WO2015052630A1 - Antisense oligonucleotides for prevention of atherosclerosis and cardiovascular infections - Google Patents
Antisense oligonucleotides for prevention of atherosclerosis and cardiovascular infections Download PDFInfo
- Publication number
- WO2015052630A1 WO2015052630A1 PCT/IB2014/065084 IB2014065084W WO2015052630A1 WO 2015052630 A1 WO2015052630 A1 WO 2015052630A1 IB 2014065084 W IB2014065084 W IB 2014065084W WO 2015052630 A1 WO2015052630 A1 WO 2015052630A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- asos
- seq
- mutans
- sobrinus
- blood
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3513—Protein; Peptide
Definitions
- the present invention is specifically related with the prevention and treatment of atherosclerosis and cardiovascular infections caused by the bacterial biofilm using antisense oligonucleotides and their biopharmaceutical compositions.
- Cardiovascular diseases continue to be one of the major reasons of mortality worldwide (Mendis et al in Global Atlas on cardiovascular disease prevention and control (World Health).
- the infectious factor is very significant in the atherogenesis, especially taking into consideration the microorganisms which compose the normal human microbiota (Koren et al in Human oral, gut and plaque microbiota in patients with atherosclerosis (Proc Nat Acad Sci USA 108 [Suppl 1] (2011), pg 4592-4598)).
- Streptococci comprising normal human microbiota are one of the infectious sources for human cardiovascular infections. Streptococcus mutans and Streptococcus sobrinus species are among them that usually present in human mouth. These streptococci are capable to form biofilm on the surface of oral tissues. Structural matrix of this biofilm consists of the water-insoluble polymer - glucan which is synthesized using glucose molecules from the hydrolyzed sucrose by several isoforms of glucosyltransferase (Gtf) enzyme, i.e. S. mutans GtfB and GtfC as well as S.
- Gtf glucosyltransferase
- sobrinus Gtfl (Bowen and Koo in Biology of Streptococcus mutans-derived glucosyltransferases: role in extracellular matrix formation of cariogenic biofilms (Caries Res 45 (2011), pg 69-86); Koo et al in The exopolysaccharide matrix: a virulence determinant of cariogenic biofilm (J Dent Res 92 (2013), pg 1065-1073)).
- S. mutans GtfB and GtfC are encoded by gtfB and gtfC genes for the synthesis of water-insoluble and partly water-soluble glucans, respectively, whereas S.
- sobrinus Gtfl is encoded by gtfl gene for the production of water-insoluble glucan.
- the glucosyltransferases are localized not only on the bacterial cell wall but they are also secreted into the environment in a free form. Due to activity of these enzymes, S. mutans, S. sobrinus and other oral bacteria can adhere virtually to any type of natural and artificial surfaces - dental enamel, mucous membrane and other human tissues as well as plastic, glass, because the synthesized glucan is a very sticky material by its physical characteristics.
- the Gtf enzymes have become important targets for the development of various pharmaceutically active substances in order to inhibit the adhesion of S. mutans and S. sobrinus.
- sobrinus is also found in atheromatous plaques, however at less frequency. That proves a direct link between these oral streptococci and pathogenesis of atherosclerosis. Moreover, it can be also supported by the results from animal experiments, as reported by Kesavalu et al in Increased atherogenesis during Streptococcus mutans infection in ApoE-null mice (J Dent Res 91 (2012), pg 255-260). The implication of S. mutans and S. sobrinus to the development of atherosclerosis may be related to the enzymatic activity of their secreted glucosyltransferases, that is, the synthesis of glucans. The experimental studies show that S.
- mutans strains with defects in the gtfB and gtfC genes exhibit considerably lower capabilities to cause platelet aggregation in the blood as compared to normal S. mutans strains (Taniguchi et al in Defect of glucosyltransferases reduces platelet aggregation activity of Streptococcus mutans: Analysis of clinical strains isolated from oral cavities (Arch Oral Biol 55 (2010), pg 410-416)).
- inhibiting the production of streptococcal glucosyltransferases is practically important not only for the prophylaxis of dental caries but also for the prevention of cardiovascular diseases.
- Herein described invention provides a method how to inhibit and/or reduce S. mutans and S.
- This method is based on the use of antisense oligonucleotides (ASOs) which inhibit selectively the expression of S. mutans gtfB, gtfC and S. sobrinus gtfl genes, thereby suppressing the synthesis of glucosyltransferases and glucans.
- ASOs antisense oligonucleotides
- the inhibition of glucan production prevents development of bacterial biofilm that in turn can be used for the prevention of atherosclerosis and cardiovascular infections (e.g., bacterial endocarditis) caused by S. mutans and S. sobrinus bacteria as well as for suppression and reduction of the atheromatous plaques' formation.
- the ASOs and method of bacterial biofilm inhibition provided in this invention is used to treat various surfaces that are in contact with human tissues and blood and/or blood serum such as e.g., tubes, catheters, dialysis membranes, probes, prosthetic heart valves, prostheses, implants, etc., in order to achieve the antibiofilm effect against S. mutans and S. sobrinus present on these surfaces.
- the bacteria attach firmly to these surfaces e.g., catheters, implants and prostheses, because of the produced glucan polymers, and form biofilms which limit the abilities of immune system to eliminate the bacteria.
- ASOs and method of this invention solve complexically the problems of prevention as well as treatment of atherosclerosis, cardiovascular and related infections.
- the main patented object of this invention is the substance - isolated antisense oligonucleotides (ASOs) corresponding to these features:
- ASOs comprising of nucleotide (nt) sequences according to SEQ ID NO: 1, 12, 18;
- ASOs comprising of nucleotide sequences, which are the fragments SEQ ID NO: 1, 12, 18; or c) ASOs having at least 85% sequence identity to SEQ ID NO: 1, 12, 18.
- object of this invention is the ASOs which nucleotide sequences differ from the indicated SEQ ID NO: 1 , 12, 18 by one, two, three or four nucleotides, and among them the ASO fragments that nucleotide sequences selected from the group consisting of: SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11 , 19, 20, 21, 22, 23.
- the ASOs any of the indicated above forms can be conjugated with peptide facilitating penetration through the bacterial cell wall.
- object of this invention is the ASOs any of the indicated above forms that are used for prevention, inhibition and reduction of the atheromatous plaques' formation in human cardiovascular tissues and/or blood, which component is serum.
- object of this invention is the biopharmaceutical composition comprised of the ASOs any of the indicated above forms, and other parts for the biopharmaceutical and medical use.
- object of this invention is the biopharmaceutical composition comprised of the ASOs any of the indicated above forms, and other parts, among them adjuvants and/or carriers used in biopharmacy.
- object of this invention is the biopharmaceutical composition comprised of the ASOs any of the indicated above forms, and other parts, in which a cationic polymer is used as the carrier. Also, object of this invention is the biopharmaceutical composition comprised of the ASOs any of the indicated above forms, and other parts, used for the prevention and treatment of atherosclerosis.
- object of this invention is the biopharmaceutical composition comprised of the ASOs any of the indicated above forms, and other parts, used for the prevention and treatment of bacterial endocarditis.
- object of this invention is the biopharmaceutical composition comprised of the ASOs any of the indicated above forms, and other parts, used for the treatment of surfaces that are in contact with human tissues and blood and/or blood serum, e.g., tubes, catheters, dialysis membranes, probes, prosthetic heart valves, prostheses, implants, etc., in order to achieve the antibiofilm effect against S. mutans and S. sobrinus present on these surfaces.
- this invention includes the method for control of S. mutans and S. sobrinus culture growth, that covers the use of ASOs for suppression of the ability of these bacteria to synthesize biofilm matrix composed of exopolysaccharides, administration of ASOs for inhibiting specifically and simultaneously the expression of S. mutans gtfB, gtfC and S. sobrinus gtfl mRNAs, thereby at the same time suppressing the ability of these bacteria to produce water- insoluble and partly water-soluble glucan polymers.
- Fig. 1 shows the fragment of nucleotide sequence SEQ ID NO: 13, i.e. 5'- UCUGUUAAGAUUAAGCAAUGGUCUGCCAAGUACUUUAAUGGGACAAAUAUUUUA GGGCGCGGAGCAGGCUAUGUCUUAAAAGA-3', in the original output of Mfold program on predicting S. mutans gtfB mRNA secondary structure model with the delineated binding site. As seen in this model, the location contains bulge loop which consists of unpaired nucleotides (5'-UAAGCA-3'), pointing out that the selected ASO can be a strong competitor in the formation of heteroduplex.
- Symbols -- - - - - - -" and " ⁇ " mean connection between appropriate nucleotides, and they are used for better representation of bulge and hairpin loops, respectively.
- the region of gtfB mRNA shown in fig. 1 begins from 3049 nt, and the delineated binding site begins from 3056 nt, that is, the same as in gtfB gene of S. mutans (see Example 1).
- Fig. 2 shows a selection of the multiple sequence alignment of the glucosyltransferase genes between various Streptococcus species and strains produced employing the MAFFT online server at the Max Planck Institute for Development Biology.
- the conserved target region consisting of 26 nucleotides:
- Fig. 3 shows a selection of the multiple sequence alignment of the glucosyltransferase genes between various Streptococcus species and strains, which are found in human body, produced employing the MAFFT online server at the Max Planck Institute for Development Biology.
- the conserved target region consisting of 26 nucleotides: 5'-
- CGCGTCATGTTTGAAGGTTTCTCTAA-3 ' with SEQ ID NO: 17) is delineated in the large rectangular.
- Fig. 4 shows optical profile of glass slides with the mixed S. mutans and S. sobrinus culture biofilm after 24 h of incubation under different treatments in Todd Hewitt broth containing 10% serum and 1% sucrose.
- Fig. 4a biofilm without treatment with ASOs; fig.4b - biofilm under treatment with ASOl + TF (TurboFect ); fig.4c - biofilm under treatment with AS02 + TF
- Fig. 5 shows quantities of the mixed S. mutans and S. sobrinus culture biofilm formed on the glass slide surface after 24 h of incubation under different treatments in Todd Hewitt (TH) broth containing 10% serum and 1 % sucrose.
- antisense effect means the oligonucleotide's effect which is produced after its binding to the complementary sequence within mRNA, resulting in specific inhibition of the target gene and protein expression.
- antisense oligonucleotides mean agents that are unmodified or chemically modified single-stranded nucleic acid molecules (usually 15-30 nt in length), which can selectively hybridize to their target complementary sequence within mRNA through Watson- Crick base pairing. Formation of an ASO -mRNA heteroduplexes induces the effects as follows: 1) activates RNase H endonuclease or as in bacteria endoribonucleases - RNase III and RNase E - leading to degradation of the bound mRNA, and leaving the ASO intact; 2) causes translational arrest by steric hindrance of ribosomal activity; 3) inhibits mRNA splicing; 4) destabilizes pre- mRNA. Indeed, what effect will occur depends on the ASO chemical composition and location of hybridization, but the subsequent result is specific down-regulation of the target gene and protein expression.
- nucleotide sequence means anything that binds or hybridizes using base pairing including oligomers or polymers having a backbone formed from naturally occurring nucleotides such as DNA (deoxyribonucleic acid) or RNA (ribonucleic acid), and/or nucleic acid analogs comprising nonstandard
- nucleobases and/or nonstandard backbones e.g., a peptide nucleic acid (PNA) or locked nucleic acid (LNA), or any derivatized or modified form of a nucleic acid, including modifications to increase stability, binding effectiveness and resistance to nucleases.
- PNA peptide nucleic acid
- LNA locked nucleic acid
- the term "peptide nucleic acid” or "PNA” means a synthetic oligomer or polymer having a polyamide backbone with pendant nucleobases (naturally occurring and modified), including, but not limited to, any of the oligomer or polymer segments referred to or claimed as peptide nucleic acids in, e.g., U.S. Pat. nos.
- the pendant nucleobase such as, e.g., a purine or pyrimidine base on PNA may be connected to the backbone via a linker such as, e.g., one of the linkers taught in PCT/US02/30573 or any of the references cited therein.
- the PNA has an N-(2-aminoethyl)-glycine) backbone.
- PNAs may be synthesized (and optionally labeled) as taught in PCT/US02/30573 or any of the references cited therein. PNAs hybridize tightly, and with high sequence specificity, with DNA and RNA, because the PNA backbone is uncharged. Thus, short PNA probes may exhibit comparable specificity to longer DNA or RNA probes. PNA probes may also show greater specificity in binding to complementary DNA or RNA.
- locked nucleic acid or "LNA” means an oligomer or polymer comprising at least one or more LNA subunits.
- LNA subunit means a ribonucleotide containing a methylene bridge that connects the 2'-oxygen of the ribose with the 4'-carbon. See generally, Kurreck in Antisense technologies. Improvement through novel chemical modifications (Eur J Biochem 270 (2003), pg 1628-1644).
- nucleic acids and nucleic acid analogs for the embodiments herein to be used as ASO in isolated forms also include oligomers and polymers of nucleotide monomers, including double and single stranded deoxyribonucleotides (DNA), ribonucleotides (RNA) including naturally occurring antisense RNA molecules such as microRNAs (miRNAs) and small interfering RNAs (siRNAs) found in eukaryotic cells as well as small antisense RNAs found in prokaryotic cells (bacteria), a-anomeric forms thereof, natural and synthetic analogs thereof, and the like.
- DNA double and single stranded deoxyribonucleotides
- RNA ribonucleotides
- antisense RNA molecules such as microRNAs (miRNAs) and small interfering RNAs (siRNAs) found in eukaryotic cells as well as small antisense RNAs found in prokaryotic cells (bacteria),
- the nucleic acid chain may be composed entirely of deoxyribonucleotides, ribonucleotides, peptide nucleic acids (PNA), locked nucleic acids (LNA), natural or synthetic analogs thereof such as phosphorodiamidate morpholino and thiophosphoroamidate
- oligonucleotides or mixtures thereof.
- DNA, RNA, or other natural or synthetic nucleic acids as defined herein can be used in the methods and compositions of the invention.
- carrier or " adjuvant” is herein intended to mean a material that is not biologically or otherwise undesirable, i.e., the material may be incorporated into a pharmaceutical composition administered to a patient without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained.
- adjuvants and carriers in compositions herein are suitable for delivery to tissues of cardiovascular system and blood, which component is serum, without causing any undesirable biological effects or interacting in a deleterious manner.
- Suitable carriers and adjuvants include nuclease-free water, or any reagent which forms compact, stable, positively charged complex with oligonucleotide in order to protect from degradation and facilitate better penetration of oligonucleotide to the bacterial cells, such as TurboFect transfection reagent commercially available (Thermo Fisher Scientific, Fermentas).
- nuclease-free water means sterile deionized water which is absent from any type of nucleases capable to degrade oligonucleotide.
- biofilm means biofilm consisting of the polysaccharide matrix composed mostly of water-insoluble and partly water-soluble glucans as well as bacteria capable to synthesize polysaccharide polymers using glucose molecules from the hydrolyzed sucrose, thereby composing exopolysaccharide matrix.
- bacterial cultures are both in vivo and in vitro cultures, if not specified separately what particular type of culture is intended.
- Said cultures include cultures in suspension and cultures on solid phases, such as glass (example of an in vitro solid phase) or blood vessel wall (example of an in vivo solid phase) or any other solid phase surface in the cardiovascular system, or implant or other surface contacting with human tissues and blood and/or blood serum.
- the present invention discloses a novel technique for decreasing, preventing or inhibiting biofilm formation, such as biofilm formation from oral streptococci, particularly S. mutans and S. sobrinus biofilm formation, all on solid phase surfaces, e.g., glass and blood vessel walls.
- This technique employs administration of the effective dose of antisense oligonucleotides (ASOs) to the bacterial culture in order to target and suppress simultaneously the expression of glucosyltransferase mRNAs in several species of streptococci, particularly in S. mutans and S. sobrinus, such as, e.g., gtfB and gtfC glucosyltransferase mRNAs in S. mutans and gtfl mRNA in
- S. sobrinus leading to inhibition of both water-insoluble and partly water-soluble glucan polymers' production and bacterial cell adherence in S. mutans and S. sobrinus cultures thus leading to a decrease, inhibition or prevention of biofilm formation.
- Said cultures may be in vitro cultures or in vivo cultures, e.g., in the cardiovascular system or on other solid phase surfaces contacting with human tissues and blood and/or blood serum.
- Said the new ASOs may be chemically synthesized phosphorothioate-modified
- oligodeoxyribonucleotides of the sequence corresponding to the nucleotide sequences of SEQ ID NO: 1, 12, 18 for exhibiting antisense effect as in the Examples, or any of the embodiments of an ASO as described herein, i.e. SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 19, 20, 21, 22, 23, or fragments or modifications of the ASOs according to the conditions indicated in specification of this invention.
- the new ASO sequences provided in this invention may be synthesized and modified in different ways.
- Fully phosphorothioate-modified oligodeoxyribonucleotides as shown in Example 2 may be used as ASO in different embodiments.
- oligodeoxyribonucleotides differ from unmodified oligodeoxyribonucleotides in that one of the non-bridging oxygen atoms in the phosphodiester linkage is replaced by a sulfur atom in order to increase resistance to endo- and exonucleases.
- oligodeoxyribonucleotides may be chemically synthesized f.ex. at the Metabion International AG (Germany) using an automated DNA synthesizer and phosphoramidite method under the standard protocols known in the art, e.g., in G. Zon, Oligonucleoside Phosphorothioates, Ed., S.
- Measuring glucans, composing exopolysaccharide matrix may be done as described in Example 2 where profilometry results clearly show that bacterial adherence to glass surfaces is significantly reduced by the ASO, which nucleotide sequence corresponds to SEQ ID NO: 1.
- the decrease in biofilm formation indirectly indicates a reduction of glucan polymers' synthesis since glucans are essential for biofilm formation and no glucans leads to no biofilm formation.
- Another aspect of the novelty of this invention provides means to use only one type of nucleotide sequence (one nucleotide sequence) of the ASOs in an effective amount for inhibiting the synthesis of both water-insoluble and partly water-soluble glucans in S. mutans encoded by gtfB and gtfC genes, and in S. sobrinus encoded by gtfl gene.
- This novel technique allows administration of ASO alone to the bacterial culture at effective concentration in order to cover two targets - gtfB and gtfC mRNAs in S. mutans, and at the same time S. sobrinus gtfl mRNA.
- the shorter sequences (SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 19, 20, 21, 22, 23) have the same arrangement of nucleotides (nt) as in the ASOs with SEQ ID NO: 1, 12, 18, and therefore they may be independently used to the determined target regions within gtfB and gtfC of S. mutans as well as gtfl of S. sobrinus in terms of the genes and mRNAs.
- these shorter fragments can also form heteroduplex with the determined region.
- the ASO with SEQ ID NO: 1 binds to unpaired nucleotides of the bulge loop in the gtfB mRNA of S. mutans as it is delineated in fig 1.
- the ASO of longer sequence can form heteroduplex with the determined region, and it is complementary and cover the bulge loop with unpaired nucleotides in the gtfB mRNA of S. mutans as it is delineated in fig 1.
- the ASOs herein may be delivered to S. mutans and S. sobrinus bacteria more effectively using carriers.
- Said carriers may be transfection reagents or cationic polymers which are known in the art.
- the combination of all the embodiments of ASO with carrier or transfection reagent composed of cationic polymer such as TurboFect (Thermo Fisher Scientific, Fermentas) may be used in order to enhance the ASO uptake by bacteria and to effectively improve the inhibition of biofilm formation in S. mutans and S. sobrinus cultures.
- These substances include, but not limited to, calcium salts (e.g., calcium phosphate, calcium chloride), cationic lipids (e.g., N-(2,3-dioleyloxypropyl) N, N, N- trimethylammonium chloride, dioleoylphosphatidylethanolamine, cholesterol), cationic polymers (e.g., diethylaminoethyl dextran, polyethyleneimine, chitosan, cyclodextrin, polyamidoamine dendrimer, polypropylenimine dendrimer), cell penetrating peptides (peptides usually less than 30 amino acids; e.g., penetratin) and different types of nanoparticles as described by D.
- calcium salts e.g., calcium phosphate, calcium chloride
- cationic lipids e.g., N-(2,3-dioleyloxypropyl) N, N, N- trimethylammonium chlor
- transfection reagents with the exception of calcium phosphate which forms calcium-phosphate - DNA precipitates, function in a similar fashion - they form complexes with oligonucleotides via electrostatic interaction between negatively charged oligonucleotide molecules and positively charged reagent molecules. Since such complexes maintain positive charge, therefore they can bind to the negatively charged eukaryotic cell plasma membrane or bacterial cell wall, and can be taken up by the cells.
- transfection reagents for the delivery of ASOs to bacterial cells are cationic polymers and cell penetrating peptides, which is usable for all the embodiments of the ASO herein as well. It is important to note that cell penetrating peptides are capable to enter into the cells not just through the electrostatic interaction but also by forming transient pores in the cellular plasma membrane. Guo et al in Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibits GtfB expression and function (FEMS Microbial Lett 264 (2006), pg 8-14) describes the efficient delivery of phosphorothioate-modified ASOs to
- the present invention in all its embodiments provides means and method for inhibition of S. mutans and S. sobrinus biofilm formation on solid phase surfaces.
- the indicated ASOs and method enable administration of ASOs with SEQ ID NO: 1, 12, 18 or fragments thereof according to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 19, 20, 21, 22, 23, to the bacterial culture using an effective concentration in order to decrease S. mutans and S. sobrinus adhesion and biofilm formation as clearly demonstrated with the mixed S. mutans and S. sobrinus culture in fig 4 and fig 5.
- the invention allows to use the ASOs of SEQ ID NO: 1, 12, 18, or ASO fragments, or ASO modifications as described herein for antisense effect as well as for prevention and control of atherosclerosis and cardiovascular infections.
- Example 2 and fig 4 an effective concentration of the ASO decreases S. mutans and S. sobrinus adhesion and biofilm formation.
- Example 2 and fig 4, fig 5, it is specifically shown the effect of effective ASO concentration in the medium with blood serum, thereby demonstrating the potential effect of ASO to prevent the formation of atheromatous plaques in blood and/or blood serum as well as blood vessels of cardiovascular system.
- the present invention provides a novel method to control and prevent the development of bacterial biofilms in the tissues of cardiovascular system as well as blood and/or blood serum using ASOs of the SEQ ID NO: 1, 12, 18, or any of the indicated herein fragments or modifications of the ASOs, thereby achieving antisense effect to the glucosyltransferases of S. mutans and S. sobrinus.
- This novel method renders a tool for the inhibition of biofilm formation on solid phase surfaces, including blood vessel walls, implants, also on other artificial surfaces contacting with human tissues and blood and/or blood serum.
- the invented new ASOs of the SEQ ID NO: 1, 12, 18, or any of the indicated herein fragments or modifications of the ASOs can be used as parts of biopharmaceutical compositions (solutions, suspensions, etc.), or can be included in the formulations of biopharmaceutical compositions, providing local as well as systemic effects for living organism - human, or non-living surfaces contacting with tissues as well as blood and/or blood serum of the living organism.
- the disclosed in this invention new ASOs of the SEQ ID NO: 1, 12, 18, or any of the indicated herein fragments or modifications of the ASOs are capable to bind simultaneously with the complementary sequences in S. mutans genome encoding gtffi and gtfC mRNAs as well as in S. sobrinus genome encoding gtfl mRNA, thereby inhibiting glucan production, reducing biofilm formation and in this way preventing the development of atheromatous plaques and
- the disclosed new ASOs of the SEQ ID NO: 1, 12, 18, or any of the indicated herein fragments or modifications of the ASOs prevent the bacterial adhesion and attachment to solid phase surfaces.
- This aspect provides possibility to apply the presented herein ASOs for the treatment of atherosclerosis and cardiovascular infections.
- Purpose of the present invention is to provide method and means for the inhibition of biofilm formation, particularly in the cardiovascular system containing blood and/or blood serum.
- the purpose is achieved using the ASOs described herein that suppress production of glucans in S. mutans and S. sobrinus, targeting simultaneously to the mechanisms of glucan synthesis in both bacterial species with one type molecule of the ASO.
- ASOs are provided in this invention as one or several sequences of molecules given below herein, i.e. ASOs which sequences are the SEQ ID NO: 1, 12, 18, also their fragments and modifications (e.g., which sequences are one of the SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 19, 20, 21, 22, 23), in the amount that is effective and sufficient according to the medium and specific composition.
- this invention provides method and means for inhibiting and reducing bacterial biofilm formation, it also prevents the development of biofilm on solid phase surfaces in vitro and in vivo. If in vivo the solid phase surface is a part of human tissues, for instance, wall of blood vessel, this method comprises of the administration of effective ASO dose to human blood, which component is serum, as described herein, i.e.
- ASOs which sequences are the SEQ ID NO: 1, 12, 18, or any of the indicated herein fragments or modifications of the ASOs (e.g., which sequences are one of the SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 19, 20, 21, 22, 23), as the structural parts of biopharmaceutical composition are used for prevention and treatment of the cardiovascular pathologies associated with atherosclerosis and/or infections caused by S. mutans and S. sobrinus due to formation of the bacterial biofilms.
- the antisense technology offers several advantages in comparison with other antibacterial technologies, and among them the main advantages are as follows: 1) specific and simultaneous suppression of the expressed gtf mRNAs in S. mutans and S. sobrinus bacteria;
- the present invention discloses the method of ASO use and ASOs, which sequences are the SEQ ID NO: 1, 12, 18, or any of the indicated herein fragments or modifications of the ASOs (e.g., which sequences are one of the SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 19, 20, 21, 22, 23), to suppress biofilm formation, and thereby the development of diseases and pathologies caused by the biofilm formation, e.g., atherosclerosis, bacterial endocarditis and inflammatory reactions to implants or prostheses, their rejection reactions, etc.
- diseases and pathologies caused by the biofilm formation e.g., atherosclerosis, bacterial endocarditis and inflammatory reactions to implants or prostheses, their rejection reactions, etc.
- Glucans comprising the exopolysaccharides of S. mutans and S. sobrinus biofilms, are composed of repeating glucose units, and they are synthesized by the enzymatic action of glucosyltransferases.
- Glucans can be water-insoluble, water-soluble and partly water-soluble.
- the water-insoluble and partly water-soluble glucans serve as a polysaccharide matrix for the biofilm with several functions: 1) enhance bacterial adherence and further accumulation on solid phase surfaces; 2) provide structural integrity and bulk to the biofilm; 3) increase adhesive properties of the biofilm matrix.
- the separate purpose and novelty of the present invention is to inhibit simultaneously and parallelly the expression of glucosyltransferase genes and mRNAs in S. mutans and S. sobrinus bacteria.
- SEQ ID NO: 1 5'-GCAGACCATTGCTTAATCT-3'
- SEQ ID NO: 12 5'-TTGGCAGACCATTGCTTAATCTTAAC-3'
- SEQ ID NO: 18 (5'-TTAGAGAAACCTTCAAACATGACGCG-3), which effect is analogous to SEQ ID NO: 1.
- analogous effect as indicated above is achieved using fragments of the ASO sequences and modified sequences (e.g., which sequence is one of the SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 19, 20, 21, 22, 23).
- the ASO can be of specific sequence, as the indicated SEQ ID NO: 1, 12, 18, or parts or fragments of these sequences.
- the parts or fragments thereof are oligonucleotides shortened in length by at least one nucleotide either from 5'-end or 3'-end.
- it can be the ASOs, which sequences are part and fragment of the SEQ ID NO: 1, 12, 18, selected from this list:
- the ASO with SEQ ID NO: 1 is derived from SEQ ID NO: 12, which is 100% complementary to the region of 26 nt in S. mutans gtfB and gtfC genes, and also with one mismatched nucleotide in S. sobrinus gtfl gene (see Example 1).
- the ASO with SEQ ID NO: 1 is the optimized molecule of 19 nucleotides on the basis of thermodynamic peculiarities needed to inhibit S. mutans gtfB, gtfC and S. sobrinus gtfl mRNAs.
- the ASO with SEQ ID NO: 1 is derived from the SEQ ID NO: 12 and it is composed of 19 nt: 5'-TTG-GCAGACCATTGCTTAATCT-TAAC-3' (underlined and indicated in Example 1).
- the ASO with SEQ ID NO: 2 is derived from the SEQ ID NO: 1 and it is used as a negative control in the provided experiments (see Example 2).
- the ASOs with SEQ ID NO: 3-11 are derived from SEQ ID NO: 1.
- the ASO with SEQ ID NO: 12 is isolated synthetic ASO composed of 26 nt:
- 5'-TTGGCAGACCATTGCTTAATCTTAAC-3' which is used to achieve the antisense effect for the natural mRNA sequence with SEQ ID NO: 13 as well as for the natural DNA sequence with SEQ ID NO: 15.
- the ASO with SEQ ID NO: 18 is isolated synthetic ASO composed of 26 nt:
- the ASOs with SEQ ID NO: 19-23 are derived from SEQ ID NO: 18.
- any fragments of the ASOs can provide antisense effect and fall in the delineated by this invention ASO forms (and brought for the patenting) that effect corresponds to the named method and means in the present invention.
- Said isolated ASO herein may be isolated from a natural or native source as in a purified restriction digest, produced synthetically e.g., chemically synthesized or produced by
- ASO may also be prepared by a process known in the art or any other method described herein in accordance with the present invention.
- the ASOs of the present invention as described herein may be any of molecules with
- PNA peptide nucleic acid
- LNA locked nucleic acid
- the ASOs may also contain partial, such as 10, 20, 30, 40, 50, 60, 70, 80 or even 90% naturally occurring nucleotides and the rest, thus e.g., 90, 80, 70, 60, 50, 40, 30, 20, or even 10%, being nucleic acid analogues comprising non-standard nucleobases and/or nonstandard backbones as exemplified herein by PNA, LNA or any derivatized form of nucleic acid.
- the ASOs may further be chemically modified. Such modifications may be
- ASO may be made of nucleotides wherein at least one of the nucleotides has a base modified to enhance binding properties and/or to decrease the action of endo- and exonucleases including 5' to 3' and 3' to 5' DNA pol 1 exonuclease, nucleases S I and PI, RNases, serum nucleases and snake venom phosphodiesterase.
- S. mutans (strain UA159) GtfB protein as a query sequence
- the BLAST Basic Local Alignment Search Tool
- S. mutans (strain UA159) GtfB protein features high identity to the GtfC protein from S. mutans (strain UA159) as well as other Gtf (i.e. Gtfl) proteins from S. criceti, S. dentirousetti, S. dentisuis, S. downei and S.
- S. mutans (strain UA159) gtfB gene contains the following sequence of 26 nt: 5'- GTTAAGATTAAGCAATGGTCTGCCAA-3 ' (SEQ ID NO: 15).
- this segment of S. mutans (strain UA159) gtfB gene has also 100% homologous fragments in S. mutans (strain UA159) gtfC, S. criceti gtfl, S. dentirousetti gtfl, S. dentisuis gtfl and S. orisuis gtf genes.
- antisense oligonucleotide of the following sequence:
- GenBank accession no. gb AEO 14133.1
- GenBank accession no. gb AEO 14133.1
- Modeling of S. mutans gtfB mRNA secondary structure was carried out using the Mfold program at the Rensselaer bioinformatics web server (http://www.bioinfo.rpi.edu/ applications/mfold; accessed in March, 2013) in order to assess binding site for the selected ASO. Consequently, one hundred models of the mRNA secondary structure were generated and the most reliable structural motif around the ASO deduced (Fig 1). In order to determine the conserved homologous regions among the gtf genes of oral streptococci - S. mutans and S.
- sobrinus which are associated with human cardiovascular pathologies, and to choose the complementary ASO sequences to them, there were selected sequences of the water- insoluble glucan synthesis encoding gtf genes of the various clinical strains and clones, belonging to these bacterial species, from the European Nucleotide Archive [ENA] (accessed in September, 2013).
- ENA European Nucleotide Archive
- S. mutans strain UA159
- gtfB gene was used as a reference sequence
- the multiple sequence alignment was produced employing MAFFT online server at the Max-Planck Institute for Development Biology (http://toolkit.tuebingen.mpg.de/mafft; accessed in September, 2013). Applying such approach, it was identified the conserved homologous region within S.
- mutans and S. sobrinus glucosyltransferase genes consisting of 26 nt: 5'- CGCGTCATGTTTGAAGGTTTCTCTAA-3 ' (SEQ ID NO : 17).
- antisense sequence i.e. antisense oligonucleotide
- SEQ ID NO: 18 The exact locations of this segment in the gtf genes of S. mutans (strain UA159) and S. sobrinus (strain SL1) along with the data linked to the GenBank of NCBI are presented below:
- GenBank accession no. gb AEO 14133.2
- GenBank accession no. gb AEO 14133.2
- the mixed S. mutans and S. sobrinus cultures were used in order to evaluate the test ASOl molecule (SEQ ID NO: 1) effect on the bacterial biofilm formation in vitro medium containing the main blood component - a serum.
- sobrinus strain SL1 which are available through the American Type Culture Collection (ATCC no. 700610 and ATCC no. 33478, respectively), were cultured in Todd Hewitt (TH) broth (Difco) with 10% heat-inactivated horse serum (Gibco) under anaerobic conditions (95% N 2 and 5% C0 2 ) at 37 °C for 18 h.
- the culture purity was checked on Mitis salivarius agar (Difco) and Columbia blood agar (E&O Laboratories). Afterwards, the optical density (OD) of bacterial culture was adjusted to 0.2 at 630 nm using microplate reader spectrophotometer (Dynex MRX).
- the ASOl comprising of the sequence: 5 '-GCAGACCATTGCTTAATCT-3 ' (SEQ ID NO:
- the AS02 comprising of the sequence: 5 '- ACTCGTATGCTAC AGCTAT-3 ' (SEQ ID NO:
- the lyophilized ASOs were dissolved in sterile nuclease-free distilled water (Thermo Fisher Scientific, Fermentas) in order to get stock solutions with the final concentration of 100 ⁇ .
- the ASOs were combined with TurboFect TM reagent and prepared according to the manufacturer's protocol by using 2 ⁇ of the reagent for 1 ⁇ g of the oligonucleotide DNA.
- the glass slides were removed from wells, dried and further used for analysis of the mixed S. mutans and S. sobrinus biofilm by Sensofar PLu 2300 optical confocal profilometer. For this purpose, there were performed 6 measurements for evaluation of the biofilm roughness and 5 measurements for assessment of the biofilm thickness (every measurement area of 180 x 240 ⁇ ) per slide halfway from bottom to top of the visible biofilm employing 50X confocal objective. Data of the scanned and measured samples were further processed with Gwyddion programme (version 2.27, available at http://gwyddion.net) in order to quantify the biofilm surface's roughness parameters and its thickness reflecting a maturity of the formed biofilm.
- Gwyddion programme version 2.27, available at http://gwyddion.net
- a Median filter size of 10 pixels or 3 ⁇ was selected to remove errors of form and waviness of the surface.
- Rq an average of the measured height deviations.
- Statistical significance of the measured biofilm parameters was evaluated using the One -Way ANOVA with LSD Post Hoc test of SPSS programme (version 20.0). A p value less than 0.05 was considered statistically significant. Analysis of the glass slides' surfaces with the mixed S. mutans and S.
- sobrinus culture biofilms applying technique of the optical profilometry revealed that the presence of 1% sucrose and 10% blood serum in TH broth considerably increase biofilm surface's roughness parameter - Rq as well as biofilm thickness in comparison to the untreated bacteria growing with 10% serum, but without sucrose (fig 4a; fig 5a,b).
- the test ASOl molecule SEQ ID NO: 1 in combination with TurboFect reagent decreased biofilm surface's roughness (Rq) of the mixed S. mutans and S.
- sobrinus cultures by 25% compared to the bacteria exposed to the AS02 (SEQ ID NO: 2) in combination with TurboFect reagent (p ⁇ 0.05) within TH broth containing 1% sucrose and 10% blood serum (fig 4b,c ; fig 5a).
- the test ASOl molecule (SEQ ID NO: 1) in combination with TurboFect reagent reduced biofilm thickness of the mixed S. mutans and S. sobrinus cultures by approximately 44% compared to the untreated bacteria and bacteria exposed to the
- test ASOl molecule SEQ ID NO: 1
- S. mutans and S. sobrinus adherence and biofilm formation on solid phase surface glass slide
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Biomedical Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Heart & Thoracic Surgery (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Cardiology (AREA)
- Vascular Medicine (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
LTLT2013109 | 2013-10-07 | ||
LT2013109A LT6214B (lt) | 2013-10-07 | 2013-10-07 | Priešprasminiai oligonukleotidai aterosklerozės ir kardiovaskulinių infekcijų prevencijai |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2015052630A1 true WO2015052630A1 (en) | 2015-04-16 |
Family
ID=51871111
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/IB2014/065084 WO2015052630A1 (en) | 2013-10-07 | 2014-10-06 | Antisense oligonucleotides for prevention of atherosclerosis and cardiovascular infections |
Country Status (2)
Country | Link |
---|---|
LT (1) | LT6214B (lt) |
WO (1) | WO2015052630A1 (lt) |
Citations (16)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996004000A1 (en) | 1994-08-05 | 1996-02-15 | The Regents Of The University Of California | PEPTIDE-BASED NUCLEIC ACID MIMICS (PENAMs) |
US5527675A (en) | 1993-08-20 | 1996-06-18 | Millipore Corporation | Method for degradation and sequencing of polymers which sequentially eliminate terminal residues |
US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
US5623049A (en) | 1993-09-13 | 1997-04-22 | Bayer Aktiengesellschaft | Nucleic acid-binding oligomers possessing N-branching for therapy and diagnostics |
WO1997048417A1 (en) * | 1996-06-21 | 1997-12-24 | Virginia Commonwealth University | Vaccine to prevent streptococcal endocarditis |
US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
US5766855A (en) | 1991-05-24 | 1998-06-16 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity and sequence specificity |
US5786461A (en) | 1991-05-24 | 1998-07-28 | Buchardt; Ole | Peptide nucleic acids having amino acid side chains |
US5837459A (en) | 1993-11-25 | 1998-11-17 | Boehringer Mannheim Gmbh | Nucleic acid analogue induced transcription of double stranded DNA |
US5891625A (en) | 1992-06-05 | 1999-04-06 | Buchardt Ole | Use of nucleic acid analogues in the inhibition of nucleic acid amplification |
US5986053A (en) | 1992-05-22 | 1999-11-16 | Isis Pharmaceuticals, Inc. | Peptide nucleic acids complexes of two peptide nucleic acid strands and one nucleic acid strand |
US6107470A (en) | 1997-05-29 | 2000-08-22 | Nielsen; Peter E. | Histidine-containing peptide nucleic acids |
US6201103B1 (en) | 1991-05-24 | 2001-03-13 | Peter E. Nielsen | Peptide nucleic acid incorporating a chiral backbone |
US6228982B1 (en) | 1992-05-22 | 2001-05-08 | Benget Norden | Double-stranded peptide nucleic acids |
WO2006060903A1 (en) * | 2004-12-06 | 2006-06-15 | Kane Biotech Inc. | Signal peptides, nucleic acid molecules and methods of treatment |
WO2014033314A1 (en) * | 2012-09-03 | 2014-03-06 | Uab Bioseka | Antisense oligonucleotide targeting bacterial glucosyltransferases |
-
2013
- 2013-10-07 LT LT2013109A patent/LT6214B/lt not_active IP Right Cessation
-
2014
- 2014-10-06 WO PCT/IB2014/065084 patent/WO2015052630A1/en active Application Filing
Patent Citations (20)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6201103B1 (en) | 1991-05-24 | 2001-03-13 | Peter E. Nielsen | Peptide nucleic acid incorporating a chiral backbone |
US6357163B1 (en) | 1991-05-24 | 2002-03-19 | Ole Buchardt | Use of nucleic acid analogues in diagnostics and analytical procedures |
US5773571A (en) | 1991-05-24 | 1998-06-30 | Nielsen; Peter E. | Peptide nucleic acids |
US5786461A (en) | 1991-05-24 | 1998-07-28 | Buchardt; Ole | Peptide nucleic acids having amino acid side chains |
US5766855A (en) | 1991-05-24 | 1998-06-16 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity and sequence specificity |
US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
US5736336A (en) | 1991-05-24 | 1998-04-07 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
US5986053A (en) | 1992-05-22 | 1999-11-16 | Isis Pharmaceuticals, Inc. | Peptide nucleic acids complexes of two peptide nucleic acid strands and one nucleic acid strand |
US6228982B1 (en) | 1992-05-22 | 2001-05-08 | Benget Norden | Double-stranded peptide nucleic acids |
US5891625A (en) | 1992-06-05 | 1999-04-06 | Buchardt Ole | Use of nucleic acid analogues in the inhibition of nucleic acid amplification |
US5972610A (en) | 1992-06-05 | 1999-10-26 | Buchardt Ole | Use of nucleic acid analogues in the inhibition of nucleic acid amplification |
US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
US5527675A (en) | 1993-08-20 | 1996-06-18 | Millipore Corporation | Method for degradation and sequencing of polymers which sequentially eliminate terminal residues |
US5623049A (en) | 1993-09-13 | 1997-04-22 | Bayer Aktiengesellschaft | Nucleic acid-binding oligomers possessing N-branching for therapy and diagnostics |
US5837459A (en) | 1993-11-25 | 1998-11-17 | Boehringer Mannheim Gmbh | Nucleic acid analogue induced transcription of double stranded DNA |
WO1996004000A1 (en) | 1994-08-05 | 1996-02-15 | The Regents Of The University Of California | PEPTIDE-BASED NUCLEIC ACID MIMICS (PENAMs) |
WO1997048417A1 (en) * | 1996-06-21 | 1997-12-24 | Virginia Commonwealth University | Vaccine to prevent streptococcal endocarditis |
US6107470A (en) | 1997-05-29 | 2000-08-22 | Nielsen; Peter E. | Histidine-containing peptide nucleic acids |
WO2006060903A1 (en) * | 2004-12-06 | 2006-06-15 | Kane Biotech Inc. | Signal peptides, nucleic acid molecules and methods of treatment |
WO2014033314A1 (en) * | 2012-09-03 | 2014-03-06 | Uab Bioseka | Antisense oligonucleotide targeting bacterial glucosyltransferases |
Non-Patent Citations (29)
Title |
---|
AALINKEEL ET AL.: "Quantum rods as nanocarriers of gene therapy", DRUG DELIV, vol. 19, 2012, pages 220 - 231 |
B. WANG ET AL: "Inducible Antisense RNA Expression in the Characterization of Gene Functions in Streptococcus mutans", INFECTION AND IMMUNITY, vol. 73, no. 6, 1 June 2005 (2005-06-01), pages 3568 - 3576, XP055090939, ISSN: 0019-9567, DOI: 10.1128/IAI.73.6.3568-3576.2005 * |
BAI ET AL.: "Antisense antibiotics: a brief review of novel target discovery and delivery", CURR DRUG DISCOV TECHNOL, vol. 7, 2010, pages 76 - 85 |
BLAST SERVICE, March 2013 (2013-03-01), Retrieved from the Internet <URL:http://blast.ncbi.nlm.nih.gov/Blast.cgi> |
BOWEN; KOO: "Biology of Streptococcus mutans-derived glucosyltransferases: role in extracellular matrix formation of cariogenic biofilms", CARIES RES, vol. 45, 2011, pages 69 - 86 |
CALIGIURI ET AL: "Phosphorylcholine-Targeting Immunization Reduces Atherosclerosis", JOURNAL OF THE AMERICAN COLLEGE OF CARDIOLOGY, ELSEVIER, NEW YORK, NY, US, vol. 50, no. 6, 31 July 2007 (2007-07-31), pages 540 - 546, XP022182016, ISSN: 0735-1097, DOI: 10.1016/J.JACC.2006.11.054 * |
D. LIU ET AL.: "Gene Delivery to Mammalian Cells (Methods Mol Biol 245", vol. 1, 2004, HUMANA PRESS INC., article "Chemical Methods for DNA Delivery", pages: 3 - 23 |
EUROPEAN NUCLEOTIDE ARCHIVE [ENA, September 2013 (2013-09-01) |
FAKLER ET AL.: "Short antisense oligonucleotide-mediated inhibition is strongly dependent on oligo length and concentration but almost independent of location of the target sequence", J BIOL CHEM, vol. 269, 1994, pages 16187 - 16194 |
G. ZON: "Protocols for Oligonucleotides and Analogs: Synthesis and Properties (Methods Mol Biol", vol. 20, 1993, HUMANA PRESS INC., article "Oligonucleoside Phosphorothioates", pages: 165 - 189 |
GUO ET AL.: "Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibits GtfB expression and function", FEMS MICROBIAL LETT, vol. 264, 2006, pages 8 - 14 |
GUZAEV: "Reactivity of 3H-1,2,4-diathiazole-3-thiones and 3H-1,2-dithiole-3-thiones as sulfurizing agents for oligonucleotide synthesis", TETRAHEDRON LETT, vol. 52, 2011, pages 434 - 437 |
KESAVALU ET AL.: "Increased atherogenesis during Streptococcus mutans infection in ApoE-null mice", J DENT RES, vol. 91, 2012, pages 255 - 260 |
KOO ET AL.: "The exopolysaccharide matrix: a virulence determinant of cariogenic biofilm", J DENT RES, vol. 92, 2013, pages 1065 - 1073 |
KOREN ET AL.: "Human oral, gut and plaque microbiota in patients with atherosclerosis", PROC NAT ACAD SCI USA, vol. 108, no. 1, 2011, pages 4592 - 4598 |
KURRECK: "Antisense technologies. Improvement through novel chemical modifications", EUR J BIOCHEM, vol. 270, 2003, pages 1628 - 1644 |
MAX-PLANCK INSTITUTE FOR DEVELOPMENT BIOLOGY, March 2013 (2013-03-01), Retrieved from the Internet <URL:http://toolkit.tuebingen.mpg.de/mafft> |
MAX-PLANCK INSTITUTE FOR DEVELOPMENT BIOLOGY, September 2013 (2013-09-01), Retrieved from the Internet <URL:http://toolkit.tuebingen.mpg.de/mafft> |
MENDIS ET AL.: "Global Atlas on cardiovascular disease prevention and control", 2011, WORLD HEALTH ORGANIZATION, pages: 8 - 14 |
NAKANO ET AL.: "Detection of cariogenic Streptococcus mutans in extirpated heart valve and atheromatous plaque specimens", J CLIN MICROBIOL, vol. 44, 2006, pages 3313 - 3317 |
NAKANO ET AL.: "Detection of oral bacteria in cardiovascular specimens", ORAL MICROBIOL IMMUNOL, vol. 24, 2009, pages 64 - 68 |
NAKANO ET AL.: "Streptococcus mutans and cardiovascular diseases", J DENT SCI REV, vol. 44, 2008, pages 29 - 37 |
QING-YU GUO ET AL: "Treatment of Streptococcus mutans with antisense oligodeoxyribonucleotides to gtfB mRNA inhibits GtfB expression and function", FEMS MICROBIOLOGY LETTERS, vol. 264, no. 1, 13 September 2006 (2006-09-13), pages 8 - 14, XP055090940, ISSN: 0378-1097, DOI: 10.1111/j.1574-6968.2006.00378.x * |
RENSSELAER BIOINFORMATICS, March 2013 (2013-03-01), Retrieved from the Internet <URL:http://www.bioinfo.rpi.edu/ applications/mfold> |
SANGHVI: "A status update of modified oligonucleotides for chemotherapeutics applications", CURR PROTOC NUCLEIC ACID CHEM, vol. 46, 2011 |
TANIGUCHI ET AL.: "Defect of glucosyltransferases reduces platelet aggregation activity of Streptococcus mutans: Analysis of clinical strains isolated from oral cavities", ARCH ORAL BIOL, vol. 55, 2010, pages 410 - 416 |
WAGNER ET AL.: "Potent and selective inhibition of gene expression by an antisense heptanucleotide", NAT BIOTECHNOL, vol. 14, 1996, pages 840 - 844 |
WOOLF ET AL.: "Specificity of antisense oligonucleotides in vivo", PROC NATL ACAD SCI USA, vol. 89, 1992, pages 7305 - 7309 |
ZHU; MAHATO: "Lipid and polymeric carrier-mediated nucleic acid delivery", EXPERT OPIN DRUG DELIV, vol. 7, 2010, pages 1209 - 1226 |
Also Published As
Publication number | Publication date |
---|---|
LT6214B (lt) | 2015-08-25 |
LT2013109A (lt) | 2015-04-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Wu et al. | Necessity of oligonucleotide aggregation for toll-like receptor 9 activation | |
CN102459597B (zh) | 通过针对dmd家族的天然反义转录物的抑制治疗肌营养蛋白家族相关疾病 | |
US20180153919A1 (en) | Organic compositions to treat kras-related diseases | |
SA517390168B1 (ar) | تركيبات لتعديل التعبير الوراثي عن c9orf72 | |
KR20160036065A (ko) | Rna를 조정하기 위한 조성물 및 방법 | |
CN110951731A (zh) | 用于调节c9orf72表达的组合物 | |
KR20230006933A (ko) | 아포지질단백질 (a) 발현을 조절하는 조성물 및 방법 | |
KR20180104075A (ko) | IL4Rα, TRPA1, 또는 F2RL1을 표적화하는 RNA 복합체를 사용한 아토피 피부염 및 천식의 치료 | |
KR20220024153A (ko) | 안지오포이에틴 유사 7(angptl7) 관련 질환의 치료 | |
KR20130051954A (ko) | 베타-ENaC-관련 질환을 치료하기 위한 유기 조성물 | |
JPH11507818A (ja) | 脊椎動物テロメラーゼの必須オリゴヌクレオチド | |
WO2014066142A1 (en) | Nucleic acid regulation of growth arrest-specific protein 6 (gas6) | |
KR102588627B1 (ko) | Mast4 유전자를 이용한 세포외 기질 생산용 조성물 및 그 제조방법 | |
CN107805643B (zh) | 靶向抑制沙门氏菌耐药外排泵基因acrA的siRNA-DNA纳米系统及其制备方法 | |
WO2015052630A1 (en) | Antisense oligonucleotides for prevention of atherosclerosis and cardiovascular infections | |
WO2019191151A1 (en) | In vitro and in vivo intracellular delivery of sirna via self-assembled nanopieces | |
KR20210144601A (ko) | 이중가닥 올리고뉴클레오티드 및 이를 포함하는 코로나바이러스감염증-19〔covid-19〕치료용 조성물 | |
US20040072769A1 (en) | Methods for design and selection of short double-stranded oligonucleotides, and compounds of gene drugs | |
US20220125651A1 (en) | Antisense oligomers for controlling candida albicans infections | |
WO2009147742A1 (ja) | ヒト・オステオポンチンsiRNA | |
Kalesinskas et al. | Streptococcus mutans biofilm inhibition using antisense oligonucleotide to glucosyltransferases B and C | |
LT6426B (lt) | Priešprasminis oligonukleotidas bakterinių bioplėvelių ir atsparumo antibiotikams prevencijai | |
Lei et al. | Spermine-starch nanoparticles with antisense vicR suppress Streptococcus mutans cariogenicity | |
WO2014033314A1 (en) | Antisense oligonucleotide targeting bacterial glucosyltransferases | |
WO2021123086A1 (en) | Enhanced oligonucleotides for inhibiting scn9a expression |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14796277 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
32PN | Ep: public notification in the ep bulletin as address of the adressee cannot be established |
Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 15/06/2016) |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 14796277 Country of ref document: EP Kind code of ref document: A1 |