WO2015060732A1 - Genetic markers and uses therefor - Google Patents

Genetic markers and uses therefor Download PDF

Info

Publication number
WO2015060732A1
WO2015060732A1 PCT/NZ2014/000224 NZ2014000224W WO2015060732A1 WO 2015060732 A1 WO2015060732 A1 WO 2015060732A1 NZ 2014000224 W NZ2014000224 W NZ 2014000224W WO 2015060732 A1 WO2015060732 A1 WO 2015060732A1
Authority
WO
WIPO (PCT)
Prior art keywords
animal
prlr
variation
genetic
isoform
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/NZ2014/000224
Other languages
English (en)
French (fr)
Inventor
Mathew Douglas Littlejohn
Stephen Richard Davis
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
LIVESTOCK IMPROVEMENT Corp Ltd
Original Assignee
LIVESTOCK IMPROVEMENT Corp Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=52993221&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2015060732(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to BR112016009194-9A priority Critical patent/BR112016009194B1/pt
Application filed by LIVESTOCK IMPROVEMENT Corp Ltd filed Critical LIVESTOCK IMPROVEMENT Corp Ltd
Priority to AP2016009207A priority patent/AP2016009207A0/en
Priority to AU2014337790A priority patent/AU2014337790B2/en
Priority to EP23186997.5A priority patent/EP4273268A3/en
Priority to US15/029,124 priority patent/US10779518B2/en
Priority to MX2016005379A priority patent/MX388563B/es
Priority to ES14855747T priority patent/ES2962492T3/es
Priority to EP14855747.3A priority patent/EP3060682B1/en
Priority to CN202511091155.5A priority patent/CN121065345A/zh
Priority to CN201480065326.0A priority patent/CN105814214A/zh
Publication of WO2015060732A1 publication Critical patent/WO2015060732A1/en
Anticipated expiration legal-status Critical
Priority to US16/987,086 priority patent/US20200375156A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72Receptors; Cell surface antigens; Cell surface determinants for hormones
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0273Cloned vertebrates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/101Bovine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/124Animal traits, i.e. production traits, including athletic performance or the like
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the present invention relates, inter alia, to methods for determining whether or not an animal and/or its offspring are more likely than not to have an increased tolerance to heat, increased resistance to ticks, and/or a desirable coat texture, and particularly but not exclusively, to methods for selecting or rejecting animals, one or more cells or embryos, estimating the worth of an animal, breeding animals and herd formation.
  • Senepol cattle Some animals are naturally able to regulate body temperature more effectively than others in subtropical and tropical climates.
  • An example of this is the Senepol breed of cattle. Senepol cattle have very short, sleek hair coats.
  • the inventors have identified that a sequence alteration or variation in the Prolactin Receptor (PRLR) gene is associated with an animal having an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the alteration or variation can be used as a genetic marker to determine whether or not an animal is more likely than not to have increased heat tolerance. Such information may be used in methods for selecting, screening and breeding animals, farm management, and for estimating an animal's worth to a particular industry, for example.
  • the invention provides a method for determining whether it is more likely than not that an animal and/or its offspring will have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture, the method comprising at least the step of analysing a nucleic acid from said animal to determine whether or not it includes one or more genetic variation in the PRLR gene and/or includes one or more genetic marker in linkage disequilibrium therewith, wherein where the nucleic acid includes said genetic variation and/or one or more genetic marker in linkage disequilibrium therewith, the animal and/or its offspring is determined to be more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • one or more genetic alteration in the PRLR gene results in an increase in PRLR activity.
  • the method comprises analysing a nucleic acid from said animal to determine whether or not it includes one or more genetic alteration located within a region bounded by nucleotides corresponding to positions 39136469 and 39136649 of chromosome 20 of Bos Taurus and/or one or more genetic marker in linkage disequilibrium therewith. In one embodiment, the method comprises analysing a nucleic acid from said animal to determine whether or not it includes one or more genetic alteration located in the final exon of the PRLR gene and/or one or more genetic marker in linkage disequilibrium therewith.
  • the method comprises analysing a nucleic acid from said animal to determine the nucleotide at a position corresponding to position 39136559 of chromosome 20 of Bos Taurus and/or the nucleotide sequence of one or more genetic marker in linkage disequilibrium therewith.
  • the deletion of a C at the position corresponding to position 39136559 and/or the presence of one or more genetic marker in linkage disequilibrium therewith infers that the animal and/or its offspring is more likely than not to have increased heat tolerance.
  • the invention provides a method for selecting or rejecting an animal, the method comprising at least the step of analysing a nucleic acid from said animal to determine whether or not it includes one or more genetic valuation in the PRLR gene and/or includes one or more genetic marker in linkage disequilibrium therewith, wherein the presence of one or more genetic variation and/or one or more genetic marker in linkage disequilibrium therewith infers that the animal is more likely than not to have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • an animal is selected if it includes one or more genetic variation in the PRLR gene and/or one or more genetic marker in linkage disequilibrium therewith and an animal is rejected if it does not include one or more genetic variation in the PRLR gene and/or one or more genetic marker in linkage disequilibrium therewith.
  • one or more genetic alteration in the PRLR gene results in an increase in PRLR activity.
  • an animal is selected if it is inferred to be more likely than not to have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture. In one embodiment, an animal is rejected if it is inferred not to be more likely than not to have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the method comprises analysing a nucleic acid from said animal to determine whether or not it includes one or more genetic alteration located within a region bounded by nucleotides corresponding to positions 39136469 and 39136649 of chromosome 20 of Bos Taurus and/or one or more genetic marker in linkage disequilibrium therewith. In one embodiment, the method comprises analysing a nucleic acid from said animal to determine whether or not it includes one or more genetic alteration located in the final exon of the PRLR gene and/or one or more genetic marker in linkage disequilibrium therewith.
  • the method comprises at least the step of analysing a nucleic acid from said animal to determine the nucleotide at a position corresponding to position 39136559 of chromosome 20 of Bos Taurus and/or the nucleotide sequence of one or more genetic marker in linkage disequilibrium therewith.
  • the method comprises at least the steps of:
  • the animal is selected if there is a deletion of a C at the position corresponding to position 39136559 and/or has one or more genetic marker in linkage disequilibrium therewith.
  • the method is performed for the purpose of selecting or rejecting an animal for milk production. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for meat production. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for egg production. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for fur, hair, wool, skin, or feather production. In one embodiment, the method is performed for selecting or rejecting an animal for a desirable coat texture.
  • the method is performed for the purpose of selecting or rejecting an animal for breeding purposes, hi one embodiment, the method is performed for the purpose of selecting or rejecting an animal for inclusion in a herd. In one embodiment, where the method is for selecting or rejecting an animal for breeding purposes and/or for inclusion in a herd, the method comprises determining whether or not the animal is homozygous or heterozygous for the one or more genetic alteration and/or one or more genetic marker in linkage disequihbrium therewith.
  • the animal is selected where it is homozygous for the one or more genetic alteration and/or the one or more genetic marker in linkage disequihbrium therewith which infers that it is more likely than not that an animal will have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the invention provides a method for estimating the worth of an animal and/or its offspring, the method comprising at least the step of analysing a nucleic acid from said animal to determine whether or not it includes one or more genetic variation in the PRLR gene and/or one or more genetic marker in linkage disequihbrium therewith, wherein the presence of one or more genetic variation and/or one or more genetic marker in linkage disequilibrium therewith infers that the animal and/or its offspring will more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • one or more genetic alteration in the PRLR gene results in an increase in PRLR activity.
  • the method comprises analysing a nucleic acid from said animal to determine whether or not it includes one or more genetic alteration located within a region bounded by nucleotides corresponding to positions 39136469 and 39136649 of chromosome 20 of Bos Taurus and/or one or more genetic marker in linkage disequilibrium therewith. In one embodiment, the method comprises analysing a nucleic acid from said animal to determine whether or not it includes one or more genetic alteration located in the final exon of the PRLR gene and/or one or more genetic marker in linkage disequilibrium therewith.
  • the method comprises analysing a nucleic acid from said animal to determine the nucleotide at a position corresponding to position 39136559 of chromosome 20 of Bos Taurus and/or the nucleotide sequence of one or more genetic marker in linkage disequilibrium therewith.
  • if there is a deletion of a C at the position corresponding to position 39136559 and/or the presence of one or more genetic marker in linkage disequilibrium therewith infers that the animal and/or its offspring will more likely than not have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the invention provides a method for breeding animals, which method comprises at least the step of selecting at least a first animal that has one or more genetic variation in the PRLR gene and/or has one or more genetic marker in linkage disequilibrium therewith and mating said first animal with a second animal.
  • the method further comprises selecting the second animal on the basis that it includes one or more genetic variation in the PRLR gene and/or has one or more genetic marker in linkage disequilibrium therewith.
  • one or more genetic alteration in the PRLR gene results in an increase in PRLR activity.
  • the first and/or second animal is selected if it is inferred to be more likely than not to have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • one or more genetic alteration in the PRLR gene results in an increase in PRLR activity.
  • the one or more genetic alteration is located within a region bounded by nucleotides corresponding to positions 39136469 and 39136649 of chromosome 20 of Bos Taurus. In one embodiment, the one or more genetic alteration is located in the final exon of the PRLR gene.
  • the method comprises selecting the first and/or second animal where it has a genetic variation at a position corresponding to position 39136559 of chromosome 20 of Bos Taurus and or has one or more genetic marker in linkage disequilibrium therewith. In one embodiment, the method comprises selecting the first and/or second animal where there is a deletion of a C at the position corresponding to position 39136559 and/or has one or more genetic marker in linkage disequilibrium therewith. In one embodiment, the method comprises selecting the first and/or second animal where the animal is determined to be homozygous for one or more particular genetic alteration and/or one or more genetic marker in linkage disequilibrium therewith.
  • the invention provides a method for selecting or rejecting one or more cell or embryo, the method comprising at least the step of analysing a nucleic acid from said one or more cell or embryo or an animal from which the one or more cell or embryo is derived, to determine whether or not it includes one or more genetic variation in the PRLR gene and/or includes one or more genetic marker in linkage disequilibrium therewith.
  • the presence of such one or more genetic variation and/or one or more genetic marker in linkage disequilibrium therewith infers that the one or more cell or embryo is suitable for use in a method for breeding or cloning an animal which is more likely than not to have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • one or more cell or embryo is selected if it, or an animal from which the one or more cell or embryo is derived, includes one or more genetic variation in the PRLR gene and/or includes one or more genetic marker in linkage disequilibrium therewith. In one embodiment, one or more cell or embryo is rejected if it, or an animal from which the one or more cell or embryo is derived, does not include one or more genetic variation in the PRLR gene and/or one or more genetic marker in linkage disequilibrium therewith. In one embodiment, one or more genetic alteration in the PRLR gene results in an increase in PRLR activity.
  • the one or more genetic alteration is located within a region bounded by nucleotides corresponding to positions 39136469 and 39136649 of chromosome 20 of Bos Taurus. In one embodiment, the one or more genetic alteration is located in the final exon of the PRLR gene.
  • the method comprises at least the step of analysing a nucleic acid from said one or more cell or embryo, or from an animal from which the one or more cell or embiyo is derived, to determine the nucleotide at a position corresponding to position 39136559 of chromosome 20 of Bos Taurus and/or the nucleotide sequence of one or more genetic marker in linkage disequilibrium therewith.
  • the method comprises at least the steps of:
  • the one or more cell or embiyo is selected if there is a deletion of a C at the position corresponding to position 39136559 and/or has one or more genetic marker in linkage disequilibrium therewith.
  • the method comprises determining whether or not the one or more cell or embryo, or an animal from which the one or more cell or embryo is derived, is homozygous or heterozygous for the one or more genetic alteration and/or the one or more genetic marker in linkage disequilibrium therewith.
  • the one or more cell or embryo is selected where it, or an animal from which the one or more cell or embryo is derived, is homozygous for the one or more genetic alteration and/or the one or more genetic marker in linkage disequilibrium therewith.
  • the method is performed for the purpose of selecting or rejecting one or more cell or embryo for use in cloning an animal and/or breeding an animal.
  • breeding an animal may involve IVF.
  • the invention provides a method for breeding animals, the method comprising at least the step of selecting a first gamete that has one or more genetic variation in the PRLR gene and/or has one or more genetic marker in linkage disequilibrium therewith and fusing said first gamete with a second gamete to form a zygote.
  • the method further comprises selecting the second gamete on the basis that it includes one or more genetic variation in the PRLR gene and/or has one or more genetic marker in linkage disequilibrium therewith.
  • the invention provides a method of breeding an animal, the method comprising at least the step of selecting an embryo that has one or more genetic variation in the PRLR gene and/or has one or more genetic marker in linkage disequilibrium therewith.
  • the invention provides a method of cloning an animal, the method comprising at least the step of selecting one or more cell that has one or more genetic variation in the PRLR gene and/or has one or more genetic marker in linkage disequilibrium therewith.
  • one or more genetic alteration in the PRLR gene results in an increase in PRLR activity.
  • the one or more genetic alteration is located within a region bounded by nucleotides corresponding to positions 3 136469 and 39136649 of chromosome 20 of Bos Taurus.
  • the one or more genetic alteration is located in the final exon of the PRLR gene.
  • the methods comprise selecting the first and/or second gamete, the embryo or one or more cell where it has a genetic variation at a position corresponding to position 39136559 of chromosome 20 of Bos Taurus and/or has one or more genetic marker in linkage disequilibrium therewith.
  • the methods comprise selecting the first and/or second gamete, the embryo or the one or more cell where there is a deletion of a C at the position corcesponding to position 39136559 and/or has one or more genetic marker in linkage disequilibrium therewith. In one embodiment, the method comprises selecting the first and/or second gamete, the embryo or one or more cell where it is determined to be homozygous for one or more genetic alteration and/or one or more genetic marker in linkage disequilibrium therewith.
  • the methods comprise analysing a nucleic acid to determine whether or not it includes one or more genetic variation in the PRLR gene alone or in combination with one or more genetic marker in linkage disequilibrium therewith, i one embodiment, the methods involve analysing a nucleic acid to determine the nucleotide present at a position corresponding to position 39136559 of chromosome 20 of Bos Taurus alone or in combination with one or more genetic marker in linkage disequilibrium therewith.
  • analysis of a nucleic acid in accordance with any one or more of the first to eighth aspects of the invention occurs using one or more of: polymerase chain reaction (PCR); gel electrophoresis; Southern blotting; nucleic acid sequencing; restriction fragment length polymorphism (RFLP); single- strand confirmation polymorphism (SSCP); LCR (ligase chain reaction); denaturing gradient gel electrophoresis (DGGE); allele-specific oligonucleotides (ASOs); proteins which recognize nucleic acid mismatches; RNAse protection; oligonucleotide array hybridisation; denaturing HPLC (dHPLC); high resolution melting (HRM); and, matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF MS), qRT-PCR.
  • PCR polymerase chain reaction
  • RFLP restriction fragment length polymorphism
  • SSCP single- strand confirmation polymorphism
  • LCR ligase chain reaction
  • the invention provides a method for determining whether it is more likely than not that an animal and/or its offspring will have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture, the method comprising at least the step of observing in the animal the level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof.
  • the method comprises comparing the level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof against one or more standard.
  • the standard comprises a level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is associated with an animal having a substantially limited tolerance to heat and/or a desirable coat texture and a higher level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof from the animal compared to the standard infers that the animal and/or its offspring will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof is the level of expression thereof.
  • the invention provides a method for selecting or rejecting an animal the method comprising at least the step of observing the level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof.
  • an animal is selected it if has a level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • an animal is rejected if it does not have a level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the method comprises comparing the level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof against one or more standard.
  • the standard comprises a level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is associated with an animal having a substantially limited tolerance to heat and/or an undesirable coat texture and a higher level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof from the animal compared to the standard infers that the animal will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • an animal is selected if it is inferred that it will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture. In one embodiment, an animal is rejected if it is inferred not to be more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof is the level of expression thereof.
  • the method is performed for the purpose of selecting or rejecting an animal for milk production. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for meat production. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for egg production. In one embodiment, the method is performed for the potpose of selecting or rejecting an animal for fur, hair, wool, skin, or feather production. In one embodiment, the method is performed for selecting or rejecting an animal for a desirable coat texture. In another embodiment, the method is performed for the purpose of selecting or rejecting an animal for breeding purposes. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for inclusion in a herd.
  • the invention provides a method for estimating the worth of an animal and/or its offspring, the method comprising at least the step of observing the level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof.
  • the method comprises comparing the level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof against one or more standard.
  • the standard comprises a level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is associated with an animal having a substantially limited tolerance to heat and/or an undesirable coat texture and a higher level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof from the animal compared to the standard infers that the animal and/or its offspring will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof is the level of expression thereof.
  • the invention provides a method for breeding animals, the method comprising at least the step of selecting a first animal identified to have a level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture and mating said first animal with a second animal.
  • the method further comprises selecting a second animal identified to have a level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the method comprises the step of observing the level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof from the first and/or second animal to identify whether or not it has a level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the method comprises comparing the level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof against one or more standard.
  • the standard comprises a level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is associated with an animal having a substantially limited tolerance to heat and/or an undesirable coat texture and the first and/or second animal is selected where it is observed to have a higher level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof compared to the standard.
  • the level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof is the level of expression thereof.
  • the first and/or second animal is selected if it is inferred to be more likely than not to have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the methods comprise at least the steps of:
  • the invention provides a method for selecting or rejecting one or more cell or embryo, the method comprising at least the step of observing the level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof, in the one or more cell or embryo or an animal from which it is derived.
  • the one or more cell or embryo is selected where it, or an animal from which it is derived, is identified to have a level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the one or more cell or embryo is rejected where it, or an animal from which it is derived, is identified not to have a level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the method comprises comparing the level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof from the one or more cell or embryo, or an animal from which it is derived, against one or more standard.
  • the standard comprises a level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is associated with an animal having a substantially limited tolerance to heat and/or an undesirable coat texture and a higher level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof from the one or more cell or embryo, or an animal from which the one or more cell or embryo is derived, compared to the standard infers that the one or more cell or embryo is suitable for use in a method for breeding or cloning an animal which is more hkely than not to have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture, hi one embodiment, one or more cell or embryo is selected if it, or an animal from which the one or more cell or embryo is derived, has a higher level ofPRLR, one or more precursor
  • the level ofPRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof is the level of expression thereof.
  • the method is performed for the purpose of selecting or rejecting one or more cell or embryo for use in cloning an animal and/or breeding an animal.
  • breeding an animal may involve IVF.
  • the invention provides a method for breeding animals, the method comprising at least the step of selecting a first gamete identified to have a level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture and fusing said first gamete with a second gamete to form a zygote.
  • the method further comprises selecting the second gamete where it is identified to have a level of one or more ofPRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the invention provides a method of breeding an animal, the method comprising at least the step of selecting an embryo where it is identified to have a level of one or more ofPRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the invention provides a method of cloning an animal, the method comprising at least the step of selecting one or more cell where it is identified to have a level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the method comprises the step of observing the level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof in said first and/or second gamete, one or more cell or embryo to identify whether or not it has a level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the methods of the fourteenth to sixteenth aspects comprise comparing the level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof in said first and/or second gamete, embryo or one or more cell to one or more standard.
  • the standard comprises a level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof which is associated with an animal having a substantially limited tolerance to heat and/or an undesirable coat texture and the first and/or second gamete, embryo or one or more cell is selected where it is observed to have a higher level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof compared to the standard.
  • the level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof is the level of expression thereof.
  • the level of the one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding one or more thereof is determined using an immunoassay, separation based on characteristics such as molecular weight and isoelectric point, gel electrophoresis, Western Blotting or mass spectroscopy.
  • the immunoassay is an ELISA.
  • the gel electrophoresis is 2D gel electrophoresis or gel-free systems based on microfluidics technologies.
  • the invention provides a method for determining whether it is more likely than not that an animal and/or its offspring will have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture, the method comprising at least the step of observing in the animal the level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof.
  • the method comprises comparing the level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof against one or more standard.
  • the standard comprises a level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof associated with an animal having a substantially limited tolerance to heat and/or an undesirable coat texture and a higher level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof in the animal compared to the standard infers that the animal and/or its offspring will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the invention provides a method for selecting or rejecting an animal the method comprising at least the step of observing the level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof.
  • an animal is selected it if has a level of activity of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • an animal is rejected if it does not have a level of activity of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the method comprises comparing the level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof against one or more standard.
  • the standard comprises a level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is associated with an animal having a substantially limited tolerance to heat and/or an undesirable coat texture and a higher level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof in the animal compared to the standard infers that the animal will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • an animal is selected if it is inferred that it will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture. In one embodiment, an animal is rejected if it is inferred not to be more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the method is performed for the purpose of selecting or rejecting an animal for milk production. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for meat production. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for egg production. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for fur, hair, wool, skin, or feather production. In one embodiment, the method is performed for selecting or rejecting an animal for a desirable coat texture. In another embodiment, the method is performed for the purpose of selecting or rejecting an animal for breeding purposes. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for inclusion in a herd.
  • the invention provides a method for estimating the worth of an animal and/or its offspring, the method comprising at least the step of observing the level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof.
  • the method comprises comparing the level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof against one or more standard.
  • the standard comprises a level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is associated with an animal having a substantially limited tolerance to heat and/or an undesirable coat texture and a higher level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof in the animal compared to the standard infers that the animal and/or its offspring will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the invention provides a method for breeding animals, the method comprising at least the step of selecting a first animal identified to have a level of activity of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture and mating said first animal with a second animal.
  • the method further comprises selecting a second animal that is identified to have a level of activity of one or more of PRLR, one or more precursor thereof, one or more isoform thereof and/or one or more fragment thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the method comprises the step of observing the level of activity of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof from the first and/or second animal to identify whether or not it has a level of activity one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the method comprises comparing the level of activity of one or more of PRLR, one or more precursor thereof, one or more isoform thereof and/or one or more fragment thereof to one or more standard.
  • the standard comprises a level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is associated with an animal having a substantially limited tolerance to heat and/or an undesirable coat texture and the first and/or second animal is selected where it is observed to have a higher level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof compared to the standard.
  • the first and/or second animal is selected if it is inferred to be more likely than not to have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the methods comprise at least the steps of:
  • the invention provides a method for selecting or rejecting one or more cell or embryo the method comprising at least the step of observing the level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof.
  • one or more cell or embryo is selected it if has a level of activity of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • one or more cell or embryo is rejected if it does not have a level of activity of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the method comprises comparing the level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof against one or more standard.
  • the standard comprises a level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is associated with an animal having a substantially limited tolerance to heat and/or an undesirable coat texture and a higher level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof in the one or more cell or embryo, or an animal from which the one or more cell or embryo is derived, compared to the standard infers that the one or more cell or embryo is suitable for use in a method for breeding or cloning an animal which will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • one or more cell or embryo is selected if it, or an animal from which the one or more cell or embryo is derived, has a higher level of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more nucleic acid encoding any one or more thereof.
  • the method is performed for the purpose of selecting or rejecting one or more cell or embryo for use in cloning an animal and/or breeding an animal.
  • breeding an animal may involve IVF.
  • the invention provides a method for breeding animals, the method comprising at least the step of selecting a first gamete identified to have level of activity of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture and fusing said first gamete with a second gamete to form a zygote.
  • the method further comprises selecting the second gamete where it is identified to have level of activity of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the invention provides a method of breeding an animal, the method comprising at least the step of selecting an embryo where it is identified to have level of activity of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the invention provides a method of cloning an animal, the method comprising at least the step of selecting one or more cell where it is identified to have level of activity of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the methods comprise the step of observing the level of activity one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof in said first and/or second gamete, one or more cell or embryo to identify whether or not it has a level of activity of one or more ofPRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is indicative of an animal which has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the methods comprise comparing the level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof in said first and/or second gamete, embryo or one or more cells to one or more standard.
  • the standard comprises a level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is associated with an animal having a substantially limited tolerance to heat and/or an undesirable coat texture and the first and/or second gamete, embryo or one or more cell is selected where it is observed to have a higher level of activity ofPRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof compared to the standard.
  • the invention provides a method for determining whether it is more likely than not that an animal and/or its offspring will have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture, the method comprising at least the step of analysing one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof from said animal to determine whether or not it includes one or more variation in the amino acid sequence, wherein where the one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof has said one or more variation the animal and/or its offspring is determined to be more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the invention provides a method for selecting or rejecting an animal, the method comprising at least the step of analysing one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof from said animal to determine whether or not it includes one or more variation in the amino acid sequence, wherein the presence of said one or more variation infers that the animal is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • an animal is selected if it is inferred to be more likely than not to have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture. In one embodiment, an animal is rejected if it is inferred not to be more likely than not to have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • an animal is selected if it includes one or more amino acid variation in PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof and an animal is rejected if it does not include one or more amino acid variation in PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof.
  • the method is performed for the purpose of selecting or rejecting an animal for milk production. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for meat production. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for egg production. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for fur, hair, wool, skin, or feather production. In one embodiment, the method is performed for selecting or rejecting an animal for a desirable coat texture. In another embodiment, the method is performed for the purpose of selecting or rejecting an animal for breeding purposes. In one embodiment, the method is performed for the purpose of selecting or rejecting an animal for inclusion in a herd.
  • the invention provides a method for estimating the worth of an animal and/or its offspring, the method comprising at least the step of analysing one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof from said animal to determine whether or not it includes one or more variation in the amino acid sequence, wherein the presence of said one or more variation infers that the animal and/or its offspring is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the invention provides a method for breeding animals, which method comprises at least the step of selecting at least a first animal that has been identified to have one or more variation in the amino acid sequence of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof and mating said first animal with a second animal.
  • the method further comprises selecting the second animal on the basis that it has been identified to have one or more variation in the amino acid sequence of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof.
  • the first and/or second animal is selected if it is inferred to be more likely than not to have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the invention provides a method for selecting or rejecting one or more cell or embryo, the method comprising at least the step of analysing one or more of PRLR, one or more precursor thereof one or more isoform thereof and/or one or more fragment thereof from said one or more cell or embryo, or from an animal from which the one or more cell or embryo is derived, to determine whether or not it includes one or more variation in the amino acid sequence.
  • the presence of such one or more variation infers that the one or more cell or embryo is suitable for use in a method for breeding or cloning an animal which is more likely than not to have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • one or more cell or embryo is selected if it, or an animal from which the one or more cell or embryo is derived, has one or more variation in the amino acid sequence of PRLR. In one embodiment, one or more cell or embryo is rejected if it, or an animal from which the one or more cell or embryo is derived, does not have one or more variation in the amino acid sequence of PRLR.
  • the method is performed for the purpose of selecting or rejecting one or more cell or embryo for use in cloning an animal and/or breeding an animal.
  • breeding an animal may involve IVF.
  • the invention provides a method for breeding animals, the method comprising at least the step of selecting a first gamete that has one or more variation in the amino acid sequence of one or more of PRLR, one or more precursor thereof, one or more isoform thereof and/or one or more fragment thereof and fusing said first gamete with a second gamete to form a zygote.
  • the method further comprises selecting the second gamete on the basis that it has one or more variation in the amino acid sequence of one or more of PRLR, one or more precursor thereof one or more isoform thereof, and/or one or more fragment thereof.
  • the invention provides a method of breeding an animal, the method comprising at least the step of selecting an embryo that has one or more variation in the amino acid sequence of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof.
  • the invention provides a method of cloning an animal, the method comprising at least the step of selecting one or more cell that has one or more variation in the amino acid sequence of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof.
  • one or more variation in the amino acid sequence is one which results in an increase in PRLR activity.
  • one or more variation is a substitution of one or more amino acid, deletion of one or more amino acid, and/or addition of one or more amino acid.
  • one or more variation in the amino acid sequence is a deletion resulting in truncation of PRLR.
  • one or more amino acid variation is located within a region from a position corresponding to amino acid 430 to amino acid 490 of PRLR of Bos Taurus. In one embodiment, one or more variation results in a truncation of PRLR in a region from approximately an amino acid position corresponding to position 430 to an amino acid position corresponding to position 490 of PRLR of Bos Taurus. In one embodiment of any one of the twenty fifth to thirty second aspects one or more amino acid variation comprises an alanine to valine substitution at a position corresponding to amino acid position 461 of PRLR of Bos Taurus.
  • one or more amino acid variation results in a truncation of PRLR to a position corresponding to amino acid position 461 of PRLR of Bos Taurus.
  • one or more amino acid variation is a substitution of an alanine with a valine at position 461 and truncation of PRLR to a position corresponding to amino acid position 461 of PRLR of Bos Taurus.
  • the invention provides a method for generating an animal which is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture, the method comprising at least the step of introducing one or more genetic alteration to the PRLR gene of one or more cell used to generate the animal.
  • the invention also provides a method for generating one or more cells which may be of use in generating an animal which is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture, the method comprising at least the step of introducing one or more genetic alteration to the PRLR gene of one or more cell.
  • the invention provides a cell generated by said method.
  • the method for generating the animal involves IVF. In one embodiment, the method for generating the animal is a cloning method. In one embodiment, one or more genetic alteration is one which increases the activity of PRLR. In one embodiment, one or more genetic alteration includes a genetic alteration located within a region bounded by nucleotides corresponding to positions 39136469 and 39136649 of chromosome 20 of Bos Taurus. In one embodiment, one or more genetic alteration is a genetic alteration located in the final exon of the PRLR gene. In one embodiment, one or more genetic alteration includes a genetic alteration at a position corresponding to position 39136559 on chromosome 20 of Bos Taurus. In one embodiment, one or more genetic alteration includes a deletion of a C at the position corresponding to position 39136559 on chromosome 20 of Bos Taurus.
  • the one or more cell is chosen from a gamete or a zygote. In one embodiment, the one or more cell is a somatic cell or a cell from a cell line.
  • a cloning method of the thirty third aspect further comprises the step of selecting or rejecting one or more animal, cell or embryo using a method of any one or more of the methods of the second, fifth, tenth, thirteenth, eighteenth, twenty first, twenty sixth or twenty ninth aspects of the invention.
  • an IVF method of the thirty third aspect further comprises the step of selecting or rejecting one or more animal, cell or embryo using a method of any one or more of the methods of the second, fifth, tenth, thirteenth, eighteenth, twenty first, twenty sixth or twenty ninth aspects of the invention.
  • the invention provides an animal generated by a method of the thirty third aspect of the invention.
  • the invention provides a method of forming a herd the method comprising at least the steps of: a. performing a method of any one or more of the first, second, third, fourth, ninth, tenth, eleventh, twelfth, seventeenth, eighteenth, ninteenth, twentieth, twenty fifth, twenty sixth, twenty seventh or twenty eighty aspects of the invention;
  • step b selecting or rejecting an animal based on the results of step a);
  • an animal is rejected if it is inferred not to be more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture. In one embodiment, an animal is selected if it is inferred to be more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • an animal is selected if it includes one or more genetic variation in the PRLR gene and/or includes one or more genetic marker in linkage disequilibrium therewith. In one embodiment, an animal is selected if it includes one or more variation in the amino acid sequence of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof.
  • an animal is selected if it has a higher level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof and/or a nucleic acid encoding any one or more thereof compared to a standard, wherein the standard comprises a level of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof and/or a nucleic acid encoding any one or more thereof which is associated with an animal having a substantially limited tolerance to heat and/or an undesirable coat texture.
  • an animal is selected if it has a higher level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof compared to a standard, wherein the standard comprises a level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof which is associated with an animal having a substantially limited tolerance to heat and/or an undesirable coat texture.
  • the invention provides a herd framed by a method of the thirty fourth aspect of the invention.
  • the invention provides a method for identifying one or more genetic vai'iation in the PRLR gene which infers an increased tolerance to heat, an increased resistance to ticks, and or a desirable coat texture in an animal,
  • the method comprises identifying one or more genetic variation in the PRLR gene and determining whether or not it results in an increase in the level or activity of PRLR. i one embodiment, where the one or more alteration results in an increase in the level or activity of PRLR it is determined to infer an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture in an animal.
  • the invention provides a method for identifying whether or not an animal (and/or its offspring), one or more cells or embryo has or may have one or more genetic alteration which is linked to an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture the method comprising observing the nucleic acid sequence to identify whether or not it includes one or more of the genetic variation in the PRLR gene and/or a genetic marker in linkage disequilibrium therewith.
  • the animal, cell or embryo is identified as having one or more genetic alteration that is linked to an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the one or more genetic alteration results in an increase in the level or activity of PRLR.
  • the invention provides a method for identifying one or more amino acid variation in PRLR which infers an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture in an animal.
  • the method comprises identifying one or more amino acid valuation in PRLR and determining whether or not it results in an increase in the level or activity of PRLR. In one embodiment, where the one or more alteration results in an increase in the level or activity of PRLR it is detennined to infer an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture in an animal.
  • the invention provides a method for identifying whether or not an animal (and/or its offspring), one or more cell or embryo has or may have one or more amino acid variation which is linked to an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture the method comprising observing the amino acid sequence to identify whether or not it includes one or more variation in the amino acid sequence of PRLR., one or more precursor thereof, one or more isoform thereof or one or more fragment thereof.
  • the animal, cell or embryo has one or more of the variation in the amino acid sequence of PRLR, one or more precursor thereof, one or more isoform thereof, or one or more fragment thereof the animal, cell or embryo is identified as having one or more amino acid variation that is linked to an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the one or more amino acid variation results in an increase in the level or activity of PRLR, one or more precursor thereof, one or more isoform thereof or one or more fragment thereof.
  • the animal is a mammal.
  • the animal is from the Bovidae family, Phasianidae family, or Suidae family. In certain embodiments, the animal is of a genus, species or breed as herein after described. In one particular embodiment, the animal is bovine. In a particular embodiment the bovine animal is Bos taurus or Bos indicus. In a particular embodiment, the animal is chosen from the group consisting Jersey, Holstein, Friesian or crossbred dairy cattle. In other embodiments, the animal is chosen from the group consisting Creole including Romosinuano, Criollo, Carora, Senepol or crossbred cattle. In one embodiment, the methods of any one or more of the first to thirty eighth aspects of the invention further comprise analysis of one or more additional biological markers. In one embodiment, the one or more biological markers are one or more genetic markers.
  • a methods of the invention may comprise two or more of: analysing a nucleic acid to determine whether or not it includes one or more genetic variation in the PRLR gene and/or includes one or more genetic marker in linkage disequilibrium therewith; observing the level of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof, and/or one or more nucleic acid encoding any one or more thereof; observing in the animal the level of activity of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof; and, analysing one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof from said animal to determine whether or not it includes one or more variation in the amino acid sequence.
  • the invention provides an isolated nucleic acid encompassing a del(C) alteration at a position corresponding to position 39136559 of chromosome 20 of Bos Taurus.
  • the invention provides an isolated nucleic acid in which the C is present at a position corresponding to position 39136559 of chromosome 20 of Bos Taurus.
  • the nucleic acid comprises a nucleotide sequence in which the C at a position corresponding to position 39136559 of chromosome 20 of Bos Taurus has been deleted.
  • the invention provides an isolated nucleic acid comprising or consisting of the sequence
  • the invention provides an isolated nucleic acid comprising or consisting of the sequence of SEQ ID No. 6 or a functionally equivalent variant thereof.
  • the invention provides a cDNA comprising one or more genetic marker described herein. In another aspect, the invention provides one or more additional nucleic acids as described further herein after. In another aspect, the invention provides an isolated peptide as described herein. In one embodiment the invention provides an isolated peptide comprising or consisting of the sequence of SEQ ID No. 7 or a functionally equivalent variant thereof.
  • the invention provides:
  • the invention may also be said broadly to consist in the parts, elements and features referred to or indicated in the specification of the application, individually or collectively, in any or all combinations of two or more of said parts, elements or features, and where specific integers are mentioned herein which have known equivalents in the art to which the invention relates, such known equivalents are deemed to be incorporated herein as if individually set forth.
  • Figure 1 Illustrates the nucleotide sequence of Bos taunts prolactin receptor (PRLR), transcript variant 2, rnRNA (NCBI Reference Sequence: NM_001039726.2). PRLR long-form. Translated region is highlighted. Start codon beginning at position 85 corresponds to position 39115293 on UMD 3.1. Exon 1 as published by NCBI starts at 39115245. Stop codon beginning at position 1828 in mRNA sequence is at position 39136922 in genome build UMD3.1. The base deletion identified in DNA from Senepol cattle is at position 1466 in mRNA sequence (highlighted) and genomic position 39136559. The resulting frameshift codes for a valine followed by a stop codon resulting in protein truncation ( Figure 2).
  • Figure 2 Bos taurus prolactin receptor (PRLR), transcript valiant 2, mRNA.
  • Figure 3 Bos taurus prolactin receptor (PRLR), transcript variant 2, mRNA, showing alteration identified by the inventors - base deleted (at 39136559 on BTA20) in Senepol PRLR (c) is indicated by omission.
  • Product is the PRLR long-form (NCBI Reference Sequence: NM_001039726.2).
  • Figure 4 Predicted amino acid sequence (n461) of Senepol prolactin receptor as a result of the base C deletion at position 39136559 of Bos Taurus BTA 20.
  • Figure 5 Illustrates the nucleotide sequence of Bos taurus prolactin receptor (PRLR), transcript variant 2, mRNA (NCBI Reference Sequence: NM_001039726.1). PRLR long-form. Translated region is highlighted. Start codon beginning at position 87 corresponds to position 39115293 on UMD 3.1. Exon 1 as published by NCBI stalls at 39115245. Stop codon beginning at position 1830 in mRNA sequence is at position 39136922 in genome build UMD3.1.
  • the base deletion identified in DNA from Senepol cattle is at position 1468 in mRNA sequence (highlighted) and genomic position 39136559.
  • the inventors have identified that particular alleles of a genetic marker located in the prolactin receptor (PRLR) gene in a region of chromosome 20 in Bos taurus is associated with the very short, sleek hair coats observed in the Senepol breed of cattle who have increased heat tolerance. This is the first time that an alteration in the PRLR gene has been directly associated with the short and sleek hair coat and heat tolerance traits of cattle. Accordingly, the inventors contemplate that any genetic alteration in the PRLR gene, particularly those which result in an increase in the activity of PRLR, may be used as a marker to determine whether an animal is more likely than not to have an increased tolerance to heat. Accordingly, while the description which follows may focus on the analysis of the nucleotide sequence at a particular position in this gene, it should be understood to extend to the analysis of the nucleotide sequence at any other position within the gene.
  • PRLR prolactin receptor
  • the inventors also contemplate that the analysis of one or more genetic marker which is in linkage disequilibrium with such an alteration in the PRLR gene may also be used for the same purpose.
  • haplotypes including a combination of two or more such genetic alterations and/or markers in linkage disequilibrium therewith may also be used for this memepose.
  • methods for determining whether an animal (and/or its offspring) is more likely than not to have an increased tolerance to heat could comprise observing the level of PRLR, one or more isoform, one or more precursor, one or more fragment and/or one or more nucleic acid encoding any one or more thereof, where in one embodiment an increase in the level of any one or more of these molecules infers it is more likely than not that it will have an increased tolerance to heat.
  • the inventors contemplate methods involving observing the activity of PRLR (including reference to one or more isoform, one or more precursor, one or more fragment and/or one or more nucleic acid encoding any one or more thereof), where in one embodiment an increase in the level of activity of PRLR (including reference to one or more isoform, one or more precursor, one or more fragment and/or one or more nucleic acid encoding any one or more thereof) infers that the animal will more likely than not have an increased tolerance to heat.
  • methods for determining whether an animal (and/or its offspring) is more likely than not to have an increased tolerance to heat could comprise observing whether or not these molecules include one or more variation in their amino acid sequence. It should be appreciated that this could include observing a size variation in PRLR (including reference to one or more precursors, isoforms, fragments thereof, and/or a nucleic acid encoding any one or more thereof).
  • Analysis of one or more biological marker of relevance to PRLR in accordance with the invention could also be used for selecting or rejecting one or more cell or embiyo. Such analysis may aid in methods for breeding or cloning animals, for example.
  • the inventors contemplate the methods of the invention being useful for determining or inferring whether or not an animal and/or its offspring is more likely than not to have a desirable coat texture (such as a short and sleek coat in cattle) as this is associated with the phenotype observed in Senepol cattle and linked to heat tolerance.
  • the methods of the invention being useful for determining or inferring whether or not an animal and/or its offspring is more likely than not to have a level of resistance to ticks.
  • Tick resistance is associated with coat type, shorter coats enhancing tick resistance and long coats increasing tick infestation, and tick resistance is associated with Senepol cattle. Accordingly, while the methods of the invention may be described herein in relation to increased tolerance to heat, it should be understood that these methods (including all aspects and embodiments of the invention) may alternatively or in addition be used for the purpose of determining or inferring whether or not an animal and/or its offspring is more likely than not to have a desirable coat texture and/or a level of tick resistance or an increased resistance to ticks. The description should be read accordingly to encompass such alternative or additional methods.
  • "desirable coat texture" includes a thin, light, sleek and/or short coat.
  • a “desirable coat texture” may be short and sleek; in the case of the Ovis family, a “desirable coat texture” may be short, thin and/or light; in the case of the Suidae family, a “desirable coat texture” may be short, thin and/or light; in the case of the Phasiadnidae family, "a desirable coat texture: may be thin and/or light feathering.
  • an "undesirable coat texture” is one which is associated with an animal have substantially limited tolerance to heat.
  • An “undesirable coat texture” may include a thick, heavy, rough and/or long coat.
  • Analysis of one or more biological marker in accordance with the invention may assist in, for example: predicting phenotypic performance, including use in production management systems known as Marker Assisted Selection; the selection or rejection of animals for breeding purposes; the selection or rejection of animals for milk production, meat production, egg production, fur, hair, wool, skin, or feather production, and/or desirable coat texture; managing animals in order to maximise their individual potential performance and value; estimating the worth or economic value of an animal; improving profits related to selling animals and/or products produced from the animals; improving the genetics of a population of animals by selecting and breeding desirable animals; generating and maintaining herds of animals; cloning animals likely to have or not have a specific trait; predicting the suitability of an animal and/or its offspring to use in different industries and/or environments and/or breeding programmes or cloning.
  • Animals more or less suitable for a particular production system, industry or environment can be tested or screened to predict life time performance and segregated or managed to suit their genotype and therefore predicted phenotype. Animals may be tested or screened at any time during their life, including but not limited to early at birth, as gametes, zygotes, embryos, foetuses.
  • an alteration in the PRLR gene is associated with heat tolerance and desirable coat texture (for example short and sleek hair coat in cattle) also allows for generation of animals having such desirable phenotypes using cloning and/or gene editing processes in which one or more specific genetic alteration is introduced into the PRLR gene.
  • one or more specific alteration may be introduced into individual gametes or a zygote during an IVF programme or in to one or more relevant cells during a cloning procedure.
  • the invention should be taken to include methods for generating animals which are more likely than not to have increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • biological marker(s) should be taken broadly and includes, for example, one or more genetic marker, the level of one or more protein (including reference to one or more fragments thereof, one or more precursors thereof, one or more isoforms thereof) or a nucleic acid encoding one or more protein (including reference to one or more fragments thereof, one or more precursors thereof, one or more isoforms thereof), the level of expression of one or more gene or protein (including reference to one or more fragments thereof, one or more precursors thereof, one or more isoforms thereof), the level of activity of one or more protein (including reference to one or more fragments thereof, one or more precursors thereof, one or more isoforms thereof) and/or variation in the amino acid sequence of a protein (including reference to one or more fragments thereof, one or more precursors thereof, one or more isoforms thereof) which may include observation of the size of a protein ((including reference to one or more fragments thereof, one or more precursors thereof, one or more isoforms thereof) which may include observation of
  • genetic marker refers to nucleic acids or specific genetic loci (including specific nucleotide positions) that are polymorphic or contain sequence alterations or variations within a population, the alleles of which can be detected and distinguished by one or more analytic methods.
  • the term “genetic marker” further includes within its scope a plurality of genetic markers co- segregating, in the form of a "haplotype".
  • haplotype refers to a plurality of genetic markers that are generally inherited together. Typically, genetic markers within a haplotype are in linkage disequilibrium.
  • the term “genetic marker” of "genetic marker of the invention” and like terms, may be used herein to describe one or more genetic variation in the PRLR gene in accordance with the invention.
  • Reference herein to analysing a nucleic acid to determine the nucleotide sequence of a "genetic marker" or at a particular genetic position or the presence or absence or nature of one or more genetic variation should be taken to include analysing and determining the nucleotide sequence on either strand of the nucleic acid. Skilled persons will readily be able to determine the nucleotide or base on an opposing strand based on well understood structure of DNA molecules: C pairs with G, A pairs with T. Accordingly, if reference is made to identifying the presence of a T at a particular position, it should be taken to include reference to identifying the presence of an A on the opposing strand of the DNA, and vice versa. Similarly, if reference is made to identifying the presence of a G at a particular position, it should be taken to include reference to identifying the presence of a C on the opposing strand of DNA, and vice versa.
  • single nucleotide polymorphism refers to nucleic acid sequence variations that occur when a single nucleotide in the genome sequence is altered.
  • a single nucleotide polymorphism may also be a single nucleotide insertion or deletion.
  • the different nucleotides within a SNP are referred to as an allele.
  • genetictype means the genetic constitution or nucleotide sequence at one or more genetic locus, in particular the nucleotide sequence of an allele of a genetic locus.
  • Linkage disequilibrium should be taken broadly to refer to the tendency of the presence of an allele at one genetic locus to predict the presence of an allele at one or more other genetic loci (for example a distinct genetic marker).
  • the genetic loci need not necessarily be on the same chromosome. However, in a preferred embodiment, the genetic loci are located on the same chromosome.
  • the marker in linkage disequilibrium with a genetic alteration in accordance with the invention is located on chromosome 20 of Bos tauras mapping to a region between positions of approximately 38.35Mb to approximately 39.85Mb.
  • the marker in linkage disequilibrium is located on chromosome 20 mapping to a region between positions of approximately 38.4Mb to approximately 39.8Mb. In another embodiment, the marker in linkage disequilibrium is located on chromosome 20 mapping to a region between positions of approximately 38.5Mb to approximately 39.7Mb.
  • DELTA 2 is calculated using the formula described by Devlin et al (Genomics 29 (2) : 311-22 (1995)), and is a measure of how well an allele X at a first genetic locus predicts the occurrence of an allele Y at a second genetic locus.
  • a DELTA 2 value of 1.0 indicates the prediction is perfect (for example, if Y is present then X is present). It should be appreciated that reference to linkage disequilibrium herein should not be taken to imply a DELTA 2 value of 1.0.
  • the linkage disequilibrium between an allele at one genetic locus and an allele at a second genetic locus has a DELTA 2 value of at least 0.75, at least 0.80, at least 0.85, at least 0.90, at least 0.95, and most preferably 1.0.
  • a genetic marker may be native to the genome (of an animal or one or more cell for example) or it may have been artificially generated or inserted.
  • An "artificially generated or inserted" genetic marker is one which has been introduced in to the genome.
  • Such genetic marker may comprise any one or more of a variety of genetic alterations, including for example, the addition of one or more nucleotide to the genome, substitution of one or more nucleotide within the genome with one or more nucleotide, and/or deletion of one or more nucleotide from the genome.
  • the genetic marker is a heterologous nucleic acid comprising one or more nucleotides which is inserted into the genome.
  • a variety of recombinant techniques including, for example gene editing methodology and site directed mutagenesis.
  • Such techniques may be described, for example, in: Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 2001, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; and, Precision Editing of Large Animal Genomes, Wenfang (Spring) Tan, Daniel F. Carlson, Mark W. Walton, Scott C. Fahrenkrug and Perry B. hackett, Adv Genet.
  • Such genetic marker may have been introduced into the genome of one or more cell to be tested, the genome of one or more cell of an ancestor of an animal, or the genome of one or more cell of an animal to be tested.
  • a "varation in the amino acid sequence" of PRLR, isoforms, fragments and/or precursors thereof should be considered broadly to include any change in the amino acid sequence. By way of example only, it should be taken to include subsitution of any one or more amino acid, addition of one or more amino acid and/or deletion of one or more amino acid.
  • a “genetic variation” should also be considered broadly to include any change in the nucleotide sequence. By way of example only, it should be taken to include subsitution of any one or more nucleotide, addition of one or more nucleotide and/or deletion of one or more nucleotide.
  • nucleic acid includes one or more genetic variation or a peptide or protein includes one or more variation in the amino acid sequence
  • variation is a difference in the nucleic acid or amino acid sequence compared to the nucleic acid sequence associated with one or more animal which has a substantially limited tolerance to heat, a substantially limited resistance to ticks and/or an undesirable coat texture or does not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the variation will be determined in relation to a reference sequence.
  • the reference sequence is a nucleic acid encoding part or all of a PRLR gene and/or one or more genetic marker in linkage disequilibrium therewith and the amino acid sequence of PRLR, an isoform, a precursor or a fragment thereof, which is associated with an animal that has substantially limited tolerance to heat, a substantially limited resistance to ticks and/or an undesirable coat texture, as defined herein, hi one embodiment, the nucleic acid reference sequence is SEQ ID No.4 or a part thereof. In one embodiment, the amino acid reference sequence is SEQ ID No. 5 or a part thereof.
  • the reference sequence could be a nucleic acid or peptide or protein having a sequence which is already known to be associated with an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture, as defined herein. Accordingly, reference to “vaiiation” should not be restricted to mean that the nucleic acid, peptide or protein being analysed is different from the reference sequence.
  • Reference to truncation of a protein or peptide "to a position corresponding to position Z", and like phrases, are intended to mean that the protein or peptide ends at position Z.
  • Reference to a region "bounded by" specific nucleotides or amino acids should be taken to mean a region comprising said nucleotides or amino acids. In other words, the region includes the terminal nucleotides or amino acids referred to.
  • a region "bounded by" nucleotides at position 39136469 and 39136649 includes the nucleotides present at position 39136469 and 39136649.
  • a “genetic alteration or variation which results in an increase in the activity of PRLR” may be any genetic change which has an affect on the level, expression or activity of the PRLR gene product (including reference to isoforms, fragments and/or precursor thereof). By way of example, it may increase the level of expression or alter the structure or function of the gene product.
  • a “variation in the amino acid sequence which results in an increase in the activity of PRLR", or like phrases may be any change that has an affect on the level or activity of PRLR (including reference to isoforms, fragments and/or precursor thereof).
  • the term "increase” should not be taken to imply any particular level of activity or function, all that is required is that there is at least some increase in activity compared to an animal or animals not having the variation or alteration (including reference to the same animal if it did not have a biological marker according to the invention).
  • an “increase” or “decrease” in the level or activity of PRLR an isoform thereof, a fragment thereof, a precursor thereof, and/or a nucleic acid encoding any one or more thereof it should be taken broadly to include any increase or decrease in said level compared to a reference animal or animals or a standard.
  • the inventors contemplate at least an approximately 20% higher level or activity of PRLR compared to an animal or animals which do not have the desired phenotype (an increased tolerance to heat, an increased resistance to ticks, and/or desirable coat texture) may be indicative of an animal who does have a desirable phenotype (an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture).
  • PRLR gene should be taken to include reference to the coding and non-coding regions of the gene, including upstream and downstream regulatory elements.
  • the PRLR gene has been reported to be transcribed into two mRNA forms which differ in length; a short form and a long form. Accordingly, the "PRLR gene” may be referred to herein using terms such as “long form” or “short form”, meaning the gene is transcribed into the long or short form mRNA, respectively.
  • Reference to the specific location of a genetic alteration within the PRLR gene should be read having regard to the long form. However, general reference to the PRLR gene should be taken to include reference to both the short and the long form, unless otherwise specified.
  • the PRLR gene is the long form.
  • PRLR is the prolactin receptor. Reference herein to "PRLR” should be taken to include reference to a precursor of PRLR, an isoform of PRLR and/or a fragment of PRLR unless the context requires otherwise. By way of example, methods of the invention may involve the analsysis of the sequence, level, and/or activity of PRLR, an isoform of PRLR, a precursor of PRLR and/or a fragment of PRLR and/or a nucleic acid encoding any one or more thereof.
  • PRLR is known to exist in two common isoforms, the long for and the short form. Reference herein to PRLR should be taken to include reference to both these forms. However, in one preferred embodiment, PRLR is the long form.
  • a “functionally equivalent variant” of any particular nucleic acid referred to herein should be taken broadly to encompass any nucleic acid whose nucleic acid sequence may vary from the specific sequence provided but which nucleic acid retains substantially the same function; for example, in the case of an oligonucleotide used to detect a genetic marker of the invention, the ability to bind to a particular target nucleic acid or prime a particular reaction with the desired specificity).
  • the phrase “functionally equivalent” should not be taken to imply that the variant has the same level of activity as the nucleic acid of which it is a variant, although this may be desired.
  • “functionally equivalent variants" of any particular nucleic acid will have at least approximately 80%, approximately 90%, approximately 95%, or approximately 99% sequence homology or identity to the nucleic acid of which it is a variant.
  • a “functionally equivalent variant” of any particular peptide or protein referred to herein should be taken broadly to encompass any peptide or protein whose amino acid sequence may vary from the specific sequence provided but which peptide or protein retains substantially the same function.
  • the phrase “functionally equivalent” should not be taken to imply that the valiant has the same level of activity as the peptide or protein of which it is a variant, although this may be desired.
  • “functionally equivalent variants” of any particular peptide or protein will have at least approximately 80%, approximately 90%, approximately 95%, or approximately 99% sequence similarity or identity to the peptide or protein of which it is a variant.
  • the term “animal” should be taken broadly to include a variety of different animals.
  • the "animal" is a mammal.
  • the animal is from the Bovidae family, the Phasianidae family, or the Suidae family.
  • an animal from the Bovidae family is from the Bovinae subfamily.
  • the animal is of the Bos genus.
  • the animal is Bos taurus or Bos indicus.
  • the animal is a beef and/or daily breed.
  • the animal may be chosen from the group of animals including, but not limited to, Jersey, Holstein, Friesian, Ayrshire, crossbred dairy cattle, Angus, Hereford, Simmental and crossbred beef cattle.
  • the animal is chosen from the group of the Creole breeds of cattle, including Romosinuano, Criollo, Carora, Senepol and crossbred dairy or beef cattle.
  • the animal is a crossbreed between a breed of animal known to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture and a breed of animal known to have substantially limited tolerance to heat, a substantially limited resistance to ticks, and/or an undesirable coat texture. Skilled persons will readily appreciate a variety of other species and breeds that the invention may be applied to.
  • an animal from the Bovidae family is from the Caprinae subfamily.
  • the animal is of the Capra genus.
  • the animal is Capra hircus.
  • the animal is a breed used for dairy, meat and/or wool farming and production.
  • the animal may be chosen from the group of animals including, but not limited to Saanen, Alpine, Nubian, Boer and Cashmere.
  • the animal is of the Ovis genus.
  • the animal is Ovis aries.
  • the animal is a breed used for daiiy, meat and/or wool fanning and production.
  • the animal may be chosen from the group of animals including but not limited to Border Leicester, Merino, Wiltshire, Dorset, East Friesian, and Lacaune. Skilled persons will readily appreciate a variety of other species and breeds that the invention may be applied to.
  • an animal from the Suidae family is from the Suinae subfamily. In one embodiment, the animal is of the Sus genus. In certain embodiments the animal is Sus scrofa. In one embodiment, the animal is a breed used for meat and/or leather farming and production. In certain embodiments, the animal may be chosen from the group of animals including, but not limited to, Landrace, Duroc, Meisham, Berkshire, and Philippine native. Skilled persons will readily appreciate a variety of other species and breeds that the invention may be applied to. ⁇ one embodiment, an animal from the Phasiadnidae family is from the Phasianinae subfamily. In one embodiment, the animal is of the Gallus genus.
  • the animal is Galliis gallus. In one embodiment, the animal is a breed used for meat, feather and/or egg farming and production. In certain embodiments, the animal may be chosen from the group of animals including, but not limited to, Namtam, Leghorn, Silkie, and Wyandotte. Skilled persons will readily appreciate a variety of other species and breeds that the invention may be applied to.
  • the invention may be described herein by reference to a "herd” of animals. This term should be taken broadly to include any group of animals of the same species. The term should be taken to encompass other collective nouns used to refer to a group of animals of any particular species, such as a "flock” or a “drove”.
  • “Increased tolerance to heat”, “increased heat tolerance” and like phrases should be taken broadly to mean that an animal is better able to maintain or regulate body temperature under heat stress than an animal that does not have a genetic alteration or other biological marker as described herein.
  • the animal has a lower average body temperature under heat stress than an animal that does not have a biological marker in accordance with the invention (including reference to the same animal if it did not have a biological marker in accordance with the invention).
  • substantially limited tolerance to heat and like phrases means that the animal has a limited or substantially no capacity to maintain or regulate its body temperature under heat stress.
  • the animal will have a higher average body temperature under heat stress than an animal that has a biological marker in accordance with the invention (including referene to the same animal if it had a biological marker in accordance with the invention).
  • Heat Stress should be taken broadly to mean exposure to a temperature of at least approximately 25°C.
  • the temperature may be calculated as a composite temperature taking into account any one or more of air temperature, humidity, radiant heat, and convection heat using known methods.
  • heat stress includes exposure to a Temperature Humidity Index (THI) of approximately 72.
  • THI Temperature Humidity Index
  • tick resistance should be taken broadly to describe the ability of an animal to resist ticks, limit the number of ticks carried on the coat and/or limit the number of ticks that survive to maturity compared to an animal that does not have a biological marker as described herein (including reference to the same animal if it did not have a biological marker in accordance with the invention). It should not be taken to mean that absolutely no ticks will affect, infest or attack an animal or that no ticks will survive to maturity.
  • the presence of a biological marker of the invention infers at least some level of "increased" resistance to ticks.
  • substantially limited resistance to ticks mean that an animal has a limited or substantially no ability to resist tick attack or infestation.
  • the animal in the presence of ticks, the animal will cany a higher number of ticks on its coat and/or a higher number of ticks which survive to maturity compared to an animal that has a biological marker in accordance with the invention (including referene to the same animal if it had a biological marker in accordance with the invention).
  • the "worth” of an animal refers to an index used to evaluate the value of an animal, for breeding purposes, inclusion in a herd, herd management, for example.
  • the “worth” is the sum of the estimated value of one or more characteristics which may be associated with the animal, typically weighted by an economic value. Exemplary characteristics include milk fat, protein, milk volume, liveweight, fertility, and milk somatic cells, growth rate, feed conversion efficiency, and egg production.
  • the term “worth” should be taken to encompass “breeding worth” and other known indexes used to assess the value of an animal. Persons skilled in the art to which the invention relates will readily appreciate methods and formulae suitable for estimating breeding worth on the basis of any number of different characteristics. Results, data and/or information generated by a method of the invention may be used in calculations for estimating "worth".
  • any appropriate breeding methods may be utilised including for example natural insemination, artificial insemination and in vitro fertilisation (IVF). Accordingly, the word "mating” should be construed broadly and not limited to the physical pairing of two animals. It should be appreciated that methods of breeding animals may involve one or more gene editing steps and/or cloning techniques.
  • the methods of the invention may be used to identify animals suitable for cloning. They may also be used during cloning processes, to determine whether or not one or more cell, embryo or cloned animal has a genetic variation in the PRLR gene and is likely to have (or develop into an animal having) an increased tolerance to heat, an increased resistance to ticks, and/or desirable coat texture. Any appropriate cloning method could be used. However, by way of example, such cloning techniques include somatic cell nuclear transfer, chromatin transfer, and embryo splitting. Persons of general skill in the art will readily appreciate appropriate somatic cell nuclear transfer and chromatin transfer methodologies.
  • IVF IVF
  • any appropriate IVF methodology may be used, as will be apparent to persons of general skill in the art to which the invention relates.
  • appropriate methods are described, for example, in: Imai K, Tagawa M, Yoshioka H, Matoba S, Narita M, et al. (2006) The efficiency of embryo production by ovum pick-up and in vitro fertilization in cattle. J Reprod Dev 52: 19-29.
  • the standard may comprise any appropriate sample or other information sufficient to compare the results from a sample from an animal against.
  • the standard may be a control sample comprising PRLR (including reference to one or more isoform, precursor and/or fragment thereof) and/or nucleic acid encoding same from an animal with a known phenotype, which is tested concurrently with a sample from an animal to be tested.
  • the standard could be a printed chart or electronic information or the like containing previously generated data considered to provide an appropriate standard and which the test samples could be compared to on the basis of colour, fluorescence levels, or numerical values, for example. Examples of appropriate standards will be elucidated further herein after.
  • the standard will be representative of an animal that has a substantially limited tolerance to heat, an increased resistance to ticks, and/or an undesirable coat texture. In another embodiment, the standard will be representative of an animal that has an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture. In certain embodiments, both of these standards may be used.
  • Methods of the invention may involve taking a "sample” from an animal to be tested.
  • the sample may be any appropriate tissue or body fluid sample.
  • the sample may comprise one or more cell, blood, muscle, bone, somatic cell(s), saliva, skin, liver, brain, placenta, amniotic fluid and/or semen.
  • a "sample” can be taken from an animal using standard techniques known in the art. It should be appreciated that a sample may be taken from an animal at any stage of life, including prior to birth; by way of non-limiting example, a zygote, an embryo, a foetus. Individual gametes could also be tested using the methods of the invention. This may assist in breeding and/or cloning programmes. Accordingly, "sample” should be taken to include a zygote, embryonic tissue, foetal tissue and gametes. A sample may also be taken after the death of an animal.
  • analysis or obseration of a nucleic acid or peptide of an animal is conducted during gestation, the analysis or observation could be conducted by analysing protein, peptide, nucleic acid or one or more cell of that animal that may be present in the maternal blood supply, placenta, amniotic fluid or any other maternal tissue or fluid prior to birth of the animal.
  • reference to analysing a nucleic acid from an animal analysing PRLR, a precursor, an isoform and/or fragment thereof from an animal, observing the level of one or more PRLR, a precursor, an isoform and/or fragment thereof in an animal, and/or observing the level of activity of a PRLR, a precursor, an isoform and/or fragment thereof in an animal, and the like, should be taken to include reference to analysing and/or observing one or more of these from that animal that may be present in a maternal tissue or fluid.
  • Embryo should be taken broadly to include an organism from the first division of the zygote. In certain embodiments, an embryo is an organism between the first division of the zygote until the time it becomes a foetus. Reference to an "embryo” should be taken to include reference to an organism at different developmental stages, including a blastula, blastocyst, gastrula, and morula for example.
  • the invention provides methods for the selection or rejection of one or more cells.
  • such "cells” may include a gamete (for example, sperm or ovum) or zygote. Selection of such cells may be of use in an IVF program, for example.
  • such "cells” may be somatic cells, embryonic cells, embryonic stem cells, cells in a cell line, one or more cells of use in cloning, for example. Selection of these cells may be of use in cloning procedures, or preparing cell lines for use in cloning and other procedures, for example. Certain aspects and embodiments of the invention may be described herein with reference to "fusing a first and second gamete" to form a zygote.
  • This phrase should be taken broadly to include fertilisation processes, such as may be used in in vitro fertilisation processes. Skilled persons will readily appreciate standard means of "fusing" gametes to form a zygote.
  • the methods of the invention may be described herein after in terms of analysing a biological marker (such as a nucleic acid sequence, amino acid sequence, level of a protein and peptide or activity level of a protein or peptide) in or from an "animal” or to determine whether or not an "animal” has a particular marker linked to or associated with an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture or determining the genotype of an "animal", and the like.
  • a biological marker such as a nucleic acid sequence, amino acid sequence, level of a protein and peptide or activity level of a protein or peptide
  • the invention may be described herein with reference to an amino acid or nucleic acid sequence, or a level or level of activity of PRLR (including reference to one or more isoform, precursor or fragment thereof) and/or one or more nucleic acid encoding same being "indicative" of an animal (or animals) who has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture. "Indicative" should not be taken to mean that the level is exactly the same as a level associated with such animal or animals. However, in one embodiment the level or level of activity is substantially similar to or substantially the same as that associated with such animal or animals.
  • an amino acid or nucleic acid sequence, or a level or level of activity of PRLR including reference to one or more isoform, precursor or fragment thereof
  • one or more nucleic acid encoding same is "indicative" of an animal (or animals) who has or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture using the various methods as described herein; for example, comparing the results from a test sample against one or more standard or reference.
  • Reference to "animal or animals” should be taken to mean that a particular reference or standard is based on a value from a single animal or pooled or averaged from a group of animals.
  • the specific marker identified herein is located in the PRLR gene at a nucleotide position on chromosome 20 of Bos Taurus.
  • the sequence and position given for this gene and the specific genetic marker is based on the genomic sequence of chromosome 20 in bovine build UMD3.1 (gil258513347lreflAC_000177.1l) in the GenBank database http://www.ncbi.nlm.nih.gov/).
  • the position of the genetic marker should be read in accordance with base position being the start site of the alteration, given that the first nucleotide in the sequence (gil258513347lreflAC_000177.1l) is denoted as position one.
  • sequence information for the PRLR gene and its location on chromosome 20 is provided on NCBI databases: Reference sequence NM_001039726.2 and Gene ID: 281422, for example.
  • the PRLR gene maps to 38,951,611 and 39,146,316 (excluding promoter sequences).
  • Reference herein to the location of a specific genetic alteration within the PRLR gene is to be read relative to its position within the long form gene.
  • reference herein to the location of a specific amino acid variation within PRLR is to be read relative to its position within the long form PRLR protein of Bos Taurus.
  • Exemplary transcript and protein sequence information for Bos taurus PRLR are provided in Figures 1 and 2 herein.
  • the start codon begins at position 85 which corresponds to position 39115293 on UMD 3.1 ; exon 1 as published by NCBI starts at 39115245; the stop codon begins at position 1828 in mRNA sequence which is at position 39136922 in genome build UMD3.1 ; the base deletion identified by the inventors is at position 1466 and genomic position 39136559. It should be appreciated that there was a previous version of this NCBI sequence
  • the start codon begins at position 87 which corresponds to position 39115293 on UMD 3.1 ; exon 1 as published by NCBI starts at 39115245; the stop codon begins at position 1830 in mRNA sequence which is at position 39136922 in genome build UMD3.1 ; the base deletion identified by the inventors is at position 1468 in the mRNA sequence which corresponds to genomic position 39136559.
  • the precise location of the genetic marker of the invention may vary slightly from genome to genome; for example, in a different species of animal, or different breed of animal, the location of the marker may vary.
  • the precise location of any amino acid variation in a PRLR protein may vary slightly from proteome to proteome; for example, in different species of animal, or different breeds of animal, the location of an alteration may vary.
  • persons of skill in the art to which the invention relate will be able to readily identify a particular marker in different genomes and/or PRLR proteins (including isoforms, fragments and precursors thereof) through routine sequence alignment and with knowledge that it resides in the PRLR gene/PRLR protein ((including isoforms, fragments and precursors thereof).
  • the marker is described herein as being “at a position corresponding to X position of chi mosome 20 of Bos Taurus", X being the nucleotide or base pair number read against the chromosome 20 sequence in the UMD3.1 genome build.
  • the amino acid variation may be described herein as being “at a position corresponding to Y position of PRLR (or the long-form of PRLR) in Bos Taurus", Y being the amino acid number read relative to the Bos Taurus PRLR sequence provided in Figure 2 herein after.
  • Exemplary PRLR nucleic acid and amino acid sequence information for animals other than Bos Taurus can be found on NCBI databases. However, the following database accession numbers are given by way of example:
  • any variation in nucleotide sequence at this genetic locus may be indicative of an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • any variation in the nucleotide sequence of the PRLR gene which results in an increase in activity of PRLR may be indicative of an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture. The invention should be interpreted accordingly.
  • Such variations may include for example, the addition of one or more nucleotide, the deletion of one or more nucleotide, the substitution of one or more nucleotide or combinations of two or more thereof.
  • one or more alteration is located within a region bounded by nucleotides corresponding to positions 39136469 and 39136649 of chromosome 20 of Bos Taurus.
  • one or more alteration is located within a region bounded by nucleotides corresponding to positions 39136498 and 39136620, to positions 39136528 and 39136590, or to positions 39136543 and 39136575.
  • the one or more genetic alteration is located in the final exon of the PRLR gene; for example, a region bounded by nucleotides corresponding to positions 39136033 to 39136920 of chromosome 20 of Bos Taurus. In one embodiment, one or more alteration results in an alanine to valine substitution at a position corresponding to position 461 of PRLR of Bos Taurus.
  • one or more genetic alteration results in truncation of the transcript or peptide expressed from the PRLR gene
  • one or more alternation results in a truncation of PRLR to an amino acid position which is in a region from approximately an amino acid position corresponding to position 430 to an amino acid position corresponding to position 490 of PRLR of Bos Taurus
  • a truncation of PRLR to an amino acid position which is in a region from approximately an amino acid position corresponding to position 450 to amino acid position 470 of PRLR of Bos Taurus or a truncation of PRLR to an amino acid position which is in a region from approximately an amino acid position corresponding to position 455 to amino acid position 465 of PRLR of Bos Tauras.
  • one or more alternation results in truncation of PRLR to a position corresponding to amino acid position 461 of PRLR of Bos Taurus. In one embodiment, one or more alternation results in substitution of an alanine with a valine at position 461 and truncation of PRLR to a position corresponding to amino acid position 461 of PRLR of Bos Taurus.
  • any variation amino acid sequence at the same position may be indicative of an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • any variation in the amino acid sequence of a PRLR which results in an increase in activity of PRLR may be indicative of an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the invention should be interpreted accordingly.
  • Such variations may include for example, the addition of one or more amino acid, the deletion of one or more amino acid, the substitution of one or more amino acid or combinations of two or more thereof.
  • one or more amino acid variation is located in a region corresponding to amino acid position 430 to amino acid position 490 of PRLR of Bos Taurus, in a region corresponding to amino acid position 440 to amino acid position 480 of PRLR of Bos Taurus, in a region corresponding to amino acid position 450 to amino acid position 470 of PRLR of Bos Taurus or in a region corresponding to amino acid position 455 to amino acid position 465 of PRLR of Bos Taurus.
  • one or more amino acid variation is an alanine to valine substitution at a position corresponding to position 461 of PRLR of Bos Taurus, i one particular embodiment, one or more variation in the amino acid sequence is a deletion resulting in truncation of PRLR.
  • one or more variation results in a truncation of PRLR to an amino acid position which is in a region from approximately an amino acid position corresponding to position 430 to an amino acid position corresponding to position 490 of PRLR or Bos Taurus, a truncation of PRLR to an amino acid position which is in a region from approximately an amino acid position corresponding to position 440 to amino acid position 480 of PRLR of Bos Taurus, a truncation of PRLR to an amino acid position which is in a region from approximately an amino acid position corresponding to position 450 to amino acid position 470 of PRLR of Bos Taurus, or a truncation of PRLR to an amino acid position which is in a region from approximately an amino acid position corresponding to position 455 to amino acid position 465 of PRLR of Bos Taurus.
  • one or more alternation results in a truncation of PRLR to a position corresponding to amino acid position 461 of PRLR of Bos Taurus.
  • one or more amino acid variation is a substitution of an alanine with a valine at position 461 and truncation of PRLR to a position corresponding to amino acid position 461 of PRLR of Bos Taurus.
  • the inventors note that the specific alteration referred to in table 3 is dominant in nature. They believe this will be the case for other alterations in the PRLR gene.
  • an animal is heterozygous for an alteration it will be inferred that it is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the methods of the invention do not require a determination of the homo- or heterozygosity of an animal.
  • the methods of the invention involve the analysis of a nucleic acid (including one or more nucleic acid) from an animal to determine the presence or absence of one or more genetic alteration in the PRLR gene.
  • a nucleic acid including one or more nucleic acid
  • Such one or more genetic alterations will be indicative of an animal and/or animals that has/have or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the one or more genetic alterations result in an increase in the activity of PRLR.
  • one or more genetic alteration may be identified by observing the size of the PRLR gene or a part or region thereof.
  • one or more alteration is located within a region bounded by nucleotides corresponding to positions 39136469 and 39136649 of chromosome 20 of Bos Taurus.
  • one or more alteration is located within a region bounded by nucleotides corresponding to positions 39136498 and 39136620, to positions 39136528 and 39136590, or to positions 39136543 and 39136575.
  • the one or more genetic alteration is located in the final exon of the PRLR gene; for example, a region bounded by nucleotides corresponding to positions 39136033 to 39136920 of chromosome 20 of Bos Taurus.
  • the methods involve the analysis of a nucleic acid (including one or more nucleic acid) to determine the nucleotide present at a position corresponding to position 39136559 of chromosome 20 of Bos taurus.
  • the methods may involve analysising the nucleotide sequence of a nucleic acid to determine the nucleotide sequence of one or more genetic marker in linkage disequilibrium with a genetic alteration in the PRLR gene, for example a genetic marker (genetic variation) at the above mentioned position.
  • the methods of the invention may involve analysing the nucleotide sequence of a nucleic acid to determine the haplotype of an animal, one or more cells or an embryo, for example, wherein the haplotype includes the genetic marker (genetic variation in the PRLR gene) mentioned above in combination with one or more genetic markers in linkage disequilibirum therewith.
  • the haplotype includes the genetic marker (genetic variation in the PRLR gene) mentioned above in combination with one or more genetic markers in linkage disequilibirum therewith.
  • nucleic acid sequence of either strand of the nucleic acid could be analysed.
  • nucleic acid sequence variations on such opposite strand which correlate with the genotypes mentioned above, having regard to the information contained herein and nucleic acid base pairing principles (ie, A pairs with T and C pairs with G).
  • Nucleic acids can be analysed to determine the genotype/sequence of a genetic marker according to any appropriate technique.
  • Such techniques include for example polymerase chain reaction (PCR), including allele-specific PCR, gel electrophoresis, the use of oligonucleotide probe hybridisation, Southern blotting, direct sequencing, restriction digestion, restriction fragment length polymorphism (RFLP), single-strand confirmation polymorphism (SSCP), LCR (ligase chain reaction), denaturing gradient gel electrophoresis (DGGE), the use of allele-specific oligonucleotides (ASOs), the use of proteins which recognize nucleic acid mismatches, such as E.coli mutS protein, RNAse protection assays, oligonucleotide aixay hybridisation (for example microarray), denaturing HPLC (dHPLC), fluorescence quenching PCR (TaqManTM Applied Biosystems, CA 94404, USA), High Resolution Melting (HRM), matrix-
  • analysis can be conducted on a single cell. In such cases, genome
  • Tumour evolution inferred by single-cell sequencing could be used.
  • SNPs single nucleotide polymorphisms
  • RFLP allele-specific PCR
  • SSCP SSCP
  • DGGE allele-specific oligonucleotides
  • ASOs allele-specific oligonucleotides
  • proteins which recognize nucleic acid mismatches oligonucleotide array hybridisation, dHPLC, fluorescence quenching PCR, and matrix MALDI-TOF MS.
  • any one or more of the techniques mentioned hereinbefore may be used to analyse genetic markers which may include insertion or deletion of one or more nucleotide.
  • certain of the techniques of use in analysing a genetic marker in accordance with the invention will utilise one or more oligonucleotides which hybridise to a genetic region encompassing the marker, adjacent to the marker, or flanking the marker.
  • Such oligonucleotides may be DNA, RNA or derivatised forms thereof and include nucleic acid primers, such as PCR and LCR primers, and nucleic acid probes.
  • nucleic acid sequence of the PRLR gene, chromosome 20 particularly in the genetic regions proximal to a genetic marker, the nature of the genetic marker to be analysed, and the general principles of nucleic acid hybridisation.
  • the nucleic acids will be capable of hybridising in a specific manner to a target nucleic acid and in the case of primers they will be capable of priming a PCR or like reaction.
  • nucleic acids While such nucleic acids will preferably have 100% complementarity to their target region of the mRNA or cDNA of the protein of interest, they may contain one or more non-complementary nucleotides at a particular position while still substantially retaining specificity for the target nucleic acid to which they are designed to bind.
  • the nucleic acids may have approximately 80%, approximately 90%, approximately 95%, or approximately 99% complementarity or homology to its target.
  • the oligonucleotides may be designed such that a mismatch at a particular nucleotide position is indicative of the nature of the genetic marker being analysed (for example, a SNP).
  • a mismatch in the nucleotide present at the 3' end of an LCR primer will inhibit the reaction providing an indication of the nature of the nucleotide at that position.
  • Mismatches may similarly be utilised in techniques including RNAse protection assays and allele-specific PCR, as well as in fluorescence quenching PCR, for example.
  • the nucleic acids will hybridise to their target nucleic acid under stringent hybridisation conditions (see for example, Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 2001, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York).
  • oligonucleotide probes or primers may be of any length as is appropriate for a particular application, having regard to the sequence of the genetic region to which they are designed to bind.
  • a probe or primer will typically be capable of forming a stable hybrid with the complementary sequence to which it is designed to hybridise. Accordingly, the length is dependent on the nucleic acid composition and percent homology between the oligonucleotide and its complementary sequence, as well as the hybridisation conditions which are utilised (for example, temperature and salt concentrations). Such hybridisation factors are well known in the art to which the invention relates.
  • oligonucleotides of use in the present invention may be from 2 to 500 nucleotides in length. In one embodiment, particularly where they are used as primers, the oligonucleotides may be of approximately 15 nucleotides to 30 nucleotides in length.
  • Non-limiting examples of oligonucleotides of use in the invention include
  • oligonucleotides are used as forward and reverse primers in a method of the invention which utilizes PCR.
  • the oligonucleotides CCTATTTTCTGGCCAATGGA (SEQ ID No. 1) and CAGCCCAACTGGAGTCTGC (SEQ ID No. 2) and/or functionally equivalent variants of one or more thereof are used as forward and reverse primers for detection of a genetic alteration at position 39136559 of chromosome 20 of Bos taurus in accordance with a method of the invention.
  • Oligonucleotide probes and primers of use in the invention may be prepared by any number of conventional DNA synthesis methods including recombinant techniques and chemical synthesis, or they may be purchase commercially.
  • any probe or primer may be evaluated, at least notionally, using appropriate software and sequence information for the nucleic acid encoding the protein of interest.
  • software packages such as Primer3 (http://primer3.sourceforge.net ), PC 01igo5 (National Bioscience Inc), Amplify (University of Wisconsin), and the PrimerSelect program (DNAStar Inc) may be used to design and evaluate primers.
  • amplification techniques for example PCR
  • amplification may be conducted according to conventional procedures in the art to which this invention relates, such as described in US Patent No 4,683,202.
  • PCR reactions will generally include 0.1 ⁇ -1 ⁇ of each primer, 200 ⁇ each dNTP, 3-7mM MgCl 2 , and 1U Taq DNA polymerase.
  • exemplary PCR cycling conditions include: denaturation at a temperature of approximately 94°C for 30 to 60 seconds, annealing at a temperature calculated on the basis of the sequence and length of the primer (as herein after discussed) for 30 to 60 seconds, and extension at a temperature of approximately 70°C to 72°C for 30 to 60 seconds. By way of example, between 25 and 45 cycles are run.
  • any amplification conditions provided herein are merely exemplary and may be varied so as to optimise conditions where, for example, alternative PCR cyclers or DNA polymerases are used, where the quality of the template DNA differs, or where variations of the primers not specifically exemplified herein are used, without departing from the scope of the present invention.
  • the PCR conditions may be altered or optimised by changing the concentration of the various constituents within the reaction and/or changing the constituents of the reaction, altering the number of amplification cycles, the denaturation, annealing or extension times or temperatures, or the quantity of template DNA, for example.
  • PCR conditions may be optimised to overcome variability between reactions.
  • annealing temperatures for any primer within the scope of the present invention may be derived from the calculated melting temperature of that primer. Such melting temperatures may be calculated using standard formulas, such as that described in Sambrook and Russell, 2001. As will be understood by those of ordinary skill in the art to which this invention relates annealing temperatures may be above or below the melting temperature but generally an annealing temperature of approximately 5°C below the calculated melting temperature of the primer is suitable.
  • Oligonucleotides used for detection and/or analysis of genetic markers in accordance with the invention may be modified to facilitate such detection.
  • nucleic acid products obtained using techniques such as PCR may be modified to facilitate detection and/or analysis.
  • the nucleic acid molecules may be labelled to facilitate visual identification using techniques standard in the art.
  • nucleic acids may be radio-labelled using P 32 as may be described in Sambrook and Russell, 2001. Further, nucleic acids may be appropriately labelled for use in colori genie, fluorogenic or chemiluminescence procedures.
  • control samples may be positive or negative controls for a particular genetic marker.
  • the type of control samples used may vary depending on such factors as the nature of the genetic marker being analysed and the specific technique being used for such detection and analysis.
  • Positive controls may include samples having known nucleic acid sequences or being of a known size, for example.
  • Negative controls may include samples having no nucleic acid present.
  • SNP positive control samples could include nucleic acids known to have a particular nucleotide at the relevant position.
  • the method may utilise a control sample having a sequence which is not associated with increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture or is associated with substantially limited tolerance to heat, a substantially limited resistance to ticks, and/or an undesirable coat texture.
  • the method may utilise a control sample having a sequence which is associated with increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the methods of this embodiment of the invention may involve comparing the sequence of a nucleic acid being tested to one or more reference sequences, as herein before described.
  • the methods of the invention may involve taking a sample (as herein before described) from an animal to be tested.
  • the samples are analysed using techniques which allow for the observation or analysis of nucleic acids, including the sequence of a particular nucleic acid.
  • a sample may be processed prior to analysis.
  • the sample may be processed to isolate nucleic acid from the sample to be analysed or to amplify a specific genetic region to be analysed.
  • nucleic acid is isolated or extracted from the sample prior to analysis.
  • genomic DNA is isolated or extracted from the sample
  • mRNA may be isolated or extracted from the sample.
  • the mRNA may be converted to cDNA using reverse transcription techniques known in the art. Techniques for isolating nucleic acids from samples will be readily appreciated by skilled persons. By way of Example, methods of use in isolating nucleic acids are described in Sambrook and Russell, 2001.
  • analysis of the nucleic acid may occur in situ obviating the need to extract nucleic acid from the sample. This may be done using PCR for example. Skilled persons will readily appreciate appropriate techniques and methodology to this end (see for example, Sambrook and Russell, 2001).
  • the methods of the invention may be combined with one or more other methods of use in assessing genotype, predicting phenotype, selecting an animal, cell or embiyo based on certain characteristics, estimating breeding values or estimating worth and the like. Accordingly, the methods of the invention may include, in addition to analysis of a genetic marker identified herein, analysis of additional genetic markers, and/or the level of expression of certain genes/proteins, and/or one or more phenotypic traits, for example.
  • the invention also provides nucleic acids carrying genetic markers of the invention.
  • isolated nucleic acids encompassing a region of a PRLR gene in which a genetic marker as herein before described resides are encompassed by the invention.
  • the invention also encompasses nucleic acids which can hydridise, preferably under stringent conditions (as herein before described), to a region of a PRLR gene in which one or more of genetic marker of the invention resides.
  • nucleic acids may be used as primers or otherwise in analysis of genetic markers of the invention, as herein before described.
  • Nucleic acids of the invention may have 100% sequence identity, homology or complementarity to the relevant region of a PRLR gene, but may also have some sequence variation. For example, nucleic acids of the invention may have approximately 80%, approximately 90%, approximately 95% or approximately 99% sequence identity, homology or complementarity.
  • the nucleic acids of the invention may be of any appropriate length. In one embodiment, they are at least 4 nucleotides in length, or at least 10, 20, 30, 40, 50, 60, 70, 80 or more nucleotides in length.
  • the invention provides a nucleic acid comprising (or in one embodiment consisting of) the nucleotide sequence GACCAAACAGACCAACATG (C) del TTTAAAAGCCTCAAAAACCA wherein (C)del indicates the absence of a C at that position (ie.
  • a nucleic acid of the invention comprises (or in one embodiment consisting of) the nucleotide sequence CCTATTTTCTGGCCAATGGA (SEQ ID No. 1),
  • CAGCCCAACTGGAGTCTGC SEQ ID No. 2
  • nucleic acids may be used as primers in a method of the invention which involves the use of PCR.
  • the invention provides one or more cDNA comprising a genetic alteration as described herein or encoding a PRLR, isoform, fragment or precursor thereof, including those comprising one or more variation in the amino acid sequence.
  • the methods of the invention comprise analysing one or more of PRLR, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof from said animal to determine whether or not it includes one or more variation in the amino acid sequence.
  • Such one or more variation in the amino acid sequence will be indicative of an animal and/or animals that has/have or is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the one or more variation results in an increase in the activity of PRLR.
  • the variation in the amino acid sequence may be the addition of one or more amino acid, the deletion of one or more amino acid, the substitution of one or more amino acid or a combination of two or more thereof.
  • the variation in the amino acid sequence is a deletion of one or more amino acid. In one embodiment, the one or more variation is an amino acid substitution. In one embodiment, the amino acid sequence of PRLR is truncated. In certain embodiments, the one or more variation in the amino acid sequence is as herein before described.
  • one or more variation in the amino acid sequence may be identified by observing the size of PRLR, one or more precursor thereof, one or more isoform thereof and/or one or more fragment thereof.
  • the one or more amino acid variation is located in a region corresponding to amino acid position 430 to amino acid position 490 of PRLR of Bos Taurus, in a region corresponding to amino acid position 440 to amino acid position 480 of PRLR of Bos Taurus, in a region corresponding to amino acid position 450 to amino acid position 470 of PRLR of Bos Taurus or in a region corresponding to amino acid position 455 to amino acid position 465 of PRLR of Bos Taurus.
  • one or more amino acid variation is an alanine to valine substitution at a position corresponding to position 461 of PRLR of Bos Taurus.
  • one or more variation in the amino acid sequence is a deletion resulting in truncation of PRLR.
  • one or more variation results in a truncation of PRLR to an amino acid position which is in a region from approximately an amino acid position corresponding to position 430 to an amino acid position corresponding to position 490 of PRLR or Bos Taurus, a truncation of PRLR to an amino acid position which is in a region from approximately an amino acid position corresponding to position 440 to amino acid position 480 of PRLR of Bos Taurus, a truncation of PRLR to an amino acid position which is in a region from approximately an amino acid position corresponding to position 450 to amino acid position 470 of PRLR of Bos Taurus, or a truncation of PRLR to an amino acid position which is in a region from approximately an amino acid position corresponding to position 455 to amino acid position 465 of PRLR of Bos Taurus.
  • one or more alternation results in a truncation of PRLR to a position corresponding to amino acid position 461 of PRLR of Bos Taurus.
  • one or more amino acid variation is a substitution of an alanine with a valine at position 461 and truncation of PRLR to a position corresponding to amino acid position 461 of PRLR of Bos Taurus.
  • a method of the invention could comprise testing for the presence or absence of a C- terrninal valine, for example.
  • the size of a protein may involve observation or measurement of the size of a protein, one or more precursor thereof, one or more isoform thereof, and/or one or more fragment thereof.
  • the presence of a PRLR which is 430 amino acids in length or shorter, 430 to 490 amino acids in length, 440 to 480 amino acids in length, 450 to 470 amino acids in length, 455 to 465 amino acids in length infers that an animal, cell or embryo carries a biological marker linked to an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • the presence of a PRLR which is 461 amino acids in length or smaller infers that an animal, cell or embryo carries a biological marker linked to an increased tolerance to heat, an increased resistance to ticks and/or a desirable coat texture.
  • PRLR isoforms thereof, precursors thereof, and/or fragments thereof
  • PRLR isoforms thereof, precursors thereof, and/or fragments thereof
  • peptide sequencing methods mass spectrometry, Western blotting and ELISA could be used.
  • the methods may employ one or more control samples, such as positive and/or negative controls for a particular amino acid sequence variation.
  • control samples such as positive and/or negative controls for a particular amino acid sequence variation.
  • the type of control samples used may vary depending on such factors as the type of variation being analysed and the specific technique being used for detection and analysis.
  • Positive controls may include samples having known amino acid sequences or being of a known size, for example.
  • Negative controls may include samples having no peptide present.
  • the method may utilise a control sample having a sequence which is not associated with increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture or is associated with substantially limited tolerance to heat, substantially limited resistance to ticks, and/or an undesirable coat texture.
  • the method may utilise a control sample having a sequence which is associated with increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the methods of this embodiment of the invention may involve comparing the sequence of a peptide or protein being tested to one or more reference sequences, as herein before described.
  • the methods of the invention may involve taking a sample for an animal to be tested.
  • a sample may be processed prior to analysis according to any of a number of known methods.
  • the sample may be processed to remove one or more one or more high abundance proteins that might make it difficult to analyse PRLR, an isoform, fragment or precursor thereof.
  • Exemplary techniques which may be employed to process a sample prior to analysis of PRLR, an isoform, fragment or precursor thereof are described elsewhere herein.
  • the invention also provides peptides and proteins carrying biological markers of the invention.
  • isolated peptides or proteins encompassing a region of PRLR in which a biological marker as herein before described resides are encompassed by the invention.
  • the peptides or proteins of the invention may be of any appropriate length. In one embodiment, they are at least 4 amino acids in length, or at least 10, 20, 30, 40, 50, 60, 70, 80 or more amino acids in length.
  • the invention provides a peptide consisting or comprising (or in one embodiment consisting of) the amino acid sequence of SEQ ID No. 7.
  • the methods of the invention involve observing the level of one or more of PRLR (including reference to any one or more isoform of PRLR, any one or more precursor of PRLR, any one or more fragment of PRLR), and/or any one or more nucleic acid encoding one or more of the foregoing.
  • an increase in the level for example, an increase in the level of expression
  • PRLR including reference to one or more isoform, precursor or fragment thereof
  • a nucleic acid encoding same infers an animal will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture. Therefore, the inventors contemplate that any increase in the level may be considered to infer an increased tolerance to heat (and/or an increased resistance to ticks and/or a desirable coat texture) in the animal and/or its offspring.
  • a decrease or substantially no increase in the level (for example, the level of expression) compared to a standard may also infer a decreased or substantially no increase in tolerance to heat, increase in resistance to ticks, and/or an undesirable coat texture for the animal and/or its offspring.
  • the methods may taking a sample from an animal, observing the level (in one embodiment the level of expression) of PRLR (including reference to one or more isoform, precursor and/or fragment thereof) or nucleic acids encoding same, and comparing the level against one or more standard.
  • the levels observed in the sample and any difference in the level between the sample and the standard infers whether the animal will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the standard represents a level of PRLR (including reference to one or more isoform, precursor and/or fragment thereof) and/or a nucleic acid encoding same, which is associated with a level in an animal or animals which have substantially limited tolerance to heat, substantially limited resistance to ticks, and/or an undesirable coat texture.
  • the standard represents a level of PRLR (including reference to one or more isoform, precursor and/or fragment thereof) and/or a nucleic acid encoding same which is associated with a level in an animal (or animals) which has an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • a higher level of PRLR including reference to one or more isoform, precursor and/or fragment thereof
  • a nucleic acid encoding same compared to a standard infers that the animal will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • substantially similar to, substantially the same as or a lower level of PRLR (including reference to one or more isoform, precursor or fragment thereof) or a nucleic acid encoding same infers that the animal will more likely than not have a decreased or substantially limited or substantially no increased tolerance to heat, increased resistance to ticks, and/or an undesirable coat texture.
  • the standard represents a level of PRLR (including reference to one or more isoform, precursor and/or fragment thereof) and/or a nucleic acid encoding same which is associated with a level in an animal (or animals) which has an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture
  • the animal being tested has a level of PRLR (including reference to one or more isoform, precursor and/or fragment thereof) or a nucleic acid encoding same substantially similar to, substantially the same as or higher than the standard, it is inferred that the animal will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the animal being tested has a level lower than the standard, it may be inferred that the animal will more likely than not have a decreased or substantially limited or substantially no increased tolerance to heat, substantially no increased resistance to ticks, and/or an undesirable coat texture.
  • PRLR including reference to one or more precursors, fragments and/or isoforms thereof
  • nucleic acids encoding same may be detected and the levels thereof compared to a standard using any one or a combination of techniques which are of use in identifying, quantifying and/or highlighting differential levels or expression of one or more proteins. Such techniques will be readily appreciated by persons of ordinary skill in the art to which the invention relates.
  • the levels of PRLR may be measured using protein purification methods, immunological techniques, separation of proteins based on characteristics such as molecular weight and isoelectric point including gel electrophoresis (for example, PAGE) and microfluidics-based technologies as for example in gel-free protein separation techniques, and mass spectrometry (MS) utilizing isobaric label based MS such as iTRAQ or label-free approaches such as multiple reaction monitoring (MRM).
  • protein purification methods immunological techniques, separation of proteins based on characteristics such as molecular weight and isoelectric point including gel electrophoresis (for example, PAGE) and microfluidics-based technologies as for example in gel-free protein separation techniques, and mass spectrometry (MS) utilizing isobaric label based MS such as iTRAQ or label-free approaches such as multiple reaction monitoring (MRM).
  • MRM multiple reaction monitoring
  • Appropriate immunological techniques include enzyme linked immunosorbent assay (ELISA) (sandwich ELISA, double sandwich ELISA, direct ELISA, microparticle ELISA), radioimmunoassay (RIA), immunoprecipitation, Western blotting, immunohistochemical staining, antibody arrays, or agglutination assays. Protocols for carrying out such techniques are readily available; for example, see “Antibodies a Laboratory Manual", Cold Spring Harbor Laboratory Press (1988). Antibodies of use in such immunological techniques may be purchased commercially or produced according to standard methodology in the art having regard to the nature of the proteins to be tested.
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • polyclonal antibodies and monoclonal antibodies may be produced in accordance with the procedures described in the text "Antibodies a Laboratory Manual” (Cold Spring Harbor Laboratory Press, 1988) using one or more of the proteins or a fragment thereof as antigen.
  • monoclonal antibodies are used.
  • Nucleic acid-based techniques of use in determining the level of a nucleic acid may include differential display procedures, Northern Blotting, competitive PCR, quantitative reverse transcriptase polymerase chain reaction (qRT-PCR), microarray analysis, and RNA sequencing. Persons skilled in the art to which the invention relates will readily appreciate methodology for performing these techniques.
  • Nucleic acids such as oligonucleotide probes and primers, of use in detecting expression levels of proteins in accordance with the invention (for example using Northern blotting or competitive PCR) will be readily appreciated by skilled persons having regard to the information contained herein and any published amino acid and/or nucleic acid sequence information for PRLR.
  • the nucleic acids will be capable of hybridising in a specific manner to an mRNA or cDNA associated with PRLR and in the case of primers they will be capable of priming a PCR or like reaction.
  • Mass spectroscopy techniques of use in the invention are described for example in "Proteins and proteomics-A laboratory manual” (RI Simpson, Cold Spring Harbour Laboratory Press (2002).
  • the levels of PRLR (including reference to one or more fragment, precursor and/or isoform) or nucleic acids encoding same in a sample versus a standard may be compared using standard technology having regard to the method employed to detect the protein or nucleic acid.
  • colorimetric and fluorometric techniques may be used in which a detection molecule (such as an antibody or nucleic acid probe or primer) is labelled with a molecule which can be visualised by the naked eye or otherwise detected using a spectrophotometer, or fluorometer for example.
  • detection molecules could be labelled with radio-isotopes.
  • Incorporating labels into nucleic acids during PCR amplification where it is employed (as opposed to labelling a detection molecule such as a probe or primer), is also contemplated.
  • the methods of the invention may include the testing of one or more positive or negative control samples to ensure the integrity of the results.
  • a sample taken from an animal may be processed prior to analysing PRLR (including reference to one or more isoform, precursor and/or fragment) and/or a nucleic acid encoding same to facilitate analysis of the proteins or nucleic acids.
  • PRLR including reference to one or more isoform, precursor and/or fragment
  • high abundance proteins which have the potential to make it difficult to analyse such as detect and/or measure the level of PRLR (including reference to one or more isoform, precursor and/or fragment) may be removed from the sample.
  • detect and/or measure the level of PRLR including reference to one or more isoform, precursor and/or fragment
  • top6 or Top7 depletion may be used.
  • the sample may also be subject to proteolytic digestion.
  • detection of a protein or isoform in accordance with the invention should be taken to include detection of any one or more fragments thereof. Fragments should be of a length sufficient to ensure specificity to PRLR. Such fragments will for example be at least 8 amino acids in length, more preferably at least 10, 15 or 20 amino acids in length.
  • Processing steps for preparing a sample for analysis of nucleic acids encoding PRLR may include lysing cells, isolating mRNA, and generating cDNA using standard procedures such as reverse transcription-PCR as will be known in the art to which the invention relates.
  • mRNA may be observed in situ.
  • methods of the invention may involve observing the level of activity of PRLR (including reference to one or more precursor, isoform and/or fragment thereof).
  • PRLR including reference to one or more precursor, isoform and/or fragment thereof.
  • an increase in the level of activity of PRLR infers the animal will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture. Therefore, the inventors contemplate that any increase in the level of activity may be considered to infer an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture in the animal and/or its offspring.
  • a decrease or substantially no increase in the level of activity compared to a standard may also infer a decreased or substantially no increase in tolerance to heat, increase in resistance to ticks, and/or an undesirable coat texture for the animal and/or its offspring.
  • the methods may involve taking a sample from an animal, observing the level of activity of PRLR (including reference to one or more isoform, precursor and/or fragment thereof), and comparing the level of activity against one or more standard. The level of activity observed in the sample and any difference between the sample and the standard infers whether the animal will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the standard represents a level of activity of PRLR (including reference to one or more isoform, precursor and/or fragment thereof) which is associated with a level in an animal or animals which have substantially limited tolerance to heat, substantially limited resistance to ticks, and/or an undesirable coat texture.
  • the standard represents a level of activity of PRLR (including reference to one or more isoform, precursor and/or fragment thereof) which is associated with a level in an animal (or animals) which has an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • a higher level of activity of PRLR (including reference to one or more isoform, precursor and/or fragment thereof) compared to a standard (having a level which is associated with an animal or animals which have substantially limited tolerance to heat, substantially limited resistance to ticks, and/or an undesirable coat texture, for example) infers that the animal will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • a standard having a level which is associated with an animal or animals which have substantially limited tolerance to heat, substantially limited resistance to ticks, and/or an undesirable coat texture, for example
  • PRLR (including reference to one or more isoform, precursor or fragment thereof) infers that the animal will more likely than not have a decreased or substantially limited or substantially no increased tolerance to heat, substantially no increased resistance to ticks, and/or an undesirable coat texture.
  • the standard represents a level of activity of PRLR (including reference to one or more isoform, precursor and/or fragment thereof) which is associated with a level in an animal (or animals) which has an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture and the animal being tested has a level of activity of PRLR (including reference to one or more isoform, precursor and/or fragment thereof) substantially similar to, substantially the same as, or higher than the standard, it is inferred that the animal will more likely than not have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the level of activity of PRLR may be measured using standard methodology as known in the art, having regard to the function of PRLR.
  • the methods used may involve one or more of the following techniques: Immunoprecipitation, Western blotting, ELISA, mass spectrometry, surface plasmon resonance, isothermal titration calorimetry, luciferase assays and reporter gene assays.
  • the activity of PRLR may be measured by measurement of one or more event downstream of PRLR signalling, such phosphorylation of one or more molecule, could be used.
  • methods involving immunoprecipitation with a PRLR antibody followed by Western blot or ELISA measuring tyrosine phosphorylation of JAK2 (Janus Kinase 2) and/or other phosphorylated molecules downstream of PRLR signalling could be used.
  • JAK2 Janus Kinase 2
  • other phosphorylated molecules downstream of PRLR signalling could be used.
  • the methods described in Perot-Applanat et al, 1997, Mol Endo 11(8) could be used.
  • the level of PRLR (including reference to one or more fragment, precursor and/or isoform) activity in a sample and any differences therein versus a standard may be compared using standard technology having regard to the method employed to detect the activity.
  • colorimetric and fluorometric techniques may be used in which a detection molecule (such as an antibody or nucleic acid probe or primer) is labelled with a molecule which can be visualised by the naked eye or otherwise detected using a spectrophotometer, or fluorometer for example.
  • detection molecules could be labelled with radio-isotopes.
  • the methodology described in Perrot-Applanat et al, 1997 Mol Endo 11(8) may be used.
  • the methods of the invention may include the testing of one or more positive or negative control samples to ensure the integrity of the results.
  • a sample may be processed prior to analysing PRLR (including reference to one or more isoform, precursor and/or fragment) activity. Skilled persons will readily appreciate appropriate processing steps and techniques suitable for performing them.
  • high abundance proteins which have the potential to make it difficult to analyse such as detect and/or measure the level of activity of PRLR (including reference to one or more isoform, precursor and/or fragment) may be removed from the sample.
  • PRLR including reference to one or more isoform, precursor and/or fragment
  • Top6 or Top7 depletion may be used.
  • immunoprecipitation of the protein of interest could also be used.
  • Processing steps for preparing the sample for analysis of PRLR (including reference to one or more isoform, precursor and/or fragment) activity may include cell lysis, immunoprecipitation and preparation of cell membranes, for example. Persons skilled in the art will readily appreciate other useful techniques that may be used. Skilled persons may readily appreciate other means by which the sample may be processed for use in the invention.
  • the invention provides methods for breeding animals.
  • Various methods of the invention (such as those used to determine whether or not an animal is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture and methods for selecting animals (including selecting their gametes, for example) can be used to identify animals (or gametes, for example) of use in the breeding methods.
  • Such methods may comprise identifying at least one first animal that has or is inferred to be more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture (using one or more method as described herein) and mating said animal with a second animal, h one embodiment, the method may comprise further identifying at least one second animal that has or is inferred to be more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture and mating said at least second animal with the at least one first animal.
  • a method may comprise selecting a first animal (and optionally also a second animal) identified to have one or more biological marker as described herein. In a preferred embodiment, the mating will produce one or more offspring.
  • animals may be mated using any appropriate methods including naturally, artificial insemination or IVF.
  • individual gametes may be selected for use in the process.
  • Such gametes may be selected using a method of the invention; for example, a method of the invention may be used to identify animals that are inferred to be more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture and gametes from those animals selected for use in a breeding program or process or gametes may be tested in accordance with the invention and then selected for use in a breeding program or process.
  • a method of selecting or rejecting one or more animal could be used to select the first and/or second animal and their gametes used in IVF.
  • a method of selecting or rejecting one or more cells could be used to select a first and/or second gamete and selected gametes used in IVF. Following selection of male and female gametes, the female gamete is fertilised in vitro. At the relevant time, one or more embiyo is transferred to a gestational carrier.
  • in vitro fertilisation of a female gamete may occur and then a method of the invention used to determine whether or not an embiyo has a desired genotype/phenotype and should be selected or rejected for further use in a breeding programme.
  • a method of the invention used to determine whether or not an embiyo has a desired genotype/phenotype and should be selected or rejected for further use in a breeding programme. This might occur where individual gametes, or animals from which they have been obtained or derived, have not been tested to determine if they are likely to have an increased tolerance to heat, an increased resistance to ticks, and/or desirable coat texture prior to fertilisation (accordingly, the invention should be taken to include methods of breeding where the first and/or second animal and/or gametes are not selected on the basis of such a test, but a resulting embryo or offspring is tested and selected).
  • one or more method of the invention may be used to determine whether or not any offspring has or may be inferred to have the desired characteristics associated with PRLR as herein before described.
  • Such testing may occur at any time during the life of the offspring, including before birth; by way of example only, testing an embryo, a foetus, amniotic fluid, placenta, maternal blood, at birth.
  • cloning may be used to generate an animal, such cases, the method may comprise identifying at least one first animal that has or is inferred to be more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture (using one or more method as described herein) and using the nucleus or chromatin from one or more cell of that animal in a cloning procedure (such as somatic cell nuclear transfer, chromatin transfer techniques, and embryo splitting).
  • a cloning procedure such as somatic cell nuclear transfer, chromatin transfer techniques, and embryo splitting.
  • a cloning procedure may utilise a cell derived from a cell line and a method of the invention may be used to select such a cell which is, or cell line whose cells are, capable of being used to generate an animal which is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • the cell line may be an embryonic cell line.
  • One or more cell of use in cloning may be selected using a method of the invention.
  • a cloning procedure can be conducted.
  • a method of the invention may be used to identify animals that are inferred to be more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture and cells from those animals selected for use in a cloning process.
  • a method of the invention may be used to identify cells from a cell line which comprise one or more genetic alteration as described herein and may be of use in generating an animal which is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture. Methods of the fifth, tenth, fifteenth and/or twentieth aspects of the invention may be used for such purposes.
  • Methods of the invention could also be used to identify animals whose cells could be used to generate cell lines for cloning purposes.
  • a method of selecting or rejecting one or more animal (according to the second, tenth, eighteenth or twenty sixth aspects of the invention described herein before, for example) could be used to select an animal for cloning.
  • a method of selecting or rejecting one or more cells (according to the fifth, thirteenth, twenty first or twenty ninth aspects of the invention) could be used to select one or more cells of use in cloning.
  • one or more method of the invention may be used to determine whether or not any cloned animal has or may be inferred to have the desired characteristics associated with PRLR as herein before described. Such testing may occur at any time during the life of the cloned animal. By way of example only, testing of a blastocyst, an embryo, a foetus, amniotic fluid, placenta, maternal blood, at birth.
  • the invention also provides methods for forming a herd of animals. Such methods may comprise determining whether or not an animal carries a biological marker linked to increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture according to the thirty sixth or thirty eighth aspect of the invention described herein, determing whether or not an animal (and/or its offspring) is more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture according to the first, ninth, seventeenth, and/or twenty fifth aspects of the invention described herein, selecting or rejecting an animal according to the second, tenth, eighteenth and/or twenty sixth aspects of the invention as described herein, and/or estimating the worth of an animal according to the third, eleventh, ninteenth and/or twenty seventh aspects of the invention as described herein, for example.
  • methods of the invention which involve selecting or rejecting one or more cells may also be used to select one or more animals for inclusion in a herd.
  • Animals may be selected or rejected for inclusion in the herd based on the results of one or more of the aforementioned methods of the invention.
  • an animal where an animal is identified to have one or more biological marker in accordance with the invention or is inferred to be more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture and/or to have a desirable "worth", it may be selected for inclusion in the herd.
  • an animal is identified not to have one or more biological marker in accordance with the invention or is inferred to be more likely than not not to have an increased tolerance to heat, an increased resistance to ticks, and/or desirable coat texture or inferred to have substantially limited tolerance to heat and/or an undesirable coat texture and/or not to have a desirable "worth", it may be rejected and not selected for inclusion in the herd.
  • animals which are homozygous for one or more biological marker in accordance with the invention are selected for inclusion in a herd, although, this may not be prefered.
  • methods of this aspect of the invention involve testing one or more animals or cells in accordance with a method of any one or more of the first, second, third, fifth, ninth, tenth, eleventh, thirteenth, seventeenth, eighteenth, ninteenth, twenty first, twenty fifth, twenth sixth, twenty seventh and/or twenty ninth aspects of the invention, selecting animals having a desirable genotype/phenotype or inferred to have one or more desired characteristic or worth and forming a herd with the selected animals.
  • the invention should also be taken to include a herd formed by the methods described herein.
  • the herd of animals may be formed for any desirable reason. However, by way of example only, it may desirable to form a herd for: beef farming; milk production; meat production; egg production; and/or fur, hair, wool, skin, or feather production.
  • an alteration in the PRLR gene is associated with desirable coat texture and heat tolerance also allows for generation of animals having such desirable phenotypes using cloning and/or gene editing processes in which one or more genetic alteration is introduced into the PRLR gene.
  • one or more specific alteration may be introduced into one or more cells that may be used to generate an animal.
  • the invention provides one or more cell into which one or more specification alteration has been introduced in accordance with the invention.
  • the genetic alteration introduced into the PRLR gene may be of any nature, including insertion of one or more nucleotide, deletion of one or more nucleotide, and/or substitution of one or more nucleotide.
  • the one or more genetic alteration is one which increases the activity of PRLR.
  • the one or more genetic alteration includes a genetic alteration at a position corresponding to position 39136559 on chromosome 20 of Bos Taurus, In one embodiment, the one or more genetic alteration includes a deletion of a C at the position corresponding to position 39136559 on chromosome 20 of Bos Taurus. In other embodiments, the one or more genetic alteration is as described herein before.
  • the one or more cell used to generate an animal includes individual gametes, zygotes, embryos, somatic cells, cells from a cell line, for example.
  • one or more genetic alteration may be introduced into one or more gamete or zygote, for example. In one embodiment, where cloning is used, one or more genetic alteration may be introduced into one or more somatic cell or cell from a cell line, for example.
  • Such methods may further comprise testing or screening one or more cell, embryo, or animal after a gene editing step to ensure they include the desired genetic alteration and that it may be inferred that an animal generated by the process will be more likely than not to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • any one of a number of standard methods may be used to introduce one or more genetic alteration to the PRLR gene in accordance with the invention.
  • TALEN or CRISPR methods may be used.
  • CRISPR embryo genomes can be directly modified by injection of Cas9 mRNA and sgRNA into the fertilised egg resulting in the efficient production of animals carrying biallelic mutations in a given gene, for example. Such techniques are described for example in:
  • the breeding method may involve IVF.
  • IVF IVF
  • individual male and female gametes may be chosen, the female gamete fertilised in vitro, and then a gene editing method conducted on the fertilised zygote to introduce at least one desired alteration into the PRLR gene.
  • one or more other alteration could also be introduced into the genome of a gamete or zygote.
  • one or more embryo may be transferred to a gestational carrier.
  • the methods of this embodiment may optionally comprise conducting a method of the invention described herein before to determine whether or not any cell or animal has a desired alteration and it can be inferred that the animal will be more likely to have an increased tolerance to heat, an increased resistance to ticks, and/or desirable coat texture.
  • Such testing may occur at any time during the process and life of any animal.
  • testing of a blastocyst, an embryo, a foetus, amniotic fluid, placenta, maternal blood, at birth By way of example testing of a blastocyst, an embryo, a foetus, amniotic fluid, placenta, maternal blood, at birth.
  • an embyo is tested prior to transferring to the gestational carrier.
  • the animal is tested at birth.
  • gene editing is combined with cloning.
  • one may first chose an animal for use in cloning based on its genetic merit or otherwise.
  • a cell from the animal may be subject to gene editing methods to introduce at least one desired alteration into the PRLR gene.
  • the nucleus from such cell may then be used in known cloning processes, such as chromatin transfer, somatic cell nuclear transfer and embryo splitting. It should be appreciated that one or more other alteration could also be introduced into the genome if desired.
  • one or more embryo may be implanted into a carrier female animal for gestation.
  • the methods of this embodiment one may optionally comprise conducting a method of the invention described herein before to determine whether or not any cloned cell or animal has a desired alteration and it can be inferred that the animal will be more likely to have an increased tolerance to heat, an increased resistance to ticks, and/or a desirable coat texture.
  • Such testing may occur at any time during the process and life of any animal.
  • testing of an embryo, a foetus, amniotic fluid, placenta, maternal blood, at birth By way of example testing of an embryo, a foetus, amniotic fluid, placenta, maternal blood, at birth.
  • an embyo is tested prior to transferring to the gestational carrier.
  • the animal is tested at birth. Kits
  • the invention also relates to kits which are of use in a method of the invention.
  • the kit comprises at least one or more reagents suitable for analysis of one or more genetic marker in accordance with the invention.
  • Reagents suitable for analysis of one or more of the markers include one or more nucleic acid probes and/or primers as herein described.
  • the kit comprises at least one or more reagents suitable for detection of the level or activity of one or more of PRLR, one or more precursor thereof, one or more isoform thereof, one or more fragment thereof and/or one or more nucleic acid encoding one or more thereof.
  • the kit may comprise one or more antibody specific to PRLR (including reference to one or more precursors, isoforms and/or fragments thereof).
  • ELISA is used and the kit comprises one or more capture and/or detection antibody for PRLR (including reference to one or more precursors, isoforms and/or fragments thereof).
  • a method of the invention involves detection of the level of one or more nucleic acids encoding one or more of PRLR, one or more precursors, one or more isoforms and/or one or more fragments thereof it may comprise one or more nucleic acid probes and/or primers which have specificity for the target nucleic acid(s).
  • kits may also comprise one or more standard and/or other control including one or more nucleic acid whose sequence or genotype at a particular' position is known, or containing a known amount of one or more of PRLR, one or more precursor thereof, one or more isoform thereof and/or one or more fragment thereof and/or one or more nucleic acid encoding same.
  • kits of the invention can also comprise instructions for the use the components of the kit as well as printed charts or the hke that could be used as standards against which results obtained from test samples could be compared.
  • Reagents may be held in any suitable container.
  • Semen from a Senepol bull was obtained from Genetic Enterprises Ltd 21 Grace Ave., Leamington, Cambridge, New Zealand. Genomic DNA was extracted from the semen using a standard
  • PCR was performed as per the manufacturer's instructions using buffer A (containing 1 ,5mM Magnesium Chloride) and 25ng genomic DNA in 50uL
  • PCR cycling (30 cycles per run) was performed as per the manufacturer's instructions including a temperature gradient of 55-68 degrees Celsius for the annealing step. Extension was carried out at 72 degrees Celsius for 60 seconds. PCR products were assessed with a 1% agarose TBE gel. PCR reactions containing sufficient and clean product were sequenced by Sanger sequencing (Centre for Genomics, Proteomics and Metabolomics, The University of Auckland) using the same primers that were used for PCR amplification. Table 1: On analysis of the sequence data obtained, the inventors have identified a genetic alteration in the PRLR gene which has not previously been observed and appears to be unique to Senepol cattle.
  • This alteration is 39136559delC (located in the final exon of the gene); Table 2.
  • the position of the alteration is read relative to the position on chromosome 20 of Bos taurus, build UMD3.1
  • RNA sequencing in mammary tissue the inventors empirically determined the structure of the bovine prolactin receptor transcript.
  • This transcript contained an additional upstream 5'UTR exon approximately 120 kb of the reference PRLR transcript (NCBI Gene ID: 281422. AC_000177.1), similar to that seen in transcript XM_05221577.1 for Gene ID: 281422.
  • the experimentally derived transcript also had a much larger 3'UTR, approximately lOkb in length.
  • the inventors used this updated annotation to design PCR primers and amplicons representing all PRLR exons, 5 kb of promoter sequence and the 3'UTR.
  • Figures 1 and 2 illustrate the nucleotide (SEQ ID No. 4) and amino acid (SEQ ID No. 5) sequences of Bos taurus prolactin receptor (PRLR), long-form (NM_001039726.2), indicating the location of the 39136559delC.
  • PRLR Bos taurus prolactin receptor
  • NM_001039726.2 long-form
  • the base deletion (C) identified is at position 1466 in mRNA sequence (arrow) and genomic position 39136559.
  • the nucleotide sequence of the gene including the deleted C at this position is provided in Figure 3 (SEQ ID No. 6).
  • the resulting frameshift codes for a valine followed by a stop codon resulting in protein truncation ( Figure 2).
  • the frame-shift mutation observed will result in truncation of the protein from 581 amino acids to 461 amino acids through removal of the sequence highlighted ( Figure 2) and conversion of the new carboxy terminal amino acid from alanine to valine.
  • the truncated protein sequence is illustrated in Figure 4 (SEQ ID no. 7).
  • the long-form of PRLR is important for many aspects of Prolactin function.
  • the NCBI Reference Sequence NM_174155.2 for the short-form of PRLR results in a PRLR variant of 296 amino acids, meaning the single base deletion variant identified by the inventors is unlikely to affect the amino acid sequence of this isoform. However, the inventors believe that the deletion may also impact the function of the short isoform since the valiant is still contained within the 3'UTR of this transcript.
  • Earpunch samples were taken from five Costa Rican Romosinuano cattle for PRLR genotyping.
  • Earpunch samples were sent to GeneSeek (Lincoln, Iowa, USA) for DNA extraction and genotyping of the chr20:39136559delC PRLR valiant using Sequenom iPLEX (Sequenom), targeting alleles in both forward and reverse strand orientations.
  • the inventors identified the chr20:39136559delC frameshift mutation in two "slick" phenotype animals of the Romosinuano breed. Both animals were heterozygous for the deletion (genotype C.Del).
  • the inventors targeted 28 crossbred cattle with Senepol ancestry, and including Red Angus and/or Tuli ancestry, for PRLR genotyping.
  • the cattle' s coats were quaUtatively scored as either slick or normal.
  • Custom capture targeting RefSeq, Ensembl, and human paralogous genes was performed using the SureSelect Target Enrichment System (Agilent), with lOlbp paired-end sequencing conducted on the HiSeq 2000. Mean sequencing depth across exome targets was 25-40x per sample.
  • Embryos are generated by in vitro fertilisation of eggs from a desirable (usually high genetic merit for a performance trait) dam with sperm from a desirable sire.
  • one or more genetic alteration in the PRLR gene for example those which result in an increase in the activity of PRLR, are identified.
  • mutations that will truncate the protein produced by the long-form of the PRLR gene to a length of 461 amino acids in cattle or truncation to an equivalent amino acid position for the target species are identified. These mutations may consist of a single base deletion, as in the Senepol 'slick' mutation, a single base addition, or may be more complex producing a stop codon at the desired position in the PRLR gene.
  • the one or more genetic alteration may be identified by reference to pre-existing information or knowledge (such as known genetic alterations), or by analysis of one or more animal to identify a previously unknown desirable genetic alteration.
  • gene editing tools will be used (such as those described in Wang et al., 2013 and Wenfang et al., 2013) to introduce the desired base change(s) to the PRLR gene in a zygote.
  • embryos may be grown in vitro so that cells may be taken to verify that the edits are correct. Selected embryos will then be implanted in the uteri of recipient cows to carry them through to term. This procedure in particular may enable the production of high genetic merit males which can be used for widespread inseminations to introduce the heat tolerance characteristic to a population or populations of cattle, pigs, sheep goats or chickens.
  • Cloning technology (such as described by Brophy et al., 2003. Nature Biotechnology 21, 157-162) can be used to introduce one or more desirable genetic alteration to an animal. Briefly, this will involve the introduction of the one or more desired mutation into a cell line in vitro and nuclear transfer to an enucleated oocyte.
  • embryos can be grown in vitro to enable biopsy and testing of embryos to enable selection of those carrying the desirable genotype.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Environmental Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/NZ2014/000224 2013-10-25 2014-10-24 Genetic markers and uses therefor Ceased WO2015060732A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
ES14855747T ES2962492T3 (es) 2013-10-25 2014-10-24 Marcadores genéticos y usos de los mismos
MX2016005379A MX388563B (es) 2013-10-25 2014-10-24 Marcadores geneticos y usos de los mismos.
AP2016009207A AP2016009207A0 (en) 2013-10-25 2014-10-24 Genetic markers and uses therefor
AU2014337790A AU2014337790B2 (en) 2013-10-25 2014-10-24 Genetic markers and uses therefor
EP23186997.5A EP4273268A3 (en) 2013-10-25 2014-10-24 Genetic markers and uses therefor
US15/029,124 US10779518B2 (en) 2013-10-25 2014-10-24 Genetic markers and uses therefor
EP14855747.3A EP3060682B1 (en) 2013-10-25 2014-10-24 Genetic markers and uses therefor
BR112016009194-9A BR112016009194B1 (pt) 2013-10-25 2014-10-24 Métodos in vitro para selecionar uma variação em um gene do receptor de prolactina (prlr), produzir uma célula ou embrião de animal não humano, gerar um animal não humano e selecionar uma variação em um gene do prlr
CN201480065326.0A CN105814214A (zh) 2013-10-25 2014-10-24 遗传标记和其用途
CN202511091155.5A CN121065345A (zh) 2013-10-25 2014-10-24 遗传标记和其用途
US16/987,086 US20200375156A1 (en) 2013-10-25 2020-08-06 Genetic markers and uses therefor

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
NZ617040 2013-10-25
NZ61704013 2013-10-25
NZ62515014 2014-05-20
NZ625150 2014-05-20
NZ62720914 2014-07-08
NZ627209 2014-07-08
NZ63054014 2014-09-12
NZ630540 2014-09-12

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/029,124 A-371-Of-International US10779518B2 (en) 2013-10-25 2014-10-24 Genetic markers and uses therefor
US16/987,086 Division US20200375156A1 (en) 2013-10-25 2020-08-06 Genetic markers and uses therefor

Publications (1)

Publication Number Publication Date
WO2015060732A1 true WO2015060732A1 (en) 2015-04-30

Family

ID=52993221

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NZ2014/000224 Ceased WO2015060732A1 (en) 2013-10-25 2014-10-24 Genetic markers and uses therefor

Country Status (9)

Country Link
US (2) US10779518B2 (https=)
EP (2) EP4273268A3 (https=)
CN (2) CN121065345A (https=)
AP (1) AP2016009207A0 (https=)
AU (1) AU2014337790B2 (https=)
BR (1) BR112016009194B1 (https=)
ES (1) ES2962492T3 (https=)
MX (1) MX388563B (https=)
WO (1) WO2015060732A1 (https=)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9528124B2 (en) 2013-08-27 2016-12-27 Recombinetics, Inc. Efficient non-meiotic allele introgression
WO2017040695A1 (en) * 2015-09-01 2017-03-09 Recombinetics, Inc. Method of identifying the presence of foreign alleles in a desired haplotype
WO2017053315A1 (en) * 2015-09-21 2017-03-30 Recombinetics, Inc. Genetically modified animals having increased heat tolerance
EP3197272A4 (en) * 2014-09-23 2018-05-23 AgGenetics, Inc. Materials and methods for producing animals with short hair
US10893667B2 (en) 2011-02-25 2021-01-19 Recombinetics, Inc. Non-meiotic allele introgression

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111455072B (zh) * 2020-05-29 2021-09-14 华中农业大学 可用于鉴别瘤牛和普通牛血统的基因组序列及其应用方法
WO2022164993A1 (en) * 2021-01-27 2022-08-04 Abs Global, Inc. Hyperprolactinemia or lactation without pregnancy
US20250098650A1 (en) * 2022-01-18 2025-03-27 The Penn State Research Foundation Selection method for domestic animal breeding
CN119562762A (zh) 2022-04-04 2025-03-04 加利福尼亚大学董事会 遗传互补组合物和方法
CN121160698B (zh) * 2025-09-26 2026-04-10 山东省农业科学院畜牧兽医研究所 一种修饰的gRNA及通过基因编辑生产耐热奶牛的方法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
WO1998003682A1 (en) * 1996-07-19 1998-01-29 Iowa State University Research Foundation, Inc. Prolactin receptor gene as a genetic marker for increased litter size in pigs
WO2007070965A1 (en) * 2005-12-22 2007-06-28 Adelaide Research & Innovation Pty Ltd Quantitative trait loci for bovine net feed intake

Family Cites Families (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4873191A (en) 1981-06-12 1989-10-10 Ohio University Genetic transformation of zygotes
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
JP3022967B2 (ja) 1985-03-15 2000-03-21 アンチバイラルズ インコーポレイテッド 立体規則性ポリヌクレオチド結合ポリマー
US5763240A (en) 1992-04-24 1998-06-09 Sri International In vivo homologous sequence targeting in eukaryotic cells
FR2737497B1 (fr) 1995-08-02 1997-10-03 Agronomique Inst Nat Rech Utilisation du domaine intra-cytoplasmique du recepteur de la prolactine ou du recepteur de l'hormone de croissance pour obtenir la secretion de proteines
US7081335B2 (en) 1996-07-19 2006-07-25 Iowa State University Research Foundation, Inc. Prolactin receptor gene as a genetic marker for increased litter size in animals
US5948653A (en) 1997-03-21 1999-09-07 Pati; Sushma Sequence alterations using homologous recombination
WO2000011155A1 (en) 1998-08-19 2000-03-02 The Board Of Trustees Of The Leland Stanford Junior University Methods and compositions for genomic modification
AU1100201A (en) 1999-10-28 2001-05-08 Board Of Trustees Of The Leland Stanford Junior University Methods of in vivo gene transfer using a sleeping beauty transposon system
US7645441B2 (en) 2000-12-22 2010-01-12 Sagres Discovery Inc. Compositions and methods in cancer associated with altered expression of PRLR
AU2002324941A1 (en) 2001-09-07 2003-03-24 The Regents Of The University Of California Method of generating a transgenic livestock animal
US20030232410A1 (en) 2002-03-21 2003-12-18 Monika Liljedahl Methods and compositions for using zinc finger endonucleases to enhance homologous recombination
CN1759182A (zh) 2002-11-22 2006-04-12 克雷顿研究院 调节基因的组合物和系统
US7985739B2 (en) 2003-06-04 2011-07-26 The Board Of Trustees Of The Leland Stanford Junior University Enhanced sleeping beauty transposon system and methods for using the same
US20120196370A1 (en) 2010-12-03 2012-08-02 Fyodor Urnov Methods and compositions for targeted genomic deletion
RU2008102646A (ru) 2005-06-24 2009-07-27 Риджентс Оф Дзе Юниверсити Оф Миннесота (Us) Применение цитозиндезаминаз для уменьшения переноса ретроэлементов от свиней человеку
WO2008106982A2 (en) 2007-03-07 2008-09-12 Aarhus Universitet Pig model for atherosclerosis
EP2205766A4 (en) 2007-10-03 2012-12-12 Pfizer GENETIC MARKERS FOR HORNVIEH / HORNLESS CATTLE AND ACCORDING PROCEDURES
US8309791B2 (en) 2008-07-16 2012-11-13 Recombinectics, Inc. Method for producing a transgenic pig using a hyper-methylated transposon
WO2010008564A2 (en) 2008-07-16 2010-01-21 Recombinetics Plaice dna transposon system
US20110023140A1 (en) 2008-12-04 2011-01-27 Sigma-Aldrich Co. Rabbit genome editing with zinc finger nucleases
EP2206723A1 (en) 2009-01-12 2010-07-14 Bonas, Ulla Modular DNA-binding domains
KR20100133319A (ko) 2009-06-11 2010-12-21 주식회사 툴젠 표적 특이적인 게놈의 재배열을 위한 표적 특이적 뉴클레아제 및 이의 용도
EP2462230B1 (en) 2009-08-03 2015-07-15 Recombinetics, Inc. Methods and compositions for targeted gene modification
KR102262704B1 (ko) 2009-08-11 2021-06-09 상가모 테라퓨틱스, 인코포레이티드 표적화 변형에 대한 동형접합성 유기체
WO2011028134A1 (en) 2009-09-02 2011-03-10 Livestock Improvement Corporation Limited Biological markers and uses therefor
IT1396440B1 (it) 2009-10-14 2012-11-23 Innovation Factory Scarl Dispositivo di riscaldamento a ciclo termodinamico irreversibile per impianti di riscaldamento ad alta temperatura di mandata.
HUE041436T2 (hu) 2009-12-10 2019-05-28 Univ Minnesota Tal-effektor-közvetített DNS-módosítás
EP3594333B1 (en) 2010-02-08 2023-11-01 Sangamo Therapeutics, Inc. Engineered cleavage half-domains
EP2534163B1 (en) 2010-02-09 2015-11-04 Sangamo BioSciences, Inc. Targeted genomic modification with partially single-stranded donor molecules
BR112012020257A8 (pt) 2010-02-11 2018-02-14 Recombinetics Inc métodos e aparelhos para produzir artiodátilos transgênicos
US20120117870A1 (en) 2010-03-10 2012-05-17 Ness Inventions, Inc Dry-cast concrete planter box
JP6208580B2 (ja) 2010-05-17 2017-10-04 サンガモ セラピューティクス, インコーポレイテッド 新規のdna結合タンパク質及びその使用
EP2392208B1 (en) 2010-06-07 2016-05-04 Helmholtz Zentrum München Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) Fusion proteins comprising a DNA-binding domain of a Tal effector protein and a non-specific cleavage domain of a restriction nuclease and their use
AU2011265733B2 (en) 2010-06-14 2014-04-17 Iowa State University Research Foundation, Inc. Nuclease activity of TAL effector and Foki fusion protein
WO2012012738A1 (en) 2010-07-23 2012-01-26 Sigma-Aldrich Co., Llc Genome editing using targeting endonucleases and single-stranded nucleic acids
WO2012093833A2 (en) 2011-01-03 2012-07-12 Toolgen Incorporation Genome engineering via designed tal effector nucleases
US20120212722A1 (en) 2011-02-21 2012-08-23 Nikon Corporation Fast Illumination Simulator Based on a Calibrated Flexible Point Spread Function
BR112013021785A8 (pt) 2011-02-25 2018-07-03 Recombinetics Inc animais geneticamente modificados e métodos para fazer os mesmos
US9528124B2 (en) 2013-08-27 2016-12-27 Recombinetics, Inc. Efficient non-meiotic allele introgression
WO2012152912A1 (en) 2011-05-12 2012-11-15 Newvectys Genetically modified pig as a cancer prone model
WO2012168304A1 (en) 2011-06-07 2012-12-13 Helmholtz Zentrum München - Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) Protein having nuclease activity, fusion proteins and uses thereof
WO2012168307A2 (en) 2011-06-07 2012-12-13 Helmholtz Zentrum München - Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) Improved recombination efficiency by inhibition of nhej dna repair
PH12014501360B1 (en) 2011-12-16 2022-05-20 Targetgene Biotechnologies Ltd Compositions and methods for modifying a predetermined target nucleic acid sequence
US20130212723A1 (en) 2012-02-15 2013-08-15 Mice With Horns, Llc Transgenic animals with customizable traits
JP6282600B2 (ja) 2012-02-15 2018-02-21 エージージェネティクス インコーポレイテッド カスタマイズ可能な形質を有するトランスジェニック動物
US20160044901A1 (en) 2012-02-15 2016-02-18 Aggenetics, Inc Transgenic Animals With Customizable Traits
AU2013259647B2 (en) 2012-05-07 2018-11-08 Corteva Agriscience Llc Methods and compositions for nuclease-mediated targeted integration of transgenes
AR091482A1 (es) 2012-06-21 2015-02-04 Recombinetics Inc Celulas modificadas geneticamente y metodos par su obtencion
WO2013191769A1 (en) 2012-06-22 2013-12-27 Mayo Foundation For Medical Education And Research Genome editing
US10058078B2 (en) 2012-07-31 2018-08-28 Recombinetics, Inc. Production of FMDV-resistant livestock by allele substitution
CA2889502A1 (en) 2012-10-30 2014-05-08 Recombinetics, Inc. Control of sexual maturation in animals
EP2943060A4 (en) 2013-01-14 2016-11-09 Recombinetics Inc LIVESTOCK WITHOUT HORN
HK1214732A1 (zh) 2013-03-15 2016-08-05 Aggenetics, Inc. 具有可定制性狀的轉基因動物
US20150013025A1 (en) 2013-05-19 2015-01-08 Mice With Horns, Llc Transgenic animals with customizable traits
US20140359796A1 (en) 2013-05-31 2014-12-04 Recombinetics, Inc. Genetically sterile animals
US20140359795A1 (en) 2013-05-31 2014-12-04 Recombinetics, Inc. Genetic techniques for making animals with sortable sperm
US9670458B2 (en) 2013-07-13 2017-06-06 Aggenetics, Inc. Methods for spermatogonial stem cell (SSC) transfer
WO2015035034A1 (en) 2013-09-04 2015-03-12 Mice With Horns, Llc Materials and methods for correcting recessive mutations in animals
EP3197272A4 (en) 2014-09-23 2018-05-23 AgGenetics, Inc. Materials and methods for producing animals with short hair

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (https=) 1985-03-28 1990-11-27 Cetus Corp
WO1998003682A1 (en) * 1996-07-19 1998-01-29 Iowa State University Research Foundation, Inc. Prolactin receptor gene as a genetic marker for increased litter size in pigs
WO2007070965A1 (en) * 2005-12-22 2007-06-28 Adelaide Research & Innovation Pty Ltd Quantitative trait loci for bovine net feed intake

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
"Antibodies a Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY PRESS
"Genetic Data Analysis II", 1996, WEIR, SINAUER ASSOCIATES, INC. PUBLISHERS
"NCBI", Database accession no. NM_001039726.2
BROPHY ET AL., NATURE BIOTECHNOLOGY, vol. 21, 2003, pages 157 - 162
DEVLIN ET AL., GENOMICS, vol. 29, no. 2, 1995, pages 311 - 22
FOITZIK, K. ET AL.: "Prolactin and the Skin: A Dermatological Perspective on an Ancient Pleiotropic Peptide Hormone", JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 129, 2009, pages 1071 - 1087, XP055334823 *
HAOYI WANGHUI YANGCHIKDU S. SHIVALILAMEELAD M. DAWLATYALBERT W. CHENGFENG ZHANGRUDOLF JAENISCH: "One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas-Mediated Genome Engineering", CELL, vol. 153, no. 4, 9 May 2013 (2013-05-09), pages 910 - 918, XP028538358, DOI: 10.1016/j.cell.2013.04.025
HUANG, W. ET AL.: "Interactions of the bovine placental lactogen and prolactin receptor genes are associated with fertility traits in cattle", ANIMAL, vol. 3, no. 12, 2009, pages 1743 - 1745, XP055334817 *
IMAI KTAGAWA MYOSHIOKA HMATOBA SNARITA M ET AL.: "The efficiency of embryo production by ovum pick-up and in vitro fertilization in cattle", J REPROD DEV, vol. 52, 2006, pages 19 - 29
ISO-TOURU, T. ET AL.: "Divergent evolution in the cytoplasmic domains of PRLR and GHR genes in Artiodactyla", BMC EVOLUTIONARY BIOLOGY, vol. 9, no. 172, 2009, XP021055922 *
LU , A. ET AL.: "Novel SNPs of the Bovine PRLR Gene Associated with Milk Production Traits", BIOCHEMICAL GENETICS, vol. 49, 2011, pages 177 - 189, XP019888549 *
LU , A. ET AL.: "Single nucleotide polymorphisms of the prolactin receptor (PRLR) gene and its association with growth traits in chinese cattle", MOLECULAR BIOLOGY REPORTS, vol. 38, 2011, pages 261 - 266, XP019866503 *
MESQUITA FSMACHADO SADRNEVICH JBOROWICZ PWANG ZNOWAK RA, ANIM REPROD SCI., vol. 136, no. 4, 30 January 2013 (2013-01-30), pages 231 - 44
NAVIN ET AL., NATURE, vol. 472, no. 7341, 7 April 2011 (2011-04-07), pages 90 - 4
PERROT-APPLANAT ET AL., MOL ENDO, vol. 11, no. 8, 1997
RJ SIMPSON: "Proteins and proteomics-A laboratory manual", 2002, COLD SPRING HARBOUR LABORATORY PRESS
ROSS PJCIBELLI, JB: "Bovine somatic cell nuclear transfer", METHODS IN MOLECULAR BIOLOGY, vol. 636, 2010, pages 155 - 177
SAMBROOKRUSSELL: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
TURNER, L. B. ET AL.: "A genome-wide association study of tick burden and milk composition in cattle", ANIMAL PRODUCTION SCIENCE, vol. 50, 2010, pages 235 - 245, XP055334820 *
VIITALA, S. ET AL.: "The Role of the Bovine Growth Hormone Receptor and Prolactin Receptor Genes in Milk, Fat and Protein Production in Finnish Ayrshire Dairy Cattle", GENETICS, vol. 173, 2006, pages 2151 - 2164, XP055334814 *
WENFANG (SPRING) TANDANIEL F. CARLSONMARK W. WALTONSCOTT C. FAHRENKRUGPERRY B. HACKETT: "Precision Editing of Large Animal Genomes", ADV GENET., vol. 80, 2012, pages 37 - 97, XP055270065, DOI: 10.1016/B978-0-12-404742-6.00002-8

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10893667B2 (en) 2011-02-25 2021-01-19 Recombinetics, Inc. Non-meiotic allele introgression
US10920242B2 (en) 2011-02-25 2021-02-16 Recombinetics, Inc. Non-meiotic allele introgression
US11477969B2 (en) 2013-08-27 2022-10-25 Recombinetics, Inc. Efficient non-meiotic allele introgression in livestock
US10959414B2 (en) 2013-08-27 2021-03-30 Recombinetics, Inc. Efficient non-meiotic allele introgression
US9528124B2 (en) 2013-08-27 2016-12-27 Recombinetics, Inc. Efficient non-meiotic allele introgression
EP3197272A4 (en) * 2014-09-23 2018-05-23 AgGenetics, Inc. Materials and methods for producing animals with short hair
US10716298B2 (en) 2014-09-23 2020-07-21 Acceligen, Inc. Materials and methods for producing animals with short hair
AU2015320738B2 (en) * 2014-09-23 2021-12-02 Acceligen, Inc. Materials and methods for producing animals with short hair
JP2018529377A (ja) * 2015-09-01 2018-10-11 リコンビネティクス・インコーポレイテッドRecombinetics,Inc. 所望のハプロタイプ中の外来対立遺伝子の存在を同定する方法
CN108289436A (zh) * 2015-09-01 2018-07-17 重组股份有限公司 鉴定期望的单倍型中外来等位基因的存在的方法
WO2017040695A1 (en) * 2015-09-01 2017-03-09 Recombinetics, Inc. Method of identifying the presence of foreign alleles in a desired haplotype
CN108347908A (zh) * 2015-09-21 2018-07-31 重组股份有限公司 具有增加的热耐受性的经遗传修饰的动物
WO2017053315A1 (en) * 2015-09-21 2017-03-30 Recombinetics, Inc. Genetically modified animals having increased heat tolerance

Also Published As

Publication number Publication date
AP2016009207A0 (en) 2016-05-31
EP3060682A4 (en) 2017-07-05
MX2016005379A (es) 2017-02-15
CN105814214A (zh) 2016-07-27
EP3060682A1 (en) 2016-08-31
AU2014337790B2 (en) 2019-09-26
AU2014337790A1 (en) 2016-05-19
ES2962492T3 (es) 2024-03-19
EP3060682B1 (en) 2023-08-30
EP4273268A3 (en) 2024-02-21
EP4273268A9 (en) 2024-10-30
CN121065345A (zh) 2025-12-05
EP4273268A2 (en) 2023-11-08
US20200375156A1 (en) 2020-12-03
US20160262360A1 (en) 2016-09-15
US10779518B2 (en) 2020-09-22
BR112016009194A2 (https=) 2017-09-19
BR112016009194B1 (pt) 2022-05-24
EP3060682C0 (en) 2023-08-30
MX388563B (es) 2025-03-20

Similar Documents

Publication Publication Date Title
US20200375156A1 (en) Genetic markers and uses therefor
US8551703B2 (en) SNPs associated with fatty acid composition of bovine meat and milk
WO2009035560A1 (en) Methods of using genetic markers and related epistatic interactions
AU2009275988B2 (en) A genetic marker test for Brachyspina and fertility in cattle
CN106957907B (zh) 用于狗中的肝铜积累的遗传检测
US10626459B2 (en) Methods and kits for the identification of animals having a greater potential for desirable characteristics, and for the early identification of fat deposits in bovines
WO2011028134A1 (en) Biological markers and uses therefor
MXPA06009452A (es) Polimorfismos del promotor de leptin y sus usos.
AU2006204993A1 (en) DNA markers for cattle growth
WO2019125188A1 (en) Genetic markers and uses therefor
JP5897704B2 (ja) ブラキスパイナ突然変異の検出
AU2018388850B2 (en) Genetic markers and uses therefor
WO2014193247A1 (en) Dwarfism genetic markers and uses therefor
WO2015093988A1 (en) Genetic markers of offspring mortality and uses therefor
BRPI0611583A2 (pt) polimorfismos no gene da proteìna de ligação de ácido graxo 4 (fabp4) e suas associações com medidas de gordura intramuscular e espessura de gordura subcutánea em gado de corte
NZ579456A (en) Biological markers on Bovine Chromosome 14 for size and uses therefor

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14855747

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 15029124

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: MX/A/2016/005379

Country of ref document: MX

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016009194

Country of ref document: BR

REEP Request for entry into the european phase

Ref document number: 2014855747

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014855747

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2014337790

Country of ref document: AU

Date of ref document: 20141024

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 16134604

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 112016009194

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20160425