WO2015038792A1 - Compositions and methods comprising lg12-clade protease variants - Google Patents

Compositions and methods comprising lg12-clade protease variants Download PDF

Info

Publication number
WO2015038792A1
WO2015038792A1 PCT/US2014/055223 US2014055223W WO2015038792A1 WO 2015038792 A1 WO2015038792 A1 WO 2015038792A1 US 2014055223 W US2014055223 W US 2014055223W WO 2015038792 A1 WO2015038792 A1 WO 2015038792A1
Authority
WO
WIPO (PCT)
Prior art keywords
clade
cleaning
enzyme
amino acid
variant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/055223
Other languages
English (en)
French (fr)
Inventor
Lilia M. Babe
David A. Estell
Frits Goedegebuur
Richard R. Bott
Marc Kolkman
Harm Mulder
Brian F. Schmidt
Katherine Augustyn
Munroop ATWAL
Abby MARQUEZ
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Danisco US Inc
Original Assignee
Danisco US Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Danisco US Inc filed Critical Danisco US Inc
Priority to JP2016542111A priority Critical patent/JP6678108B2/ja
Priority to EP14784386.6A priority patent/EP3044313B1/en
Priority to DK14784386.6T priority patent/DK3044313T3/da
Priority to CN201480050677.4A priority patent/CN105593365B/zh
Priority to US15/021,681 priority patent/US20160222368A1/en
Priority to EP19199383.1A priority patent/EP3653707B1/en
Priority to BR112016005286A priority patent/BR112016005286A2/pt
Publication of WO2015038792A1 publication Critical patent/WO2015038792A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • C12N9/54Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K20/00Accessory food factors for animal feeding-stuffs
    • A23K20/10Organic substances
    • A23K20/189Enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • CCHEMISTRY; METALLURGY
    • C11ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11DDETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16Organic compounds
    • C11D3/38Products with no well-defined composition, e.g. natural products
    • C11D3/386Preparations containing enzymes, e.g. protease or amylase
    • CCHEMISTRY; METALLURGY
    • C11ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11DDETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16Organic compounds
    • C11D3/38Products with no well-defined composition, e.g. natural products
    • C11D3/386Preparations containing enzymes, e.g. protease or amylase
    • C11D3/38681Chemically modified or immobilised enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • CCHEMISTRY; METALLURGY
    • C14SKINS; HIDES; PELTS; LEATHER
    • C14CCHEMICAL TREATMENT OF HIDES, SKINS OR LEATHER, e.g. TANNING, IMPREGNATING, FINISHING; APPARATUS THEREFOR; COMPOSITIONS FOR TANNING
    • C14C1/00Chemical treatment prior to tanning
    • C14C1/06Facilitating unhairing, e.g. by painting, by liming
    • C14C1/065Enzymatic unhairing
    • DTEXTILES; PAPER
    • D06TREATMENT OF TEXTILES OR THE LIKE; LAUNDERING; FLEXIBLE MATERIALS NOT OTHERWISE PROVIDED FOR
    • D06MTREATMENT, NOT PROVIDED FOR ELSEWHERE IN CLASS D06, OF FIBRES, THREADS, YARNS, FABRICS, FEATHERS OR FIBROUS GOODS MADE FROM SUCH MATERIALS
    • D06M16/00Biochemical treatment of fibres, threads, yarns, fabrics, or fibrous goods made from such materials, e.g. enzymatic
    • D06M16/003Biochemical treatment of fibres, threads, yarns, fabrics, or fibrous goods made from such materials, e.g. enzymatic with enzymes or microorganisms
    • DTEXTILES; PAPER
    • D21PAPER-MAKING; PRODUCTION OF CELLULOSE
    • D21CPRODUCTION OF CELLULOSE BY REMOVING NON-CELLULOSE SUBSTANCES FROM CELLULOSE-CONTAINING MATERIALS; REGENERATION OF PULPING LIQUORS; APPARATUS THEREFOR
    • D21C9/00After-treatment of cellulose pulp, e.g. of wood pulp, or cotton linters ; Treatment of dilute or dewatered pulp or process improvement taking place after obtaining the raw cellulosic material and not provided for elsewhere
    • D21C9/10Bleaching ; Apparatus therefor
    • D21C9/1063Bleaching ; Apparatus therefor with compounds not otherwise provided for, e.g. activated gases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21062Subtilisin (3.4.21.62)

Definitions

  • Serine proteases are a class of enzymes that cleave peptide bonds in proteins.
  • the serine proteases contain a nucleophilic serine residue at the active site.
  • Subtilisins are a large family of serine proteases, and although they have long been known in the art of industrial enzymes, there remains a need for engineered proteases that are suitable for particular conditions and uses.
  • FIG. 11 provides a region of the homology model of the structure of LG12 sprC protease based on the structure of subtilisin from B. licheniformis.
  • the side chains of Tyr 86, Asn 87, Thr 22 and His 17 are shown as stick figures.
  • polynucleotide and “nucleic acid,” which are used interchangeably herein, refer to a polymer of any length of nucleotide monomers covalently bonded in a chain.
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • polynucleotides or nucleic acids having distinct biological function are examples of polynucleotides or nucleic acids having distinct biological function.
  • Polynucleotides or nucleic acids include, but are not limited to, a single-, double- or triple-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically, biochemically modified, non-natural or derivatized nucleotide bases.
  • the following are non-limiting examples of polynucleotides: genes, gene fragments, chromosomal fragments, expressed sequence tag(s) (EST(s)), exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), ribozymes, complementary DNA (cDNA), recombinant
  • mutation refers to changes made in a starting amino acid or nucleic acid sequence. It is intended that the term encompass substitutions, insertions and deletions.
  • vector refers to a nucleic acid construct or polynucleotide construct used to introduce or transfer nucleic acid(s) or polynucleotide(s) into a target cell or tissue.
  • a vector is typically used to introduce foreign DNA into another cell or tissue.
  • a vector generally comprises a DNA sequence that is a transgene and a larger polynucleotide sequence that serves as the "backbone" of the vector.
  • the vector typically serves to transfers genetic information, such as the inserted transgene, to a target cell or tissue so as to isolate, multiply, or express the insert in the target cell or tissue.
  • DNA construct may be used, for example, to: 1) insert heterologous sequences into a desired target sequence of a host cell; and/or 2) mutagenize a region of the host cell chromosome (i.e., replace an endogenous sequence with a heterologous sequence); 3) delete target genes; and/or 4) introduce a replicating plasmid into the host.
  • DNA construct is used interchangeably herein with "expression cassette.”
  • nucleic acid or gene "amplification” refers to a process by which specific DNA sequences are disproportionately replicated such that the amplified nucleic acid or gene becomes present in a higher copy number than was initially present in the genome.
  • Nomenclature is used through out this disclosure.
  • the single letter X refers to any of the twenty amino acids. It is also understood that a polypeptide may be coded for by more than one nucleotide sequence due to the degeneracy of the genetic code. Mutations are named by the one letter code for the parent amino acid, followed by a three or two digit position number and then the one letter code for the variant amino acid. For example, mutating glycine (G) at position 87 to serine (S) is represented as "G087S" or "G87S”. Multiple mutations are indicated by inserting a "-" between the mutations.
  • homology refers to sequence similarity or identity, with identity being preferred. Homology may be determined using standard techniques known in the art (See e.g., Smith and Waterman, Adv. Appl. Math. 2:482 [1981]; Needleman and Wunsch, J. Mol. Biol. 48:443 [1970];
  • PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pair-wise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng and Doolittle (See, Feng and Doolittle, J. Mol. Evol.
  • Optimal alignment refers to the alignment of two (or more) sequences giving the highest percent identity score.
  • optimal alignment of two protein sequences can be achieved by manually aligning the sequences such that the maximum number of identical amino acid residues in each sequence are aligned together or by using software programs or procedures described herein or known in the art.
  • Optimal alignment of two nucleic acid sequences can be achieved by manually aligning the sequences such that the maximum number of identical nucleotide residues in each sequence are aligned together or by using software programs or procedures described herein or known in the art.
  • the invention provides methods of enriching compositions for one or more molecules of the invention, such as one or more polypeptides or polynucleotides of the invention.
  • a composition is enriched for a molecule when there is a substantial increase in the concentration of the molecule after application of a purification or enrichment technique.
  • target property refers to the property of the starting gene that is to be altered. It is not intended that the present invention be limited to any particular target property.
  • Cleaning performance can be determined by comparing the variant proteases of the present invention with reference proteases in various cleaning assays concerning enzyme sensitive stains such as grass, blood, ink, oil, and/or milk as determined by usual spectrophotometric or analytical methodologies after standard wash cycle conditions.
  • a given amino acid sequence such as a variant protease amino acid sequence described herein, can be aligned with the LG12 sprC sequence (SEQ ID NO:3) using an alignment algorithm as described herein, and an amino acid residue in the given amino acid sequence that aligns (preferably optimally aligns) with an amino acid residue in the LG12 sprC sequence can be conveniently numbered by reference to the corresponding amino acid residue in the LG12 sprC sequence.
  • the LG12 enzyme clade comprises subtilisin proteases where the parent, wildtype and/or variant sequence contains one or more of the following amino acid motifs: a catalytic triad comprising Ser221, His64, and Asp32; a Pro, Asp/Asn, Ala, Leu motif from positions 55-58; a Thrl03- Leul04 motif; a Tyr86-Asn/Asp87 motif; an Alal6-Hisl7 motif; a Val21-Thr22 motif, and/or a motif at the C-terminus, starting at position 267: Val,Ile,Asp/Asn,Val/Leu,Glu,X,Ala,Leu,Gln, where the X represents any amino acid, and where the residue numbers correspond to LG12 sprC (SEQ ID NO:3).
  • a catalytic triad comprising Ser221, His64, and Asp32
  • Pro Asp/Asn
  • Ala Leu motif from positions 55-58
  • Productive positions are described as those positions within a molecule that are most useful for making combinatorial variants exhibiting an improved characteristic, where the position itself allows for at least one combinable mutation.
  • Combinable mutations can be described as those substitutions in a molecule that can be used to make combinatorial variants.
  • Combinable mutations are ones that improve at least one desired property of the molecule, while not significantly decreasing either: expression, activity, or stability.
  • Activity Combinable mutations are ones that improve at least one activity property of the molecule, with a performance index greater than or equal to 1.5, while not decreasing either expression or stability PI values below 0.5. These Activity Combinable mutations can be used to modify the molecule in order to achieve a desired property without significantly decreasing other known and desired properties of the molecule (e.g. expression or stability).
  • LG12-clade enzymes of the present invention having a beneficial mutation in ADW stability and ADW performance comprise substitutions from the group selected from: A001G, A001K, A001R, Q002F, Q002K, Q002P, Q002R, Q002S, Q002W, T003G, T003I, T003V, T003Y, G007N, P009A, P009G, P009H, P009I, P009M, P009Q, P009R, P009S, P009T, P009V, A018N, A019M, T022E, S024H, S024R, S024T, S024V, G025A, V026N, K027P, K027R, K027S, K027T, A029S, I030V, N038A, N038Q, N038T, A040
  • the variant LG12-clade enzyme polypeptides of the invention have enzymatic activities (e.g., proteolytic activities) and thus are useful in cleaning applications, including but not limited to, methods for cleaning dishware items, tableware items, fabrics, and items having hard surfaces (e.g., the hard surface of a table, table top, wall, furniture item, floor, ceiling, etc.).
  • enzymatic activity e.g., LG12-clade enzyme activity
  • a variant LG12-clade enzyme polypeptide of the invention can be determined readily using procedures well known to those of ordinary skill in the art.
  • polypeptides of the invention may have cleaning abilities that may be compared to known proteases, including known serine proteases.
  • the Bacillus host comprises a mutation or deletion in scoC4 ⁇ See e.g., Caldwell et al., J. Bacteriol. 183:7329-7340 [2001]); spoIIE ⁇ See e.g., Arigoni et al., Mol. Microbiol. 31: 1407-1415 [1999]); and/or oppA or other genes of the opp operon ⁇ See e.g., Perego et al, Mol. Microbiol. 5: 173-185 [1991]).
  • the enzymes of the present invention are ideally suited for laundry applications. Furthermore, the enzymes of the present invention find use in granular and liquid compositions.
  • variant proteases of the present invention find particular use in the cleaning industry, including, but not limited to laundry and dish detergents. These applications place enzymes under various environmental stresses.
  • the variant proteases of the present invention provide advantages over many currently used enzymes, due to their stability under various conditions.
  • alkaline proteases examples include subtilisins, especially those derived from Bacillus (e.g., subtilisin, lentus, amyloliquefaciens, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtilisin 168). Additional examples include those mutant proteases described in U.S. Pat. Nos. RE 34,606, 5,955,340, 5,700,676, 6,312,936, and 6,482,628, all of which are incorporated herein by reference. Additional protease examples include, but are not limited to trypsin (e.g., of porcine or bovine origin), and the Fusarium protease described in WO
  • compositions of the present invention preferably contain at least one surfactant and at least one builder compound, as well as one or more cleaning adjunct materials preferably selected from organic polymeric compounds, bleaching agents, additional enzymes, suds suppressors, dispersants, lime-soap dispersants, soil suspension and anti-redeposition agents and corrosion inhibitors.
  • cleaning adjunct materials preferably selected from organic polymeric compounds, bleaching agents, additional enzymes, suds suppressors, dispersants, lime-soap dispersants, soil suspension and anti-redeposition agents and corrosion inhibitors.
  • laundry compositions also contain softening agents (i.e., as additional cleaning adjunct materials).
  • the present invention provides methods for cleaning or washing a fabric item optionally in need of cleaning or washing, respectively.
  • the methods comprise providing a composition comprising the variant protease, including but not limited to fabric or laundry cleaning composition, and a fabric item or laundry item in need of cleaning, and contacting the fabric item or laundry item (or a portion of the item desired to be cleaned) with the composition under conditions sufficient or effective to clean or wash the fabric or laundry item to a desired degree.
  • LG-12 clade protease polypeptides described herein find further use in tissue culture.
  • LG-12 clade proteases of the present invention can be used to suspend or resuspend cells adherent to a cell culture wall, such as during the process of harvesting cells.
  • LG-12 clade proteases of the present invention can be used to cleave protein bonds between cultured cells and the dish, allowing cells to become suspended in solution.
  • Protein determination was performed to determine levels of protein expression using supernatants from cultures grown in 96-well micro-titer plates (MTPs), by High Performance Liquid Chromatography (HPLC) method.
  • HPLC High Performance Liquid Chromatography
  • An Agilent 1200 or 1260 HPLC equipped with an Acquity UPLC BEH 125 SEC (Waters) size exclusion column was used. Sample was eluted from the column using 25 mM sodium phosphate buffer pH 6.8 containing 250 mM sodium chloride.
  • suc-AAPF-pNA stock solution was added to 100 ml Tris/Ca buffer and mixed well.
  • An enzyme sample was added to a MTP plate (Greiner 781101) containing 1 mg/ suc-AAPF-pNA working solution and assayed for activity at 405 nm over 3 minutes using a SpectraMax plate reader in kinetic mode at RT.
  • the protease activity was expressed as mOD- min "1 .
  • Variants were tested for stability under various stress conditions (buffers and detergents as indicated on the Table 1 below) by measuring the residual activity following incubation at elevated temperature.
  • the elevated temperature was set to obtain approximately 30% residual activity
  • Diluted enzyme sample was mixed in stressor and unstressed protease activity was measured.
  • the diluted sample in stressor was incubated at elevated temperature and after incubation the stressed protease activity was measured.
  • Hindlll site in pHY300PLK was also removed using a linker cloned into the BamHI and Hindlll sites (SEQ ID NO:22 new linker sequence, GGATCCTGACTGCCTGAGCTT) .
  • SEQ ID NO:3 sets forth the amino acid sequence of the mature LG12 sprC protein (275 amino acids)
  • Combinable mutations were assigned to groups A, B or C according to criteria set forth in Example 4. These substitutions are further assigned a Suitability Score based on the group(s) (A, B, C) where the substitution appears, and where a higher suitability scores represents a substitution more suitable for use in making combinatorial variants. Suitability scores are defined in Table 4. Suitability scores for individual substitutions of LG12 sprC that fit the above criteria are reported in Table 4.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Polymers & Plastics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Molecular Biology (AREA)
  • Food Science & Technology (AREA)
  • Animal Husbandry (AREA)
  • Textile Engineering (AREA)
  • Cell Biology (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Dermatology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Detergent Compositions (AREA)
  • Fodder In General (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
  • Cosmetics (AREA)
PCT/US2014/055223 2013-09-12 2014-09-11 Compositions and methods comprising lg12-clade protease variants Ceased WO2015038792A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
JP2016542111A JP6678108B2 (ja) 2013-09-12 2014-09-11 Lg12−系統群プロテアーゼ変異体を含む組成物及び方法
EP14784386.6A EP3044313B1 (en) 2013-09-12 2014-09-11 Compositions and methods comprising lg12-clade protease variants
DK14784386.6T DK3044313T3 (da) 2013-09-12 2014-09-11 Sammensætninger og fremgangsmåder omfattende lg12-clade- proteasevarianter
CN201480050677.4A CN105593365B (zh) 2013-09-12 2014-09-11 包含lg12-进化枝蛋白酶变体的组合物和方法
US15/021,681 US20160222368A1 (en) 2013-09-12 2014-09-11 Compositions and Methods Comprising LG12-CLADE Protease Variants
EP19199383.1A EP3653707B1 (en) 2013-09-12 2014-09-11 Compositions and methods comprising lg12-clade protease variants
BR112016005286A BR112016005286A2 (pt) 2013-09-12 2014-09-11 composições e métodos compreendendo variantes de protease do clado lg12

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361877087P 2013-09-12 2013-09-12
US61/877,087 2013-09-12

Publications (1)

Publication Number Publication Date
WO2015038792A1 true WO2015038792A1 (en) 2015-03-19

Family

ID=51726858

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/055223 Ceased WO2015038792A1 (en) 2013-09-12 2014-09-11 Compositions and methods comprising lg12-clade protease variants

Country Status (7)

Country Link
US (1) US20160222368A1 (enExample)
EP (2) EP3044313B1 (enExample)
JP (1) JP6678108B2 (enExample)
CN (1) CN105593365B (enExample)
BR (1) BR112016005286A2 (enExample)
DK (1) DK3044313T3 (enExample)
WO (1) WO2015038792A1 (enExample)

Cited By (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016145428A1 (en) 2015-03-12 2016-09-15 Danisco Us Inc Compositions and methods comprising lg12-clade protease variants
WO2016205710A1 (en) * 2015-06-17 2016-12-22 Danisco Us Inc. Proteases with modified propeptide regions
WO2016205755A1 (en) 2015-06-17 2016-12-22 Danisco Us Inc. Bacillus gibsonii-clade serine proteases
WO2017079751A1 (en) 2015-11-05 2017-05-11 Danisco Us Inc Paenibacillus sp. mannanases
WO2017079756A1 (en) 2015-11-05 2017-05-11 Danisco Us Inc Paenibacillus and bacillus spp. mannanases
WO2017106676A1 (en) 2015-12-18 2017-06-22 Danisco Us Inc Polypeptides with endoglucanase activity and uses thereof
WO2017192300A1 (en) 2016-05-05 2017-11-09 Danisco Us Inc Protease variants and uses thereof
WO2017192692A1 (en) 2016-05-03 2017-11-09 Danisco Us Inc Protease variants and uses thereof
WO2017210295A1 (en) 2016-05-31 2017-12-07 Danisco Us Inc. Protease variants and uses thereof
WO2017219011A1 (en) 2016-06-17 2017-12-21 Danisco Us Inc Protease variants and uses thereof
EP3275990A1 (en) * 2016-07-28 2018-01-31 The Procter and Gamble Company Process for reblending a first liquid detergent composition into a second liquid detergent composition
WO2018085524A2 (en) 2016-11-07 2018-05-11 Danisco Us Inc Laundry detergent composition
WO2018118917A1 (en) 2016-12-21 2018-06-28 Danisco Us Inc. Protease variants and uses thereof
WO2018118950A1 (en) 2016-12-21 2018-06-28 Danisco Us Inc. Bacillus gibsonii-clade serine proteases
JP2018524970A (ja) * 2015-05-13 2018-09-06 ダニスコ・ユーエス・インク AprL−CLADEプロテアーゼ変異体及びその使用
WO2018169750A1 (en) 2017-03-15 2018-09-20 Danisco Us Inc Trypsin-like serine proteases and uses thereof
WO2018184004A1 (en) 2017-03-31 2018-10-04 Danisco Us Inc Alpha-amylase combinatorial variants
WO2019036721A2 (en) 2017-08-18 2019-02-21 Danisco Us Inc VARIANTS OF ALPHA-AMYLASES
WO2019108599A1 (en) 2017-11-29 2019-06-06 Danisco Us Inc Subtilisin variants having improved stability
WO2019245705A1 (en) 2018-06-19 2019-12-26 Danisco Us Inc Subtilisin variants
WO2019245704A1 (en) 2018-06-19 2019-12-26 Danisco Us Inc Subtilisin variants
WO2020028443A1 (en) 2018-07-31 2020-02-06 Danisco Us Inc Variant alpha-amylases having amino acid substitutions that lower the pka of the general acid
WO2020068486A1 (en) 2018-09-27 2020-04-02 Danisco Us Inc Compositions for medical instrument cleaning
WO2020077331A2 (en) 2018-10-12 2020-04-16 Danisco Us Inc Alpha-amylases with mutations that improve stability in the presence of chelants
WO2020112599A1 (en) 2018-11-28 2020-06-04 Danisco Us Inc Subtilisin variants having improved stability
WO2020242858A1 (en) 2019-05-24 2020-12-03 Danisco Us Inc Subtilisin variants and methods of use
WO2020247582A1 (en) 2019-06-06 2020-12-10 Danisco Us Inc Methods and compositions for cleaning
WO2021080948A2 (en) 2019-10-24 2021-04-29 Danisco Us Inc Variant maltopentaose/maltohexaose-forming alpha-amylases
WO2022047149A1 (en) 2020-08-27 2022-03-03 Danisco Us Inc Enzymes and enzyme compositions for cleaning
WO2022165107A1 (en) 2021-01-29 2022-08-04 Danisco Us Inc Compositions for cleaning and methods related thereto
WO2023278297A1 (en) 2021-06-30 2023-01-05 Danisco Us Inc Variant lipases and uses thereof
WO2023034486A2 (en) 2021-09-03 2023-03-09 Danisco Us Inc. Laundry compositions for cleaning
WO2023114936A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Subtilisin variants and methods of use
WO2023114939A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Subtilisin variants and methods of use
WO2023114932A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Subtilisin variants and methods of use
WO2023114988A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Variant maltopentaose/maltohexaose-forming alpha-amylases
WO2023168234A1 (en) 2022-03-01 2023-09-07 Danisco Us Inc. Enzymes and enzyme compositions for cleaning
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections
WO2023250301A1 (en) 2022-06-21 2023-12-28 Danisco Us Inc. Methods and compositions for cleaning comprising a polypeptide having thermolysin activity
WO2024050339A1 (en) 2022-09-02 2024-03-07 Danisco Us Inc. Mannanase variants and methods of use
WO2024050346A1 (en) 2022-09-02 2024-03-07 Danisco Us Inc. Detergent compositions and methods related thereto
WO2024050343A1 (en) 2022-09-02 2024-03-07 Danisco Us Inc. Subtilisin variants and methods related thereto
WO2024102698A1 (en) 2022-11-09 2024-05-16 Danisco Us Inc. Subtilisin variants and methods of use
DE102022213537A1 (de) 2022-12-13 2024-06-13 Henkel Ag & Co. Kgaa Wasch- und reinigungsmittel enthaltend protease
DE102022213538A1 (de) 2022-12-13 2024-06-13 Henkel Ag & Co. Kgaa Wasch- und reinigungsmittel enthaltend protease
WO2024163584A1 (en) 2023-02-01 2024-08-08 Danisco Us Inc. Subtilisin variants and methods of use
WO2024186819A1 (en) 2023-03-06 2024-09-12 Danisco Us Inc. Subtilisin variants and methods of use
WO2024191711A1 (en) 2023-03-16 2024-09-19 Nutrition & Biosciences USA 4, Inc. Brevibacillus fermentate extracts for cleaning and malodor control and use thereof
WO2025071996A1 (en) 2023-09-28 2025-04-03 Danisco Us Inc. Variant cutinase enzymes with improved solubility and uses thereof
WO2025085351A1 (en) 2023-10-20 2025-04-24 Danisco Us Inc. Subtilisin variants and methods of use

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3174724B1 (en) * 2014-07-31 2019-01-23 Kornit Digital Ltd. Process and system for continuous inkjet printing
CN109949867B (zh) * 2019-01-25 2023-05-30 中国农业科学院特产研究所 一种多条序列比对算法的优化方法和系统、存储介质
CN111575265B (zh) * 2020-05-22 2022-07-22 江南大学 一种热稳定性提高的角蛋白酶突变体

Citations (100)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US202535A (en) 1878-04-16 Improvement in devices for supplying feed-water to boilers
GB1296839A (enExample) 1969-05-29 1972-11-22
GB1372034A (en) 1970-12-31 1974-10-30 Unilever Ltd Detergent compositions
US4246612A (en) 1979-02-28 1981-01-20 Barr & Stroud Limited Optical raster scanning system
US4302544A (en) 1979-10-15 1981-11-24 University Of Rochester Asporogenous mutant of B. subtilis for use as host component of HV1 system
US4430243A (en) 1981-08-08 1984-02-07 The Procter & Gamble Company Bleach catalyst compositions and use thereof in laundry bleaching and detergent compositions
US4435307A (en) 1980-04-30 1984-03-06 Novo Industri A/S Detergent cellulase
US4450235A (en) 1982-04-21 1984-05-22 Cpc International Inc. Asporogenic mutant of bacillus subtilis useful as a host in a host-vector system
EP0134048A1 (en) 1983-07-06 1985-03-13 Gist-Brocades N.V. Molecular cloning and expression in industrial microorganism species
US4515705A (en) 1983-11-14 1985-05-07 The Procter & Gamble Company Compositions containing odor purified proteolytic enzymes and perfumes
US4515707A (en) 1983-06-27 1985-05-07 The Chemithon Corporation Intermediate product for use in producing a detergent bar and method for producing same
US4537706A (en) 1984-05-14 1985-08-27 The Procter & Gamble Company Liquid detergents containing boric acid to stabilize enzymes
US4550862A (en) 1982-11-17 1985-11-05 The Procter & Gamble Company Liquid product pouring and measuring package with self draining feature
US4561998A (en) 1982-05-24 1985-12-31 The Procter & Gamble Company Near-neutral pH detergents containing anionic surfactant, cosurfactant and fatty acid
US4597898A (en) 1982-12-23 1986-07-01 The Proctor & Gamble Company Detergent compositions containing ethoxylated amines having clay soil removal/anti-redeposition properties
EP0214761A2 (en) 1985-08-07 1987-03-18 Novo Nordisk A/S An enzymatic detergent additive, a detergent, and a washing method
EP0218272A1 (en) 1985-08-09 1987-04-15 Gist-Brocades N.V. Novel lipolytic enzymes and their use in detergent compositions
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
EP0238023A2 (en) 1986-03-17 1987-09-23 Novo Nordisk A/S Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus
EP0258068A2 (en) 1986-08-29 1988-03-02 Novo Nordisk A/S Enzymatic detergent additive
US4760025A (en) 1984-05-29 1988-07-26 Genencor, Inc. Modified enzymes and methods for making same
US4765916A (en) 1987-03-24 1988-08-23 The Clorox Company Polymer film composition for rinse release of wash additives
WO1988009367A1 (en) 1987-05-29 1988-12-01 Genencor, Inc. Cutinase cleaning composition
EP0305216A1 (en) 1987-08-28 1989-03-01 Novo Nordisk A/S Recombinant Humicola lipase and process for the production of recombinant humicola lipases
US4810410A (en) 1986-12-13 1989-03-07 Interox Chemicals Limited Bleach activation
JPS6474992A (en) 1987-09-16 1989-03-20 Fuji Oil Co Ltd Dna sequence, plasmid and production of lipase
WO1989006270A1 (en) 1988-01-07 1989-07-13 Novo-Nordisk A/S Enzymatic detergent
EP0331376A2 (en) 1988-02-28 1989-09-06 Amano Pharmaceutical Co., Ltd. Recombinant DNA, bacterium of the genus pseudomonas containing it, and process for preparing lipase by using it
WO1990009446A1 (en) 1989-02-17 1990-08-23 Plant Genetic Systems N.V. Cutinase
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US4968451A (en) 1988-08-26 1990-11-06 The Procter & Gamble Company Soil release agents having allyl-derived sulfonated end caps
US4972017A (en) 1987-03-24 1990-11-20 The Clorox Company Rinse soluble polymer film composition for wash additives
US4977252A (en) 1988-03-11 1990-12-11 National Starch And Chemical Investment Holding Corporation Modified starch emulsifier characterized by shelf stability
WO1991016422A1 (de) 1990-04-14 1991-10-31 Kali-Chemie Aktiengesellschaft Alkalische bacillus-lipasen, hierfür codierende dna-sequenzen sowie bacilli, die diese lipasen produzieren
EP0495257A1 (en) 1991-01-16 1992-07-22 The Procter & Gamble Company Compact detergent compositions with high activity cellulase
WO1992021760A1 (en) 1991-05-29 1992-12-10 Cognis, Inc. Mutant proteolytic enzymes from bacillus
US5227084A (en) 1991-04-17 1993-07-13 Lever Brothers Company, Division Of Conopco, Inc. Concentrated detergent powder compositions
US5264366A (en) 1984-05-29 1993-11-23 Genencor, Inc. Protease deficient bacillus
WO1994006915A1 (en) * 1992-09-24 1994-03-31 Genencor International, Inc. Cleaning compositions containing novel alkaline proteases
WO1994012621A1 (en) 1992-12-01 1994-06-09 Novo Nordisk Enhancement of enzyme reactions
US5354559A (en) 1990-05-29 1994-10-11 Grain Processing Corporation Encapsulation with starch hydrolyzate acid esters
WO1994026860A1 (de) 1993-05-08 1994-11-24 Henkel Kommanditgesellschaft Auf Aktien Silberkorrosionsschutzmittel ii
WO1994026859A1 (de) 1993-05-08 1994-11-24 Henkel Kommanditgesellschaft Auf Aktien Silberkorrosionsschutzmittel i
WO1995001426A1 (en) 1993-06-29 1995-01-12 Novo Nordisk A/S Enhancement of laccase reactions
WO1995023221A1 (en) 1994-02-24 1995-08-31 Cognis, Inc. Improved enzymes and detergents containing them
US5486303A (en) 1993-08-27 1996-01-23 The Procter & Gamble Company Process for making high density detergent agglomerates using an anhydrous powder additive
US5489392A (en) 1994-09-20 1996-02-06 The Procter & Gamble Company Process for making a high density detergent composition in a single mixer/densifier with selected recycle streams for improved agglomerate properties
US5516448A (en) 1994-09-20 1996-05-14 The Procter & Gamble Company Process for making a high density detergent composition which includes selected recycle streams for improved agglomerate
US5565422A (en) 1995-06-23 1996-10-15 The Procter & Gamble Company Process for preparing a free-flowing particulate detergent composition having improved solubility
US5565145A (en) 1994-05-25 1996-10-15 The Procter & Gamble Company Compositions comprising ethoxylated/propoxylated polyalkyleneamine polymers as soil dispersing agents
US5569645A (en) 1995-04-24 1996-10-29 The Procter & Gamble Company Low dosage detergent composition containing optimum proportions of agglomerates and spray dried granules for improved flow properties
US5574005A (en) 1995-03-07 1996-11-12 The Procter & Gamble Company Process for producing detergent agglomerates from high active surfactant pastes having non-linear viscoelastic properties
US5576282A (en) 1995-09-11 1996-11-19 The Procter & Gamble Company Color-safe bleach boosters, compositions and laundry methods employing same
US5595967A (en) 1995-02-03 1997-01-21 The Procter & Gamble Company Detergent compositions comprising multiperacid-forming bleach activators
US5597936A (en) 1995-06-16 1997-01-28 The Procter & Gamble Company Method for manufacturing cobalt catalysts
WO1997011151A1 (en) 1995-09-18 1997-03-27 The Procter & Gamble Company Delivery systems
US5646101A (en) 1993-01-18 1997-07-08 The Procter & Gamble Company Machine dishwashing detergents containing an oxygen bleach and an anti-tarnishing mixture of a paraffin oil and sequestrant
US5686014A (en) 1994-04-07 1997-11-11 The Procter & Gamble Company Bleach compositions comprising manganese-containing bleach catalysts
US5691297A (en) 1994-09-20 1997-11-25 The Procter & Gamble Company Process for making a high density detergent composition by controlling agglomeration within a dispersion index
US5695679A (en) 1994-07-07 1997-12-09 The Procter & Gamble Company Detergent compositions containing an organic silver coating agent to minimize silver training in ADW washing methods
US5698504A (en) 1993-07-01 1997-12-16 The Procter & Gamble Company Machine dishwashing composition containing oxygen bleach and paraffin oil and benzotriazole compound silver tarnishing inhibitors
US5700676A (en) 1984-05-29 1997-12-23 Genencor International Inc. Modified subtilisins having amino acid alterations
US5705464A (en) 1995-06-16 1998-01-06 The Procter & Gamble Company Automatic dishwashing compositions comprising cobalt catalysts
US5710115A (en) 1994-12-09 1998-01-20 The Procter & Gamble Company Automatic dishwashing composition containing particles of diacyl peroxides
US5801039A (en) 1994-02-24 1998-09-01 Cognis Gesellschaft Fuer Bio Und Umwelttechnologie Mbh Enzymes for detergents
US5855625A (en) 1995-01-17 1999-01-05 Henkel Kommanditgesellschaft Auf Aktien Detergent compositions
WO1999006521A1 (en) 1997-08-02 1999-02-11 The Procter & Gamble Company Detergent tablet
US5874276A (en) 1993-12-17 1999-02-23 Genencor International, Inc. Cellulase enzymes and systems for their expressions
US5879584A (en) 1994-09-10 1999-03-09 The Procter & Gamble Company Process for manufacturing aqueous compositions comprising peracids
EP0922499A2 (de) 1993-12-15 1999-06-16 Ing. Erich Pfeiffer GmbH Austragvorrichtung für Medien
WO1999034011A2 (en) 1997-12-24 1999-07-08 Genencor International, Inc. Method of assaying for a preferred enzyme and/or detergent
US5929022A (en) 1996-08-01 1999-07-27 The Procter & Gamble Company Detergent compositions containing amine and specially selected perfumes
US5935826A (en) 1997-10-31 1999-08-10 National Starch And Chemical Investment Holding Corporation Glucoamylase converted starch derivatives and their use as emulsifying and encapsulating agents
US5955340A (en) 1984-05-29 1999-09-21 Genencor International, Inc. Modified subtilisins having amino acid alterations
WO2000032601A2 (en) 1998-11-30 2000-06-08 The Procter & Gamble Company Process for preparing cross-bridged tetraaza macrocycles
US6077316A (en) 1995-07-19 2000-06-20 Novo Nordisk A/S Treatment of fabrics
US6225464B1 (en) 1997-03-07 2001-05-01 The Procter & Gamble Company Methods of making cross-bridged macropolycycles
US6294514B1 (en) 1998-11-24 2001-09-25 The Procter & Gamble Company Process for preparing mono-long chain amine oxide surfactants with low nitrite, nitrosamine and low residual peroxide
US6306812B1 (en) 1997-03-07 2001-10-23 Procter & Gamble Company, The Bleach compositions containing metal bleach catalyst, and bleach activators and/or organic percarboxylic acids
US6312936B1 (en) 1997-10-23 2001-11-06 Genencor International, Inc. Multiply-substituted protease variants
US6326348B1 (en) 1996-04-16 2001-12-04 The Procter & Gamble Co. Detergent compositions containing selected mid-chain branched surfactants
US6376445B1 (en) 1997-08-14 2002-04-23 Procter & Gamble Company Detergent compositions comprising a mannanase and a protease
US6376450B1 (en) 1998-10-23 2002-04-23 Chanchal Kumar Ghosh Cleaning compositions containing multiply-substituted protease variants
US6440991B1 (en) 2000-10-02 2002-08-27 Wyeth Ethers of 7-desmethlrapamycin
WO2002102955A1 (en) 2001-06-18 2002-12-27 Unilever Plc Water soluble package and liquid contents thereof
US6566114B1 (en) 1998-06-10 2003-05-20 Novozymes, A/S Mannanases
US6582914B1 (en) 2000-10-26 2003-06-24 Genencor International, Inc. Method for generating a library of oligonucleotides comprising a controlled distribution of mutations
EP1321513A1 (en) * 2001-12-21 2003-06-25 Direvo Biotech AG Subtilisin variants with improved characteristics
US6602842B2 (en) 1994-06-17 2003-08-05 Genencor International, Inc. Cleaning compositions containing plant cell wall degrading enzymes and their use in cleaning methods
US6605458B1 (en) 1997-11-21 2003-08-12 Novozymes A/S Protease variants and compositions
JP2004154003A (ja) * 2002-11-01 2004-06-03 Kao Corp アルカリプロテアーゼ
JP2004313043A (ja) * 2003-04-14 2004-11-11 Kao Corp アルカリプロテアーゼ
WO2004111178A1 (en) 2003-05-23 2004-12-23 The Procter & Gamble Company Cleaning composition for use in a laundry or dishwashing machine
WO2005056782A2 (en) 2003-12-03 2005-06-23 Genencor International, Inc. Perhydrolase
WO2007044993A2 (en) 2005-10-12 2007-04-19 Genencor International, Inc. Use and production of storage-stable neutral metalloprotease
WO2007145964A2 (en) 2006-06-05 2007-12-21 The Procter & Gamble Company Enzyme stabilizer
US20080090747A1 (en) 2006-07-18 2008-04-17 Pieter Augustinus Protease variants active over a broad temperature range
EP2100947A1 (en) 2008-03-14 2009-09-16 The Procter and Gamble Company Automatic dishwashing detergent composition
WO2013063460A2 (en) 2011-10-28 2013-05-02 Danisco Us Inc. Variant maltohexaose-forming alpha-amylase variants

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE530560T1 (de) 2003-11-06 2011-11-15 Danisco Us Inc Vegf bindende und geträgerte peptide zur behandlung von hautkrankheiten
MX2010013121A (es) * 2008-06-06 2011-01-21 Danisco Inc Composiciones y metodos que comprenden proteasas microbianas variantes.

Patent Citations (108)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US202535A (en) 1878-04-16 Improvement in devices for supplying feed-water to boilers
GB1296839A (enExample) 1969-05-29 1972-11-22
GB1372034A (en) 1970-12-31 1974-10-30 Unilever Ltd Detergent compositions
US4246612A (en) 1979-02-28 1981-01-20 Barr & Stroud Limited Optical raster scanning system
US4302544A (en) 1979-10-15 1981-11-24 University Of Rochester Asporogenous mutant of B. subtilis for use as host component of HV1 system
US4435307A (en) 1980-04-30 1984-03-06 Novo Industri A/S Detergent cellulase
US4430243A (en) 1981-08-08 1984-02-07 The Procter & Gamble Company Bleach catalyst compositions and use thereof in laundry bleaching and detergent compositions
US4450235A (en) 1982-04-21 1984-05-22 Cpc International Inc. Asporogenic mutant of bacillus subtilis useful as a host in a host-vector system
US4561998A (en) 1982-05-24 1985-12-31 The Procter & Gamble Company Near-neutral pH detergents containing anionic surfactant, cosurfactant and fatty acid
US4550862A (en) 1982-11-17 1985-11-05 The Procter & Gamble Company Liquid product pouring and measuring package with self draining feature
US4597898A (en) 1982-12-23 1986-07-01 The Proctor & Gamble Company Detergent compositions containing ethoxylated amines having clay soil removal/anti-redeposition properties
US4515707A (en) 1983-06-27 1985-05-07 The Chemithon Corporation Intermediate product for use in producing a detergent bar and method for producing same
EP0134048A1 (en) 1983-07-06 1985-03-13 Gist-Brocades N.V. Molecular cloning and expression in industrial microorganism species
US4515705A (en) 1983-11-14 1985-05-07 The Procter & Gamble Company Compositions containing odor purified proteolytic enzymes and perfumes
US4537706A (en) 1984-05-14 1985-08-27 The Procter & Gamble Company Liquid detergents containing boric acid to stabilize enzymes
US5700676A (en) 1984-05-29 1997-12-23 Genencor International Inc. Modified subtilisins having amino acid alterations
US5264366A (en) 1984-05-29 1993-11-23 Genencor, Inc. Protease deficient bacillus
USRE34606E (en) 1984-05-29 1994-05-10 Genencor, Inc. Modified enzymes and methods for making same
US5955340A (en) 1984-05-29 1999-09-21 Genencor International, Inc. Modified subtilisins having amino acid alterations
US4760025A (en) 1984-05-29 1988-07-26 Genencor, Inc. Modified enzymes and methods for making same
US4683202B1 (enExample) 1985-03-28 1990-11-27 Cetus Corp
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
EP0214761A2 (en) 1985-08-07 1987-03-18 Novo Nordisk A/S An enzymatic detergent additive, a detergent, and a washing method
EP0218272A1 (en) 1985-08-09 1987-04-15 Gist-Brocades N.V. Novel lipolytic enzymes and their use in detergent compositions
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (enExample) 1986-01-30 1990-11-27 Cetus Corp
EP0238023A2 (en) 1986-03-17 1987-09-23 Novo Nordisk A/S Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
EP0258068A2 (en) 1986-08-29 1988-03-02 Novo Nordisk A/S Enzymatic detergent additive
US4810410A (en) 1986-12-13 1989-03-07 Interox Chemicals Limited Bleach activation
US4972017A (en) 1987-03-24 1990-11-20 The Clorox Company Rinse soluble polymer film composition for wash additives
US4765916A (en) 1987-03-24 1988-08-23 The Clorox Company Polymer film composition for rinse release of wash additives
WO1988009367A1 (en) 1987-05-29 1988-12-01 Genencor, Inc. Cutinase cleaning composition
EP0305216A1 (en) 1987-08-28 1989-03-01 Novo Nordisk A/S Recombinant Humicola lipase and process for the production of recombinant humicola lipases
JPS6474992A (en) 1987-09-16 1989-03-20 Fuji Oil Co Ltd Dna sequence, plasmid and production of lipase
WO1989006270A1 (en) 1988-01-07 1989-07-13 Novo-Nordisk A/S Enzymatic detergent
EP0331376A2 (en) 1988-02-28 1989-09-06 Amano Pharmaceutical Co., Ltd. Recombinant DNA, bacterium of the genus pseudomonas containing it, and process for preparing lipase by using it
US4977252A (en) 1988-03-11 1990-12-11 National Starch And Chemical Investment Holding Corporation Modified starch emulsifier characterized by shelf stability
US4968451A (en) 1988-08-26 1990-11-06 The Procter & Gamble Company Soil release agents having allyl-derived sulfonated end caps
WO1990009446A1 (en) 1989-02-17 1990-08-23 Plant Genetic Systems N.V. Cutinase
WO1991016422A1 (de) 1990-04-14 1991-10-31 Kali-Chemie Aktiengesellschaft Alkalische bacillus-lipasen, hierfür codierende dna-sequenzen sowie bacilli, die diese lipasen produzieren
US5354559A (en) 1990-05-29 1994-10-11 Grain Processing Corporation Encapsulation with starch hydrolyzate acid esters
EP0495257A1 (en) 1991-01-16 1992-07-22 The Procter & Gamble Company Compact detergent compositions with high activity cellulase
US5227084A (en) 1991-04-17 1993-07-13 Lever Brothers Company, Division Of Conopco, Inc. Concentrated detergent powder compositions
US5340735A (en) 1991-05-29 1994-08-23 Cognis, Inc. Bacillus lentus alkaline protease variants with increased stability
US5500364A (en) 1991-05-29 1996-03-19 Cognis, Inc. Bacillus lentus alkaline protease varints with enhanced stability
WO1992021760A1 (en) 1991-05-29 1992-12-10 Cognis, Inc. Mutant proteolytic enzymes from bacillus
WO1994006915A1 (en) * 1992-09-24 1994-03-31 Genencor International, Inc. Cleaning compositions containing novel alkaline proteases
WO1994012621A1 (en) 1992-12-01 1994-06-09 Novo Nordisk Enhancement of enzyme reactions
US5646101A (en) 1993-01-18 1997-07-08 The Procter & Gamble Company Machine dishwashing detergents containing an oxygen bleach and an anti-tarnishing mixture of a paraffin oil and sequestrant
WO1994026859A1 (de) 1993-05-08 1994-11-24 Henkel Kommanditgesellschaft Auf Aktien Silberkorrosionsschutzmittel i
WO1994026860A1 (de) 1993-05-08 1994-11-24 Henkel Kommanditgesellschaft Auf Aktien Silberkorrosionsschutzmittel ii
WO1995001426A1 (en) 1993-06-29 1995-01-12 Novo Nordisk A/S Enhancement of laccase reactions
US5698504A (en) 1993-07-01 1997-12-16 The Procter & Gamble Company Machine dishwashing composition containing oxygen bleach and paraffin oil and benzotriazole compound silver tarnishing inhibitors
US5486303A (en) 1993-08-27 1996-01-23 The Procter & Gamble Company Process for making high density detergent agglomerates using an anhydrous powder additive
EP0922499A2 (de) 1993-12-15 1999-06-16 Ing. Erich Pfeiffer GmbH Austragvorrichtung für Medien
US5874276A (en) 1993-12-17 1999-02-23 Genencor International, Inc. Cellulase enzymes and systems for their expressions
WO1995023221A1 (en) 1994-02-24 1995-08-31 Cognis, Inc. Improved enzymes and detergents containing them
US5801039A (en) 1994-02-24 1998-09-01 Cognis Gesellschaft Fuer Bio Und Umwelttechnologie Mbh Enzymes for detergents
US5686014A (en) 1994-04-07 1997-11-11 The Procter & Gamble Company Bleach compositions comprising manganese-containing bleach catalysts
US5565145A (en) 1994-05-25 1996-10-15 The Procter & Gamble Company Compositions comprising ethoxylated/propoxylated polyalkyleneamine polymers as soil dispersing agents
US6602842B2 (en) 1994-06-17 2003-08-05 Genencor International, Inc. Cleaning compositions containing plant cell wall degrading enzymes and their use in cleaning methods
US5695679A (en) 1994-07-07 1997-12-09 The Procter & Gamble Company Detergent compositions containing an organic silver coating agent to minimize silver training in ADW washing methods
US5879584A (en) 1994-09-10 1999-03-09 The Procter & Gamble Company Process for manufacturing aqueous compositions comprising peracids
US5516448A (en) 1994-09-20 1996-05-14 The Procter & Gamble Company Process for making a high density detergent composition which includes selected recycle streams for improved agglomerate
US5489392A (en) 1994-09-20 1996-02-06 The Procter & Gamble Company Process for making a high density detergent composition in a single mixer/densifier with selected recycle streams for improved agglomerate properties
US5691297A (en) 1994-09-20 1997-11-25 The Procter & Gamble Company Process for making a high density detergent composition by controlling agglomeration within a dispersion index
US5710115A (en) 1994-12-09 1998-01-20 The Procter & Gamble Company Automatic dishwashing composition containing particles of diacyl peroxides
US5855625A (en) 1995-01-17 1999-01-05 Henkel Kommanditgesellschaft Auf Aktien Detergent compositions
US5595967A (en) 1995-02-03 1997-01-21 The Procter & Gamble Company Detergent compositions comprising multiperacid-forming bleach activators
US5574005A (en) 1995-03-07 1996-11-12 The Procter & Gamble Company Process for producing detergent agglomerates from high active surfactant pastes having non-linear viscoelastic properties
US5569645A (en) 1995-04-24 1996-10-29 The Procter & Gamble Company Low dosage detergent composition containing optimum proportions of agglomerates and spray dried granules for improved flow properties
US5705464A (en) 1995-06-16 1998-01-06 The Procter & Gamble Company Automatic dishwashing compositions comprising cobalt catalysts
US5597936A (en) 1995-06-16 1997-01-28 The Procter & Gamble Company Method for manufacturing cobalt catalysts
US5565422A (en) 1995-06-23 1996-10-15 The Procter & Gamble Company Process for preparing a free-flowing particulate detergent composition having improved solubility
US6077316A (en) 1995-07-19 2000-06-20 Novo Nordisk A/S Treatment of fabrics
US5576282A (en) 1995-09-11 1996-11-19 The Procter & Gamble Company Color-safe bleach boosters, compositions and laundry methods employing same
WO1997011151A1 (en) 1995-09-18 1997-03-27 The Procter & Gamble Company Delivery systems
US6326348B1 (en) 1996-04-16 2001-12-04 The Procter & Gamble Co. Detergent compositions containing selected mid-chain branched surfactants
US5929022A (en) 1996-08-01 1999-07-27 The Procter & Gamble Company Detergent compositions containing amine and specially selected perfumes
US6306812B1 (en) 1997-03-07 2001-10-23 Procter & Gamble Company, The Bleach compositions containing metal bleach catalyst, and bleach activators and/or organic percarboxylic acids
US6225464B1 (en) 1997-03-07 2001-05-01 The Procter & Gamble Company Methods of making cross-bridged macropolycycles
WO1999006521A1 (en) 1997-08-02 1999-02-11 The Procter & Gamble Company Detergent tablet
US6376445B1 (en) 1997-08-14 2002-04-23 Procter & Gamble Company Detergent compositions comprising a mannanase and a protease
US6482628B1 (en) 1997-10-23 2002-11-19 Genencor International, Inc. Multiply-substituted protease variants
US6312936B1 (en) 1997-10-23 2001-11-06 Genencor International, Inc. Multiply-substituted protease variants
US5935826A (en) 1997-10-31 1999-08-10 National Starch And Chemical Investment Holding Corporation Glucoamylase converted starch derivatives and their use as emulsifying and encapsulating agents
US6605458B1 (en) 1997-11-21 2003-08-12 Novozymes A/S Protease variants and compositions
WO1999034011A2 (en) 1997-12-24 1999-07-08 Genencor International, Inc. Method of assaying for a preferred enzyme and/or detergent
US6566114B1 (en) 1998-06-10 2003-05-20 Novozymes, A/S Mannanases
US6376450B1 (en) 1998-10-23 2002-04-23 Chanchal Kumar Ghosh Cleaning compositions containing multiply-substituted protease variants
US6294514B1 (en) 1998-11-24 2001-09-25 The Procter & Gamble Company Process for preparing mono-long chain amine oxide surfactants with low nitrite, nitrosamine and low residual peroxide
WO2000032601A2 (en) 1998-11-30 2000-06-08 The Procter & Gamble Company Process for preparing cross-bridged tetraaza macrocycles
US6610642B2 (en) 2000-04-20 2003-08-26 The Procter And Gamble Company Cleaning compositions containing multiply-substituted protease variants
US6440991B1 (en) 2000-10-02 2002-08-27 Wyeth Ethers of 7-desmethlrapamycin
US6582914B1 (en) 2000-10-26 2003-06-24 Genencor International, Inc. Method for generating a library of oligonucleotides comprising a controlled distribution of mutations
WO2002102955A1 (en) 2001-06-18 2002-12-27 Unilever Plc Water soluble package and liquid contents thereof
EP1321513A1 (en) * 2001-12-21 2003-06-25 Direvo Biotech AG Subtilisin variants with improved characteristics
JP2004154003A (ja) * 2002-11-01 2004-06-03 Kao Corp アルカリプロテアーゼ
JP2004313043A (ja) * 2003-04-14 2004-11-11 Kao Corp アルカリプロテアーゼ
WO2004111178A1 (en) 2003-05-23 2004-12-23 The Procter & Gamble Company Cleaning composition for use in a laundry or dishwashing machine
WO2005056782A2 (en) 2003-12-03 2005-06-23 Genencor International, Inc. Perhydrolase
WO2007044993A2 (en) 2005-10-12 2007-04-19 Genencor International, Inc. Use and production of storage-stable neutral metalloprotease
WO2007145964A2 (en) 2006-06-05 2007-12-21 The Procter & Gamble Company Enzyme stabilizer
US20080090747A1 (en) 2006-07-18 2008-04-17 Pieter Augustinus Protease variants active over a broad temperature range
EP2100947A1 (en) 2008-03-14 2009-09-16 The Procter and Gamble Company Automatic dishwashing detergent composition
EP2100949A1 (en) 2008-03-14 2009-09-16 The Procter and Gamble Company Automatic dishwashing detergent composition
WO2013063460A2 (en) 2011-10-28 2013-05-02 Danisco Us Inc. Variant maltohexaose-forming alpha-amylase variants

Non-Patent Citations (66)

* Cited by examiner, † Cited by third party
Title
"Molecular Biological Methods for Bacillus", 1990, JOHN WILEY & SONS
ALTSCHUL ET AL., NUCLEIC ACIDS RES, vol. 25, 1997, pages 3389 - 402
ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, no. 17, 1997, pages 3389 - 3402
ALTSCHUL, J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ARIGONI ET AL., MOL. MICROBIOL., vol. 31, 1999, pages 1407 - 1415
B. SCHMIDT ET AL., APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 61, 1995, pages 4490 - 4493
BEAUCAGE ET AL., TETRAHEDRON LETTERS, vol. 22, 1981, pages 1859 - 69
CALDWELL ET AL., J. BACTERIOL., vol. 183, 2001, pages 7329 - 7340
CHANG ET AL., MOL. GEN. GENET., vol. 168, 1979, pages 11 - 115
CHRISTIANSON ET AL., ANAL. BIOCHEM., vol. 223, 1994, pages 119 - 129
CONTENTE ET AL., PLASMID, vol. 2, 1979, pages 555 - 571
DARTOIS ET AL., BIOCHEM. BIOPHYS. ACTA, vol. 1131, 1993, pages 253 - 260
DATABASE Geneseq [online] 26 August 2004 (2004-08-26), "Bacillus sp. KSM-LD1 alkaline protease mature protein.", XP002734385, retrieved from EBI accession no. GSP:ADP70361 Database accession no. ADP70361 *
DATABASE Geneseq [online] 27 January 2005 (2005-01-27), "Novel Bacillus KS alkaline protease protein sequence SeqID2.", XP002734384, retrieved from EBI accession no. GSP:ADU05756 Database accession no. ADU05756 *
DEL MAR, ANAL. BIOCHEM., vol. 99, 1979, pages 316 - 320
DEVEREUX ET AL., NUCL. ACID RES., vol. 12, 1984, pages 387 - 395
EMANUELSSON ET AL., NATURE PROTOCOLS, vol. 2, 2007, pages 953 - 971
FAHNESTOCK; FISCHER, J. BACTERIOL., vol. 165, 1986, pages 796 - 804
FENG; DOOLITTLE, J. MOL. EVOL., vol. 35, 1987, pages 351 - 360
FERRARI ET AL.: "Bacillus", 1989, PLENUM PUBLISHING CORP., article "Genetics", pages: 57 - 72
FERRARI ET AL.: "Genetics", 1989, PLENUM PUBLISHING CORP., pages: 57 - 72
FISHER ET AL., ARCH. MICROBIOL., vol. 139, 1981, pages 213 - 217
HAIMA ET AL., MOL. GEN. GENET., vol. 223, pages 185 - 191
HAN-SEUNG JOO ET AL: "Purification and Characterization of a Novel Alkaline Protease from Bacillus horikoshii", JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY, vol. 22, no. 1, 28 January 2012 (2012-01-28), pages 58 - 68, XP055161644, ISSN: 1017-7825, DOI: 10.4014/jmb.1109.09006 *
HASS ET AL., GENE, vol. 109, 1991, pages 117 - 113
HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 10915
HIGGINS; SHARP, CABIOS, vol. 5, 1989, pages 151 - 153
HOCH ET AL., GENETICS, vol. 73, 1973, pages 215 - 228
HOCH ET AL., J. BACTERIOL., vol. 93, 1967, pages 1925 - 1937
HOLUBOVA, FOLIA MICROBIOL., vol. 30, 1985, pages 97
HSIA ET AL., BIOCHEM., vol. 242, 1999, pages 221 - 227
ITAKURA ET AL., ANN. REV. BIOCHEM., vol. 53, 1984, pages 323
ITAKURA ET AL., SCIENCE, vol. 198, 1984, pages 1056
KALISZ: "Advances in Biochemical Engineering/Biotechnology", 1988, article "Microbial Proteinases"
KROLL ET AL., DNA CELL BIOL., vol. 12, 1993, pages 441 - 53
KUGIMIYA ET AL., BIOSCI. BIOTECH. BIOCHEM., vol. 56, 1992, pages 716 - 719
MADDOX ET AL., J. EXP. MED., vol. 158, 1983, pages 1211
MANN ET AL., CURRENT MICROBIOL., vol. 13, 1986, pages 131 - 135
MATTHES ET AL., EMBO J., vol. 3, 1984, pages 801 - 805
MCDONALD, J., GEN. MICROBIOL., vol. 130, 1984, pages 203
MSADEK ET AL., J. BACTERIOL., vol. 172, 1990, pages 824 - 834
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
OLMOS ET AL., MOL. GEN. GENET., vol. 253, 1997, pages 562 - 567
PALMEROS ET AL., GENE, vol. 247, 2000, pages 255 - 264
PALVA ET AL., GENE, vol. 19, 1982, pages 81 - 87
PEARSON; LIPMAN, PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
PEREGO ET AL., MOL. MICROBIOL., vol. 5, 1991, pages 173 - 185
PEREGO ET AL.: "Bacillus subtilis and Other Gram-Positive Bacteria: Biochemistry, Physiology and Molecular Genetics", 1993, AMERICAN SOCIETY FOR MICROBIOLOGY, article "Integrational Vectors for Genetic Manipulations in Bacillus subtilis", pages: 615 - 624
PORATH, PROTEIN EXPR. PURIF., vol. 3, 1992, pages 263 - 281
SAITOU, N.; NEI, M., MOLBIOL. EVOL., vol. 4, 1987, pages 406 - 425
SAITOU, N.; NEI, M.: "The neighbor-joining method: a new method for reconstructing Guide Trees", MOL BIOL EVOL, vol. 4, 1987, pages 406 - 425, XP001154601
SAUNDERS, J. BACTERIOL., vol. 157, 1984, pages 718 - 726
SCHIMADA ET AL., J. BIOCHEM., vol. 106, 1989, pages 383 - 388
SMITH ET AL., APPL. ENV. MICROBIOL., vol. 51, 1986, pages 634
SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482
STAHL ET AL., J. BACTERIOL., vol. 158, 1984, pages 411 - 418
THOMPSON ET AL., NUCLEIC ACIDS RESEARCH, vol. 22, 1994, pages 4673 - 4680
VOROBJEVA ET AL., FEMS MICROBIOL. LETT., vol. 7, 1980, pages 261 - 263
WANG ET AL., GENE, vol. 69, 1988, pages 39 - 47
WARD: "Microbial Enzymes and Biotechnology", 1983, APPLIED SCIENCE, article "Proteinases", pages: 251 - 317
WEINRAUCH ET AL., J. BACTERIOL., vol. 154, 1983, pages 1077 - 1087
WEINRAUCH ET AL., J. BACTERIOL., vol. 169, 1987, pages 1205 - 1211
WELLS ET AL., NUCLEIC ACIDS RES., vol. 11, 1983, pages 7911 - 25
WELLS ET AL., NUCLEIC ACIDS RES., vol. 11, 1983, pages 7911 - 7925
YAMAGUCHI ET AL., GENE, vol. 103, 1991, pages 61 - 67
YASUSHI TAKIMURA ET AL: "Alkaliphilic Bacillus sp. strain KSM-LD1 contains a record number of subtilisin-like serine proteases genes", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, SPRINGER, BERLIN, DE, vol. 76, no. 2, 15 June 2007 (2007-06-15), pages 395 - 405, XP019538683, ISSN: 1432-0614, DOI: 10.1007/S00253-007-1022-9 *

Cited By (70)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3611259A1 (en) 2015-03-12 2020-02-19 Danisco US Inc. Compositions and methods comprising lg12-clade protease variants
WO2016145428A1 (en) 2015-03-12 2016-09-15 Danisco Us Inc Compositions and methods comprising lg12-clade protease variants
EP4219704A2 (en) 2015-05-13 2023-08-02 Danisco US Inc Aprl-clade protease variants and uses thereof
EP3872174A1 (en) 2015-05-13 2021-09-01 Danisco US Inc. Aprl-clade protease variants and uses thereof
JP2018524970A (ja) * 2015-05-13 2018-09-06 ダニスコ・ユーエス・インク AprL−CLADEプロテアーゼ変異体及びその使用
JP7274819B2 (ja) 2015-05-13 2023-05-17 ダニスコ・ユーエス・インク AprL-CLADEプロテアーゼ変異体及びその使用
CN107922934A (zh) * 2015-06-17 2018-04-17 丹尼斯科美国公司 具有经修饰的前肽区域的蛋白酶
EP4234693A2 (en) 2015-06-17 2023-08-30 Danisco US Inc Bacillus gibsonii-clade serine proteases
WO2016205755A1 (en) 2015-06-17 2016-12-22 Danisco Us Inc. Bacillus gibsonii-clade serine proteases
WO2016205710A1 (en) * 2015-06-17 2016-12-22 Danisco Us Inc. Proteases with modified propeptide regions
EP4141113A1 (en) 2015-11-05 2023-03-01 Danisco US Inc Paenibacillus sp. mannanases
EP4483721A2 (en) 2015-11-05 2025-01-01 Danisco US Inc. Paenibacillus and bacillus spp. mannanases
WO2017079756A1 (en) 2015-11-05 2017-05-11 Danisco Us Inc Paenibacillus and bacillus spp. mannanases
WO2017079751A1 (en) 2015-11-05 2017-05-11 Danisco Us Inc Paenibacillus sp. mannanases
WO2017106676A1 (en) 2015-12-18 2017-06-22 Danisco Us Inc Polypeptides with endoglucanase activity and uses thereof
WO2017192692A1 (en) 2016-05-03 2017-11-09 Danisco Us Inc Protease variants and uses thereof
US20190136218A1 (en) * 2016-05-05 2019-05-09 Danisco Us Inc Protease variants and uses thereof
WO2017192300A1 (en) 2016-05-05 2017-11-09 Danisco Us Inc Protease variants and uses thereof
CN109072213A (zh) * 2016-05-05 2018-12-21 丹尼斯科美国公司 蛋白酶变体及其用途
EP3845642A1 (en) 2016-05-05 2021-07-07 Danisco US Inc. Protease variants and uses thereof
WO2017210295A1 (en) 2016-05-31 2017-12-07 Danisco Us Inc. Protease variants and uses thereof
EP4527923A2 (en) 2016-06-17 2025-03-26 Danisco US Inc Protease variants and uses thereof
EP4151726A1 (en) 2016-06-17 2023-03-22 Danisco US Inc Protease variants and uses thereof
WO2017219011A1 (en) 2016-06-17 2017-12-21 Danisco Us Inc Protease variants and uses thereof
WO2018022271A1 (en) * 2016-07-28 2018-02-01 The Procter & Gamble Company Process for reblending a first liquid detergent composition into a second liquid detergent composition
EP3275990A1 (en) * 2016-07-28 2018-01-31 The Procter and Gamble Company Process for reblending a first liquid detergent composition into a second liquid detergent composition
US10323219B2 (en) 2016-07-28 2019-06-18 The Procter & Gamble Company Process for reblending a first liquid detergent composition into a second liquid detergent composition
WO2018085524A2 (en) 2016-11-07 2018-05-11 Danisco Us Inc Laundry detergent composition
WO2018112123A1 (en) 2016-12-15 2018-06-21 Danisco Us Inc. Polypeptides with endoglucanase activity and uses thereof
EP4520820A2 (en) 2016-12-21 2025-03-12 Danisco Us Inc Protease variants and uses thereof
WO2018118917A1 (en) 2016-12-21 2018-06-28 Danisco Us Inc. Protease variants and uses thereof
EP4212622A2 (en) 2016-12-21 2023-07-19 Danisco US Inc. Bacillus gibsonii-clade serine proteases
EP4424805A2 (en) 2016-12-21 2024-09-04 Danisco Us Inc Bacillus gibsonii-clade serine proteases
WO2018118950A1 (en) 2016-12-21 2018-06-28 Danisco Us Inc. Bacillus gibsonii-clade serine proteases
WO2018169750A1 (en) 2017-03-15 2018-09-20 Danisco Us Inc Trypsin-like serine proteases and uses thereof
WO2018184004A1 (en) 2017-03-31 2018-10-04 Danisco Us Inc Alpha-amylase combinatorial variants
WO2019036721A2 (en) 2017-08-18 2019-02-21 Danisco Us Inc VARIANTS OF ALPHA-AMYLASES
WO2019108599A1 (en) 2017-11-29 2019-06-06 Danisco Us Inc Subtilisin variants having improved stability
WO2019245705A1 (en) 2018-06-19 2019-12-26 Danisco Us Inc Subtilisin variants
WO2019245704A1 (en) 2018-06-19 2019-12-26 Danisco Us Inc Subtilisin variants
WO2020028443A1 (en) 2018-07-31 2020-02-06 Danisco Us Inc Variant alpha-amylases having amino acid substitutions that lower the pka of the general acid
WO2020068486A1 (en) 2018-09-27 2020-04-02 Danisco Us Inc Compositions for medical instrument cleaning
WO2020077331A2 (en) 2018-10-12 2020-04-16 Danisco Us Inc Alpha-amylases with mutations that improve stability in the presence of chelants
WO2020112599A1 (en) 2018-11-28 2020-06-04 Danisco Us Inc Subtilisin variants having improved stability
WO2020242858A1 (en) 2019-05-24 2020-12-03 Danisco Us Inc Subtilisin variants and methods of use
WO2020247582A1 (en) 2019-06-06 2020-12-10 Danisco Us Inc Methods and compositions for cleaning
WO2021080948A2 (en) 2019-10-24 2021-04-29 Danisco Us Inc Variant maltopentaose/maltohexaose-forming alpha-amylases
WO2022047149A1 (en) 2020-08-27 2022-03-03 Danisco Us Inc Enzymes and enzyme compositions for cleaning
WO2022165107A1 (en) 2021-01-29 2022-08-04 Danisco Us Inc Compositions for cleaning and methods related thereto
WO2023278297A1 (en) 2021-06-30 2023-01-05 Danisco Us Inc Variant lipases and uses thereof
WO2023034486A2 (en) 2021-09-03 2023-03-09 Danisco Us Inc. Laundry compositions for cleaning
WO2023114932A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Subtilisin variants and methods of use
WO2023114936A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Subtilisin variants and methods of use
WO2023114939A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Subtilisin variants and methods of use
WO2023114988A2 (en) 2021-12-16 2023-06-22 Danisco Us Inc. Variant maltopentaose/maltohexaose-forming alpha-amylases
WO2023168234A1 (en) 2022-03-01 2023-09-07 Danisco Us Inc. Enzymes and enzyme compositions for cleaning
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections
WO2023250301A1 (en) 2022-06-21 2023-12-28 Danisco Us Inc. Methods and compositions for cleaning comprising a polypeptide having thermolysin activity
WO2024050339A1 (en) 2022-09-02 2024-03-07 Danisco Us Inc. Mannanase variants and methods of use
WO2024050346A1 (en) 2022-09-02 2024-03-07 Danisco Us Inc. Detergent compositions and methods related thereto
WO2024050343A1 (en) 2022-09-02 2024-03-07 Danisco Us Inc. Subtilisin variants and methods related thereto
WO2024102698A1 (en) 2022-11-09 2024-05-16 Danisco Us Inc. Subtilisin variants and methods of use
DE102022213537A1 (de) 2022-12-13 2024-06-13 Henkel Ag & Co. Kgaa Wasch- und reinigungsmittel enthaltend protease
WO2024125930A1 (de) * 2022-12-13 2024-06-20 Henkel Ag & Co. Kgaa Wasch- und reinigungsmittel enthaltend protease
DE102022213538A1 (de) 2022-12-13 2024-06-13 Henkel Ag & Co. Kgaa Wasch- und reinigungsmittel enthaltend protease
WO2024163584A1 (en) 2023-02-01 2024-08-08 Danisco Us Inc. Subtilisin variants and methods of use
WO2024186819A1 (en) 2023-03-06 2024-09-12 Danisco Us Inc. Subtilisin variants and methods of use
WO2024191711A1 (en) 2023-03-16 2024-09-19 Nutrition & Biosciences USA 4, Inc. Brevibacillus fermentate extracts for cleaning and malodor control and use thereof
WO2025071996A1 (en) 2023-09-28 2025-04-03 Danisco Us Inc. Variant cutinase enzymes with improved solubility and uses thereof
WO2025085351A1 (en) 2023-10-20 2025-04-24 Danisco Us Inc. Subtilisin variants and methods of use

Also Published As

Publication number Publication date
US20160222368A1 (en) 2016-08-04
CN105593365A (zh) 2016-05-18
CN105593365B (zh) 2021-08-27
JP6678108B2 (ja) 2020-04-08
EP3044313A1 (en) 2016-07-20
EP3044313B1 (en) 2019-11-06
EP3653707A1 (en) 2020-05-20
DK3044313T3 (da) 2020-02-17
JP2016537011A (ja) 2016-12-01
EP3653707B1 (en) 2025-07-16
BR112016005286A2 (pt) 2017-09-12

Similar Documents

Publication Publication Date Title
US12305205B2 (en) AprL-clade protease variants and uses thereof
EP3044313B1 (en) Compositions and methods comprising lg12-clade protease variants
EP3268471B1 (en) Compositions and methods comprising lg12-clade protease variants
US10696958B2 (en) Metalloproteases
US20200407703A1 (en) Serine proteases of bacillus species
US20190264187A1 (en) Novel metalloproteases
EP3882346B1 (en) Novel metalloproteases

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14784386

Country of ref document: EP

Kind code of ref document: A1

REEP Request for entry into the european phase

Ref document number: 2014784386

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014784386

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016542111

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15021681

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016005286

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112016005286

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20160310