WO2015063452A2 - Cell transport - Google Patents

Cell transport Download PDF

Info

Publication number
WO2015063452A2
WO2015063452A2 PCT/GB2014/053037 GB2014053037W WO2015063452A2 WO 2015063452 A2 WO2015063452 A2 WO 2015063452A2 GB 2014053037 W GB2014053037 W GB 2014053037W WO 2015063452 A2 WO2015063452 A2 WO 2015063452A2
Authority
WO
WIPO (PCT)
Prior art keywords
cpp
agent
therapeutic
molecule
peptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2014/053037
Other languages
English (en)
French (fr)
Other versions
WO2015063452A3 (en
Inventor
William Jonathan RYVES
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CUPID PEPTIDE Co Ltd
Original Assignee
CUPID PEPTIDE Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CUPID PEPTIDE Co Ltd filed Critical CUPID PEPTIDE Co Ltd
Priority to JP2016549646A priority Critical patent/JP6576355B2/ja
Priority to EP14784358.5A priority patent/EP3062822B1/en
Priority to US15/032,668 priority patent/US9913914B2/en
Priority to CA2928773A priority patent/CA2928773A1/en
Publication of WO2015063452A2 publication Critical patent/WO2015063452A2/en
Publication of WO2015063452A3 publication Critical patent/WO2015063452A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/08Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22

Definitions

  • the invention relates to novel polypeptides for transporting molecules across cell membranes and, particularly but not exclusively, biological membranes; a conjugate comprising at least one of said polypeptides and at least one selected molecule or agent co-joined or conjugated to said polypeptide for the purpose of transporting said molecule or agent across a cell membrane; a method of transporting at least one selected molecule or agent across a cell membrane involving the use of at least one of said polypeptides; a therapeutic comprising at least one of said conjugates; a combination therapeutic comprising at least one of said conjugates and at least one further therapeutic agent; a method of treatment involving the use of at least one of said conjugates or said therapeutics.
  • the cell membrane or plasma membrane surrounds the cytoplasm of living cells, physically separating the intracellular components from the extracellular environment.
  • the cell membrane is selectively permeable to ions and organic molecules and controls the movement of substances in and out of the cell.
  • This membrane serves to separate a cell from its surrounding thereby protecting it from changes in the chemical and physical environment, and also permitting regulation of the entry/exit of molecules into and out of the cell. It is made mostly from a bilayer (double layer) of phospholipid molecules, only very few molecules can pass directly through the lipid bilayer to get from one side of the membrane to the other. Embedded within this membrane are a variety of protein molecules that act as channels and pumps for moving vital molecules into and out of the cell.
  • the cell is selective permeable, able to regulate what enters and exits the cell, thus facilitating the transport of materials needed for survival. Whilst vital biologically, these membranes often pose a difficulty for the delivery of many therapeutics whose efficacy depends upon such molecules being able to travel through the aqueous environment in the body and subsequently across the hydrophobic barrier of cellular membranes.
  • CPPs Cell-permeable or Cell-Penetrating peptides
  • CPPs also known as a protein transduction domain or membrane translocation sequence
  • CPPs can traverse the membranes of a cell and access the cell interior, for this reason they have been exploited in a range of living systems to internalize molecules (generically termed 'cargo').
  • the function of the CPPs is typically to deliver cargo into cells, a process that commonly occurs through endocytosis with the cargo being delivered via the endosomes of living mammalian cells.
  • Coupling of CPPs to proteins, oligonucleotides, peptide nucleic acids, and other pharmacologically active compounds thus provides a promising strategy for cellular delivery of otherwise membrane-impermeable molecules.
  • CPPs Common applications include the delivery of nucleic acid-based macromolecules such as siRNA, antisense oligonucleotide, DNA, and plasmids; all have been realized as promising biological and pharmacological therapeutics in the regulation of gene expression. Recently, it has been reported, using several methods, that CPPs can be used as vehicles to deliver biologically active, full-length proteins, such as horseradish peroxidase, RNase A and even CPP-crosslinked Fab fragments, into living cells.
  • nucleic acid-based macromolecules such as siRNA, antisense oligonucleotide, DNA, and plasmids
  • CPPs are generally classified into three groups, but all share the ability to translocate the plasma membrane and facilitate the delivery of various molecular cargoes to the cytoplasm or even to an organelle: i. short sequences of amino acids with a high density of basic (+) charge, commonly a string of Lysine or Arginine residues e.g. octarginine;
  • TAT trans-activating transcriptional activator
  • CPPs may be classified based upon their peptide sequences and binding properties to lipids: primary amphipathic; secondary amphipathic; and non-amphipathic CPPs.
  • CPPs the ability of CPPs to translocate a membrane is an on-going area of research. It is thought that the mechanism of action and can vary from one CPP to the next, with some CPPs employing more than one mechanism. Generally, it is thought CPPs enter via: 1 ) direct penetration of the membrane; 2) endocytosis-mediated entry; or 3) translocation through the formation of a transitory structure.
  • Direct penetration has recently been proposed to involve strong interactions between cell-penetrating peptides and the phosphate groups on both sides of the lipid bilayer, the insertion of charged side-chains that nucleate the formation of a transient pore, followed by the translocation of cell-penetrating peptides by diffusing on the pore surface.
  • Endocytosis is the process of cellular ingestion by which the plasma membrane folds inward to bring substances into the cell, but is largely thought to be energy dependent.
  • the third class of CPPs have the property of being internalized by cells through a mechanism that is independent of classic endocytosis. Although the physics of this mechanism is more poorly understood, unlike the other classes, peptides of class 3 can transverse membranes and require no biological surface receptor or cell-derived ATP energy to do so.
  • an example of this class 3 includes the synthetically derived PenetratinTM, a 16 amino acid peptide derived from the DNA binding domain of the Antennapedia homeoprotein, which is one of the most commonly used CPPs.
  • Antennapedia peptide sequence (pAnt) is found within the genome of creatures as diverse as Man, Mouse, Fly and the simple earth worm, there is no Antennapedia sequence in the genome of the eukaryotic Dictyostelium amoeba.
  • CUPID A and CUPID B in reference to their origin (Cellular Permeating peptides In Dictyostelium).
  • CUPID A and CUPID B Cellular Permeating peptides In Dictyostelium.
  • these CUPID peptides have been shown to result in superior transport of cargo into cells when compared to other tested CPPs, such as the commonly used PenetratinTM, and therefore the CUPID peptides offer improved transport performance for the intracellular delivery of otherwise cell impermeable molecules.
  • a cell penetrating peptide for transporting a selected molecule or agent across a cellular membrane comprising a peptide having an amino acid sequence selected from the group comprising:
  • iii a sequence at least 75% homologous to peptide i) or ii).
  • Reference herein to a CPP refers to a short peptide sequence, typically less than 30 amino acids, that possesses the ability to translocate the plasma membrane when co-joined with at least one selected molecule, whereby the delivery of said molecule inside a cell or an organelle is facilitated.
  • Reference herein to a cellular membrane or cell membrane includes reference to a biological membrane or an artificial or synthetic membrane based upon, or having, the same or similar properties to a biological membrane (plasma membrane and all intracellular membranes) of Eukaryotic or Prokaryotic origin and so includes reference to artificial or manmade organisms.
  • said cellular membrane is a biological membrane.
  • Reference herein to a biological membrane is to a naturally occurring or living membrane, as opposed to an artificial or synthetic membrane.
  • reference herein to selected molecule or agent refers to any cargo that can be co-joined or conjugated to the CPP for the purpose of being transported into a cell or organelle, such as but not limited to, small molecules, proteins and supramolecular particles including peptides, proteins, plasmid DNA, nucleic acid sequences including siRNA and antisense oligonucleotides, chemical entities, therapeutic drugs, antibodies, organic dyes, fluorescent labels, or contrast agents such as quantum dots or nanospheres.
  • said biological membrane may be the membrane surrounding a cell.
  • This may include, but is not limited to, membranes such as the simple plasma membrane or more specialized membrane structures including apical, basolateral, presynaptic and postsynaptic membranes, membranes of flagella, cilia, microvillus, filopodia and lamellipodia, the sarcolemma of muscle cells, as well as specialized myelin and dendritic spine membranes of neurons. Additionally, or alternatively, said membrane may be that of an organelle located within the cell, permitting delivery of selected agents to a specific internal cellular compartment.
  • organelles such as, but not limited to, endosome; smooth and rough endoplasmic reticulum; sarcoplasmic reticulum; Golgi apparatus; lysosome; mitochondrion (inner and outer membranes); nucleus (inner and outer membranes); peroxisome; vacuole; cytoplasmic granules; cell vesicles (phagosome, autophagosome, clathrin- coated vesicles, COPI-coated and COPII-coated vesicles) and secretory vesicles.
  • organelles such as, but not limited to, endosome; smooth and rough endoplasmic reticulum; sarcoplasmic reticulum; Golgi apparatus; lysosome; mitochondrion (inner and outer membranes); nucleus (inner and outer membranes); peroxisome; vacuole; cytoplasmic granules; cell vesicles (phagosome,
  • said biological membrane includes reference to any membrane of Eukaryotic or Prokaryotic origin.
  • CPPs which include one or more additions, deletions, substitutions or the like are encompassed by the present invention.
  • homologous refers to amino acid sequences which have a sequence at least 75% homology or identity to/with the amino acid sequence of RRVQIWFQNKRAKVKR or RSVQIWFQNRRAKAR and which retain the biological activity or membrane transport function of RRVQIWFQNKRAKVKR or RSVQIWFQNRRAKAR.
  • homologues are at least 75% homologous to the peptide sequence of i) or ii) and, in increasing order of preference, at least 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94% 95%, 96%, 97%, 98% or 99% homologous to RRVQIWFQNKRAKVKR or RSVQIWFQNRRAKAR.
  • said CPP comprises, or consists of, the sequence RRVQIWFQNKRAKVKR or RSVQIWFQNRRAKAR.
  • a conjugate comprising at least one of said CPPs and at least one selected molecule or agent that is covalently or non-covalently attached to or associated with said CPPs for the purpose of transporting said selected molecule or agent across a membrane, typically, but not exclusively, a biological membrane.
  • said selected agent may be attached to said CPP by numerous means as known to those skilled in the art, such as but not limited to, covalent or non-covalent linkage.
  • said cargo will be added to said CPP by in vivo or in vitro recombination.
  • said selected agent will be conjugated to said CPP molecule at either its amino or carboxy terminal.
  • said selected molecule or agent is conjugated immediately next to or to the amino acid residues of said CPP.
  • said selected molecule or agent is located distally from the amino acid residues of said CPP due to the presence of at least one further amino acid residue or a spacer preferably represented by a number of amino acid residues selected from the group comprising 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, and 20 amino acid residues.
  • this may improve permeability of the selected agent, however, other spacers that can perform this function to equal effect may be used in the working of the invention.
  • a method of transporting at least one selected molecule or agent across a cellular membrane comprising the use of at least one of said CPPs covalently or non-covalently associated with at least one molecule or agent to be transported across said membrane.
  • a therapeutic comprising at least one CPP in accordance with the invention, covalently or non-covalently associated with a selected molecule or agent wherein said molecule or agent is a therapeutic.
  • said therapeutic may be a small molecule chemical inhibitor or activator, a protein, a supramolecular particle including a peptide, a plasmid DNA, a nucleic acid sequence including siRNA and an antisense oligonucleotide, a chemical entity, a therapeutic drug, or an antibody.
  • This therefore encompasses the delivery of agents intracellularly to exert their therapeutic action inside the cytoplasm or individual organelles such as, for example, the nuclei for gene therapy to achieve expression of a deficient or incorrectly expressed gene product, delivery of deficient lysosomal enzymes in lysosomes for disease therapy, and proapoptotic anticancer drugs in mitochondria for cancer therapy.
  • a combination therapeutic comprising at least one CPP covalently or non-covalently associated with a therapeutic agent and one further therapeutic agent.
  • other active materials may also be present, as may be considered appropriate or advisable for the disease or condition being treated or prevented.
  • the combination therapeutic may also contain an antibiotic or antibacterial agent.
  • said combination therapeutic comprises a plurality of CPPs in accordance with the invention, each one being covalently or non-covalently associated with a therapeutic agent.
  • the said agents are selected to treat the same condition, ideally different aspects or symptoms thereof, but in certain circumstances they may be selected to treat different conditions from which a patient is suffering.
  • the CPPs of the invention can be used in combination with a selection of therapeutics to enable bespoke treatment to take place.
  • the invention provides a method of treatment comprising administering an effective amount of a therapeutic in accordance with the invention, or combination therapeutic in accordance with the invention, to an individual to be treated.
  • a pharmaceutical composition comprising a therapeutic in accordance with the invention, or combination therapeutic in accordance with the invention, together with a pharmaceutically acceptable carrier.
  • the carrier or, if more than one be present, each of the carriers, must be acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient.
  • the formulations include those suitable for oral, rectal, nasal, bronchial (inhaled), topical (including eye drops, buccal and sublingual), vaginal or parenteral (including subcutaneous, intramuscular, intraperitoneal, intravenous and intradermal) administration and may be prepared by any methods well known in the art of pharmacy.
  • compositions for intravenous, parenteral, oral, nasal, bronchial or topical administration.
  • the composition may be prepared by bringing into association the therapeutic of the invention, or combination therapeutic of the invention, and the carrier.
  • the formulations are prepared by uniformly and intimately bringing into association the active agent with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product.
  • the invention extends to methods for preparing a pharmaceutical composition comprising bringing a peptide of the invention in conjunction or association with a pharmaceutically or veterinarily acceptable carrier or vehicle.
  • Formulations for oral administration in the present invention may be presented as: discrete units such as capsules, sachets or tablets each containing a predetermined amount of the active agent; as a powder or granules; as a solution or a suspension of the active agent in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water in oil liquid emulsion; or as a bolus etc.
  • the term "acceptable carrier" includes vehicles such as common excipients e.g.
  • binding agents for example syrup, acacia, gelatin, sorbitol, tragacanth, polyvinylpyrrolidone (Povidone), methylcellulose, ethylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, sucrose and starch; fillers and carriers, for example corn starch, gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride and alginic acid; and lubricants such as magnesium stearate, sodium stearate and other metallic stearates, glycerol stearate stearic acid, silicone fluid, talc waxes, oils and colloidal silica.
  • Flavouring agents such as peppermint, oil of wintergreen, cherry flavouring and the like can also be used. It may be desirable to add a colouring agent to make the dosage form readily identifiable. Tablets may also be coated by methods well known in the art.
  • a tablet may be made by compression or moulding, optionally with one or more accessory ingredients.
  • Compressed tablets may be prepared by compressing in a suitable machine the active agent in a free flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, preservative, surface-active or dispersing agent.
  • Moulded tablets may be made by moulding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
  • the tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active agent.
  • compositions suitable for oral administration include lozenges comprising the active agent in a flavoured base, usually sucrose and acacia or tragacanth; pastilles comprising the active agent in an inert base such as gelatin and glycerin, or sucrose and acacia; and mouthwashes comprising the active agent in a suitable liquid carrier.
  • lozenges comprising the active agent in a flavoured base, usually sucrose and acacia or tragacanth
  • pastilles comprising the active agent in an inert base such as gelatin and glycerin, or sucrose and acacia
  • mouthwashes comprising the active agent in a suitable liquid carrier.
  • compositions may be made up into a cream, ointment, jelly, solution or suspension etc.
  • Cream or ointment formulations that may be used for the drug are conventional formulations well known in the art, for example, as described in standard text books of pharmaceutics such as the British Pharmacopoeia.
  • Parenteral formulations will generally be sterile.
  • nucleic acid molecule encoding the CPP according to the invention.
  • nucleic acid molecule encoding the conjugate or therapeutic according to the invention.
  • a vector comprising said nucleic acid molecule.
  • a method for the production of said CPP, or said conjugate, or said therapeutic comprising culturing a host cell transformed with a nucleic acid molecule encoding said CPP, or said conjugate, or said therapeutic according to the invention under conditions that enable transcription and translation of said CPP and/or conjugate and/or said therapeutic to take place and then harvesting same.
  • Figure 1 Fluorescently labeled peptides (10 ⁇ ) entering cultured cells after 1 hour.
  • A FITC-Cupid A in a Dictyostelium cell
  • B FITC-Cupid B in a Dictyostelium cell
  • C FITC-Cupid B in Human Fibroblast cell
  • D FITC- Cupid B in human kidney cell.
  • Figure 2 Time course of fluorescently labelled peptide (10 micromolar of Cupid A, Cupid B or pANT) accumulation within cultured Dictyostelium cells.
  • FIG. 3 The accumulation of fluorescently labelled Cupid B peptide (10 micromolar) was monitored in cultured Dictyostelium cells (A-C) after 4 min (A), 16 min (B) and 32 min (C). At 32 minutes the culture media was washed out and cell fluorescence monitored (D-E) at 4 min (D), 16 min (E) and 32 min (F) post washing.
  • FIG. 4 SDS PAGE gel of dried peptides prepared. The gel was stained with Coomasie Blue protein stain to visualise bands of Cupid-PKI (A), Cupid B (B) and Molecular Weight Standards (C).
  • FIG. 1 Fluorescently labeled Cupid B-PKI peptide, 10 micromolar, was added to cultured Dictyostelium cells for 1 hour. Cells were then washed and analysed by light (A) and fluorescence (B) microscopy.
  • Cupid can transport small molecule cargo into cells.
  • Starved Dictyostelium cultures were treated with no peptide (A), cupid B peptide (B), PKI peptide (C) and Cupid B-PKI peptide (D) and analysed for aggregation.
  • untreated cultures A or cultures treated with 10 micromolar Cupid B peptide (B) or PKI peptide (C)
  • cells aggregated into tight masses.
  • cultures treated with 10 micromolar Cupid-PKI peptide (D) failed to aggregate.
  • FIG 7. Fluorescently labeled Cupid B-PTEN peptide, 10 micromolar, was added to cultured Dictyostelium cells for 1 hour. Cells were then washed and prepared for fluorescence microscopy. Figure 8. Cupid can transport large molecule cargo into the cell. Starved Dictyosteiium cultures were plated into petri dishes in starvation buffer and visualised after 10 hours. In untreated wild-type (VVT) cultures (A), cells stream together into aggregation centres, co-ordinated by cell to cell signaling. In the PTEN null mutant culture (B), or VVT cultures treated with 10 micromolar Cupid-PTEN peptide (C), cells failed to stream together or aggregate.
  • VVT wild-type
  • FIG. 9 The levels of the 4 inositol phospholipids (PI, PIP, PIP2 and PIP3) in wild-type Dictyosteiium cells undergoing starvation were measured by solvent extraction of cell cultures and analysis using thin layer chromatography. The effect of Cupid B-PTEN peptide treatment (10 micromolar, 1 hour) was calculated as a percentage change in the basal (untreated) levels.
  • FIG. 10 In starving Dictyosteiium cultures, several proteins undergo rapid phosphorylation / dephosphorylation events in response to an applied dose of cyclic AMP. The strength of this response is limited by PTEN enzyme activity. This response is visualised with antibody detection of these phosphoproteins on SDS gels prepared from extracted cultures at the time points indicated after the cAMP dose. Compared with wild-type (VVT) cultures, cultures pretreated for 1 hour with 10 micromolar Cupid-PTEN peptide, cells exhibited a much greater phosphorylation response suggesting a decreased PTEN activity.
  • VVT wild-type
  • Cupid can deliver large cargo into cells that is capable of bioactivity.
  • Purified Cupid-GFP sequence as shown in Table 1
  • the cells were then washed and mounted on a slide using Fluorsave (Merck) and observed by microscopy.
  • the cells were observed under phase contrast (A) and fluorescence microscopy (B). GFP was observed leading to the conclusion that Cupid- Green Fluorescent Protein peptide (Cupid-GFP) permeates into cells, refolds and causes these cells to fluoresce.
  • Cupid-GFP Cupid- Green Fluorescent Protein peptide
  • pBR322 New England Biolabs DNA Vector was cut with EcoRI and Clal DNA restriction enzymes (New England Biolabs). Samples were incubated in Restriction Enzyme buffer from the manufacturer and incubated at 37 °C with EcoRI (1 ⁇ ) and Clal (1 ⁇ ) restriction enzyme leading to a linear DNA molecule (a). This molecule features 'sticky' EcoRI and Clal sites at the ends. Samples were stored on ice or frozen at -20 °C.
  • GAATCCATGCACCATCACCATCACCATAGAAGAGTTCAAATTTGGTTCC AAAATAAACGTGCTAAAGTAAAGAGAATCGAT] was ordered synthesized as 2 complimentary DNA strands (Sigma, UK). It features the EcoRI Restriction Enzyme site (GAATCC), the start codon (ATG), a 6x Histidine (CACCATCACCATCACCAT) the Cupid B sequence (AGAAGAGTTCAAATTTGGTTCCAAAATAAACGTGCTAAAGTAAAGAGA) and the Clal Restriction Enzyme site (ATCGAT).
  • the linear DNA vector (a) was mixed with the Cupid insert (b) and ligated through the 'sticky ends' into a circle with DNA Ligase kit (New England Biolabs). The DNA was cloned into E.Coli bacteria and plated onto LB agar plates supplemented with Ampicillin (100 micrograms per imL). Plasmid DNA was extracted from ampicillin-resistant bacterial colonies and the plasmid sequences were determined (Dundee Sequencing, UK). A clone containing the correct sequence was grown and the Plasmid extracted (Plasmid extraction kit, Qiagen) to provide a source of the finished Cupid B plasmid vector (c).
  • clones were grown on LB agar plates supplemented with Ampicillin (100 micrograms per imL). A single colony was picked and grown in LB medium containing Ampicillin for 8h at 37°C. Cultures were diluted 1 /500 in LB supplemented with Ampicillin and grown overnight at 37°C. Cultures were pelleted by centrifugation, followed by lysis and purification according to manufacturers' instructions (Plasmid extraction kit, Qiagen)
  • Cargo DNA insert was created from Genomic DNA using PCR amplification technique.
  • the primers for this reaction were synthesized and ordered from Sigma, UK.
  • Cupid B vector (c) was cut with Clal and Hindlll DNA restriction enzymes (New England Biolabs). Samples were incubated in Restriction Enzyme buffer from the manufacturer and incubated at 37°C with Hindlll (1 ⁇ ) and Clal (1 ⁇ ) restriction enzyme leading to a linear DNA molecule (d). This molecule features 'sticky' Clal and Hindlll sites at the ends. Samples were stored on ice or frozen at -20 °C.
  • the linear Cupid B vector DNA (d) was mixed with the Cargo insert DNA (e) and ligated through the 'sticky ends' into a circle with DNA Ligase kit (New England Biolabs). The DNA was cloned into E.Coli bacteria and plated onto LB agar plates supplemented with Ampicillin (100 micrograms per imL). Plasmid DNA was extracted from ampicillin-resistant bacterial colonies and the plasmid sequences were determined (Dundee Sequencing, UK). A clone containing the correct sequence was grown and the Plasmid extracted (Plasmid extraction kit, Qiagen) as detailed above to provide the finished Cupid B-Cargo DNA plasmid (f)
  • buffer A 50 mM phosphate buffer, 15 pH 7.5, 400 mM NaCI, 2 mM EDTA, 1 imM PMSF
  • a Poly Histidine amino tail was added to constructs, using conventional techniques, to allow the product to stick to the Ni-NTA His Binding Resin and be separated from contaminants.
  • Bound peptide was washed with buffer A and eluted by applying an Imidazole gradient (0 to 0.5M in buffer A). The eluted peptide (3 mg/L of culture) was dialyzed against 50 imM phosphate buffer, pH 7.5, 150 mM NaCI overnight. For long term storage, peptides were finally dried and stored at -20 C until use.
  • Peptides were labelled with Fluorescein isothiocyanate (FITC) using a FITC labeling kit as per instructions (Pierce, UK). When added to cell cultures the labeled peptides were visualized using a fluorescent microscope by exciting the FITC with a 488nm spectral line, argon-ion laser (Excitation wavelength of 494nm and an Emission wavelength of 518nm).
  • FITC Fluorescein isothiocyanate
  • AX2 wild type Dictyostelium cells were grown on SM agar plates seeded with Aerobacter aerogenes bacteria (also known as Klebsiella aerogenes) as a food source.
  • Aerobacter aerogenes bacteria also known as Klebsiella aerogenes
  • Cupid A (RSVQIWFQNRRAKAR) and Cupid B (RRVQIWFQNKRAKVKR) were chemically synthesized labelled with FITC at the amino terminal.
  • the peptides were added to cultured eukaryotic cells of Dictyostelium discoideum amoeba for varying amounts of time up to 2 hours. Cells were then washed and prepared for examination under a fluorescent microscope ( Figure 1 ). The time courses of permeation were compared to the class 3 CPP, the Antennapedia peptide, pANT which was also labelled with FITC in chemical synthesis ( Figure 2). In other experiments we also found that the permeation capabilities of Cupid peptides extended into all cells tested, including human fibroblasts, human embryonic kidney cells ( Figure 1 ) and chicken neurons (not shown).
  • Cupid A and B as being novel members of the third class of CPP is evidenced by: (i) Ability to enter a variety of living cells; (ii) Capability to exit living cells as well as enter; and (iii) similarity of size and primary structure to the Antennapedia peptide.
  • Cupid can deliver bioactive peptide cargo into living cells
  • Cupid B To examine the ability of Cupid B to be internalized and deliver a bioactive cargo to living cells we have used the Dictyostelium discoideum model system.
  • Dictyostelium Upon starvation Dictyostelium initiates a developmental program leading to the aggregation of free-living amoebae. Genetic research has uncovered the crucial role that cyclic adenosine monophosphate (cAMP) plays in orchestrating as an extracellular chemoattractant in the initial aggregation process through Dictyostelium cAMP-dependent Protein Kinase (DdPKA). DdPKA can be inhibited by PKI, a 20 amino acid peptide sequence derived from an inhibitor of PKA, by PKI binding directly to the catalytic unit of PKA. By creating a Cupid B-PKI fusion protein we aimed to establish that it prevents starving Dictyostelium cells from aggregating in vivo.
  • cAMP cyclic adenosine monophosphate
  • Cupid linked peptides were generated as described, and analysed by gel electrophoresis in the presence of SDS this demonstrated the presence of a major band of molecular weight corresponding to that of the Cupid B or Cupid B-PKI peptide ( Figure 4).
  • Cupid B-PKI fusion peptide is capable of permeating into living cells
  • FITC-Cupid B-PKI to Dictyostelium cells for 1 hour followed by fluorescent microscopy showed that Cupid B-PKI is cell permeable (Figure 5).
  • Cupid B-PKI is effective at entering cells and completely attenuating the PKA-dependent process of Dictyostelium aggregation at a concentration of 10 micromolar (figure 6D).
  • the Cupid B peptide nor the PKI peptide alone have any effect on aggregation ( Figure 6b and c).
  • Cupid can deliver large peptide cargo into cells
  • Cupid B to deliver large peptide cargos into living cells, we demonstrated that the Cargo retains bioactivity of both a biological and biochemical nature.
  • a 167 amino acid region of the PTEN protein to fuse to the Cupid B peptide using the process above.
  • This stretch of amino acids (number 186 - 352 of human PTEN) is known as the C2 region and to be involved in the auto-inhibition of the PTEN enzymatic activity.
  • this large fusion peptide is capable of permeating into living cells, we labelled the peptide fluorescently using a fluorescein peptide labelling kit (Pierce, UK). Addition of 20 micromolar FITC-Cupid B-PTEN to Dictyostelium cells for 1 hour followed by fluorescent microscopy showed that Cupid B-PTEN is cell permeable (Figure 7).
  • Dictyostelium a genetic mutant in which the PTEN gene is absent causes marked changes in phenotype.
  • the PTEN-null mutant strain exhibits a characteristic aggregation behaviour in which the cells try to aggregate but repeatedly fail to do so when viewed under time- lapse photography (figure 8b). If wild-type Dictyostelium cells are given the Cupid B-PTEN peptide under these same circumstances at a 10 micromolar dose, they exhibit the same distinctive behaviour as the PTEN-Null strain ( Figure 8c).
  • the PTEN protein has a phospholipase enzymatic activity that functions to remove phosphate groups from inositol-based lipids and as such is involved with maintaining the balance between varieties of inositol phospholipids present at the cell surface.
  • PIP2 and PIP3 inositol phospholipids with 3 and 4 phosphate groups
  • Cupid B-PTEN peptide was determined the effect of Cupid B-PTEN peptide on the inositol phospholipid levels in Dictyostelium cultures.
  • Cupid B-PTEN peptide treated cells (10 micromolar, 1 hour) alters the basal levels of inositol phospholipids in Dictyostelium cells.
  • the levels of PIP2 and PIP3 rise to +75% and +150% respectively of untreated basal levels, consistent with inhibition of PTEN phopholipase activity (Figure 9).
  • Cupid B-PTEN peptide permeates and inhibits PTEN activity when added to cultures of living cells. This shows that cell-permeant bioactivity of large Cupid B-linked peptides generated by our process is not limited to small cargoes.
  • Cupid peptide can deliver large cargo and does not hinder cargo function
  • Cupid is effective at performing as a cell permeable peptide carrier
  • Aequorea victoria Jellyfish; UniProt Accession Number P42212.
  • GFP Green Fluorescent Protein
  • GFP was added to a cupid peptide as shown in Table 1 .
  • Cupid-GFP was purified to a powder and dissolved in distilled water neither the Cupid- GFP powder or the Cupid-GFP solution (1 millimolar) were fluorescent.
  • Cupid-GFP was added to the cell medium (40 ⁇ for 1 h)
  • the cupid-GFP was found to permeate into the cell and begin to fluoresce when observed under fluorescence microscopy (figure 1 1 ).
  • Cupid-GFP is not fluorescent (as it is incorrectly folded) for it to be detectable as green fluorescence suggests that the Cupid-GFP has permeated the cells where it has been correctly folded by the cellular protein machinery. This supports the role of Cupid as a truly cell permeable peptide and can take large cargo peptides into living cells where they are capable of bioactivity.
  • Cupid novel peptide sequences
  • CPPs cell penetrating peptides

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/GB2014/053037 2013-10-28 2014-10-09 Cell transport Ceased WO2015063452A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2016549646A JP6576355B2 (ja) 2013-10-28 2014-10-09 細胞輸送
EP14784358.5A EP3062822B1 (en) 2013-10-28 2014-10-09 Cell transport
US15/032,668 US9913914B2 (en) 2013-10-28 2014-10-09 Cell transport
CA2928773A CA2928773A1 (en) 2013-10-28 2014-10-09 Cell transport

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1318954.3A GB201318954D0 (en) 2013-10-28 2013-10-28 Cell transport
GB1318954.3 2013-10-28

Publications (2)

Publication Number Publication Date
WO2015063452A2 true WO2015063452A2 (en) 2015-05-07
WO2015063452A3 WO2015063452A3 (en) 2015-09-17

Family

ID=49767211

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2014/053037 Ceased WO2015063452A2 (en) 2013-10-28 2014-10-09 Cell transport

Country Status (6)

Country Link
US (1) US9913914B2 (cg-RX-API-DMAC7.html)
EP (1) EP3062822B1 (cg-RX-API-DMAC7.html)
JP (1) JP6576355B2 (cg-RX-API-DMAC7.html)
CA (1) CA2928773A1 (cg-RX-API-DMAC7.html)
GB (1) GB201318954D0 (cg-RX-API-DMAC7.html)
WO (1) WO2015063452A2 (cg-RX-API-DMAC7.html)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12195768B2 (en) 2018-07-13 2025-01-14 The Trustees Of Princeton University System and method for modulating stress granule assembly

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3652196A4 (en) 2017-07-10 2021-08-18 Brown, Kathlynn, C. MOLECULAR GUIDANCE SYSTEMPEPTIDES AND USES THEREOF

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5523359A (en) * 1995-01-13 1996-06-04 Exxon Chemical Patents Inc. Functionalized polymer and methods to obtain functionalized polymer
GB9814527D0 (en) * 1998-07-03 1998-09-02 Cyclacel Ltd Delivery system
CZ20011671A3 (cs) 1998-11-13 2001-10-17 Cyclacel Limited Peptidová nosná skupina pro transport
US7091026B2 (en) * 2001-02-16 2006-08-15 University Of Iowa Research Foundation Artificial endonuclease
GB0229151D0 (en) * 2002-12-13 2003-01-15 St Georges Entpr Ltd Product and method
WO2005016387A2 (en) * 2003-08-12 2005-02-24 University Of Iowa Research Foundation Dna-dependent mri contrast agents
EP1991560B1 (en) * 2006-02-20 2018-04-04 Ewha University-Industry Collaboration Foundation Peptide having cell membrane penetrating activity
WO2007109908A1 (en) * 2006-03-29 2007-10-04 The University Of British Columbia Therapeutic yb-1 phosphorylation decoys
WO2012023284A1 (en) 2010-08-20 2012-02-23 Oncotherapy Science, Inc. Lhx4 as a target gene for cancer therapy and diagnosis
WO2012170431A2 (en) 2011-06-06 2012-12-13 Bluebird Bio, Inc. Improved geneswitch systems

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12195768B2 (en) 2018-07-13 2025-01-14 The Trustees Of Princeton University System and method for modulating stress granule assembly

Also Published As

Publication number Publication date
WO2015063452A3 (en) 2015-09-17
US20160310607A1 (en) 2016-10-27
JP2016535600A (ja) 2016-11-17
CA2928773A1 (en) 2015-05-07
EP3062822B1 (en) 2025-05-14
JP6576355B2 (ja) 2019-09-18
US9913914B2 (en) 2018-03-13
EP3062822A2 (en) 2016-09-07
GB201318954D0 (en) 2013-12-11
EP3062822C0 (en) 2025-05-14

Similar Documents

Publication Publication Date Title
AU2021200135B2 (en) Liposome compositions and methods of use thereof
Ruczynski et al. Cell-penetrating peptides as a promising tool for delivery of various molecules into the cells
US9969774B2 (en) Cell penetrating peptide and method for delivering biologically active substance using same
JP2014159484A (ja) 細胞透過のための過剰に荷電されたタンパク質
JP2011523353A5 (cg-RX-API-DMAC7.html)
WO2014053629A1 (en) Cell penetrating peptides for intracellular delivery of molecules
EP2916874A1 (en) Nanocomplex containing cationic peptide for biomolecule delivery
Noguchi et al. Macropinocytosis-inducible extracellular vesicles modified with antimicrobial protein CAP18-derived cell-penetrating peptides for efficient intracellular delivery
US20120065126A1 (en) Pharmaceutical Compositions Containing Antifungal Peptides
JP2021533825A (ja) リポソームの調製方法
US20210269504A1 (en) Protein-based micelles for the delivery of hydrophobic active compounds
US9913914B2 (en) Cell transport
CN113966233A (zh) 用于基因编辑的细胞膜穿透缀合物
KR20150130249A (ko) 세포 투과성 펩티드 및 이를 이용한 생물학적 활성 물질의 전달방법
KR101559974B1 (ko) siRNA 전달을 위한 재조합 단백질 및 이를 포함하는 조성물
Song et al. SPA: a peptide antagonist that acts as a cell-penetrating peptide for drug delivery
KR20230086784A (ko) 유전자 발현 변조를 위한 비음이온성 폴리뉴클레오타이드 유사체의 펩타이드 기반 형질도입
US12404307B2 (en) Methods and compositions for use of recombinant bacterial effector proteins as anti-inflammatory agents
WO2021004923A1 (en) Cell penetrating peptides for intracellular delivery of molecules
EP4475889A1 (en) Protein carrier system based on cyanobacterial nano-sized extracellular vesicles
Marchione et al. Study on the internalization mechanism of the ZEBRA cell-penetrating peptide
WO2024075767A1 (ja) ミトコンドリアへの核酸の導入方法
JP2025504832A (ja) CD32aに特異的な結合タンパク質
Marchione Optimization of ZEBRA protein as an innovative delivery system for therapeutic molecules
Gong Engineering cell-penetrating peptides for translocation and intracellular cargo delivery in Candida species

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14784358

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2016549646

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2928773

Country of ref document: CA

REEP Request for entry into the european phase

Ref document number: 2014784358

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014784358

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 15032668

Country of ref document: US

WWG Wipo information: grant in national office

Ref document number: 2014784358

Country of ref document: EP