WO2015054375A2 - Graminées résistantes à la sécheresse et matériaux et procédés associés - Google Patents

Graminées résistantes à la sécheresse et matériaux et procédés associés Download PDF

Info

Publication number
WO2015054375A2
WO2015054375A2 PCT/US2014/059676 US2014059676W WO2015054375A2 WO 2015054375 A2 WO2015054375 A2 WO 2015054375A2 US 2014059676 W US2014059676 W US 2014059676W WO 2015054375 A2 WO2015054375 A2 WO 2015054375A2
Authority
WO
WIPO (PCT)
Prior art keywords
identity
seq
plant
loc
nucleic acid
Prior art date
Application number
PCT/US2014/059676
Other languages
English (en)
Other versions
WO2015054375A3 (fr
Inventor
Amelia HENRY
Ajay Kohli
Arvind Kumar
Original Assignee
International Rice Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by International Rice Research Institute filed Critical International Rice Research Institute
Priority to AU2014331939A priority Critical patent/AU2014331939A1/en
Priority to US15/027,896 priority patent/US20160251675A1/en
Publication of WO2015054375A2 publication Critical patent/WO2015054375A2/fr
Publication of WO2015054375A3 publication Critical patent/WO2015054375A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/46—Gramineae or Poaceae, e.g. ryegrass, rice, wheat or maize
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/10—Seeds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/13—Abiotic stress
    • Y02A40/132—Plants tolerant to drought

Definitions

  • Cereal grasses cultivated for their edible seeds, are grown in greater quantities and provide more food energy worldwide than any other type of crop. Cereal grasses comprise a range of crops, including corn, rice, wheat, barley, sorghum, millet, oats, and rye. Together, maize, wheat and rice account for nearly half of all food calories consumed globally. Drought is one of the most important and damaging abiotic stresses for all cereal grasses. With rice, drought severely hampers rice productivity in rainfed areas. In Asia, more that 23 million ha of rice are rainfed. Eastern India and adjoining areas of Nepal occupy a large drought-affected area with an estimate of around 17 million ha.
  • Drought is an extended period of substantially lower-than-usual rainfall, leading to a shortage of water for domestic use and agriculture. Drought may affect rice by several mechanisms, including: inhibition of leaf production and decline in leaf area, leading to retarded leaf growth and light interception; closure of stomata, leading to reduced transpiration rates and reduced photosynthesis; leaf rolling, leading to reduction in effective leaf area available for light interception; enhanced leaf senescence, or leaf deaths, leading to reduced canopy photosynthesis; reduced plant height and spikelet number, resulting in low yield production; spikelet sterility, resulting in decreased percentage of filled spikelets; delayed flowering, caused by drought during the vegetative development stage; reduced tillering and tiller death, resulting in a reduction in the number of tillers and panicles per hill; and decreased grain weight, if drought occurs during flowering.
  • a marker-assisted breeding (MAB) strategy advocated to be a fast-track approach in rice improvement for drought-prone environments, can be a suitable alternative strategy.
  • the marker assisted backcrossing (MABC) approach has been used to improve the drought tolerance of high-yielding, popular, farmer-adapted varieties grown on a large scale.
  • QTLs with large and consistent effects are worthy for use in marker-assisted selection (MAS) to improve the drought tolerance of presently cultivated varieties.
  • MAS marker-assisted selection
  • the most suitable QTL for drought would be one that can overcome QTL x genetic background, QTL x environment, and QTL x ecosystem effects.
  • One skilled in the art will recognize that the identification and introgression of QTLs in the background of elite rice varieties could be helpful in MAB and the generation of new drought-tolerant varieties.
  • Described herein are methods and materials useful for improving lateral root growth, water uptake, and the yield of grain of cereal grasses grown under drought stress conditions.
  • the present disclosure provides a quantitative trait locus associated with improved yield under drought stress.
  • the disclosure further provides recombinant DNA for the generation of transgenic plants, transgenic plant cells, and methods of producing the same.
  • the present disclosure further provides methods for generating transgenic seed that can be used to produce a transgenic plant having improved yield under drought stress, and methods for improving yield under drought stress in a cereal grass involving marker assisted selection and backcrossing.
  • a method of improving lateral root growth and water uptake in a cereal grass comprising: a) crossing a crossing plant of one variety of cereal grass having chromosomal DNA that comprises a nucleic acid comprising qDTY 12 1 , or a yield-improving part thereof, with a recipient plant of a distinct variety of cereal grass having chromosomal DNA that does not include a nucleic acid comprising qDTY 12 .i, or a yield-improving part thereof; and b) selecting one or more progeny plants having chromosomal DNA that comprises a nucleic acid comprising qDTY 12 .i, or a yield-improving part thereof, wherein qDTY 12 1 , or a yield-improving part thereof, is detected in the crossing plant, recipient plant, or one or more progeny plants by analyzing genomic DNA from the crossing plant, the recipient plant, or one or more progeny plant, or germplasm, pollen, or seed thereof,
  • the method of improving lateral root growth and water uptake in a cereal grass further comprises the steps: a) backcrossing the one or more selected progeny plants to produce backcross progeny plants; and b) selecting one or more backcross progeny plants having chromosomal DNA that comprises a nucleic acid comprising qDTY 12 1 , or a yield-improving part thereof, wherein qDTY 12 1 , or a yield-improving part thereof, is detected in the one or more backcross progeny plants by analyzing genomic DNA from the one or more backcross progeny plants, or germplasm, pollen, or seed thereof, for the presence of at least one molecular marker linked to qDTY 12 1 , or a yield-improving part thereof, wherein the at least one molecular marker is selected from the group consisting of: RM28048; RM28076; RM28089; RM28099; RM28130; RM511 ; RM1261 ;
  • these two steps are repeated one or more times to produce third or higher backcross progeny plants having chromosomal DNA that comprises a nucleic acid comprising qDTY lzl , or a yield-improving part thereof, wherein qDTY 12. i, or a yield- improving part thereof, is detected in the one or more backcross progeny plants by analyzing genomic DNA from the one or more backcross progeny plants, or germplasm, pollen, or seed thereof, for the presence of at least one molecular marker linked to qDTY 12. i, or a yield-improving part thereof, wherein the at least one molecular marker is selected from the group consisting of: RM28048; RM28076;
  • the physiological and morphological characteristics of the recipient plant are retained.
  • at least one of the crossing plant and the recipient plant has chromosomal DNA comprising a nucleic acid having at least 70% sequence identity to Ulpl.
  • the selected one or more progeny plants is further selected for having increased lateral root growth relative to a control plant.
  • the selected one or more progeny plants is further selected for having increased lateral root growth relative to a control plant in both well watered and drought conditions.
  • the selected one or more progeny plants is further selected for having improved yield under drought conditions relative to a control plant.
  • the selected one or more progeny plants is further selected for having at least one trait associated with improved yield under drought conditions selected from the group consisting of: increased sucrose content in flag leaf relative to a control plant; increased sucrose content in spikelets relative to a control plant; increased starch content in spikelets relative to a control plant; and increased carbon reserves in roots relative to a control plant.
  • the cereal grass is selected from the group consisting of: rice; corn; wheat; barley; sorghum; millet; oats; and rye.
  • the cereal grass is rice.
  • the cereal grass is corn.
  • the crossing plant is a rice plant selected from the group consisting of: WayRarem; IR79971-B-102-B; and IR74371-46-1-1.
  • the recipient plant is a rice plant selected from the group consisting of: Vandana; Kalinga 3; Anjali; IR64; Swarna; Sambha Mahsuri; MTU1010, Lalat; Naveen; Sabitri; BR11; BR29; BR28; TDK1 ; TDK 9; and Chirang.
  • the yield improving part of qDTY 12 1 comprises one or more nucleic acids sharing at least 70% identity with one or more nucleic acids of the group of nucleic acids consisting of: SEQ ID NO: 2 (OsNAM lzl ); SEQ ID NO: 3 (OsGPDP lzl ); SEQ ID NO: 4
  • the yield improving part of qDTY 12 .i comprises a nucleic acid sharing an identity with SEQ ID NO: 2 (OsNAMjzi) selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity.
  • SEQ ID NO: 2 OsNAMjzi
  • the crossing plant in addition to having
  • chromosomal DNA that comprises a nucleic acid comprising qDTY12.1, or a yield-improving part thereof, also comprises a nucleic acid comprising qDTY 23 .
  • the recipient plant has chromosomal DNA that comprises a nucleic acid comprising qDTY 23 .
  • a method of improving lateral root growth and water uptake in a cereal grass comprising: a) crossing a crossing plant of one variety of cereal grass having chromosomal DNA that comprises a nucleic acid sharing an identity with SEQ ID NO: 2
  • ⁇ OsNAM 12 j selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity, with a recipient plant of a distinct variety of cereal grass having chromosomal DNA that does not include a nucleic acid sharing at least 70% identity with SEQ ID NO: 2 ⁇ OsNAM 12 1 ); and b) selecting one or more progeny plants having chromosomal DNA that comprises a nucleic acid sharing an identity with SEQ ID NO: 2
  • (OsNAMjz) selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity.
  • the nucleic acid sharing an identity with SEQ ID NO: 2 selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity is detected by RT- PCR.
  • the method of improving lateral root growth and water uptake in a cereal grass further comprising the steps: c) backcrossing the one or more selected progeny plants produce backcross progeny plants; and d) selecting one or more backcross progeny plants having chromosomal DNA that comprises a nucleic acid sharing an identity with SEQ ID NO: 2
  • (OsNAM ]2 ) selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity.
  • these steps are repeated one or more times to produce third or higher backcross progeny plants having chromosomal DNA that comprises a nucleic acid sharing an identity with SEQ ID NO: 2 (OsNAM]2.) selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity.
  • OsNAM SEQ ID NO: 2
  • the at least one of the crossing plant and the recipient plant has chromosomal DNA comprising a nucleic acid having at least 70% sequence identity to Ulpl, wherein Ulpl encodes a functional deSUMOylating protease capable of deSUMOylating a polypeptide encoded by the nucleic acid sharing an identity with SEQ ID NO: 2 (OsNAM ]2 ) selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity.
  • Ulpl encodes a functional deSUMOylating protease capable of deSUMOylating a polypeptide encoded by the nucleic acid sharing an identity with SEQ ID NO: 2 (OsNAM ]2 ) selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity
  • a method for selecting a cereal grass plant having improved lateral root growth and water uptake relative to a control cereal grass plant comprising: a) inducing expression or increasing expression in a cereal grass plant a nucleic acid comprising qDTY 12 1 , or a yield-improving part thereof, wherein the induced or increased expression of the nucleic acid comprising qDTY 12 .i, or a yield-improving part thereof, is obtained by transforming and expressing in the cereal grass plant the nucleic acid comprising qDTY 12 .i, or a yield-improving part thereof; and b) selecting a cereal grass plant having improved lateral root growth and water uptake relative to a control cereal grass plant, wherein the cereal grass plant having improved lateral root growth and water uptake relative to a control cereal grass plant is selected by analyzing genomic DNA from the cereal grass plant, or germplasm, pollen, or seed thereof, and detecting therein at least one molecular marker linked to qDTY
  • the induced or increased expression of the nucleic acid comprising qDTY12.1, or a yield-improving part thereof is a result of introducing and expressing the nucleic acid comprising qDTY 12 1 , or a yield-improving part thereof, in the cereal grass plant under control of at least one promoter functional in plants.
  • the at least one promoter and the nucleic acid comprising qDTY 12 1 , or yield improving part thereof are operably linked.
  • a method for generating a cereal grass plant having improved lateral root growth and water uptake relative to a control cereal grass plant comprising: a) transforming a cereal grass plant cell, cereal grass plant, or part thereof with a construct comprising: 1) a nucleic acid encoding a polypeptide having a sequence identity selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity to nucleic acid sequence SEQ ID NO: 2 (OsNAM 12 1 ); 2) a promoter operably linked to the nucleic acid; and 3) a transcription termination sequence; and b) expressing the construct in a cereal grass plant cell, cereal grass plant, or part thereof, thereby generating a cereal grass plant having improved lateral root growth and water uptake relative to a control cereal grass plant
  • the construct further comprises one or more nucleic acids sharing at an identity selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity, with one or more nucleic acids of the group of nucleic acids consisting of: SEQ ID NO: 3 (OsGPDP 12 j); SEQ ID NO: 4 (OsGPDP 12 1 ) ⁇ SEQ ID NO: 5 (OsGPDP 12 1 ) ⁇ SEQ ID NO: 6 (OsSTPK 12 1 ) ⁇ SEQ ID NO: 7 (OsSTPK lzl ); SEQ ID NO: 8 (OsSTPK 12 1 ) ⁇ SEQ ID NO: 9 (OsPOle 12 1 ); SEQ ID NO: 10 (OsMtN3 lzl ); SEQ ID NO: 11 (Os)
  • the construct further comprises a nucleic acid having at least 70% sequence identity to Ulpl, wherein the nucleic acid encoding a deSUMOylating protease encodes a functional deSUMOylating protease capable of deSUMOylating a polypeptide encoded by the nucleic acid sharing an identity with SEQ ID NO: 2 (OsNAM 12 ) selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity.
  • SEQ ID NO: 2 OsNAM 12
  • a method for the production of a transgenic cereal grass plant having improved lateral root growth and water uptake relative to a control cereal grass plant comprising: a) transforming and expressing in a cereal grass plant cell at least one nucleic acid having at a sequence identity selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity with one or more nucleic acids of the group of nucleic acids consisting of: SEQ ID NO: 2 (OsNAM 12J ); SEQ ID NO: 3 (OsGPDP 12 1 ); SEQ ID NO: 4 (OsGPDP 12 1 ); SEQ ID NO: 5 (OsGPDP 12 1 ); SEQ ID NO: 6 (OsSTPK 12 1 ) ⁇ SEQ ID NO: 7 (OsSTPK 12 1
  • the method for the production of a transgenic cereal grass plant having improved lateral root growth and water uptake relative to a control cereal grass plant further comprises transforming and expressing in the cereal grass plant cell a nucleic acid having at least 70% sequence identity to Ulpl, wherein Ulpl encodes a functional deSUMOylating protease capable of deSUMOylating a polypeptide encoded by the nucleic acid having at least 70% sequence identity with SEQ ID NO: 2 ⁇ OsNAM 12 .i).
  • transgenic plant cell comprising: a) at least one promoter that is functional in plants; and b) at least one nucleic acid having a sequence identity selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity with one or more nucleic acids of the group of nucleic acids consisting of: SEQ ID NO: 2 SEQ ID NO: 3 ⁇ OsGPDP 12 1 ); SEQ ID NO: 4 ⁇ OsGPDP 12 1 ) ⁇ SEQ ID NO: 5 ⁇ OsGPDP 12 1 ) ⁇ SEQ ID NO: 6 ⁇ OsSTPK 12 1 ) ⁇ SEQ ID NO: 7 ⁇ OsSTPK 12 1 ) ⁇ SEQ ID NO: 8 ⁇ OsSTPK 12 1 ) ⁇ SEQ ID NO: 9
  • a transgenic plant cell further comprising a nucleic acid having at least 70% sequence identity to Ulpl, wherein Ulpl encodes a functional deSUMOylating proteas capable of deSUMOylating a polypeptide encoded by the nucleic acid having at least 70% sequence identity with SEQ ID NO: 2 ⁇ OsNAM 12J ).
  • a transgenic plant cell is a plant cell selected from the group consisting of: rice plant cell; corn plant cell; wheat plant cell; barley plant cell; sorghum plant cell; millet plant cell; oats plant cell; and rye plant cell.
  • he plant cell is homozygous for the at least one nucleic acids.
  • transgenic plant comprising a plurality of transgenic plant cells described herein.
  • a transgenic plant comprising: a) at least one promoter that is functional in plants; and b) at least one nucleic acid having a sequence identity selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity with one or more nucleic acids of the group of nucleic acids consisting of: SEQ ID NO: 2 SEQ ID NO: 3 ⁇ OsGPDP 12 1 ); SEQ ID NO: 4 ⁇ OsGPDP 12 1 ) ⁇ SEQ ID NO: 5 ⁇ OsGPDP 12A ); SEQ ID NO: 6 ⁇ OsSTPK 12A ); SEQ ID NO: 7 (OsSTPK
  • transgenic plant homozygous for the at least one nucleic acid.
  • a method for selecting transgenic plants having improved lateral root growth and water uptake relative to a control plant comprising: a) screening a population of plants for increased lateral root growth and water uptake, wherein plants in the population comprise a transgenic plant cell having recombinant DNA incorporated into its chromosomal DNA, wherein the recombinant DNA comprises a promoter that is functional in a plant cell and that is functionally linked to an open reading frame of a nucleic acid having a sequence identity selected from the group consisting of: at least 70% identity; at least 75% identity; at least 80% identity; at least 85% identity; at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity with one or more nucleic acids of the group of nucleic acids consisting of: SEQ ID NO: 2 ⁇ OsNAM 12A ); SEQ ID NO: 3 ⁇ OsGPDP 12
  • the method for selecting transgenic plants having improved lateral root growth and water uptake relative to a control plant further comprises selecting one or more plants that exhibit increased yield under drought conditions at a level greater than the yield under drought conditions in control plants that do not comprise the transgenic plant cell.
  • the method for selecting transgenic plants having improved lateral root growth and water uptake relative to a control plant further comprises a step of collecting seed from the one or more selected plants.
  • nucleic acid encoding no-apical meristem (NAM) transcription factor in a cereal grass so that the nucleic acid encoding the NAM transcription factor shares an identity with SEQ ID NO: 2 ⁇ OsNAM 12 ) selected from the group consisting of: at least 90% identity; at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity.
  • this method further comprises modifying one or more nucleic acids encoding one or more genes selected from the group consisting of GPDP; STPK; POle; MtN3; WAK, CesA; GDP; ARF; and Amh so that the one or more nucleic acids share an identity selected from the group consisting of: at least 95% identity; at least 96% identity; at least 97% identity; at least 98% identity; at least 99% identity; and 100% identity with one or more nucleic acids of the group of nucleic acids consisting of: SEQ ID NO: 3 ⁇ OsGPDP 12 1 ); SEQ ID NO: 4 ⁇ OsGPDP 12 1 ); SEQ ID NO: 5 ⁇ OsGPDP 12 1 ) ⁇ SEQ ID NO: 6 ⁇ OsSTPK 12 1 ) ⁇ SEQ ID NO: 7 ⁇ OsSTPK 12 1 ) ⁇ SEQ ID NO: 8 (OsSTPK 12 1 ); SEQ ID NO: 9 ⁇ OsPOle 12 1 ) SEQ ID NO: 10 (
  • the cereal grass comprises a nucleic acid comprising qDTY 23 .
  • this method of improving lateral root growth and water uptake in a cereal grass plant modifying the nucleic acid is performed using a technique selected from the group consisting of: transgenic method; crossing; backcrossing; protoplast fusion; doubled haploid technique; embryo rescue; zinc-finger nucleases; transcription activator-like effector nucleases; and clustered regularly interspaced short palindromic repeat (CRISPR)/Cas-based RNA-guided DNA endonucleases.
  • CRISPR clustered regularly interspaced short palindromic repeat
  • FIG 1A Line graph showing yield and panicle branching results for qDTY 12. i NILs. Data show an additive effect of qDTY 12. i QTL+ and QTL- lines for grain yield over Vandana under varying severity of drought stress in six experiments conducted over three seasons at IRRI.
  • FIG. IB Photographs showing yield and panicle branching results for qDTY 12. i NILs.
  • FIG. 1C Bar graph showing yield and panicle branching results for ql)TY 12 NILs.
  • FIGS 2A - 2D Graphs showing morpho-physiological characters of qDTY 12 1 NILs.
  • the drought response of qDTY 12 .] reflects drought-induced transpiration efficiency coupled with greater water uptake during reproductive stage drought due to increased lateral root growth.
  • NILs showed higher transpiration efficiency according to FIG. 2 A) carbon isotope discrimination in the youngest leaves sampled every 2 weeks during the drought stress period in the field (2012DS);
  • FIG. 2B instantaneously by gas exchange (photosynthesis rate/stoniatai conductance; 2012WS);
  • FIG.2C gravimetrically in a greenhouse seedling-stage study; and FIG.2D) by soil moisture measurements in which 481-B showed more conservative water uptake patterns than Vandana during vegetative stage and higher water uptake during reproductive stage at a 40 cm depth (2012DS).
  • FIGS. 2E - 2F Photographs showing morpho-physiological characteristics of qDTY] 2. ⁇ NIL
  • FIG. 2E a higher proportion of lateral roots in 481-B than in Vandana
  • FIG. 2F increased LRN in vitro compared with Vandana.
  • FIG. 3A A heat map showing the relative expression of candidate genes in root, leaf & panicles in NILs compared to Vandana during severe reproductive stage DC.
  • FIG. 3B A bar graph representing qRT-PCR expression analysis of the five putative target CGs of OsNAM 12 .i.
  • FIG. 3C Photograph of EMSA for CG promoter binding by OsNAM ]2 .
  • Lane 1 Negative control of DNA without the protein;
  • Lane 2 DNA with GST protein,
  • Lane 3 to 6 DNA with OsGDP 12 1 ' OsNOD lzl , OsCesA lzl ' and OsNAM 12A respectively.
  • FIG. 4A Table showing characteristics of the parental rice varieties used.
  • FIG. 4B Flow chart showing the marker assisted backcrossing (MAB) strategy for simultaneous fine mapping and development of NILs of recipient parent Vandana with fine-mapped segment of qDTY 12 1 .
  • MAB marker assisted backcrossing
  • FIG.5 Graphical genotype of IR84984-83-15-481-B (BC 2 F 3:4 ) showing recipient genome recovery in the background and length of QTL region transferred.
  • FIG. 6A Photographs of donor parent WayRarem (WR), recipient parent Vandana (V), and qDTYn positive NIL IR84984-83-15-481-B (481-B) under drought. The NIL 481-B shows filled panicles while the other two do not.
  • FIG. 6B Photographs showing grain type similarity between V and 481-B.
  • FIG. 6C Line graph showing grain yield data from 11 trials over three years for yield.
  • FIGS. 7A - 7C FIG. 7 A) Two NILs showed improved performance over Vandana in seedling stage trials for drought tolerance as measure by shoot biomass.
  • FIGS. 8A-8C The ⁇ 12 ⁇ NILs did not show different transpiration efficiency (TE) than
  • FIG. 8A successive carbon isotope discrimination measurements on the 3 youngest leaves in the field (DS), FIG. 8B) gravimetrically in the greenhouse, and
  • FIG. 8C instantaneously by gas exchange in the field (WS). Significant differences between +QTL and -
  • QTL lines are indicated by a "**" for p ⁇ 0.01 and "*" for p ⁇ 0.05.
  • FIGS. 8D-8G Additional seasons of data for the TE and root traits observed for qDTY n . carbon isotope discrimination in FIG. 8D) drought stress and FIG. 8E) well-watered conditions (WS); FIG. 8F) genotypic differences in soil moisture levels (2012WS); FIG. 8G) Differences in root distribution among diameter classes as a proportion of total root length at a soil depth of 30-45 cm (2010DS). Significant differences between +QTL and -QTL lines are indicated by a "**" for p ⁇ 0.01 and "*" for p ⁇ 0.05.
  • FIG. 9A Comparison of the QTL region in the Nipponbare and 9311 genomes.
  • FIG. 9B Schematic representation of the relative position of the CG along the QTL.
  • FIG. 9C Results for Southern hybridization of the OsCesA 12 1 probe on genomic DNA of NB, WayRarem, +21, +83, -21, -83 and V (1-7). Plasmid DNA containing the OsCesA 12 1 fragment was used as a positive control (P). Arrow indicates the 2.7 kb fragment absent in V, -21 & -83 but present in NB, WayRarem, +21 and +83.
  • FIG. 10A Schematic of the different regions of the OsNAM 12 .i protein from the N-terminal to the C-terminal: dimerization domain (DD), DNA binding domain (DBD), transactivation domain (TAD) and the position of the PEST motif that facilitates proteasome or calpain mediated protein cleavage. Numbers represent the amino acid position.
  • FIG. 10B Primary amino acid sequence comparision between Vandana (SEQ ID NO: 182) and WayRarem (SEQ ID NO: 183) showing the three mutations encircled.
  • the red arrows indicate potential SUMOylation sites and the blue arrow indicates the phosphorylation site change.
  • the underlined region indicates the PEST sequence.
  • FIG. IOC The effect of the AA differences on the 3D structure of Vanadana (V) and WayRarem (WR).
  • FIG. 10D Schematic differences in drought responsive promoter cis -elements in the additional promoter sequence present in WR.
  • FIG. 11A-11B Characteristics of transgenic plants l-OsNAM ]2 .
  • FIG. 11 A Photograph showing an increase in lateral root growth under PEG simulated water deficit in the three transgenic events of ⁇ -OsNAM 12 1 ox seedlings in vitro.
  • FIG. 1 IB Bar graph showing quantitative difference in LR between the three events compared to WT IR64.
  • FIGS. 11C-11D Characteristics of transgenic plants l-OsNAM lzl ox .
  • FIG. 11C Photograph showing an increase in panicle branching under PEG simulated water deficit.
  • FIG. 11D Quantitative difference in panicle branching between the three events compared to WT IR64.
  • FIG. HE Characteristics of transgenic plants l-OsNAM ]2 .i° x - Line graph showing gas exchange measurements (LICOR-6400) whereby transgenic events showed higher transpiration rates under drought stress.
  • FIG. 11F Characteristics of transgenic plants ⁇ -OsNAM 12 1 ° x . Bar graph showing field comparison between WT IR64 and as seen through number of spikelets and filled spikelets under drought.
  • FIGS. 12A-12B FIG 12A) Panel showing that plants mutated for the particular CGs led to higher lateral root growth than the WT.
  • FIG. 12B table showing percentage increase in LR in the mutants. Three to five tubes were sampled for each mutant and WT.
  • FIGS. 13A-13B EMSA and SUMOylation results for OsNAM 12 .i - FIG. 12A) EMSA for CG promoter binding by OsNAM 12 1 .
  • Lanes 3 to 6, respective promoter DNA of OsGDP 12 1 , OsNOD 12 1 , OsCesA ]2 1 , and OsARF 12 1 showing binding to the recombinant OsNAM 12 1 through band shift represented by the white arrowheads.
  • FIG.12B An immunoblot using anti-NAM antibody from rabbit shows higher M w bands of OsNAM 12 1.
  • Lane 1-5 Vandana, WayRarem, NIL, WT-IR64 & ⁇ -OsNAM 12A ox ).
  • FIG. 13 C An immunoblot showing the action of deSUMoylating protease Ulpl on the di- sumoylated OsNAM 12 1 ( ⁇ 53kDa).
  • the column graph shows the subsequent deSUMOylation of di- SUMOylated form and progressive accumulation of mono-SUMOylated ( ⁇ 41kDa) OsNAM 12 1 .
  • FIG. 13D SUMO protein interaction with recombinant OsNAM 12 .i . Lane 1 Marker; Lane 2, SUMOl ; Lane 3, SUM02; Lane 4, SUM03; P is positive control, N is negative control and NAM is untreated NAM.
  • FIG. 13E 2D-immunoblot result for deSUMOylation with Ulpl shows clear changes in spots marked with arrows, after the enzyme treatment.
  • FIG. 13F 2D-immunoblot successively on the same blot with anti-NAM and anti-SUMO antibody shows identical spots confirming in vivo SUMOylation of the NAM protein.
  • FIG. 14 The effect of OsNAM 12 j on in vitro root phenotype of different genotypes.
  • FIG. 15 Haplotype Structure at OsNAM12.1.
  • Figure depicts SNP calls from the 125 genomes data across the LOC_Osl2g29330.1 locus, including the 5' and 3' untranslated region (UTR).
  • UTR untranslated region
  • Seven major haplotypes were identified by clustering the domesticated varieties at both synonymous and non-synonymous SNPs that differ from the Nipponbare reference genome.
  • the temperate japonica subpopulation is comprised of one haplotype, while the indica, aus, tropical japonica, and aromatic subpopulations each have two haplotypes (labeled along the y-axis of the graph).
  • Nipponbare SNPs are labeled in dark blue.
  • Synonymous SNPs that differ from the reference genome are labeled in white.
  • Four Non-synonymous SNPs were identified within the coding sequence. Two of these non-synonymous SNPs are highly prevalent within the indica subpopulation (labeled yellow), and are present within WayRarem. The other two non-synonymous SNPs identified are relatively rare within this collection of germplasm, only appearing three times within all 125 genetic lines (labeled red). Missing SNP calls are labeled with a double period (..).
  • FIG. 16A SSR marker and CG-allele based genotyping of Intra-QTL recombinant lines.
  • FIG. 16B Effect on root growth under presence/absence of genetic regions in IQRLs.
  • FIG. 16C Field-based yield data on line 937-B and 917-B. The colored numbers represent highest yield.
  • FIG. 17 Field performance and grain characteristics of BC 2 F3 :4 and BC 3 F 3:7 NILs, parents, and drought-tolerant checks in advanced yield trials under upland severe stress and non-stress conditions with respective percentage recovery of Vandana allele in the background ( BG).
  • FIGS. 18A-18B Fine mapping results.
  • FIG. 17A Top -Using five SSR markers RM28099, RM28130, RM511, RM1261 and RM28166 represented as alphabets respectively or Bottom - the nine candidate genes OsGPDP 12 1 , OsAmH 12 1 OsPOLe 12 1 OsMtN3 12 .i, OsCesA 12 1 , OsNAM 12 .i, OsGDP 12 1 , OsWAK 12 1 and OsARF 12 1 represented as numerals 1-9 respectively on the x-axis.
  • FIG. 187B In qDTY ]2 ] recombinant plants, yield was reduced as the percentage of WR alleles decreased.
  • FIG. 19A-19F Heat map style representation of the observation that higher the number of WayRarem alleles of markers (genes) along qDTY ]2 ] , better the yield.
  • the figure represents raw data for yield (Y-axis-right; Kg/h) in different recombinant lines (Y-axis-left) containing markers (X-axis top) for Vandana (yellow), WayRarem (Green) and heterozygote (light green) alleles under no stress (FIG. 19A), mild stress (FIG. 19B), moderate stress (FIG. 19C), severe stress-I (FIG. 19D), severe stress-II (FIG. 19E).
  • the sixth panel (FIG. 19F) represents percent yield loss under the two severe stress conditions combined.
  • FIGS. 20A-20B Differences between Vandana and WayRarem in the potential post- translational modification of in FIG. 20A) SUMOylation and FIG. 20B) phosphorylation sites.
  • Figures disclose SEQ ID NOS 182, 184-187, 183-184, 187, and 186, respectively, in order of appearance.
  • FIGS. 21A-21C Differences in LRN and SUMOylation of OsNAM 12 1 in different plant lines.
  • FIG. 21A 2D-immunodetection of OsNAM 12 1 SUMOylation pattern under drought in various plant lines. The arrows indicate spots that are substantially reduced under drought in the tolerant lines of 481-B, WR50-6-B4 (2.3), V-OsNAM 12 1 ⁇ (V-Ox) and I-OsNAM 12 1 ⁇ (IR-Ox) but not in Vandana or WayRarem. Multiple spots are most likely the various combinations of multiple phosphorylation and SUMOylation of OsNAM 12J .
  • FIG. 21A 2D-immunodetection of OsNAM 12 1 SUMOylation pattern under drought in various plant lines. The arrows indicate spots that are substantially reduced under drought in the tolerant lines of 481-B, WR50-6-B4 (2.3), V-OsNAM 12 1 ⁇
  • FIG. 21B The effect of OsNAM 12J on in vitro root phenotype of different 'genotypes' .
  • FIG. 21C 3D scatterplot for total root length, maximum root depth and root surface area of Vandana, WayRarem, V-OsNAMi 2. i ⁇ , 481-B, and WR-50-6-B4 plants at 15 days after germination. Data was collected with ImageJ root analyzer from 8 to 15 seedlings under normal and PEG-simulated drought conditions. Statistical analysis and graph plotting were performed using R software. Multiple stalks of a single color represent mean values for multiple samples within a 'genotype' , which represent different SD within the group in the three root traits. A single stalk for 481-B in well-watered conditions is masked by one of the stalks of WayRarem indicating similar values of the two.
  • FIG. 22 Proteins related to cell growth and cell wall formation, along with amino acid metabolism in the roots during stress. Specific locus IDs in the MSU database are shown, along with the protein description and the comparative amounts in NILs compared to Vandana.
  • FIG. 23 Proteins related to glycolysis and the TCA cycle in the flag leaf, spikelets and roots during stress.
  • FIG. 24 Proteins related to carbohydrate metabolism, specifically sucrose and starch metabolism in the flag leaf and spikelets during stress. Specific locus IDs in the MSU database are shown, along with the protein description and the comparative amounts in the NILs compared to
  • FIG. 25 Proteins related to photosynthesis and photorespiration in the flag leaf during stress. Specific locus IDs in the database are shown, along with the protein description and the comparative amounts in the NILs compared to Vandana.
  • FIG. 26 Proteins related to redox systems in the flag leaf during stress. Specific locus IDs in the MSU database are shown along with the protein description and the comparative amounts in the NILs compared to Vandana.
  • FIGS. 27A-27B FIG. 28 A) A Venn diagram depicting the unique and common proteins identified in all the three tissues from the parent Vandana and the 481-B during drought stress treatment.
  • FIG. 28B Percentage overview of the proteins mapped onto the gene ontologies through MapMan in flag leaf, spikelets and roots during stress represented as in the 481-B compared to Vandana.
  • FIGS. 31A-31F Content of total free amino acid in the spikelets (FIGS. 31A-31C) and in the flag leaf (FIGS. 31D-31F) of the parents (Vandana and WayRarem) and the 481-B. Green bars represent the well-watered treatment (control) while red bars represent the drought (stress) treatment.
  • FIG. 33 Complete set of primers used for quantitative PCR analysis in Example 3 (SEQ ID NOS 188-197, respectively, in order of appearance).
  • Generating drought tolerant rice genotypes is a highly desirable goal for hunger and poverty amelioration.
  • Single gene transgenic approaches or QTL research have yet not resulted in tolerance levels better than in the available landraces.
  • Disclosed herein are methods of improving upon the tolerance level of a commercial rice genotype through a QTL. This result is of future significance to rice farmers. Also disclosed is evidence that success with this QTL is due to a gene-complex of different genes co-localized at this region. These genes explained multiple morpho-physiological traits altered under drought. This is the first such validation. Ideally expected but rarely demonstrated, field- and lab-based results are corroborative.
  • the present invention provides methods and materials useful for improving lateral root growth, water uptake, and the yield of grain of cereal grasses grown under drought stress conditions.
  • Yield describes the amount of grain produced by a plant or a group, or crop, of plants. Yield can be measured in several ways, e.g. t ha "1 , average grain yield per plant.
  • drought stress means a period of insufficient water supply for normal plant development and growth.
  • Improved yield under drought stress means an increase in the yield of a plant or a group, or crop, of plants compared to corresponding plant or a group, or crop, of plants.
  • phenotypic trait is a distinct variant of an observable characteristic, e.g., yield under drought conditions, of a plant that may be inherited by a plant or may be artificially incorporated into a plant by processes such as transfection.
  • introduction means the movement of one or more genes, or a group of genes, from one plant variety into the gene complex of another as a result of backcrossing.
  • a "plant cell” means a plant cell that is transformed with stably-integrated, non-natural, recombinant DNA, e.g. by Agrobacterium-mediated transformation, bombardment using microparticles coated with recombinant DNA, or other method, or by programmable site-specific nucleases, e.g. zinc -finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), clustered regulator interspaced short palindromic repeat (CRISP)/Cas-based RNA-guided DNA endonucleases, or other nuclease .
  • ZFNs zinc -finger nucleases
  • TALENs transcription activator-like effector nucleases
  • CRISP clustered regulator interspaced short palindromic repeat
  • a plant cell of this invention can be an originally-transformed or nucleases-modified plant cell that exists as a microorganism or as a progeny plant cell that is regenerated into differentiated tissue, e.g. into a transgenic plant with stably-integrated, non-natural recombinant DNA, or seed or pollen derived from a progeny transgenic plant.
  • transgenic plant means a plant whose genome has been altered by the stable integration of recombinant DNA.
  • a transgenic plant includes a plant regenerated from an originally-transformed plant cell and progeny transgenic plants from later generations or crosses of a transformed plant.
  • recombinant DNA means DNA which has been a genetically engineered and constructed outside of a cell including DNA containing naturally occurring DNA or cDNA or synthetic DNA.
  • Percent identity describes the extent to which the sequences of DNA or protein segments are invariant throughout a window of alignment of sequences, for example nucleotide sequences or amino acid sequences. Percent identity is calculated over the aligned length preferably using a local alignment algorithm, such as BLASTp. As used herein, sequences are "aligned" when the alignment produced by BLASTp has a minimal e-value.
  • promoter means regulatory DNA for initializing transcription.
  • a "promoter that is functional in a plant cell” is a promoter capable of initiating transcription in plant cells whether or not its origin is a plant cell, e.g. is it well known that Agrobacterium promoters are functional in plant cells.
  • plant promoters include promoter DNA obtained from plants, plant viruses and bacteria such as Agrobacterium and Bradyrhizobium bacteria.
  • operably linked means the association of two or more DNA fragments in a recombinant DNA construct so that the function of one, e.g. protein-encoding DNA, is controlled by the other, e.g. a promoter.
  • expressed means produced, e.g. a protein is expressed in a plant cell when its cognate DNA is transcribed to mRNA that is translated to the protein.
  • control plant means a plant that does not contain the recombinant DNA that imparts enhanced yield under drought stress.
  • a control plant is used to identify and select a transgenic plant that has enhanced yield under drought stress.
  • a suitable control plant can be a non- transgenic plant of the parental line used to generate a transgenic plant, i.e. devoid of recombinant DNA.
  • a suitable control plant may in some cases be a progeny of a hemizygous transgenic plant line that does not contain the recombinant DNA, known as a negative segregant.
  • Recombinant DNA constructs are assembled using methods well known to persons of ordinary skill in the art and typically comprise a promoter operably linked to DNA, the expression of which provides the enhanced agronomic trait.
  • Other construct components may include additional regulatory elements, such as 5' leaders and introns for enhancing transcription, 3' untranslated regions (such as polyadenylation signals and sites), DNA for transit or signal peptides.
  • promoters that are active in plant cells have been described in the literature. These include promoters present in plant genomes as well as promoters from other sources, including nopaline synthase (NOS) promoter and octopine synthase (OCS) promoters carried on tumor-inducing plasmids of Agrobacterium tumefaciens and the CaMV35S promoters from the cauliflower mosaic virus as disclosed in U.S. Pat. Nos. 5,164,316 and 5,322,938.
  • Useful promoters derived from plant genes are found in U.S. Pat. No: 5,641,876 which discloses a rice actin promoter, U.S. Pat.
  • the promoters may be altered to contain multiple "enhancer sequences" to assist in elevating gene expression.
  • enhancers are known in the art.
  • the expression of the selected protein may be enhanced.
  • These enhancers often are found 5' to the start of transcription in a promoter that functions in eukaryotic cells, but can often be inserted upstream (5') or downstream (3') to the coding sequence.
  • these 5' enhancing elements are introns. Particularly useful as enhancers are the 5' introns of the rice actin 1 (see U.S. Pat.
  • Quantitative trait locus refers to a polymorphic genetic locus with at least two alleles that reflect differential expression of a continuously distributed phenotypic trait.
  • association with refers to, for example, a nucleic acid and a phenotypic trait, that are in linkage disequilibrium, i.e., the nucleic acid and the trait are found together in progeny plants more often than if the nucleic acid and phenotype segregated independently.
  • the term "marker” or “molecular marker” or “genetic marker” refers to a genetic locus (a "marker focus") used as a point of reference when identifying genetically linked loci such as a quantitative trait locus (QTL).
  • the term may also refer to nucleic acid sequences complementary to the genomic sequences, such as nucleic acids used as probes or primers.
  • the primers may be complementary to sequences upstream or downstream of the marker sequences.
  • the term can also refer to amplification products associated with the marker.
  • the term can also refer to alleles associated with the markers. Allelic variation associated with a phenotype allows use of the marker to distinguish germplasm on the basis of the sequence.
  • interval refers to a continuous linear span of chromosomal DNA with termini defined by and including molecular markers.
  • crossed or "cross” in the context of this invention means the fusion of gametes via pollination to produce progeny (i.e., cells, seeds or plants).
  • progeny i.e., cells, seeds or plants.
  • the term encompasses both sexual crosses (the pollination of one plant by another) and selling (self-pollination, i.e., when the pollen and ovule are from the same plant or from genetically identical plants).
  • stringent hybridization conditions refers to conditions under which a probe or nucleic acid will hybridize to its target subsequence, typically in a complex mixture of nucleic acids, but to essentially no other sequences. Stringent conditions are sequence -dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Thijssen (Thijssen, 1993). Generally, stringent conditions are selected to be about 5-10° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH.
  • Tm thermal melting point
  • the Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium).
  • Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • a positive signal is at least two times background, preferably 10 times background hybridization.
  • Exemplary stringent hybridization conditions are often: 50% formamide, 5xSSC, and 1% SDS, incubating at 42° C, or, 5xSSC, 1% SDS, incubating at 65° C, with wash in 0.2xSSC, and 0.1% SDS at 65° C.
  • PCR a temperature of about 36° C. is typical for low stringency amplification, although annealing temperatures may vary between about 32° C. and 48° C. depending on primer length. Additional guidelines for determining hybridization parameters are provided in numerous references, e.g. Current Protocols in Molecular Biology, eds. Ausubel, et al. 1995).
  • a QTL of the present invention comprises at least one marker associated with the QTL of the present invention selected from the group consisting of: RM28048 (forward primer: SEQ ID NO: 22; reverse primer: SEQ ID NO: 23); RM28076 (forward primer: SEQ ID NO: 24; reverse primer: SEQ ID NO: 25); RM28089 (forward primer: SEQ ID NO: 26; reverse primer: SEQ ID NO: 27);
  • RM28099 forward primer: SEQ ID NO: 28; reverse primer: SEQ ID NO: 29
  • RM28130 forward primer: SEQ ID NO: 30; reverse primer: SEQ ID NO: 31
  • RM511 forward primer: SEQ ID NO: 32; reverse primer: SEQ ID NO: 33
  • RM1261 forward primer: SEQ ID NO: 34; reverse primer: SEQ ID NO: 35
  • RM28166 forward primer: SEQ ID NO: 36; reverse primer: SEQ ID NO: 37
  • RM28199 forward primer: SEQ ID NO: 38; reverse primer: SEQ ID NO: 39
  • Indel-8 forward primer: SEQ ID NO: 60; reverse primer: SEQ ID NO: 61
  • the markers indicate linked inheritance of genetic regions or the absence of observed recombination within such genetic regions. Therefore, it is noted that the markers listed herein indicate the chromosomal region where a QTL of the invention is located in the genome of the specified rice varieties and that those markers do not necessarily define the boundaries or the structure of that QTL. Thus, the part of the QTL that comprises the essential yield-improving nucleic acid sequence(s) may be considerably smaller than that indicated by the contiguous markers listed for a particular QTL. Such a part is herein referred to as a "yield-improving part" of a QTL.
  • a yield-improving part of a QTL for improving yield under drought stress in cereal grasses may be identified by using a molecular marker technique, for instance, with one or more of the markers for a QTL disclosed herein as being linked to said QTL, preferably in combination with a yield bioassay. Cereal grass plants that do not comprise a yield-improving part of a QTL of the present invention have a relatively lower yield.
  • the markers provided by the present invention may be used for detecting the presence of one or more QTLs of the invention in a cereal grass plant suspected of having improved yield under drought stress, and may therefore be used in methods involving marker-assisted breeding and selection of cereal grass plants having improved yield under drought stress.
  • detecting the presence of a QTL of the invention is performed with at least one of the markers for a QTL described herein as being linked to the QTL.
  • the present invention therefore relates in another aspect to a method for detecting the presence of a QTL for improved yield under drought stress, comprising detecting the presence of a nucleic acid sequence of the QTL in a cereal grass plant suspected of having improved yield under drought stress, wherein the presence of the nucleic acid sequence may be detected by the use of the said markers.
  • the nucleic acid sequence of a QTL of the present invention may be determined by methods known to the skilled person. For instance, a nucleic acid sequence comprising the QTL or a yield- improving part thereof may be isolated from a donor plant by fragmenting the genome of said plant and selecting those fragments harboring one or more markers indicative of the QTL. Subsequently, or alternatively, the marker sequences (or parts thereof) indicative of the QTL may be used as PCR amplification primers, in order to amplify a nucleic acid sequence comprising said QTL from a genomic nucleic acid sample or a genome fragment obtained from said plant. The amplified sequence may then be purified in order to obtain the isolated QTL. The nucleotide sequence of the QTL, and/or of any additional markers comprised therein, may then be obtained by standard sequencing methods.
  • the present invention therefore also relates to an isolated nucleic acid (preferably DNA) sequence that comprises a QTL of the present invention, or a yield-improving part thereof.
  • an isolated nucleic acid (preferably DNA) sequence that comprises a QTL of the present invention, or a yield-improving part thereof.
  • the markers that pinpoint the various QTLs described herein may be used for the identification, isolation and purification of one or more genes from cereal that encode for yield improvement under drought stress.
  • the nucleotide sequence of a QTL of the present invention may, for instance, also be resolved by determining the nucleotide sequence of one or more markers associated with the QTL and designing internal primers for the marker sequences that may then be used to further determine the sequence of the QTL outside of the marker sequences.
  • the nucleotide sequence of the markers disclosed herein may be obtained by isolating the markers from the electrophoresis gel used in the determination of the presence of the markers in the genome of a subject plant, and determining the nucleotide sequence of the markers by, for instance, dideoxy chain terminating methods, which are well known in the art.
  • the method may also comprise the steps of providing a oligonucleotide or nucleic acid capable of hybridizing under stringent hybridization conditions to a nucleic acid sequence of a marker linked to the QTL, preferably selected from the markers disclosed herein as being linked to said QTL, contacting the oligonucleotide or nucleic acid with a genomic nucleic acid of a cereal grass plant suspected of possessing relatively higher yield during drought stress, and determining the presence of specific hybridization of the oligonucleotide or nucleic acid to said genomic nucleic acid.
  • said method is performed on a nucleic acid sample obtained from the cereal grass plant suspected of possessing relatively higher yield during drought, although in situ hybridization methods may also be employed.
  • the skilled person may, once the nucleotide sequence of the QTL has been determined, design specific hybridization probes or oligonucleotides capable of hybridizing under stringent hybridization conditions to the nucleic acid sequence of said QTL and may use such hybridization probes in methods for detecting the presence of a QTL of the invention in a cereal grass plant suspected of possessing relatively higher yield during drought stress.
  • a nucleic acid (preferably DNA) sequence comprising at least one QTL of the present invention or a yield-improving part thereof, may be used for the production of a cereal grass plant with improved yield under drought stress.
  • the invention provides for the use of a QTL of the present invention or yield-improving parts thereof, for producing a cereal grass plant with improved yield under drought stress, which use involves the introduction of a nucleic acid sequence comprising said QTL in a cereal grass plant having relatively low yield under drought stress.
  • said nucleic acid sequence may be derived from a suitable donor cereal grass plant.
  • Suitable donor rice plants capable of providing a nucleic acid sequence comprising at least one of the hereinbefore described QTLs, or yield-improving parts thereof, are WayRarem, and the WayRarem-derived hybrids IR74371-46-1-1 and IR79971-B-102-B.
  • Other related rice plants that exhibit relatively high yield under drought stress and comprise one or more genes that encode for improved yield under drought stress may also be utilized as donor plants as the present invention describes how this material may be identified.
  • a suitable recipient cereal grass plant is a rice plant that does not comprise a yield- improving QTL described herein, or a yield-improving part thereof, including but not limited to Vandana; Kalinga 3; Anjali; IR64; Swarna; Sambha Mahsuri; MTU1010, Lalat; Naveen; Sabitri; BR11 ; BR29; BR28; TDK1; TDK 9; and Chirang.
  • the said nucleic acid sequence may be transferred by crossing a donor cereal grass plant with a susceptible recipient cereal grass plant (i.e. by introgression), by transformation, by protoplast fusion, by a doubled haploid technique, by embryo rescue, or by any other nucleic acid transfer system, optionally followed by selection of offspring plants comprising the QTL and exhibiting improved yield under drought stress.
  • a nucleic acid sequence comprising a QTL for improved yield under drought stress according to the present invention may be isolated from said donor plant by using methods known in the art and the thus isolated nucleic acid sequence may be transferred to the recipient plant by transgenic methods, for instance by means of a vector, in a gamete, or in any other suitable transfer element, such as a ballistic particle coated with said nucleic acid sequence.
  • Plant transformation generally involves the construction of an expression vector that will function in plant cells.
  • a vector comprises a nucleic acid sequence that comprises a QTL for improved yield under drought stress of the present invention, or a yield-improving part thereof, which vector may comprise a yield-improving gene that is under control of, or operatively linked to, a regulatory element such as a promoter.
  • the expression vector may contain one or more such operably linked gene/regulatory element combinations, provided that at least one of the genes contained in the combinations encodes for improved yield under drought stress.
  • the vector(s) may be in the form of a plasmid, and can be used alone or in combination with other plasmids to provide transgenic plants that have improved yield under drought stress, using transformation methods known in the art, such as the Agrobacterium transformation system.
  • Expression vectors may include at least one marker gene, operably linked to a regulatory element (such as a promoter) that allows transformed cells containing the marker to be either recovered by negative selection (by inhibiting the growth of cells that do not contain the selectable marker gene), or by positive selection (by screening for the product encoded by the marker gene).
  • selectable marker genes for plant transformation include, for example, genes that code for enzymes that metabolically detoxify a selective chemical agent which may be an antibiotic or a herbicide, or genes that encode an altered target which is insensitive to the inhibitor.
  • positive selection methods are known in the art, such as mannose selection.
  • marker-less transformation can be used to obtain plants without mentioned marker genes, the techniques for which are known in the art.
  • A. tumefaciens and A. rhizogenes are plant pathogenic soil bacteria that genetically transform plant cells.
  • rhizogenes carry genes responsible for genetic transformation of the plant.
  • Methods of introducing expression vectors into plant tissue include the direct infection or co-cultivation of plant cells with Agrobacterium tumefaciens. Descriptions of Agrobacterium vectors systems and methods for Agrobacterium-mediated gene transfer are provided by Gruber and Crosby, 1993 and Moloney et al., 1989. See also, U.S. Pat. No. 5,591,616. General descriptions of plant expression vectors and reporter genes and transformation protocols and descriptions of Agrobacterium vector systems and methods for Agrobacterium-mediated gene transfer can be found in Gruber and Crosby, 1993.
  • Another method for introducing an expression vector into a plant is based on microprojectile- mediated transformation wherein DNA is carried on the surface of microprojectiles.
  • the expression vector is introduced into plant tissues with a biolistic device that accelerates the microprojectiles to speeds of 300 to 600 m/s which is sufficient to penetrate plant cell walls and membranes.
  • Another method for introducing DNA to plants is via the sonication of target cells.
  • liposome or spheroplast fusion has been used to introduce expression vectors into plants.
  • Direct uptake of DNA into protoplasts using CaCl 2 precipitation, polyvinyl alcohol, or poly-L-ornithine may also be used. Electroporation of protoplasts and whole cells and tissues has also been described.
  • Zinc-finger nucleases ZFNs
  • transcription activator-like effector nucleases TALENs
  • CRISPR clustered regularly interspaced short palindromic repeat
  • the chimeric nucleases of ZFNs and TALENs are composed of programmable, sequence-specific DNA-binding modules linked to a nonspecific DNA cleavage domain. ZFNs and TALENs enable a broad range of genetic
  • any one of these technologies may be used to modify the genome of a cereal grass plant.
  • Such modification may include modification, insertion, or deletion of a QTL or one or more individual genes associated with improved lateral root growth, water uptake, and increased yield under drought conditions.
  • the Vandana genome which already includes qDTY 2.3 , or a functional part thereof, may be modified from the Vandana allele to the WayRarem allele at OsNAM 12 1 .
  • protoplast fusion can be used for the transfer of nucleic acids from a donor plant to a recipient plant.
  • Protoplast fusion is an induced or spontaneous union, such as a somatic hybridization, between two or more protoplasts (cells of which the cell walls are removed by enzymatic treatment) to produce a single bi- or multi-nucleate cell.
  • the fused cell which may even be obtained with plant species that cannot be interbred in nature, is tissue cultured into a hybrid plant exhibiting the desirable combination of traits. More specifically, a first protoplast can be obtained from a cereal grass plant or other plant line that exhibits improved yield under drought stress.
  • a protoplast from rice WayRarem can be used.
  • a second protoplast can be obtained from rice or other plant variety, preferably a variety that comprises commercially desirable characteristics, such as, but not limited to disease resistance, insect resistance, weed resistance, etc.
  • the protoplasts are then fused using traditional protoplast fusion procedures, which are known in the art.
  • embryo rescue may be employed in the transfer of a nucleic acid comprising one or more QTLs of the present invention from a donor plant to a recipient plant.
  • Embryo rescue can be used as a procedure to isolate embryo's from crosses wherein plants fail to produce viable seed. In this process, the fertilized ovary or immature seed of a plant is tissue cultured to create new plants (Pierik, 1999).
  • the present invention also relates to a method of producing a cereal grass plant having improved yield under drought stress comprising the steps of performing a method for detecting the presence of a quantitative trait locus (QTL) associated with improved yield under drought stress in a donor cereal grass plant according to invention as described above, and transferring a nucleic acid sequence comprising at least one QTL thus detected, or a yield-improving part thereof, from said donor plant to a cereal grass plant having a relatively lower yield under drought stress.
  • QTL quantitative trait locus
  • a preferred embodiment of such a method comprises the transfer by introgression of said nucleic acid sequence from a cereal grass plant having improved yield under drought stress into a cereal grass plant having a relatively lower yield under drought stress by crossing said plants. This transfer may thus suitably be accomplished by using traditional breeding techniques.
  • QTLs are preferably introgressed into commercial cereal grass varieties by using marker-assisted breeding (MAS). Marker-assisted breeding or marker-assisted selection involves the use of one or more of the molecular markers for the identification and selection of those offspring plants that contain one or more of the genes that encode for the desired trait. In the present instance, such identification and selection is based on selection of QTLs of the present invention or markers associated therewith.
  • MAS can also be used to develop near-isogenic lines (NIL) harboring the QTL of interest, allowing a more detailed study of each QTL effect and is also an effective method for development of backcross inbred line (BIL) populations (see, e.g., Nesbitt et al., 2001 ; van Berloo et al., 2001).
  • NIL near-isogenic lines
  • BIL backcross inbred line
  • Cereal grass plants developed according to this preferred embodiment can advantageously derive a majority of their traits from the recipient plant, and derive improved yield under drought stress from the donor plant.
  • a donor cereal grass plant comprising a nucleic acid sequence encoding for improved yield under drought stress is crossed with a cereal grass plant having a relatively lower yield under drought stress that preferably exhibits commercially desirable characteristics, such as, but not limited to, disease resistance, insect resistance, weed resistance, etc.
  • the resulting plant population (representing the Fl hybrids) is then self -pollinated and set seeds (F2 seeds).
  • the F2 plants grown from the F2 seeds are then screened for improved yield under drought stress.
  • the population can be screened for improve yield under drought stress in a number of different ways. For example, the population can be screened by field evaluation over several seasons. Yield may be determined by weight of grain per hectare (e.g., t ha "1 , kg ha "1 ), average grain weight per plant, or any other method known in the art.
  • a Cereal Grass Plant Having Improved Yield under Drought Stress, or a Part Thereof, Obtainable by a Method of the Invention is Also an Aspect of the Present Invention.
  • Another aspect of the present invention relates to a cereal grass plant having improved yield under drought stress, or part thereof, comprising within its genome at least one QTL, or a yield-improving part thereof, consisting at least in part of the QTL on chromosome 12 of WayRarem associated with improved yield under drought stress, wherein the QTL or the yield improving part thereof is not in its natural genetic background.
  • the cereal grass plants having improved yield under drought stress of the present invention can be of any genetic type such as inbred, hybrid, haploid, dihaploid, parthenocarp, or transgenic. Further, the plants of the present invention may be heterozygous or homozygous for the improved yield under drought stress trait, preferably homozygous.
  • the QTLs of the present invention, as well as those QTLs obtainable by a method of the invention, as well as yield-improving parts thereof may be transferred to any plant in order to provide for a plant having improved yield under drought stress, the methods and plants of the invention are preferably related to the cereal grasses family, more preferably rice.
  • Inbred cereal grass lines having improved yield under drought stress can be developed using the techniques of recurrent selection and backcrossing, selfing and/or dihaploids or any other technique used to make parental lines.
  • improved yield under drought stress can be introgressed into a target recipient plant (which is called the recurrent parent) by crossing the recurrent parent with a first donor plant (which is different from the recurrent parent and referred to herein as the "non-recurrent parent").
  • the recurrent parent is a plant that has relatively low yield under drought stress and possesses commercially desirable characteristics, such as, but not limited to disease resistance, insect resistance, weed resistance, etc.
  • the non-recurrent parent comprises a nucleic acid sequence that encodes for improved yield under drought stress.
  • the non-recurrent parent can be any plant variety or inbred line that is cross-fertile with the recurrent parent.
  • the progeny resulting from a cross between the recurrent parent and non-recurrent parent are backcrossed to the recurrent parent.
  • the resulting plant population is then screened.
  • the population can be screened in a number of different ways.
  • Fl hybrid plants that exhibit improved yield under drought stress comprise the requisite nucleic acid sequence encoding for improved yield under drought stress, and possess commercially desirable characteristics, are then selected and selfed and selected for a number of generations in order to allow for the cereal grass plant to become increasingly inbred.
  • This process of continued selfing and selection can be performed for two to five or more generations.
  • the result of such breeding and selection is the production of lines that are genetically homogenous for the genes associated with improved yield under drought stress as well as other genes associated with traits of commercial interest.
  • MAS can be performed using one or more of the herein described molecular markers, hybridization probes or nucleic acids to identify those progeny that comprise a nucleic acid sequence encoding for improved yield under drought stress.
  • MAS can be used to confirm the results obtained from the quantitative bioassays. Once the appropriate selections are made, the process is repeated.
  • the process of backcrossing to the recurrent parent and selecting for improved yield under drought stress is repeated for approximately five or more generations.
  • the progeny resulting from this process are heterozygous for one or more genes that encode for improve yield under drought stress.
  • the last backcross generation is then selfed in order to provide for homozygous pure breeding progeny for improved yield under drought stress.
  • the cereal grass lines having improved yield under drought stress described herein can be used in additional crossings to create hybrid plants having improved yield under drought stress.
  • a first inbred cereal grass plant having improved yield under drought stress of the invention can be crossed with a second inbred cereal grass plant possessing commercially desirable traits such as, but not limited to, disease resistance, insect resistance, weed resistance, etc.
  • This second inbred cereal grass line may or may not have relatively improved yield under drought stress.
  • molecular markers can include restriction fragment length polymorphisms (RFLP), random amplified polymorphic DNA (RAPD), amplified fragment length polymorphisms (AFLP), single nucleotide polymorphisms (SNP) or simple sequence repeats (SSR).
  • RFLP restriction fragment length polymorphisms
  • RAPD random amplified polymorphic DNA
  • AFLP amplified fragment length polymorphisms
  • SNP single nucleotide polymorphisms
  • SSR simple sequence repeats
  • SSR Simple sequence repeats or microsatellites are regions of DNA where one to a few bases are tandemly repeated for few to hundreds of times. For example, a di- nucleotide repeat would resemble CACACACA and a trinucleotide repeat would resemble ATGATGATGATG (SEQ ID NO: 141).
  • Simple sequence repeats are thought to be generated due to slippage mediated errors during DNA replication, repair and recombination. Over time, these repeated sequences vary in length between one cultivar and another.
  • An example of allelic variation in SSRs would be: allele A being GAGAGAGA (4 repeats of the GA sequence) and allele B being GAGAGAGAGAGA (6 repeats of the GA sequence) (SEQ ID NO: 142).
  • SSRs occur in a coding region, their survival depends on their impact on structure and function of the encoded protein. Since repeat tracks are prone to DNA-slippage mediated expansions/deletions, their occurrences in coding regions are limited by non-perturbation of the reading frame and tolerance of expanding amino acid stretches in the encoded proteins.
  • tri-nucleotide repeats or multiples thereof are more common in coding regions.
  • a single nucleotide polymorphism is a DNA sequence variation occurring when a single nucleotide - A, T, C or G - differs between members of a species (or between paired chromosomes in an individual). For example, two sequenced DNA fragments from two individuals, AAGCCTA to AAGCTTA, contain a difference in a single nucleotide. In this case, there are two alleles: C and T.
  • a primary motivation for development of molecular markers in crop species is the potential for increased efficiency in plant breeding through marker assisted selection (MAS) and marker assisted backcrossing (MABC).
  • MAS marker assisted selection
  • MABC marker assisted backcrossing
  • Genetic marker alleles are used to identify plants that contain a desired genotype at one or more loci and that are expected to transfer the desired genotype, along with a desired phenotype to their progeny. Genetic marker alleles can be used to identify plants that contain a desired genotype at one locus or at several unlinked or linked loci (e.g., a haplotype) and that would be expected to transfer the desired genotype, along with a desired phenotype to their progeny.
  • the present invention provides the means to identify cereal grass plants, particularly rice, that are able to improve the yield of grain under drought stress by identifying plants having a specified quantitative trait locus or gene, e.g., qDTY ]2 .i, OsNAM 12 1 , and homologous or linked markers. Similarly, by identifying plants having poor yield under drought stress, such low-yielding plants can be identified and, e.g., eliminated from subsequent crosses.
  • a desired phenotype e.g., improved yield under drought stress and a polymorphic chromosomal locus, e.g., a marker locus or QTL
  • a polymorphic chromosomal locus e.g., a marker locus or QTL
  • MAS marker-assisted selection
  • This detection can take the form of hybridization of a probe nucleic acid to a marker, e.g., using allele-specific hybridization, Southern analysis, northern analysis, in situ hybridization, hybridization of primers followed by PCR amplification of a region of the marker or the like.
  • a marker e.g., using allele-specific hybridization, Southern analysis, northern analysis, in situ hybridization, hybridization of primers followed by PCR amplification of a region of the marker or the like.
  • a variety of procedures for detecting markers are described herein. After the presence (or absence) of a particular marker and/or marker allele in the biological sample is verified, the plant may be selected, i.e., used to make progeny plants by selective breeding.
  • Rice breeders combine modern irrigated rice varieties, e.g. Vandana and Sabitri, with genes for improved yield under drought stress and other desirable traits to develop improved rice varieties. Screening a large number of plants for improved yield under drought stress can be expensive, time consuming and unreliable.
  • Use of the polymorphic loci described herein, and genetically-linked nucleic acids, as genetic markers for the improved yield under drought stress locus is an effective method for selecting varieties capable of fertility restoration in breeding programs. For example, one advantage of marker-assisted selection over field evaluations for improved yield under drought stress is that MAS can be done at any time of year regardless of the growing season. Moreover, environmental effects are irrelevant to marker-assisted selection.
  • MAS MAS
  • backcross breeding is the process of crossing a progeny back to one of its parents. Backcrossing is usually done for the purpose of introgressing one or a few loci from a donor parent into an otherwise desirable genetic background from the recurrent parent. The more cycles of backcrossing that are done, the greater the genetic contribution of the recurrent parent to the resulting variety. This is often necessary, because donor parent plants may be otherwise undesirable.
  • varieties which are the result of intensive breeding programs may have excellent yield, fecundity or the like, merely being deficient in one desired trait such as yield under drought stress.
  • backcrossing can be done to select for or against a trait.
  • Markers corresponding to genetic polymorphisms between members of a population can be detected by numerous methods, well-established in the art (e.g., restriction fragment length
  • polymorphisms isozyme markers, allele specific hybridization (ASH), amplified variable sequences of the plant genome, self-sustained sequence replication, simple sequence repeat (SSR), single nucleotide polymorphism (SNP) or amplified fragment length polymorphisms (AFLP)).
  • SSR simple sequence repeat
  • SNP single nucleotide polymorphism
  • AFLP amplified fragment length polymorphisms
  • hybridization formats include but are not limited to, solution phase, solid phase, mixed phase or in situ hybridization assays.
  • Markers which are restriction fragment length polymorphisms (RFLP) are detected by hybridizing a probe (which is typically a sub- fragment or a synthetic oligonucleotide corresponding to a sub-fragment of the nucleic acid to be detected) to restriction digested genomic DNA.
  • the restriction enzyme is selected to provide restriction fragments of at least two alternative (or polymorphic) lengths in different individuals and will often vary from line to line. Determining a (one or more) restriction enzyme that produces informative fragments for each cross is a simple procedure, well known in the art. After separation by length in an appropriate matrix (e.g., agarose) and transfer to a membrane (e.g., nitrocellulose, nylon), the labeled probe is hybridized under conditions which result in equilibrium binding of the probe to the target followed by removal of excess probe by washing. Nucleic acid probes to the marker loci can be cloned and/or synthesized.
  • an appropriate matrix e.g., agarose
  • a membrane e.g., nitrocellulose, nylon
  • Detectable labels suitable for use with nucleic acid probes include any composition detectable by spectroscopic, radioisotopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means.
  • Useful labels include biotin for staining with labeled streptavidin conjugate, magnetic beads, fluorescent dyes, radiolabels, enzymes and colorimetric labels.
  • Other labels include ligands which bind to antibodies labeled with fluorophores, chemiluminescent agents and enzymes. Labeling markers is readily achieved such as by the use of labeled PCR primers to marker loci.
  • Amplified variable sequences refer to amplified sequences of the plant genome which exhibit high nucleic acid residue variability between members of the same species. All organisms have variable genomic sequences and each organism (with the exception of a clone) has a different set of variable sequences. Once identified, the presence of specific variable sequence can be used to predict phenotypic traits.
  • DNA from the plant serves as a template for amplification with primers that flank a variable sequence of DNA. The variable sequence is amplified and then sequenced.
  • RNA polymerase mediated techniques e.g., NASBA
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • NASBA RNA polymerase mediated techniques
  • Oligonucleotides for use as primers are typically synthesized chemically according to the solid phase phosphoramidite triester method, or can simply be ordered commercially.
  • self-sustained sequence replication can be used to identify genetic markers.
  • Self-sustained sequence replication refers to a method of nucleic acid amplification using target nucleic acid sequences which are replicated exponentially in vitro under substantially isothermal conditions by using three enzymatic activities involved in retroviral replication: (1) reverse transcriptase, (2) Rnase H and (3) a DNA-dependent RNA polymerase. By mimicking the retroviral strategy of RNA replication by means of cDNA intermediates, this reaction accumulates cDNA and RNA copies of the original target.
  • AFLP amplified fragment length polymorphisms
  • ASH allele-specific hybridization
  • SNP single nucleotide polymorphisms
  • SSR simple sequence repeats
  • isozyme markers Methods of using the different types of molecular markers are known to those skilled in the art.
  • the ⁇ 12 ⁇ QTL and genes MtN3 12J ; WAK 1Z1 ; CesA 12 1 ; GDP 12 1 ; ARF 12 1 ; Nod 12 .i ', and AmHl 12 1 , or homologs thereof, in the genome of a plant exhibiting a preferred phenotypic trait is determined by any method listed above, e.g., RFLP, AFLP, SSR, etc. If the nucleic acids from the plant are positive for one or more desired genetic markers, the plant can be selfed to create a true breeding line with the same genotype or it can be crossed with a plant with the same marker or with other desired characteristics to create a sexually crossed hybrid generation.
  • Example 1 A Gene- Complex Affecting Multiple Component Traits Underpins a Large- Effect QTL for Rice Yield Under Drought.
  • Vandana is an upland-adapted cultivar derived from a cross between C22 and Kalakeri. This cultivar is early to mature, and low yielding but tolerant of drought, and is grown in drought-prone areas of Jharkhand and Orissa (eastern India).
  • WayRarem is a high-yielding, drought-susceptible upland rice cultivar from Indonesia. The yield-increasing allele in this study was derived from the susceptible parent, WayRarem, making the tolerant parent Vandana the recipient parent for a MAB program.
  • IR79971-B- 102-B one of the F 3 -derived lines from the original population, was used as the donor for qDTY 12 1 .
  • This line was backcrossed to Vandana to develop BC 2 - and BC 3 -derived populations for the identification of NILs with qDTY 12 1 showing improved tolerance of drought compared with Vandana.
  • a set of such contrasting +QTL and -QTL BC 2 F 3 -derived lines was used for the qDTY 12 1 physiology studies.
  • RM28166, RM28199, RM28048, and Indel-8) were used for foreground, recombinant, and background selection. All markers described by Bernier et al. (2007) were used for selection. Three other markers, RM28076, RM28089, and RM28099, were also included for foreground and recombinant selection.
  • the cM position was used for constructing chromosome maps.
  • Graphical genotyping software GGT2 was used for the construction of chromosome maps of the selected lines.
  • FIG. 4B The MAB scheme for the transfer of qDTY 12 1 into Vandana is shown in FIG. 4B.
  • qDTY 12 1 spans between RM28048 and RM28166 on chromosome 12 of the rice genome.
  • IR79971-B-102-B an F 3:4 line with the full segment of the QTL, was crossed twice to Vandana to develop a BC 2 Fi (241 plants).
  • the population was screened with RM28048, RM511, and RM28166 to identify individual plants segregating for qDTY 12. i (foreground selection).
  • the selected plants were then screened with 42 SSR markers for the presence of the Vandana allele across the background (background selection) and two BC 2 Fi plants (IR84984-21-19 and IR84984-83-15) segregating for qDTY 12 1 and maximum background recovery were identified to develop the BC 2 F 2 population.
  • a large BC 2 F 2 population (1907 plants) was developed from the identified BC 2 F ! plants and was genotyped with foreground markers RM28048, RM28130, and CG29430 to identify lines segregating for the qDTY 12 locus.
  • the 180 BC 2 F 3 lines identified through this process were then saturated with six additional SSR markers, RM28076,
  • RM28089, RM28099, RM511, RM1261, and RM26166 within the region and were screened under varying drought-stress conditions to identify high-yielding BC 2 F 3 -derived NILs. Lines from this population with and without the full region of the QTL (RM28048-RM28166) were also used for the study of QTL physiology.
  • BC 2 F 3 4 lines, IR84984-21-19-861-B, IR84984-21-19-158-B, IR84984-21- 19-177-B, IR84984-21-19-917-B, IR84984-83-15-805-B, and IR84984-83-15-937-B, were backcrossed to Vandana to generate 148 BC 3 F 1 plants. These lines were also screened with all background markers segregating in the BC 2 Fi background screening. The BC 3 Fi plants were screened with all eight markers within the QTL, and 15 BC 3 Fi plants segregating for different segments of qDTY 12 1 were selected for developing a large BC 3 F 2 population (2263 plants).
  • Seeds from 62 different lines coming from BC 2 - and BC 3 -derived populations were multiplied under non-stress conditions and confirmed for the presence of qDTY 12 1 along with background screening with segregating markers. Thirty-five selected lines with the qDTY 12 1 segment were evaluated in advanced yield trials (AYTs) under upland stress and non-stress conditions and four BC 2 -derived and three BC 3 -derived lines with qDTY 12 1 , superior plant type, the highest Vandana genome recovery, and highest yield under non- stress conditions were identified.
  • ABTs advanced yield trials
  • TE Instantaneous transpiration efficiency
  • Table 1 Statistical analysis used.
  • Seedling stage stress trials were established in upland fields in both dry and wet seasons as described above, except that the drought stress treatment was initiated 7 DAS and plants were harvested at 32 DAS to determine biomass.
  • a seedling greenhouse study was conducted in 4-cm-diam 40-cm deep soil-filled tubes according to Henry et al. 2012. Soil moisture treatments included well-watered (WW; maintained at field capacity) and dry down from field capacity (DD), with five replicates per genotype planted in an RCBD. Water uptake, shoot mass, and root length were determined, including one nodal root from each plant with all lateral roots carefully spread apart in order to detect the number of root branches.
  • Root phenotyping Mature dehusked seeds of Vandana, WayRarem, NIL, 6 recombinant lines, IR64 (Parent for the transgenic line) and 3 transgenic events were sterilized in 1 % Sodium Hypochlorite and were germinated in MS 0 media (KN0 3 - 1.9 g /L, (NH 4 ) 2 S0 4 -1.65g /L, MgS0 4 .H20 - 0.37g /L, MnS0 4 .4H 2 0 - 22.3 mg /L, ZnS0 4 .7H 2 0 - 8.6 mg /L, CuS0 4 .5H 2 0 - 0.025 mg /L, CaCl 2 .2H 2 0 - 0.44 g /L, KI - 0.83 mg /L, CoCl 2 .6H 2 0 - 0.025 mg /L, KH 2
  • Ten pregerminated seeds per line were transferred into MS 0 with and without 10% (w/v) PEG (MW: 8,000) in test tubes and were grown under light at 29°C. The root morphology was observed after 8 days and was documented using Nikon D90 camera under diffused light.
  • qDTY12.1 covers a region of 1.75 Mb spanning the area between the markers RM28099 and RM28166. A total of 248 genes were collected from Gramene database. Since this region was closer to the centromere, there were a lot of transposons and retro- transposons. As a first step, all the transposons and retro- transposons were removed.
  • BC2F3 lines were phenotyped for drought tolerance through yield analysis and these lines were then genotyped using SSR markers described herein. Fifty six of these lines were genotyped with 9 candidate gene-based markers using primers designed (Table 2) after comparing the Vandana and WayRarem sequence obtained from the NGS data.
  • Primer pairs for use in RT-PCR experiments were designed based on the coding sequence of candidate genes (sequences obtained from Gramene) (Table 3).
  • reaction was set in 20 ⁇ volume consisting of 5.0 ⁇ of normalized cDNA, 10 ⁇ of 2X SYBR green PCR master mix (Roche Diagnostics GmbH, Germany), and 1 ⁇ each of 10 x primer pair. Reactions were run in duplicate in a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, USA). The amplification conditions maintained were 95 °C for 15 min, 40 cycles of denaturing at 94 °C for 15 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s, followed by a disassociation stage (melting curve analysis). The comparative threshold cycle (AACt) method was used to quantify the relative expression levels.
  • AACt comparative threshold cycle
  • Genomic DNA was extracted from young leaf tissue of 125 purified (homozygous) rice varieties and wild ancestors using Qiagen DNeasy columns, made into paired-end libraries and sequenced on an Illumina Genome Analyser II, providing reads of 88, 100 and 120 bp lengths. Short reads were aligned to the Nipponbare reference genome and SNP genotypes were called using "Panati” (Mark Wright, Cornell University). Genome coverage was > 7x genome equivalents in each case. Fastq data has been deposited in the Short Read Archive at NCBI as AccJD SRA# SAMN02142729- SAMN02142853. Subpopulation identity of the O.
  • PC A Principle Component Analysis
  • the haplotype structure of a ⁇ 6kB region surrounding the OsNAM12.1 gene was analyzed, including 2kB upstream and downstream of the 5' and 3' untranslated regions (UTRs).
  • Proteins were extracted from the roots of the rice plants from both the treatments (drought stress & well-watered) using the trichloroacetic acid-acetone method and dissolved in solubilisation buffer containing 9M urea, 4% CHAPS, 1% DTT, and 1% Biolyte Amphotytes (pH 3-10; BIO-RAD Laboratories, Inc, Hercules, CA, USA). Protein concentration of the extracts was determined using the Bradford method. Protein samples (125 ⁇ g) were rehydrated overnight at room temperature on an IPGphor using IPG Dry-Strips (7 cm, pH 3-10; non-linear gradient, GE Healthcare, USA), followed by iso-electric focusing at 10.8 kVhrs.
  • the IPG strips were loaded on a 10% w/v SDS-PAGE gel using the 4-gel Mini-PROTEAN® Tetra cell (BIO-RAD Laboratories, Inc, Hercules, CA, USA). The gels were run at 20V/gel for 2 h and kept until the dye front reached the bottom of the gel. The gels were visualized using the CBB- G250 and scanned using Quantity One software (BIO- RAD) at a resolution of 600 dpi. After electrophoresis, proteins were blotted onto a nitrocellulose membrane (Hybond-C Extra GE Healthcare Amersham Biosciences, USA) using the "semi-dry method" with a discontinuous buffer system.
  • BIO-RAD Quantity One software
  • the blotting procedure was carried out for 1 h with a constant voltage of 17V. Subsequently, the membrane was blocked with 5% (w/v) dried skimmed milk in PBS-T (0.1% Tween 20 in phosphate buffered saline (PBS), 10 mM Na2HP04, 1.75 mM KH2P04, 13.7 mM NaCl and 2.86 mM KC1) at room temperature for 1 h. Incubation with primary antibody was performed in 5% (w/v) dried skimmed milk in PBS-T (0.01% Tween 20 in PBS) overnight at 4°C.
  • PBS-T phosphate buffered saline
  • the primary antibodies used for these experiments were anti-NAM antibody (1 : 1000 dilution of NAM polyclonal (0.39mg) - Abexome Biosciences, India) and anti-SUMO (1 : 1000 dilution of Sumo 1 antibody (ab5316), Abeam PLC, Cambridge, England). Subsequently, incubation with HRP- conjugated secondary antibody (Goat Anti-Rabbit Antibody Conjugated to Horseradish Peroxidase - 166-2408EDU- BIO-RAD
  • Chemiluminescence was detected by Novex® ECL Chemiluminescent Substrate Reagent Kit (Invitrogen, UK). Blots were exposed to autoradiographic films (Amersham Hyperfilm ECL) for chemiluminescent imaging.
  • Recombinant OsNAM 12 1 was expressed in BL21 E. coli cells from a BamHl and Xhol construct in pGEX-4Tl (Promega) amplified from pCAMBIA_NAM using the primers NAMpGEXFor (CCCCGGATCCATGGAGACGACGGCG) (SEQ ID NO: 131) and NAMpGEXRev
  • GCGCCTCGAGTTAGTCGGAGGCGTCGCC SEQ ID NO: 132
  • Transformed cells were induced with 1 mM IPTG at 25°C and induced cultures lysed in PBS buffer pH 7.4 by sonication. The soluble fraction was extracted by centrifugation at lOOOx g for 30'. Protein was obtained after glutathione sepharose column chromatography (GE healthcare), by eluting with 10 mM glutathione, 50 mM Tris-Hcl pH 8.0. EMSA.
  • Electrophoretic Mobility Shift Assay was performed using LightShift Chemiluminescent EMSA Kit (Thermo Scientific, USA). Around 400 bp to 450 bp promoters region of the target genes were Amplified by PCR using the following pairs primers: OsGDP12.1 (ProGDPOl and ProGDP02), OsCesA12.1 (ProCESAOl and ProCESA02), OsARF12.1 (ProARFOl and ProARF02) and OsNodl2.1 (ProNODOl and ProNOD02) (Table 1).
  • the DNA were labeled with biotin using Biotin ⁇ End DNA Labeling Kit (Thermo Scientific, USA) followed by PCR purification using QIAquick PCR Purification Kit (QIAGEN).
  • the labeled DNA was incubated with different concentration of OsNAM12.1GST for 20 min at 30 °C and were run on 4 % native PAGE. The signals were detected according to the manufacturer' s protocol.
  • TRIM lines used in the current study were M0074686, M0092628, M0111080, M0093267, M0032667 and M0066205 which were AT lines for OsCesA12.1, OsWAK12.1, OsGDP12.1,
  • OsARF12.1, OsSTPK12.1 and OsPOLel2.1 were received for each line. They were imbibed for two days before subjected to the Yoshida medium with gerite in the presence (+) or absence (-) of 23% PEG. Genotyping was performed at Day 10 to identify homozygous, heterozygous, and wild type (no T-DNA integration) plants. qRT-PCR of the root tissue was then performed to confirm the AT/KO nature of each line. The photos of roots of each genotype were taken at Day 14. The roots were fixed at Day 20 and several root parameters were then assayed by scanner coupled with WinRhizo program.
  • the cells were harvested by spinning for 30 seconds at 3000 rpm in a micro-centrifuge. Approximately 3/4 of the supernatant was decanted in the laminar air flow cabinet and the pellet was re-dissolved in the solution that was left behind by slow tapping. These cells were plated in 2 SOB media plates containing 10 mg/L of rifampicin, 50mg/L kanamycin for which the resistance gene is conferred on the plasmid and incubated at 28 °C for 48 hours until the bacterial colonies became visible and big enough for streaking and colony PCR. Plasmid DNA was extracted from colony PCR positive clones and restricted by BamHI and Kpnl to release the insert DNA. Only the colony confirmed by PCR and restriction digestion was used for transformation into immature embryo of IR64.
  • IE immature embryos
  • Agrobacterium culture About 5 ⁇ of the Agrobacterium culture was added to each embryo and the plate was incubated in dark at 25 °C in dark for one week. The shoot was carefully removed from the germinating embryo and it was blotted on sterile filter paper to remove the Agrobacterium. The embryo was placed back to resting medium A202 with 16 embryos arranged per plate for five days. The growing embryos were divided 4 equal parts and were incubated on selection medium (A203) containing 30 mg/L of hygromycin for 10 days. This was repeated three times. A hundred percent transformation efficiency was considered if three plants were produced from 1 ⁇ 4 part of the IE.
  • Resistant calli were transferred to A204 pre -regeneration medium (8 callus lines per Petri dish) containing 50 mg/L of hygromycin and were cultured for 10 days.
  • the greenish embryogenic calli were transferred into A205regeneration medium (4 callus lines per Petri dish) with 50 mg/L of hygromycin for 10 days.
  • growing shoots were selected and transferred to test tubes with solid MS medium for rooting 2 weeks.
  • the well rooted plantlets were washed in tap water and were grown hydroponically in Yoshida culture solution.
  • the composition and details of the media used for Agrobacterium mediated transformation are provided in Appendix 3 and 4.
  • NILs carrying the WayRarem qDTY 12 1 were generated in the Vandana background with 93.4 to 95.9% recovery of the Vandana-genome (FIGS. 4A-4B, 5, 17). All NILs had a yield advantage of 300-500 kg/ha over Vandana under field drought (FIGS. 1A, 17). Mean grain yield was 323 kg/ha, with NIL IR84984-83-15-481-B (481-B) showing the largest increase in grain yield (693 kg/ha vs. 27 kg/ha for Vandana). Field evaluation over six trials in three seasons demonstrated that the additive effect of qDTY 12 1 was proportional to drought severity.
  • NILs also exhibited increased numbers of secondary branches and filled grains in the panicles (FIGS. IB - 1C). Taken together, NILs performed better under drought for multiple morpho-physiological component traits of yield including biomass, DTF, TE, LRN, number of panicle branches, total number of spikelets, and number of filled spikelets.
  • the large-effect qDTY 12 1 is composed of sub-QTLs: the search for candidate genes.
  • Vandana and WayRarem l acked three ATPases and a Tetratricopeptide gene. Vandana lacked an additional gene ⁇ Cellulose synthase A; CesAlO) that WayRarem retained. Considering the promoter and CDS, the sequence of 16 genes was >3 dissimilar between Vandana and WayRarem.
  • the OsNAMn.i protein contains a protein cleavage PEST motif (177- KGSAAASTASPTADADDDDATTER-200 (SEQ ID NO: 180); score 14.1) as in the negative regulatory domain of another drought responsive Arabidopsis transcription factor DREB2A.
  • the lysine bordering the PEST motif can accept ubiquitin or SUMO, and such a modification can alter PEST-targeted protein cleavage, thus affecting protein stability.
  • OsNAM 12 .i are revealed as multiple immuno-detectable bands under well-watered conditions.
  • OsNAM i2 .i was preferentially deSUMOylated.
  • Such differential/preferential activity is known for Ulpl. DeSUMOyltion visualization on 2D gel provided further evidence that OsNAM 12 1 was SUMOylated in vivo.
  • Promoter polymorphism in OsNAM 12 .i was highly relevant to drought response and LRN, while non-synonymous CDS SNPs predicted protein structure variation (FIG. 10). Moreover,
  • Arabidopsis CesA genes might be targets of NAC domain proteins (24).
  • candidate gene promoters when queried for NAM/NAC binding sites revealed OsAmH 12 1 , OsMtN3 12 .i, OsCesA 12 1 , OsGDP 12 1 and OSARF U as putative targets of OsNAM 12 1 .
  • Recombinant WayRarem OsNAM 12 1 binding to these promoters was confirmed with electrophoretic mobility shift assay (EMS A), except for OsAmH 12 1 (FIG. 13A).
  • EMS A electrophoretic mobility shift assay
  • FIG. 13A separate evidence supported OsAmH 12 1 regulation by OsNAM 12 1 .
  • WayRarem OsNAM 12 1 when constitutively over-expressed in IR64 (I-OsNAM 12 1 ox ), led to upregulation of OsCesA 12 1 , OsMtN3 ]2 1, OsARF 12 1 and OsGDP 12 1 and down-regulation of OsAmH 12 1 in T 2 homozygous plants under drought.
  • the up- and down-regulation of these particular genes was similar to the observations in 481-B (FIG. 19).
  • the I-OsNAM 12 1 ox plants exhibited increased root and panicle branching, spikelet number and transpiration rates under drought, as in 481-B (FIGS. 11A-11E).
  • I-OsNAM 12 1 ox plants had similar TE and yield-under-drought in pot studies but under field conditions the I-OsNAM 12 1 ox plants exhibited increase in yield as seen through the number of filled spikelets (FIG. 1 IF). I-OsNAMi 2. i° x plants thus largely recapitulated the performance of 481-B under drought but not to similar extents, as discussed below.
  • the OsNAMn.i is differentially SUMOylated under drought.
  • TFs act as negative and positive regulators, like OsNAM 12 1 most likely does for OsAmH 12 .i and the four other co-localized target genes respectively, through post-translational modification (PTM).
  • Vandana and WayRarem OsNAM 12 1 lacked a phosphorylation and a SUMOylation site respectively from the potential multiple sites for the two correlated PTMs (FIG. 21). Potential multiple SUMOylation may explain the multiple immunodetection bands for OsNAM 12 1 (FIG. 13B).
  • OsNAM 12 1 under drought was also confirmed through 2D -immunodetection (FIG. 22A).
  • the importance of differential SUMOylation of OsNAM 12 1 and its potential role in explaining the epistasis noted for a functional qDTY 12 1 is discussed below.
  • drought- mediated deSUMOylation of some was noteworthy.
  • the functional OsNAM 12 1 haplotype is specific to susceptible genotypes.
  • SUMOylation of OsNAM 12 1 may underlie qDTY 12 1 epistasis.
  • Vandana a similar lack of deSUMOylated moieties under drought, despite the presence of qDTY 23 , was due to the mutations in its OsNAM 12 1 (FIG. 21). Vandana is thus an OsNAM 12 functional knock out (KO) line, amenable to complementation with the WayRarem OsNAM 12 1 as shown through the change in the OsNAM 12 1 2D pattern (FIG. 22A) and in the drought responsive morpho-physiology of 481-B and V-OsNAM 12 1 ox (FIGS. 11 ; 22B - 22C).
  • KO OsNAM 12 functional knock out
  • Root architecture plays an important role in drought tolerance.
  • WR50-6-B4, 481-B and V-OsNAM 12 1 ox in that order, exhibited significant increases over Vandana and WayRarem (FIGS. 22B - 22C).
  • T-DNA insertion-mediated knock out (KO) line for OsAmH 12 1 and activation-tag (AT) lines for OsCesAn.i, OsGDP 12 .i and OsARF 12 1 , along with those for OsSTPK 12 1 , OsPOlen.i and OsWAK 12 1 were identified in the TRIM collection.
  • LRN was enhanced in all mutants (FIG. 11) but panicle branching and spikelet number was not affected (Table 4).
  • AT-OsSTPK ]2 ⁇ exhibited significantly higher number of filled grains than the WT (Table 4).
  • Table 4 Panicle branching, spikelet number, and fertility of AT/KO mutants.
  • OsNAMjzi was considered a prime candidate gene herein because i) NAM/NAC TFs affect root architecture and drought tolerance; ii) phylogenetically it belonged to the ONACl clade, none of the eight members of which have been studied; iii) its promoter indel contained auxin and ethylene response elements important in drought response and root growth (FIG. 10D); and iv) its CDS SNPs changed a lysine (K7N) and a serine (S109N) which predicted altered SUMOylation and phosphorylation and a weaker fitting structural RMSD for Vandana than WayRarem to the rice stress-inducible NAC1 (FIGS. lOB-lOC).
  • OsNAM 12 1 was justified when I-OsNAM 12 .i° x plants largely recapitulated the morpho-physiology of 481-B (FIG. 11). Additionally, V-OsNAM 12 .i° x plants also exhibited the expected changes in LRN (FIGS. 22A - 22B) and in panicle branching.
  • OsNAM 12 .i Multiple glycosylation, phosphorylation, and SUMOylation sites were present in OsNAM 12 .i (FIG. 21).
  • Recombinant OsNAMn.i was SUMOylated with SUM02 in vitro but not with SUMOl or SUM03 (FIG. 13D).
  • Protein SUMOylation under stress by SUMOl/2 but not SUM03 was earlier noted in Arabidopsis indicating heterogeneity and plant-, trait- or protein-specificity for the protein: SUMO interaction.
  • the two-dimensional immunodetection results with anti-OsNAMn . i and anti-SUMO antibodies showed identical spots and supported in vivo SUMOylation of OsNAMn . i (FIG 13F).
  • the functional OsNAM 12 1 being restricted to susceptible genotypes indicated epistasis, which was identified with the Vandana qDTY 2 3 , or a functional part thereof.
  • the qDTY 23 locus contained an ubiquitin protease, which acts as a deSUMOylating protein.
  • the functional model for qDTY 12 1 is that the Vandana OsNAM 12 1 does not work due to the SNPs that cause K7N and S109N alterations and the P223 insertion (this latter P insertion was not noticed in any of the 125 re-sequenced genomes), while the WayRarem OsNAM 12 1 does not work, due to altered ubiquitin protease or any other gene at qDTY 23 that facilitates deSUMOylation.
  • V- OsNAMi 2 .i ox and WR50-6-B4 plants exhibited drought-mediated deSUMOylation of OsNAM 12 .i and LRN increased similar to that in 481-B and I-OsNAMi 2 .i° x plants (FIGS. 11A - 10B, 16B, 22B - 22C), showing a direct relationship between OsNAM 12 j deSUMOylation and LRN increase.
  • the present invention provides molecular markers, (i.e. including marker loci and nucleic acids corresponding to (or derived from) these marker loci, such as probes and amplification products) useful for genotyping plants, correlated with the qDTY ]2 ] QTL in rice.
  • molecular markers are useful for selecting plants that carry the drought tolerance QTL or that do not carry the drought tolerance QTL. Accordingly, these markers are useful for marker assisted selection (MAS) and breeding of drought tolerant lines and identification of non-tolerant lines.
  • Markers which may be used include: RM28048 (forward primer: SEQ ID NO: 22; reverse primer: SEQ ID NO: 23); RM28076 (forward primer: SEQ ID NO: 24; reverse primer: SEQ ID NO: 25); RM28089 (forward primer: SEQ ID NO: 26; reverse primer: SEQ ID NO: 27); RM28099 (forward primer: SEQ ID NO: 28; reverse primer: SEQ ID NO: 29);
  • RM28130 forward primer: SEQ ID NO: 30; reverse primer: SEQ ID NO: 31
  • RM511 forward primer: SEQ ID NO: 32; reverse primer: SEQ ID NO: 33
  • RM1261 forward primer: SEQ ID NO: 34; reverse primer: SEQ ID NO: 35
  • RM28166 forward primer: SEQ ID NO: 36; reverse primer: SEQ ID NO: 37
  • RM28199 forward primer: SEQ ID NO: 38; reverse primer: SEQ ID NO: 39
  • Indel-8 forward primer: SEQ ID NO: 60; reverse primer: SEQ ID NO: 61
  • LOC_Os02g45750 LOC_Os02g45770, LOC_Os02g45810, LOC_Os02g46100, LOC_Os02g46140, LOC_Os02g46260, LOC_Os02g46320, LOC_Os02g46340, LOC_Os02g46350, LOC_Os02g46360, LOC_Os02g46600, LOC_Os02g46650, LOC_Os02g46690, LOC_Os02g46700, LOC_Os02g46720, LOC_Os02g46770, LOC_Os02g46780, LOC_Os02g46910, and LOC_Os02g46940.
  • qDTYn.i is bred into a variety of rice having a functional qDTY 23 .
  • both qDTYn.i and qDTY 23 , or functional parts thereof are bred into a recipient variety.
  • one or more of the candidate genes at the epistatic QTL 2 .3 are expressed in a rice plant along with QTL i2 1 , or one or more of the candidate genes at QTL i2 1 identified above.
  • Example 2 Complexity of drought tolerance - proteomic and targeted metabolite analysis of field proven near isogenic lines of a QTL for rice yield under stress.
  • Soil water potential in the DS treatment was monitored by tensiometers (Soilmoisture Equipment Corp., CA, USA; one per replicate) installed at a depth of 30 cm. From the date that WayRarem plots were sown until harvest, the ambient temperature averaged 23.4-30.8°C (min-max), relative humidity averaged 85.8%, the crop received 1750 MJ m-2 solar radiation, and pan evaporation totaled 552 mm.
  • Protein samples were extracted from the plant material using the Tris method. Flag leaf, root and spikelets (lOOmg) from the three genotypes were pulverized with liquid nitrogen into fine powder to which 0.7 ml of Tris-Cl buffer (pH 8.0) was added. Seven (7) ⁇ of protease inhibitor cocktail (Sigma- Aldrich) was added to prevent endogenous protease digestions. Samples were then allowed to incubate on ice while shaking for 2 hours. After incubation, they were spun at 17900xg (13000 rpm) for 15 minutes and the supernatant was collected. Quantification for all the samples was done using the Bradford method.
  • Protein bands were excised and collected from the three independent replicate gels manually, and cut into small pieces.
  • the gel pieces were washed twice with 50 of 50% acetonitrile (ACN)/50% 200 mM ammonium bicarbonate (ABC) for 5 min and shrunk with 100% ACN until the gels turned white; the gels were then dried for 5 min in a concentrator (miVac, Genevac, UK).
  • the gel pieces were rehydrated at room temperature in 15 of 50 mM ABC (37 °C, 4 min).
  • An equivalent volume (15 ⁇ ) of trypsin (Promega, USA) solution (20 ng ⁇ L in 50 mM ABC) was then added, and the gel pieces were incubated at 37 °C for at least 16 h.
  • Each digested peptide mixture (5 ⁇ ) for nano-LC/MS/MS analyses were introduced into the mass spectrometer via high-performance liquid chromatography using a 1200 series binary HPLC pump (Agilent, CA, USA) and a FAMOSTM well-plate microautosampler (LC Packings).
  • sample was loaded into a 2 cm x 75 ⁇ i.d. trap column packed in-house with CI 8 resin (Magic C18AQ, 5 mm, 200 A; Michrom, Bioresources, CA, USA).
  • the trap column was connected to an analytical column (11 cm x 75 mm i.d.) and the columns were rigidly packed in-house with CI 8 resin (Magic C18AQ, 5 ⁇ , 100 A).
  • Mobile phase A consisted of 0.1% formic acid
  • mobile phase B consisted of 0.1% formic acid in 100% ACN.
  • the flow rate was -250 nL/min under an in-house split flow system.
  • Each reversed-phase step began with 5% ACN for 10 min, a gradient of 5%-40% ACN for 75 min, 40%- 85% ACN for 5 min, 85% ACN for 10 min, and then re -equilibrated with 5% ACN for 20 min.
  • Mass spectrometric analyses were performed on a LTQ XL linear ion trap mass spectrometer (ThermoFisher Scientific, San Jose, CA, USA). A full-mass scan was performed between m/z 350 and 2000, followed by MS/MS scans of the five highest-intensity precursor ions at 35% relative collision energy. Dynamic exclusion was enabled with a repeat count of 1, exclusion duration of 3 min, and a repeat duration of 30s.
  • Starch was estimated by measuring the NADH absorption at 340 nm which was generated during the conversion of glucose 6 phosphate to 6-phosphogluconate by the enzyme, glucose 6 phosphate dehydrogenase (Ernst and Arditti, 1972).
  • the pellet obtained (from 15-20 mg of seed or leaf) after ethanolic extraction was used for starch estimation by HC1 (Hydrochloric acid).
  • the pellet was dissolved in 2N HC1 (1.5 mL) and incubated at 95°C for 1 h. The resulting mixture was directly used for glucose estimation after centrifugation at 13,000g for 5 min.
  • Derivatization was carried out according to the instructions provided in the manual, AccQ-Tag method (Meyer et al., 2008). Briefly, AQC reagent powder was dissolved in 1 mL of acetonitrile which was approximately 3.0 mg/mL, vortexed thoroughly and incubated at 50°C for 10 min. A mixture of standard amino acids except asparagine and glutamine was available from Sigma (0.5 mM in 0.01 M HC1). A working solution of 50 pmol ⁇ L of each amino acid was made using 0.01 M HC1 after adding asparagine and glutamine separately.
  • the fluorescent dye reagent was added to a small eppendorf (0.5mL) containing 10 ⁇ ⁇ of sample and 80 ⁇ ⁇ of borate buffer (0.2M, pH 8.8). The contents were thoroughly mixed immediately and incubated at 50°C for 10 min. and analyzed by HPLC. Similarly, standard was prepared by derivatizing with different volumes of the working standard solution. Unused reagent could be stored at - 20°C for several weeks. Before the chromatographic analysis, the system was equilibrated with 100% eluent A (140 mM sodium acetate and 7 mM triethanolamine) and the column temperature was set to 37°C. Fluorescence detector was set at 248 nm wavelength for excitation and 395 nm for absorbance.
  • eluent A 140 mM sodium acetate and 7 mM triethanolamine
  • Chromatography was carried out using a Dionex HPLC system (Summit) consisting of a gradient pump (P680), a degasser module, an autosampler (ASI-100) and a fluorescent detector (RF 2000). Data acquisition and processing was accomplished with Dionex Chromeleon 6.70 software. The gradient was accomplished with eluent A, B and C representing buffer, acetonitrile and water, respectively. Analytes were separated on a reversed-phase analytical column (AccQ Tag) coupled to a guard column (Nova-Pak C18). The column temperature was maintained at 37°C throughout the measurement and the flow rate to 1 mL/min.
  • AccQ Tag reversed-phase analytical column
  • guard column Nova-Pak C18
  • the gradient curve was always maintained at 6. Free proline content was also assayed using the ninhydrin assay (Bates et al., 1973)
  • C02, H20 und NOx Various gases formed (C02, H20 und NOx) then passes through a silica tube packed with copper granules held at about 500°C (reduction tube) where the remaining oxygen is bound and nitric/nitrous oxides are reduced to N2.
  • the leaving gas stream includes analytically important C02, H20, N2 and S02. All gases are removed at appropriate traps leaving the analytically important C02 and N2 which are subsequently detected with a thermal conductivity detector.
  • High purity helium Quality 5.0
  • Blank values are obtained from empty aluminum capsules and calibration is done by elemental analysis of standard substances supplied by the manufacturer. [000294] Quantitative PCR.
  • ADF reduction in the 481-B facilitates lateral root growth.
  • Glyceraldehyde-3 -phosphate dehydrogenase, enolase and glucose-6- phosphate isomerase belonging to the glycolytic pathway were more abundant in the roots of the 481-B (FIG. 24) indicating a favorable energy supply situation in the roots of the 481-B during stress.
  • a cellulose synthase (OsCesA 12 1 ⁇ LOC_Osl2g29300) is one of the candidate genes in qDTY 12 .i and it is comparatively more upregulated under drought in the 481-B roots, while an activation tag T20 DNA insertion mutant overexpressing OsCesA 12 1 exhibited increased lateral roots under water deficit (Example 1). Therefore, the sugars in the roots of the 481- B are utilized to provide the energetic and structural component to drive lateral root growth, while their conversion into higher amounts of starch in Vandana may not be helpful. Starch accumulation in roots under drought stress occurred in a variety of plants and was correlated with impaired growth (Galvez et al., 2011), as in Vandana.
  • Serine produced is involved directly or indirectly in generation of osmolytes like betaine, thus increasing 481-B capacity to counter stress. Serine also acts as a precursor of other limited essential amino acids in crop plants, such as methionine and cysteine.
  • Table 5 The complete set of proteins identified in flag leaf of Vandana and the 48 IB NIL (in triplicates), represented as fold increase in the NIL compared to Vandana during drought stress.
  • oxygen-evolving enhancer protein 1 oxygen-evolving enhancer protein 1
  • ferredoxin domain containing protein expressed
  • triosephosphate isomerase cytosolic
  • triosephosphate isomerase chloroplast
  • fructose-bisphospate aldolase isozyme putative, expressed fructose-bisphospate aldolase isozyme
  • fructose-bisphospate aldolase isozyme putative, expressed fructose-bisphospate aldolase isozyme
  • fructose-bisphospate aldolase isozyme
  • fructose-bisphospate aldolase isozyme
  • PS.calvin cycle seduheptulose fructose-l,6-bisphosphatase, putative,
  • PS.calvin cycle.RPE LOC_ _Os03j 507300 -1.8252 Upregulated chloroplast precursor, putative, expressed
  • Oxidative dehydrogenase containing protein expressed Pentose OPP.non-reductive
  • TCA Cycle transformation TCA.pyruvate LOC_ _Os01j 522520 -0.1910 Upregulated mitochondrial precursor, putative,
  • DH.E3 expressed TCA / org. succinyl-CoA ligase subunit alpha-2, transformation.TCA. succinyl- LOC_ _Os07j »38970 1.7102 Downregulated mitochondrial precursor, putative,
  • LOC_ _Os04j 554810 1.1963 Downregulated beta-D-xylosidase, putative, expressed xylose-arabinose-fucose
  • Metabolism (steroids, squalene etc) domain containing protein, expressed amino acid
  • aminotransferase, classes I and II amino acid LOC_ _Os02j 555420 -0.4215 Upregulated
  • aminotransferase, classes I and II amino acid LOC_ _Os07j 5 ⁇ 6 ⁇ -0.1129 Upregulated
  • LOC_ _Os03j 545320 -0.1042 Upregulated dehydrogenase, putative, expressed chain group. leucine specific.3- isopropylmalate dehydrogenase
  • S econdary pyrophosphate dimethyllallyl hydrolase, NUDBi family, domain
  • lipoxygenase LOC_Os02gl0120 -0.2903 Upregulated lipoxygenase, putative, expressed stress.
  • biotic LOC_ _Osl0j »34930 -1.0021 Upregulated secretory protein, putative, expressed stress.
  • abiotic.heat LOC_ _Os09j »30412 0.2942 Downregulated heat shock protein, putative, expressed
  • DnaK family protein putative, stress. abiotic.heat LOC_ _Os02j »02410 -0.1783 Upregulated expressed
  • DnaK family protein putative, stress. abiotic.heat LOC_ _Os03j j60620 -0.0838 Upregulated expressed
  • DnaK family protein putative, stress. abiotic.heat LOC_ _Os02j 553420 0.0308 Downregulated expressed
  • glutathione S-transferase putative, misc. glutathione S transferases LOC_ _Os01j 555830 0.2875 Downregulated expressed
  • glutathione S-transferase putative, misc. glutathione S transferases LOC_ _Os03j 504240 1.9698 Downregulated expressed
  • glutathione S-transferase putative, misc. glutathione S transferases LOC_ _Os03j 5 ⁇ 422 ⁇ 1.0953 Downregulated expressed
  • nucleoside nucleoside diphosphate kinase nucleoside diphosphate kinase, diphosphate kinase LOC_ _Os05j 551700 -0.3549 Upregulated putative, expressed nucleotide
  • nucleoside nucleoside diphosphate kinase nucleoside nucleoside diphosphate kinase, diphosphate kinase LOC_ _Osl0g41410 0.4579 Downregulated putative, expressed nucleotide
  • nucleoside nucleoside diphosphate kinase nucleoside nucleoside diphosphate kinase, diphosphate kinase LOC_ _Os07j 530970 1.1458 Downregulated putative, expressed nucleotide
  • RNA.processing.ribonucleases LOC_ _Os07j J33240 0.0570 Downregulated endoribonuclease, putative, expressed
  • RNA binding LOC_ _Os09j jl0760 0.5613 Downregulated protein, putative, expressed
  • N-metabolism ammonia synthase, chloroplast precursor, metabolism. glutamate synthase LOC_Os07g46460 -0.9547 Upregulated putative, expressed
  • N-metabolism ammonia glutamine synthetase, catalytic domain metabolism.
  • glutamine synthase LOC_Os02g50240 0.5269 Downregulated containing protein, expressed
  • N-metabolism ammonia glutamine synthetase, catalytic domain metabolism.
  • glutamine synthase LOC_Os04g56400 -0.2369 Upregulated containing protein, expressed protein, synthesis.ribosomal
  • chloroplast chloroplast 50S ribosomal protein L14, Synthesis and 50S subunit.L14 LOC_Os04gl6828 -0.8244 Upregulated putative, expressed
  • chloroplast chloroplast 50S ribosomal protein L14,
  • chloroplast chloroplast 50S ribosomal protein L14,
  • chloroplast chloroplast 50S ribosomal protein L14,
  • degradation LOC_Os02g58340 0.1390 Downregulated oligopeptidase, putative, expressed protein.
  • degradation LOC_Os08g44860 -0.3903 Upregulated aminopeptidase, putative, expressed leucine aminopeptidase, chloroplast protein.
  • Aldehydes are intermediates in several fundamental metabolism pathways such as those involved with amino acid and carbohydrates. They are produced in response to environmental stress. Aldehyde dehydrogenases catalyze the irreversible oxidation of reactive aldehydes to their corresponding carboxylic acids and also act as efficient scavengers of reactive oxygen species (Perozich et al., 1999; Kirch et al., 2005).
  • MMSDH specifically catalyzes the irreversible oxidative decarboxylation of malonate-semialdehydes and methylmalonate semialdehydes to acetyl-CoA which leads to more energy generation through TCA cycle (Oguchi et al., 2004). They play an important role in detoxifying the aldehydes as well as for energy generation in the roots of the NILs and thus help in maintaining better homeostasis required for better plant sustenance.
  • N nitrogen
  • N supply was better in the plants with N supply than in those without (Suralta, 2010).
  • Increased lateral roots in the 481-B make for increased capacity to extract nutrients from the soil.
  • N content under drought was more in the roots of the 481-B (FIG. 29E).
  • Use of N by plants involves the processes of N uptake, assimilation, translocation and remobilization, wherein amino acids play a crucial role. Free amino acid content in the roots of the 481-B was more compared to the parents (FIGS. 29G- 29J), showing that plants with more lateral roots were be the ones with better N status under drought. Proteome analysis also showed this.
  • Aminotransferases which are involved in N utilization through several amino acids (Robredo et al., 2011 ; Forde and Lea, 2007), were more abundant in the 481-B roots than in Vandana roots (FIG. 23). Glutamate synthetase was also more in the 481-B roots (FIG. 23) indicating increased glutamate amounts, which was observed to be in larger amounts in the 481-B than in Vandana 1 (FIGS. 29G-29J). Glutamate is one of the transportable amino acids, as well as a precursor for the synthesis of other amino acids such as arginine and proline (Ramanjulu et al., 1997).
  • sucrose has a role in stabilizing the membranes and proteins under water deficit (Gupta & Kaur, 2005).
  • a slight increase in the sucrose content was observed under stress compared to the control condition (FIG. 30C).
  • sucrose synthase was seen to be down-regulated in the 481-B compared to Vandana (FIG. 25). Down-regulation of sucrose synthase was an indication of feedback inhibition due to higher content of sucrose in the flag leaf.
  • sucrose in the flag leaf of the 481- B perhaps indicated a better mechanism to be operative in the 481-B to maintain sufficient amounts of sucrose during stress as compared to the control conditions which can then be made available for remobilization to the spikelets during grain filling for starch synthesis.
  • the 481-B flag leaf exhibited limited change in sucrose content, which was also true for its starch content, while starch content in Vandana flag leaf and spikelets changed significantly under stress (FIGS. 30C, 31C-31D).
  • the reason for decreased photosynthesis is related to the sugars.
  • glucose and fructose increased under stress in the flag leaves of Vandana and 481-B but the combined amount of the three sugars (sucrose, glucose and fructose) was more in the flag leaf of the 481-B than in Vandana (FIGS. 30A-30C).
  • Higher sugar content and decreased starch synthesis lead to feedback inhibition of photosynthesis (Paul and Foyer, 2001).
  • RuBP Roslulose-1, 5-bisphosphate
  • triose phosphate isomerase fructose bis-phospate aldolase
  • fructose- 1,6-bisphosphatase and transketolase were more abundant in the 481-B (FIG. 28).
  • Regeneration of RuBP produces C0 2 and NADPH.
  • C0 2 is also limited by partial stomatal closure, while NADPH can feed into various biosynthetic reactions and help in redox buffering in the cell (Verslues and Sharma, 2000).
  • photorespiratory pathway particularly glycolate oxidase, glycine dehydrogenase and serine
  • ROS reactive oxygen species
  • Table 6 The complete set of proteins identified in the spikelets of Vandana and the 48 IB NIL (in triplicates), represented as fold increase in the 48 IB NIL compared to Vandana during drought stress.
  • ferredoxin NADP reductase
  • PS .photorespiration.aminotransf erases aminotransferase, putative
  • trio sephosph ate isomerase
  • PS.calvin cycle seduheptulose fructose-l,6-bisphosphatase
  • Thylakoid thylakoid lumenal protein not assigned.unknown LOC_Os01g05080 0.1848 Downregulated
  • Metabolism ma j or CHO 1 ,4-alpha-glucan -branching metaboli sm. synthesis . starch, starch LOC_Os06g51084 -0.9212 Upregulated enzyme, chloroplast precursor, branching putative, expressed major CHO
  • enolase LOC_Os06g04510 1.2905 Downregulated enolase, putative, expressed glycolysis.cytosolic branch.
  • enolase LOC_Osl0g08550 0.2115 Downregulated enolase, putative, expressed glycolysis.plastid branch. glucoses- glucose-6-phosphate isomerase,
  • aldehyde dehydrogenase fermentation. aldehyde dehydrogenase LOC_Os08g32870 0.9221 Downregulated
  • aldehyde dehydrogenase fermentation. aldehyde dehydrogenase LOC_Os06g 15990 0.0983 Downregulated
  • LTPL10 - Protease lipid metabolism lipid transfer proteins inhibitor/seed storage/LTP

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Botany (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Environmental Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Physiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

La présente invention concerne des procédés et des matériaux utilisables afin d'améliorer le développement des racines latérales, l'absorption d'eau et le rendement en grains de graminées cultivées dans des conditions de stress dû à la sécheresse. La présente invention concerne, en particulier, un locus de caractère quantitatif associé à un rendement amélioré chez des plantes soumises à un stress dû à la sécheresse. L'invention concerne, en outre, de l'ADN recombiné utilisable en vue de la génération de plantes transgéniques, des cellules végétales transgéniques et leurs procédés de production. La présente invention concerne, encore, des procédés de génération de semences transgéniques pouvant être utilisées pour produire une plante transgénique présentant un rendement amélioré alors qu'elle est soumise à un stress dû à la sécheresse, ainsi que des procédés d'amélioration du rendement chez une graminée soumise à un stress dû à la sécheresse, lesdits procédés impliquant une sélection assistée par marqueur et un croisement en retour.
PCT/US2014/059676 2013-10-08 2014-10-08 Graminées résistantes à la sécheresse et matériaux et procédés associés WO2015054375A2 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU2014331939A AU2014331939A1 (en) 2013-10-08 2014-10-08 Drought-resistant cereal grasses and related materials and methods
US15/027,896 US20160251675A1 (en) 2013-10-08 2014-10-08 Drought-Resistant Cereal Grasses and Related Materials and Methods

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201361888397P 2013-10-08 2013-10-08
US61/888,397 2013-10-08
US201461994558P 2014-05-16 2014-05-16
US61/994,558 2014-05-16

Publications (2)

Publication Number Publication Date
WO2015054375A2 true WO2015054375A2 (fr) 2015-04-16
WO2015054375A3 WO2015054375A3 (fr) 2015-06-04

Family

ID=52813737

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/059676 WO2015054375A2 (fr) 2013-10-08 2014-10-08 Graminées résistantes à la sécheresse et matériaux et procédés associés

Country Status (3)

Country Link
US (1) US20160251675A1 (fr)
AU (1) AU2014331939A1 (fr)
WO (1) WO2015054375A2 (fr)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106636149A (zh) * 2017-01-03 2017-05-10 内蒙古农业大学 斯氏副柔线虫丝氨酸/苏氨酸蛋白激酶Pj_STPK基因克隆、原核表达方法及应用
CN106893728A (zh) * 2015-12-18 2017-06-27 中国种子集团有限公司 重组核酸片段RecCR033208及其检测方法
CN108048599A (zh) * 2018-02-13 2018-05-18 中国农业科学院油料作物研究所 一种与油菜侧根数主效QTL位点RtA07-2紧密连锁的分子标记及应用
US10337001B2 (en) 2014-12-03 2019-07-02 Agilent Technologies, Inc. Guide RNA with chemical modifications
CN110846323A (zh) * 2019-11-07 2020-02-28 中国农业科学院作物科学研究所 小麦TaARF12基因及其应用
US10767175B2 (en) 2016-06-08 2020-09-08 Agilent Technologies, Inc. High specificity genome editing using chemically modified guide RNAs
CN112390866A (zh) * 2019-08-14 2021-02-23 北京大学 OsARF12基因在提高水稻对水稻矮缩病毒抗性中的应用
CN112410314A (zh) * 2020-11-02 2021-02-26 武汉大学 乙酰转移酶OsG2基因及其编码的蛋白质的应用
CN113265407A (zh) * 2021-05-26 2021-08-17 广西壮族自治区农业科学院 水稻花青素生物合成调控基因OsTTG1及其应用
US11306309B2 (en) 2015-04-06 2022-04-19 The Board Of Trustees Of The Leland Stanford Junior University Chemically modified guide RNAs for CRISPR/CAS-mediated gene regulation
CN115851788A (zh) * 2022-11-02 2023-03-28 东北农业大学 GmOTSa基因在植物抗逆境中的应用
US11884915B2 (en) 2021-09-10 2024-01-30 Agilent Technologies, Inc. Guide RNAs with chemical modification for prime editing

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112018074494A2 (pt) * 2016-06-01 2019-03-19 Kws Saat Se & Co Kgaa sequências de ácidos nucleicos híbridas para engenharia genômica
CN108864267B (zh) * 2018-08-01 2020-09-04 中国农业大学 甘薯类胡萝卜素合成和耐盐抗旱相关蛋白IbARF5及其编码基因与应用
EP3987040A4 (fr) * 2019-06-21 2023-07-26 International Rice Research Institute Procédés d'amélioration de rendement en grains, et plantes et produits générés par ces derniers
CN114478731A (zh) * 2022-03-17 2022-05-13 安徽农业大学 抗除草剂水稻突变型蛋白及应用
CN114807215A (zh) * 2022-04-18 2022-07-29 云南中烟工业有限责任公司 一种烟草甲硫氨酸亚砜还原酶基因NtE4在烟草抗逆中的应用
CN118374538B (zh) * 2024-04-26 2024-10-15 湖北省农业科学院粮食作物研究所 敲除OsLTPL163基因在正向调控水稻抗褐飞虱中的应用

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080229439A1 (en) * 1999-05-06 2008-09-18 La Rosa Thomas J Nucleic acid molecules and other molecules associated with transcription in plants and uses thereof for plant improvement
EP1742527B1 (fr) * 2004-04-20 2013-02-20 Syngenta Participations AG Sequences regulatrices pour exprimer des produits geniques dans le tissu reproducteur de plantes
US20110093985A1 (en) * 2009-09-29 2011-04-21 Riken Transcription factor for promoting lateral root growth under nitrogen-limiting conditions

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10337001B2 (en) 2014-12-03 2019-07-02 Agilent Technologies, Inc. Guide RNA with chemical modifications
US10900034B2 (en) 2014-12-03 2021-01-26 Agilent Technologies, Inc. Guide RNA with chemical modifications
US11306309B2 (en) 2015-04-06 2022-04-19 The Board Of Trustees Of The Leland Stanford Junior University Chemically modified guide RNAs for CRISPR/CAS-mediated gene regulation
US11851652B2 (en) 2015-04-06 2023-12-26 The Board Of Trustees Of The Leland Stanford Junior Compositions comprising chemically modified guide RNAs for CRISPR/Cas-mediated editing of HBB
US11535846B2 (en) 2015-04-06 2022-12-27 The Board Of Trustees Of The Leland Stanford Junior University Chemically modified guide RNAS for CRISPR/Cas-mediated gene regulation
CN106893728A (zh) * 2015-12-18 2017-06-27 中国种子集团有限公司 重组核酸片段RecCR033208及其检测方法
CN106893728B (zh) * 2015-12-18 2020-12-18 中国种子集团有限公司 重组核酸片段RecCR033208及其检测方法
US10767175B2 (en) 2016-06-08 2020-09-08 Agilent Technologies, Inc. High specificity genome editing using chemically modified guide RNAs
CN106636149A (zh) * 2017-01-03 2017-05-10 内蒙古农业大学 斯氏副柔线虫丝氨酸/苏氨酸蛋白激酶Pj_STPK基因克隆、原核表达方法及应用
CN108048599A (zh) * 2018-02-13 2018-05-18 中国农业科学院油料作物研究所 一种与油菜侧根数主效QTL位点RtA07-2紧密连锁的分子标记及应用
CN108048599B (zh) * 2018-02-13 2021-05-28 中国农业科学院油料作物研究所 一种与油菜侧根数主效QTL位点RtA07-2紧密连锁的分子标记及应用
CN112390866A (zh) * 2019-08-14 2021-02-23 北京大学 OsARF12基因在提高水稻对水稻矮缩病毒抗性中的应用
CN110846323A (zh) * 2019-11-07 2020-02-28 中国农业科学院作物科学研究所 小麦TaARF12基因及其应用
CN112410314B (zh) * 2020-11-02 2022-07-15 武汉大学 乙酰转移酶OsG2基因及其编码的蛋白质的应用
CN112410314A (zh) * 2020-11-02 2021-02-26 武汉大学 乙酰转移酶OsG2基因及其编码的蛋白质的应用
CN113265407A (zh) * 2021-05-26 2021-08-17 广西壮族自治区农业科学院 水稻花青素生物合成调控基因OsTTG1及其应用
US11884915B2 (en) 2021-09-10 2024-01-30 Agilent Technologies, Inc. Guide RNAs with chemical modification for prime editing
CN115851788A (zh) * 2022-11-02 2023-03-28 东北农业大学 GmOTSa基因在植物抗逆境中的应用

Also Published As

Publication number Publication date
AU2014331939A1 (en) 2016-04-28
US20160251675A1 (en) 2016-09-01
WO2015054375A3 (fr) 2015-06-04

Similar Documents

Publication Publication Date Title
US20160251675A1 (en) Drought-Resistant Cereal Grasses and Related Materials and Methods
Li et al. Chilling tolerance in rice: Past and present
Lafitte et al. Abiotic stress tolerance in rice for Asia: progress and the future
Yang et al. Transcriptome profiling of Populus tomentosa under cold stress
Ren et al. Target of rapamycin signaling regulates metabolism, growth, and life span in Arabidopsis
US8637735B2 (en) Method for improving stress resistance in plants and materials therefor
Rahman et al. Molecular mapping of quantitative trait loci for drought tolerance in maize plants
Baloch et al. Recent advancements in the breeding of sorghum crop: current status and future strategies for marker-assisted breeding
US20210207157A1 (en) Methods of increasing crop yield under abiotic stress
US20120317676A1 (en) Method of producing plants having enhanced transpiration efficiency and plants produced therefrom
Najeeb et al. Genetics and breeding of low-temperature stress tolerance in rice
Tuberosa et al. QTLs and genes for tolerance to abiotic stress in cereals
Madhusudhana Marker-assisted breeding in sorghum
Biswal et al. Role of biotechnology in rice production
Glover-Cutter et al. Enhanced oxidative stress resistance through activation of a zinc deficiency transcription factor in Brachypodium distachyon
Andleeb et al. QTL mapping for drought stress tolerance in plants
Lafitte et al. Abiotic stress tolerance in tropical rice: progress and future prospects
Anilkumar et al. Genome-wide association mapping and genomic selection approaches for stress resilience in rice
Khan et al. The intervention of multi-omics approaches for developing abiotic stress resistance in cotton crop under climate change
Zhao et al. Natural variation of CsSTOP1 in tea plant (Camellia sinensis) related to aluminum tolerance
Ahmed et al. Exploration and utilization of drought-tolerant barley germplasm
Joshi et al. Salt stress in pulses: A learning from global research on salinity in crop plants
Syed et al. Breeding and omics approaches to understand abiotic stress response in rice
Singh et al. in Maize
Syed et al. Rice breeding and genomics approaches for improving water and nitrogen use efficiency

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14852178

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 15027896

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2014331939

Country of ref document: AU

Date of ref document: 20141008

Kind code of ref document: A

122 Ep: pct application non-entry in european phase

Ref document number: 14852178

Country of ref document: EP

Kind code of ref document: A2