016-06-05 2022-10-18 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11351252B2 (en) 2016-06-05 2022-06-07 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10603379B2 (en) 2016-06-05 2020-03-31 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10765740B2 (en) 2016-06-05 2020-09-08 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US11141481B2 (en) 2016-06-05 2021-10-12 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10300139B2 (en) 2016-06-05 2019-05-28 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10363308B2 (en) 2016-06-05 2019-07-30 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10300138B2 (en) 2016-06-05 2019-05-28 Snipr Technologies Limited Selectively altering microbiota for immune modulation
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11466271B2 (en) 2017-02-06 2022-10-11 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
US12559748B2 (en) 2017-02-06 2026-02-24 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12516308B2 (en) 2017-03-09 2026-01-06 President And Fellows Of Harvard College Suppression of pain by gene editing
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US12435331B2 (en) 2017-03-10 2025-10-07 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US12195741B2 (en) 2017-05-11 2025-01-14 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Creation of herbicide resistant gene and use thereof
US11345924B2 (en) 2017-05-11 2022-05-31 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Creation of herbicide resistant gene and use thereof
WO2018205995A1 (en) * 2017-05-11 2018-11-15 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Creation of herbicide resistant gene and use thereof
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US12359218B2 (en) 2017-07-28 2025-07-15 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US10920222B2 (en) 2018-04-30 2021-02-16 Snipr Biome Aps Treating and preventing microbial infections
US11421227B2 (en) 2018-04-30 2022-08-23 Snipr Biome Aps Treating and preventing microbial infections
US11643653B2 (en) 2018-04-30 2023-05-09 Snipr Biome Aps Treating and preventing microbial infections
US12448619B2 (en) 2018-04-30 2025-10-21 Snipr Biome Aps Treating and preventing microbial infections
US10760075B2 (en) 2018-04-30 2020-09-01 Snipr Biome Aps Treating and preventing microbial infections
US11788085B2 (en) 2018-04-30 2023-10-17 Snipr Biome Aps Treating and preventing microbial infections
US11485973B2 (en) 2018-04-30 2022-11-01 Snipr Biome Aps Treating and preventing microbial infections
US20210205380A1 (en) * 2018-05-22 2021-07-08 Jichi Medical University Antibacterial phage, therapeutic composition, bactericidal agent, food, bacteria identification kit, therapeutic composition manufacturing method, bacteria elimination method, bacteria identification method, and animal therapeutic method
US12502413B2 (en) * 2018-05-22 2025-12-23 Jichi Medical University Antibacterial phage, therapeutic composition, bactericidal agent, food, bacteria identification kit, therapeutic composition manufacturing method, bacteria elimination method, bacteria identification method, and animal therapeutic method
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
EP3817556A4 (en) * 2018-05-25 2022-03-30 Locus Biosciences, Inc. METHODS AND COMPOSITIONS FOR KILLING A TARGET BACTERIA
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof
AU2019341000B2 (en) * 2018-09-12 2023-03-16 Institute For Basic Science Composition for inducing death of cells having mutated gene, and method for inducing death of cells having modified gene by using composition
US11680259B2 (en) 2018-10-01 2023-06-20 North Carolina State University Recombinant type I CRISPR-CAS system
US12264330B2 (en) 2018-10-01 2025-04-01 North Carolina State University Recombinant type I CRISPR-Cas system and uses thereof for killing target cells
US12264313B2 (en) 2018-10-01 2025-04-01 North Carolina State University Recombinant type I CRISPR-Cas system and uses thereof for genome modification and alteration of expression
US10711267B2 (en) 2018-10-01 2020-07-14 North Carolina State University Recombinant type I CRISPR-Cas system
US12203123B2 (en) 2018-10-01 2025-01-21 North Carolina State University Recombinant type I CRISPR-Cas system and uses thereof for screening for variant cells
US11578333B2 (en) 2018-10-14 2023-02-14 Snipr Biome Aps Single-vector type I vectors
US11851663B2 (en) 2018-10-14 2023-12-26 Snipr Biome Aps Single-vector type I vectors
US12404513B2 (en) 2018-10-14 2025-09-02 Snipr Biome Aps Single-vector Type I vectors
US11629350B2 (en) 2018-10-14 2023-04-18 Snipr Biome Aps Single-vector type I vectors
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12509680B2 (en) 2019-03-19 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12281303B2 (en) 2019-03-19 2025-04-22 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12570972B2 (en) 2019-03-19 2026-03-10 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US20220290213A1 (en) * 2021-02-11 2022-09-15 Brigham Young University Composition, method, and system for a rapid, real-time pentaplex pcr assay for major beta-lactamase genes
US12421561B2 (en) * 2021-02-11 2025-09-23 Brigham Young University Composition, method, and system for a rapid, real-time pentaplex PCR assay for major beta-lactamase genes
US12076375B2 (en) 2022-06-29 2024-09-03 Snipr Biome Aps Treating and preventing E coli infections

Also Published As

Publication number Publication date
JP2017513489A (ja) 2017-06-01
PT3132034T (pt) 2020-11-12
CN106536739B (zh) 2021-08-03
AU2015248621A1 (en) 2016-11-17
DK3132034T3 (da) 2020-10-19
EP3132034A1 (en) 2017-02-22
ES2827279T3 (es) 2021-05-20
US20180362990A1 (en) 2018-12-20
US20170037414A1 (en) 2017-02-09
SI3132034T1 (sl) 2020-12-31
AU2015248621B2 (en) 2020-08-27
HUE051354T2 (hu) 2021-03-01
JP6849435B2 (ja) 2021-03-24
CN106536739A (zh) 2017-03-22
EP3132034B1 (en) 2020-08-19
PL3132034T3 (pl) 2021-04-06
AU2020277257A1 (en) 2021-01-07
EP3766971A1 (en) 2021-01-20
JP2021013383A (ja) 2021-02-12
CA2945573A1 (en) 2015-10-22

Similar Documents

Publication Publication Date Title
AU2015248621B2 (en) Therapeutic
AU2016308591B2 (en) Delivery vehicle
CN107208070B (zh) 细菌基因的靶向消除
EP3322797B1 (en) Improving sequence-specific antimicrobials by blocking dna repair
Grohmann et al. Conjugative plasmid transfer in gram-positive bacteria
EP3630979A2 (en) Genetic systems that defend against foreign dna and uses thereof
KR20160050069A (ko) Cas9 변이체 및 그의 용도
US20190330643A1 (en) Engineering of bacteriophages by genome editing using the crispr-cas9 system
KR102876612B1 (ko) 하나 이상의 비-고유 꼬리 섬유를 가지는 비-복제성 형질도입 입자 및 형질도입 입자-기반 리포터 시스템
Tamaki et al. Application of the SpCas9 inhibitor BRD0539 for CRISPR/Cas9-based genetic tools in Lacticaseibacillus paracasei
WO2019152941A1 (en) Engineered gut microbes for reduction of reactivation of detoxified drugs
US7758854B2 (en) Anti-microbial agents
HK1234437B (en) Therapeutic
HK1234437A1 (en) Therapeutic
JP2023507163A (ja) バクテロイデスにおけるゲノム編集
CN115368449B (zh) 基于pe增加smn蛋白表达的方法及其应用
CN1989255A (zh) 降低细胞中的自发突变率
김혜준 Development of the Cas9-gRNA ribonucleoprotein-meditated editing for inactivation of hemolysin gene in Lactiplantibacillus plantarum
Bohaychuk Heterologous expression of brochocin-C in Carnobacterium spp.
Jahanshahi DEVELOPMENT OF DNA CONSTRUCTS, BACTERIAL STRAINS AND METHODOLOGIES TO CHARACTERIZE THE IBS/SIB FAMILY OF TYPE I TOXIN-ANTITOXINS IN ESCHERICHIA COLI
Whittle Isolation and characterisation of four novel bacteriophages infecting clinically relevant PCR ribotypes of Clostridium difficile
Lertworapreecha CRISPR/Cas9 System Targeting blaSHV-18 Gene Terminate the Extended Spectrum Beta-Lactamase (ESBL) Activity and Reversed of Antibiotic Resistant Phenotype in Klebsiella quasipneumoniae

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15718982

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2945573

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2016563122

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15303925

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2015718982

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2015718982

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2015248621

Country of ref document: AU

Date of ref document: 20150414

Kind code of ref document: A