WO2015038792A1 - Compositions and methods comprising lg12-clade protease variants - Google Patents
Compositions and methods comprising lg12-clade protease variants Download PDFInfo
- Publication number
- WO2015038792A1 WO2015038792A1 PCT/US2014/055223 US2014055223W WO2015038792A1 WO 2015038792 A1 WO2015038792 A1 WO 2015038792A1 US 2014055223 W US2014055223 W US 2014055223W WO 2015038792 A1 WO2015038792 A1 WO 2015038792A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- clade
- cleaning
- enzyme
- amino acid
- variant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
- C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/189—Enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- C—CHEMISTRY; METALLURGY
- C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
- C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
- C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
- C11D3/16—Organic compounds
- C11D3/38—Products with no well-defined composition, e.g. natural products
- C11D3/386—Preparations containing enzymes, e.g. protease or amylase
-
- C—CHEMISTRY; METALLURGY
- C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
- C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
- C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
- C11D3/16—Organic compounds
- C11D3/38—Products with no well-defined composition, e.g. natural products
- C11D3/386—Preparations containing enzymes, e.g. protease or amylase
- C11D3/38681—Chemically modified or immobilised enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
-
- C—CHEMISTRY; METALLURGY
- C14—SKINS; HIDES; PELTS; LEATHER
- C14C—CHEMICAL TREATMENT OF HIDES, SKINS OR LEATHER, e.g. TANNING, IMPREGNATING, FINISHING; APPARATUS THEREFOR; COMPOSITIONS FOR TANNING
- C14C1/00—Chemical treatment prior to tanning
- C14C1/06—Facilitating unhairing, e.g. by painting, by liming
- C14C1/065—Enzymatic unhairing
-
- D—TEXTILES; PAPER
- D06—TREATMENT OF TEXTILES OR THE LIKE; LAUNDERING; FLEXIBLE MATERIALS NOT OTHERWISE PROVIDED FOR
- D06M—TREATMENT, NOT PROVIDED FOR ELSEWHERE IN CLASS D06, OF FIBRES, THREADS, YARNS, FABRICS, FEATHERS OR FIBROUS GOODS MADE FROM SUCH MATERIALS
- D06M16/00—Biochemical treatment of fibres, threads, yarns, fabrics, or fibrous goods made from such materials, e.g. enzymatic
- D06M16/003—Biochemical treatment of fibres, threads, yarns, fabrics, or fibrous goods made from such materials, e.g. enzymatic with enzymes or microorganisms
-
- D—TEXTILES; PAPER
- D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
- D21C—PRODUCTION OF CELLULOSE BY REMOVING NON-CELLULOSE SUBSTANCES FROM CELLULOSE-CONTAINING MATERIALS; REGENERATION OF PULPING LIQUORS; APPARATUS THEREFOR
- D21C9/00—After-treatment of cellulose pulp, e.g. of wood pulp, or cotton linters ; Treatment of dilute or dewatered pulp or process improvement taking place after obtaining the raw cellulosic material and not provided for elsewhere
- D21C9/10—Bleaching ; Apparatus therefor
- D21C9/1063—Bleaching ; Apparatus therefor with compounds not otherwise provided for, e.g. activated gases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21062—Subtilisin (3.4.21.62)
Definitions
- Serine proteases are a class of enzymes that cleave peptide bonds in proteins.
- the serine proteases contain a nucleophilic serine residue at the active site.
- Subtilisins are a large family of serine proteases, and although they have long been known in the art of industrial enzymes, there remains a need for engineered proteases that are suitable for particular conditions and uses.
- FIG. 11 provides a region of the homology model of the structure of LG12 sprC protease based on the structure of subtilisin from B. licheniformis.
- the side chains of Tyr 86, Asn 87, Thr 22 and His 17 are shown as stick figures.
- polynucleotide and “nucleic acid,” which are used interchangeably herein, refer to a polymer of any length of nucleotide monomers covalently bonded in a chain.
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- polynucleotides or nucleic acids having distinct biological function are examples of polynucleotides or nucleic acids having distinct biological function.
- Polynucleotides or nucleic acids include, but are not limited to, a single-, double- or triple-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically, biochemically modified, non-natural or derivatized nucleotide bases.
- the following are non-limiting examples of polynucleotides: genes, gene fragments, chromosomal fragments, expressed sequence tag(s) (EST(s)), exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), ribozymes, complementary DNA (cDNA), recombinant
- mutation refers to changes made in a starting amino acid or nucleic acid sequence. It is intended that the term encompass substitutions, insertions and deletions.
- vector refers to a nucleic acid construct or polynucleotide construct used to introduce or transfer nucleic acid(s) or polynucleotide(s) into a target cell or tissue.
- a vector is typically used to introduce foreign DNA into another cell or tissue.
- a vector generally comprises a DNA sequence that is a transgene and a larger polynucleotide sequence that serves as the "backbone" of the vector.
- the vector typically serves to transfers genetic information, such as the inserted transgene, to a target cell or tissue so as to isolate, multiply, or express the insert in the target cell or tissue.
- DNA construct may be used, for example, to: 1) insert heterologous sequences into a desired target sequence of a host cell; and/or 2) mutagenize a region of the host cell chromosome (i.e., replace an endogenous sequence with a heterologous sequence); 3) delete target genes; and/or 4) introduce a replicating plasmid into the host.
- DNA construct is used interchangeably herein with "expression cassette.”
- nucleic acid or gene "amplification” refers to a process by which specific DNA sequences are disproportionately replicated such that the amplified nucleic acid or gene becomes present in a higher copy number than was initially present in the genome.
- Nomenclature is used through out this disclosure.
- the single letter X refers to any of the twenty amino acids. It is also understood that a polypeptide may be coded for by more than one nucleotide sequence due to the degeneracy of the genetic code. Mutations are named by the one letter code for the parent amino acid, followed by a three or two digit position number and then the one letter code for the variant amino acid. For example, mutating glycine (G) at position 87 to serine (S) is represented as "G087S" or "G87S”. Multiple mutations are indicated by inserting a "-" between the mutations.
- homology refers to sequence similarity or identity, with identity being preferred. Homology may be determined using standard techniques known in the art (See e.g., Smith and Waterman, Adv. Appl. Math. 2:482 [1981]; Needleman and Wunsch, J. Mol. Biol. 48:443 [1970];
- PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pair-wise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng and Doolittle (See, Feng and Doolittle, J. Mol. Evol.
- Optimal alignment refers to the alignment of two (or more) sequences giving the highest percent identity score.
- optimal alignment of two protein sequences can be achieved by manually aligning the sequences such that the maximum number of identical amino acid residues in each sequence are aligned together or by using software programs or procedures described herein or known in the art.
- Optimal alignment of two nucleic acid sequences can be achieved by manually aligning the sequences such that the maximum number of identical nucleotide residues in each sequence are aligned together or by using software programs or procedures described herein or known in the art.
- the invention provides methods of enriching compositions for one or more molecules of the invention, such as one or more polypeptides or polynucleotides of the invention.
- a composition is enriched for a molecule when there is a substantial increase in the concentration of the molecule after application of a purification or enrichment technique.
- target property refers to the property of the starting gene that is to be altered. It is not intended that the present invention be limited to any particular target property.
- Cleaning performance can be determined by comparing the variant proteases of the present invention with reference proteases in various cleaning assays concerning enzyme sensitive stains such as grass, blood, ink, oil, and/or milk as determined by usual spectrophotometric or analytical methodologies after standard wash cycle conditions.
- a given amino acid sequence such as a variant protease amino acid sequence described herein, can be aligned with the LG12 sprC sequence (SEQ ID NO:3) using an alignment algorithm as described herein, and an amino acid residue in the given amino acid sequence that aligns (preferably optimally aligns) with an amino acid residue in the LG12 sprC sequence can be conveniently numbered by reference to the corresponding amino acid residue in the LG12 sprC sequence.
- the LG12 enzyme clade comprises subtilisin proteases where the parent, wildtype and/or variant sequence contains one or more of the following amino acid motifs: a catalytic triad comprising Ser221, His64, and Asp32; a Pro, Asp/Asn, Ala, Leu motif from positions 55-58; a Thrl03- Leul04 motif; a Tyr86-Asn/Asp87 motif; an Alal6-Hisl7 motif; a Val21-Thr22 motif, and/or a motif at the C-terminus, starting at position 267: Val,Ile,Asp/Asn,Val/Leu,Glu,X,Ala,Leu,Gln, where the X represents any amino acid, and where the residue numbers correspond to LG12 sprC (SEQ ID NO:3).
- a catalytic triad comprising Ser221, His64, and Asp32
- Pro Asp/Asn
- Ala Leu motif from positions 55-58
- Productive positions are described as those positions within a molecule that are most useful for making combinatorial variants exhibiting an improved characteristic, where the position itself allows for at least one combinable mutation.
- Combinable mutations can be described as those substitutions in a molecule that can be used to make combinatorial variants.
- Combinable mutations are ones that improve at least one desired property of the molecule, while not significantly decreasing either: expression, activity, or stability.
- Activity Combinable mutations are ones that improve at least one activity property of the molecule, with a performance index greater than or equal to 1.5, while not decreasing either expression or stability PI values below 0.5. These Activity Combinable mutations can be used to modify the molecule in order to achieve a desired property without significantly decreasing other known and desired properties of the molecule (e.g. expression or stability).
- LG12-clade enzymes of the present invention having a beneficial mutation in ADW stability and ADW performance comprise substitutions from the group selected from: A001G, A001K, A001R, Q002F, Q002K, Q002P, Q002R, Q002S, Q002W, T003G, T003I, T003V, T003Y, G007N, P009A, P009G, P009H, P009I, P009M, P009Q, P009R, P009S, P009T, P009V, A018N, A019M, T022E, S024H, S024R, S024T, S024V, G025A, V026N, K027P, K027R, K027S, K027T, A029S, I030V, N038A, N038Q, N038T, A040
- the variant LG12-clade enzyme polypeptides of the invention have enzymatic activities (e.g., proteolytic activities) and thus are useful in cleaning applications, including but not limited to, methods for cleaning dishware items, tableware items, fabrics, and items having hard surfaces (e.g., the hard surface of a table, table top, wall, furniture item, floor, ceiling, etc.).
- enzymatic activity e.g., LG12-clade enzyme activity
- a variant LG12-clade enzyme polypeptide of the invention can be determined readily using procedures well known to those of ordinary skill in the art.
- polypeptides of the invention may have cleaning abilities that may be compared to known proteases, including known serine proteases.
- the Bacillus host comprises a mutation or deletion in scoC4 ⁇ See e.g., Caldwell et al., J. Bacteriol. 183:7329-7340 [2001]); spoIIE ⁇ See e.g., Arigoni et al., Mol. Microbiol. 31: 1407-1415 [1999]); and/or oppA or other genes of the opp operon ⁇ See e.g., Perego et al, Mol. Microbiol. 5: 173-185 [1991]).
- the enzymes of the present invention are ideally suited for laundry applications. Furthermore, the enzymes of the present invention find use in granular and liquid compositions.
- variant proteases of the present invention find particular use in the cleaning industry, including, but not limited to laundry and dish detergents. These applications place enzymes under various environmental stresses.
- the variant proteases of the present invention provide advantages over many currently used enzymes, due to their stability under various conditions.
- alkaline proteases examples include subtilisins, especially those derived from Bacillus (e.g., subtilisin, lentus, amyloliquefaciens, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtilisin 168). Additional examples include those mutant proteases described in U.S. Pat. Nos. RE 34,606, 5,955,340, 5,700,676, 6,312,936, and 6,482,628, all of which are incorporated herein by reference. Additional protease examples include, but are not limited to trypsin (e.g., of porcine or bovine origin), and the Fusarium protease described in WO
- compositions of the present invention preferably contain at least one surfactant and at least one builder compound, as well as one or more cleaning adjunct materials preferably selected from organic polymeric compounds, bleaching agents, additional enzymes, suds suppressors, dispersants, lime-soap dispersants, soil suspension and anti-redeposition agents and corrosion inhibitors.
- cleaning adjunct materials preferably selected from organic polymeric compounds, bleaching agents, additional enzymes, suds suppressors, dispersants, lime-soap dispersants, soil suspension and anti-redeposition agents and corrosion inhibitors.
- laundry compositions also contain softening agents (i.e., as additional cleaning adjunct materials).
- the present invention provides methods for cleaning or washing a fabric item optionally in need of cleaning or washing, respectively.
- the methods comprise providing a composition comprising the variant protease, including but not limited to fabric or laundry cleaning composition, and a fabric item or laundry item in need of cleaning, and contacting the fabric item or laundry item (or a portion of the item desired to be cleaned) with the composition under conditions sufficient or effective to clean or wash the fabric or laundry item to a desired degree.
- LG-12 clade protease polypeptides described herein find further use in tissue culture.
- LG-12 clade proteases of the present invention can be used to suspend or resuspend cells adherent to a cell culture wall, such as during the process of harvesting cells.
- LG-12 clade proteases of the present invention can be used to cleave protein bonds between cultured cells and the dish, allowing cells to become suspended in solution.
- Protein determination was performed to determine levels of protein expression using supernatants from cultures grown in 96-well micro-titer plates (MTPs), by High Performance Liquid Chromatography (HPLC) method.
- HPLC High Performance Liquid Chromatography
- An Agilent 1200 or 1260 HPLC equipped with an Acquity UPLC BEH 125 SEC (Waters) size exclusion column was used. Sample was eluted from the column using 25 mM sodium phosphate buffer pH 6.8 containing 250 mM sodium chloride.
- suc-AAPF-pNA stock solution was added to 100 ml Tris/Ca buffer and mixed well.
- An enzyme sample was added to a MTP plate (Greiner 781101) containing 1 mg/ suc-AAPF-pNA working solution and assayed for activity at 405 nm over 3 minutes using a SpectraMax plate reader in kinetic mode at RT.
- the protease activity was expressed as mOD- min "1 .
- Variants were tested for stability under various stress conditions (buffers and detergents as indicated on the Table 1 below) by measuring the residual activity following incubation at elevated temperature.
- the elevated temperature was set to obtain approximately 30% residual activity
- Diluted enzyme sample was mixed in stressor and unstressed protease activity was measured.
- the diluted sample in stressor was incubated at elevated temperature and after incubation the stressed protease activity was measured.
- Hindlll site in pHY300PLK was also removed using a linker cloned into the BamHI and Hindlll sites (SEQ ID NO:22 new linker sequence, GGATCCTGACTGCCTGAGCTT) .
- SEQ ID NO:3 sets forth the amino acid sequence of the mature LG12 sprC protein (275 amino acids)
- Combinable mutations were assigned to groups A, B or C according to criteria set forth in Example 4. These substitutions are further assigned a Suitability Score based on the group(s) (A, B, C) where the substitution appears, and where a higher suitability scores represents a substitution more suitable for use in making combinatorial variants. Suitability scores are defined in Table 4. Suitability scores for individual substitutions of LG12 sprC that fit the above criteria are reported in Table 4.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Polymers & Plastics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Molecular Biology (AREA)
- Food Science & Technology (AREA)
- Animal Husbandry (AREA)
- Textile Engineering (AREA)
- Cell Biology (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Dermatology (AREA)
- Enzymes And Modification Thereof (AREA)
- Detergent Compositions (AREA)
- Fodder In General (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicinal Preparation (AREA)
- Cosmetics (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2016542111A JP6678108B2 (ja) | 2013-09-12 | 2014-09-11 | Lg12−系統群プロテアーゼ変異体を含む組成物及び方法 |
| EP14784386.6A EP3044313B1 (en) | 2013-09-12 | 2014-09-11 | Compositions and methods comprising lg12-clade protease variants |
| DK14784386.6T DK3044313T3 (da) | 2013-09-12 | 2014-09-11 | Sammensætninger og fremgangsmåder omfattende lg12-clade- proteasevarianter |
| CN201480050677.4A CN105593365B (zh) | 2013-09-12 | 2014-09-11 | 包含lg12-进化枝蛋白酶变体的组合物和方法 |
| US15/021,681 US20160222368A1 (en) | 2013-09-12 | 2014-09-11 | Compositions and Methods Comprising LG12-CLADE Protease Variants |
| EP19199383.1A EP3653707B1 (en) | 2013-09-12 | 2014-09-11 | Compositions and methods comprising lg12-clade protease variants |
| BR112016005286A BR112016005286A2 (pt) | 2013-09-12 | 2014-09-11 | composições e métodos compreendendo variantes de protease do clado lg12 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361877087P | 2013-09-12 | 2013-09-12 | |
| US61/877,087 | 2013-09-12 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015038792A1 true WO2015038792A1 (en) | 2015-03-19 |
Family
ID=51726858
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/055223 Ceased WO2015038792A1 (en) | 2013-09-12 | 2014-09-11 | Compositions and methods comprising lg12-clade protease variants |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20160222368A1 (enExample) |
| EP (2) | EP3044313B1 (enExample) |
| JP (1) | JP6678108B2 (enExample) |
| CN (1) | CN105593365B (enExample) |
| BR (1) | BR112016005286A2 (enExample) |
| DK (1) | DK3044313T3 (enExample) |
| WO (1) | WO2015038792A1 (enExample) |
Cited By (50)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016145428A1 (en) | 2015-03-12 | 2016-09-15 | Danisco Us Inc | Compositions and methods comprising lg12-clade protease variants |
| WO2016205710A1 (en) * | 2015-06-17 | 2016-12-22 | Danisco Us Inc. | Proteases with modified propeptide regions |
| WO2016205755A1 (en) | 2015-06-17 | 2016-12-22 | Danisco Us Inc. | Bacillus gibsonii-clade serine proteases |
| WO2017079751A1 (en) | 2015-11-05 | 2017-05-11 | Danisco Us Inc | Paenibacillus sp. mannanases |
| WO2017079756A1 (en) | 2015-11-05 | 2017-05-11 | Danisco Us Inc | Paenibacillus and bacillus spp. mannanases |
| WO2017106676A1 (en) | 2015-12-18 | 2017-06-22 | Danisco Us Inc | Polypeptides with endoglucanase activity and uses thereof |
| WO2017192300A1 (en) | 2016-05-05 | 2017-11-09 | Danisco Us Inc | Protease variants and uses thereof |
| WO2017192692A1 (en) | 2016-05-03 | 2017-11-09 | Danisco Us Inc | Protease variants and uses thereof |
| WO2017210295A1 (en) | 2016-05-31 | 2017-12-07 | Danisco Us Inc. | Protease variants and uses thereof |
| WO2017219011A1 (en) | 2016-06-17 | 2017-12-21 | Danisco Us Inc | Protease variants and uses thereof |
| EP3275990A1 (en) * | 2016-07-28 | 2018-01-31 | The Procter and Gamble Company | Process for reblending a first liquid detergent composition into a second liquid detergent composition |
| WO2018085524A2 (en) | 2016-11-07 | 2018-05-11 | Danisco Us Inc | Laundry detergent composition |
| WO2018118917A1 (en) | 2016-12-21 | 2018-06-28 | Danisco Us Inc. | Protease variants and uses thereof |
| WO2018118950A1 (en) | 2016-12-21 | 2018-06-28 | Danisco Us Inc. | Bacillus gibsonii-clade serine proteases |
| JP2018524970A (ja) * | 2015-05-13 | 2018-09-06 | ダニスコ・ユーエス・インク | AprL−CLADEプロテアーゼ変異体及びその使用 |
| WO2018169750A1 (en) | 2017-03-15 | 2018-09-20 | Danisco Us Inc | Trypsin-like serine proteases and uses thereof |
| WO2018184004A1 (en) | 2017-03-31 | 2018-10-04 | Danisco Us Inc | Alpha-amylase combinatorial variants |
| WO2019036721A2 (en) | 2017-08-18 | 2019-02-21 | Danisco Us Inc | VARIANTS OF ALPHA-AMYLASES |
| WO2019108599A1 (en) | 2017-11-29 | 2019-06-06 | Danisco Us Inc | Subtilisin variants having improved stability |
| WO2019245705A1 (en) | 2018-06-19 | 2019-12-26 | Danisco Us Inc | Subtilisin variants |
| WO2019245704A1 (en) | 2018-06-19 | 2019-12-26 | Danisco Us Inc | Subtilisin variants |
| WO2020028443A1 (en) | 2018-07-31 | 2020-02-06 | Danisco Us Inc | Variant alpha-amylases having amino acid substitutions that lower the pka of the general acid |
| WO2020068486A1 (en) | 2018-09-27 | 2020-04-02 | Danisco Us Inc | Compositions for medical instrument cleaning |
| WO2020077331A2 (en) | 2018-10-12 | 2020-04-16 | Danisco Us Inc | Alpha-amylases with mutations that improve stability in the presence of chelants |
| WO2020112599A1 (en) | 2018-11-28 | 2020-06-04 | Danisco Us Inc | Subtilisin variants having improved stability |
| WO2020242858A1 (en) | 2019-05-24 | 2020-12-03 | Danisco Us Inc | Subtilisin variants and methods of use |
| WO2020247582A1 (en) | 2019-06-06 | 2020-12-10 | Danisco Us Inc | Methods and compositions for cleaning |
| WO2021080948A2 (en) | 2019-10-24 | 2021-04-29 | Danisco Us Inc | Variant maltopentaose/maltohexaose-forming alpha-amylases |
| WO2022047149A1 (en) | 2020-08-27 | 2022-03-03 | Danisco Us Inc | Enzymes and enzyme compositions for cleaning |
| WO2022165107A1 (en) | 2021-01-29 | 2022-08-04 | Danisco Us Inc | Compositions for cleaning and methods related thereto |
| WO2023278297A1 (en) | 2021-06-30 | 2023-01-05 | Danisco Us Inc | Variant lipases and uses thereof |
| WO2023034486A2 (en) | 2021-09-03 | 2023-03-09 | Danisco Us Inc. | Laundry compositions for cleaning |
| WO2023114936A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2023114939A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2023114932A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2023114988A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Variant maltopentaose/maltohexaose-forming alpha-amylases |
| WO2023168234A1 (en) | 2022-03-01 | 2023-09-07 | Danisco Us Inc. | Enzymes and enzyme compositions for cleaning |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
| WO2023250301A1 (en) | 2022-06-21 | 2023-12-28 | Danisco Us Inc. | Methods and compositions for cleaning comprising a polypeptide having thermolysin activity |
| WO2024050339A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Mannanase variants and methods of use |
| WO2024050346A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Detergent compositions and methods related thereto |
| WO2024050343A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Subtilisin variants and methods related thereto |
| WO2024102698A1 (en) | 2022-11-09 | 2024-05-16 | Danisco Us Inc. | Subtilisin variants and methods of use |
| DE102022213537A1 (de) | 2022-12-13 | 2024-06-13 | Henkel Ag & Co. Kgaa | Wasch- und reinigungsmittel enthaltend protease |
| DE102022213538A1 (de) | 2022-12-13 | 2024-06-13 | Henkel Ag & Co. Kgaa | Wasch- und reinigungsmittel enthaltend protease |
| WO2024163584A1 (en) | 2023-02-01 | 2024-08-08 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2024186819A1 (en) | 2023-03-06 | 2024-09-12 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2024191711A1 (en) | 2023-03-16 | 2024-09-19 | Nutrition & Biosciences USA 4, Inc. | Brevibacillus fermentate extracts for cleaning and malodor control and use thereof |
| WO2025071996A1 (en) | 2023-09-28 | 2025-04-03 | Danisco Us Inc. | Variant cutinase enzymes with improved solubility and uses thereof |
| WO2025085351A1 (en) | 2023-10-20 | 2025-04-24 | Danisco Us Inc. | Subtilisin variants and methods of use |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3174724B1 (en) * | 2014-07-31 | 2019-01-23 | Kornit Digital Ltd. | Process and system for continuous inkjet printing |
| CN109949867B (zh) * | 2019-01-25 | 2023-05-30 | 中国农业科学院特产研究所 | 一种多条序列比对算法的优化方法和系统、存储介质 |
| CN111575265B (zh) * | 2020-05-22 | 2022-07-22 | 江南大学 | 一种热稳定性提高的角蛋白酶突变体 |
Citations (100)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US202535A (en) | 1878-04-16 | Improvement in devices for supplying feed-water to boilers | ||
| GB1296839A (enExample) | 1969-05-29 | 1972-11-22 | ||
| GB1372034A (en) | 1970-12-31 | 1974-10-30 | Unilever Ltd | Detergent compositions |
| US4246612A (en) | 1979-02-28 | 1981-01-20 | Barr & Stroud Limited | Optical raster scanning system |
| US4302544A (en) | 1979-10-15 | 1981-11-24 | University Of Rochester | Asporogenous mutant of B. subtilis for use as host component of HV1 system |
| US4430243A (en) | 1981-08-08 | 1984-02-07 | The Procter & Gamble Company | Bleach catalyst compositions and use thereof in laundry bleaching and detergent compositions |
| US4435307A (en) | 1980-04-30 | 1984-03-06 | Novo Industri A/S | Detergent cellulase |
| US4450235A (en) | 1982-04-21 | 1984-05-22 | Cpc International Inc. | Asporogenic mutant of bacillus subtilis useful as a host in a host-vector system |
| EP0134048A1 (en) | 1983-07-06 | 1985-03-13 | Gist-Brocades N.V. | Molecular cloning and expression in industrial microorganism species |
| US4515705A (en) | 1983-11-14 | 1985-05-07 | The Procter & Gamble Company | Compositions containing odor purified proteolytic enzymes and perfumes |
| US4515707A (en) | 1983-06-27 | 1985-05-07 | The Chemithon Corporation | Intermediate product for use in producing a detergent bar and method for producing same |
| US4537706A (en) | 1984-05-14 | 1985-08-27 | The Procter & Gamble Company | Liquid detergents containing boric acid to stabilize enzymes |
| US4550862A (en) | 1982-11-17 | 1985-11-05 | The Procter & Gamble Company | Liquid product pouring and measuring package with self draining feature |
| US4561998A (en) | 1982-05-24 | 1985-12-31 | The Procter & Gamble Company | Near-neutral pH detergents containing anionic surfactant, cosurfactant and fatty acid |
| US4597898A (en) | 1982-12-23 | 1986-07-01 | The Proctor & Gamble Company | Detergent compositions containing ethoxylated amines having clay soil removal/anti-redeposition properties |
| EP0214761A2 (en) | 1985-08-07 | 1987-03-18 | Novo Nordisk A/S | An enzymatic detergent additive, a detergent, and a washing method |
| EP0218272A1 (en) | 1985-08-09 | 1987-04-15 | Gist-Brocades N.V. | Novel lipolytic enzymes and their use in detergent compositions |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| EP0238023A2 (en) | 1986-03-17 | 1987-09-23 | Novo Nordisk A/S | Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus |
| EP0258068A2 (en) | 1986-08-29 | 1988-03-02 | Novo Nordisk A/S | Enzymatic detergent additive |
| US4760025A (en) | 1984-05-29 | 1988-07-26 | Genencor, Inc. | Modified enzymes and methods for making same |
| US4765916A (en) | 1987-03-24 | 1988-08-23 | The Clorox Company | Polymer film composition for rinse release of wash additives |
| WO1988009367A1 (en) | 1987-05-29 | 1988-12-01 | Genencor, Inc. | Cutinase cleaning composition |
| EP0305216A1 (en) | 1987-08-28 | 1989-03-01 | Novo Nordisk A/S | Recombinant Humicola lipase and process for the production of recombinant humicola lipases |
| US4810410A (en) | 1986-12-13 | 1989-03-07 | Interox Chemicals Limited | Bleach activation |
| JPS6474992A (en) | 1987-09-16 | 1989-03-20 | Fuji Oil Co Ltd | Dna sequence, plasmid and production of lipase |
| WO1989006270A1 (en) | 1988-01-07 | 1989-07-13 | Novo-Nordisk A/S | Enzymatic detergent |
| EP0331376A2 (en) | 1988-02-28 | 1989-09-06 | Amano Pharmaceutical Co., Ltd. | Recombinant DNA, bacterium of the genus pseudomonas containing it, and process for preparing lipase by using it |
| WO1990009446A1 (en) | 1989-02-17 | 1990-08-23 | Plant Genetic Systems N.V. | Cutinase |
| US4965188A (en) | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| US4968451A (en) | 1988-08-26 | 1990-11-06 | The Procter & Gamble Company | Soil release agents having allyl-derived sulfonated end caps |
| US4972017A (en) | 1987-03-24 | 1990-11-20 | The Clorox Company | Rinse soluble polymer film composition for wash additives |
| US4977252A (en) | 1988-03-11 | 1990-12-11 | National Starch And Chemical Investment Holding Corporation | Modified starch emulsifier characterized by shelf stability |
| WO1991016422A1 (de) | 1990-04-14 | 1991-10-31 | Kali-Chemie Aktiengesellschaft | Alkalische bacillus-lipasen, hierfür codierende dna-sequenzen sowie bacilli, die diese lipasen produzieren |
| EP0495257A1 (en) | 1991-01-16 | 1992-07-22 | The Procter & Gamble Company | Compact detergent compositions with high activity cellulase |
| WO1992021760A1 (en) | 1991-05-29 | 1992-12-10 | Cognis, Inc. | Mutant proteolytic enzymes from bacillus |
| US5227084A (en) | 1991-04-17 | 1993-07-13 | Lever Brothers Company, Division Of Conopco, Inc. | Concentrated detergent powder compositions |
| US5264366A (en) | 1984-05-29 | 1993-11-23 | Genencor, Inc. | Protease deficient bacillus |
| WO1994006915A1 (en) * | 1992-09-24 | 1994-03-31 | Genencor International, Inc. | Cleaning compositions containing novel alkaline proteases |
| WO1994012621A1 (en) | 1992-12-01 | 1994-06-09 | Novo Nordisk | Enhancement of enzyme reactions |
| US5354559A (en) | 1990-05-29 | 1994-10-11 | Grain Processing Corporation | Encapsulation with starch hydrolyzate acid esters |
| WO1994026860A1 (de) | 1993-05-08 | 1994-11-24 | Henkel Kommanditgesellschaft Auf Aktien | Silberkorrosionsschutzmittel ii |
| WO1994026859A1 (de) | 1993-05-08 | 1994-11-24 | Henkel Kommanditgesellschaft Auf Aktien | Silberkorrosionsschutzmittel i |
| WO1995001426A1 (en) | 1993-06-29 | 1995-01-12 | Novo Nordisk A/S | Enhancement of laccase reactions |
| WO1995023221A1 (en) | 1994-02-24 | 1995-08-31 | Cognis, Inc. | Improved enzymes and detergents containing them |
| US5486303A (en) | 1993-08-27 | 1996-01-23 | The Procter & Gamble Company | Process for making high density detergent agglomerates using an anhydrous powder additive |
| US5489392A (en) | 1994-09-20 | 1996-02-06 | The Procter & Gamble Company | Process for making a high density detergent composition in a single mixer/densifier with selected recycle streams for improved agglomerate properties |
| US5516448A (en) | 1994-09-20 | 1996-05-14 | The Procter & Gamble Company | Process for making a high density detergent composition which includes selected recycle streams for improved agglomerate |
| US5565422A (en) | 1995-06-23 | 1996-10-15 | The Procter & Gamble Company | Process for preparing a free-flowing particulate detergent composition having improved solubility |
| US5565145A (en) | 1994-05-25 | 1996-10-15 | The Procter & Gamble Company | Compositions comprising ethoxylated/propoxylated polyalkyleneamine polymers as soil dispersing agents |
| US5569645A (en) | 1995-04-24 | 1996-10-29 | The Procter & Gamble Company | Low dosage detergent composition containing optimum proportions of agglomerates and spray dried granules for improved flow properties |
| US5574005A (en) | 1995-03-07 | 1996-11-12 | The Procter & Gamble Company | Process for producing detergent agglomerates from high active surfactant pastes having non-linear viscoelastic properties |
| US5576282A (en) | 1995-09-11 | 1996-11-19 | The Procter & Gamble Company | Color-safe bleach boosters, compositions and laundry methods employing same |
| US5595967A (en) | 1995-02-03 | 1997-01-21 | The Procter & Gamble Company | Detergent compositions comprising multiperacid-forming bleach activators |
| US5597936A (en) | 1995-06-16 | 1997-01-28 | The Procter & Gamble Company | Method for manufacturing cobalt catalysts |
| WO1997011151A1 (en) | 1995-09-18 | 1997-03-27 | The Procter & Gamble Company | Delivery systems |
| US5646101A (en) | 1993-01-18 | 1997-07-08 | The Procter & Gamble Company | Machine dishwashing detergents containing an oxygen bleach and an anti-tarnishing mixture of a paraffin oil and sequestrant |
| US5686014A (en) | 1994-04-07 | 1997-11-11 | The Procter & Gamble Company | Bleach compositions comprising manganese-containing bleach catalysts |
| US5691297A (en) | 1994-09-20 | 1997-11-25 | The Procter & Gamble Company | Process for making a high density detergent composition by controlling agglomeration within a dispersion index |
| US5695679A (en) | 1994-07-07 | 1997-12-09 | The Procter & Gamble Company | Detergent compositions containing an organic silver coating agent to minimize silver training in ADW washing methods |
| US5698504A (en) | 1993-07-01 | 1997-12-16 | The Procter & Gamble Company | Machine dishwashing composition containing oxygen bleach and paraffin oil and benzotriazole compound silver tarnishing inhibitors |
| US5700676A (en) | 1984-05-29 | 1997-12-23 | Genencor International Inc. | Modified subtilisins having amino acid alterations |
| US5705464A (en) | 1995-06-16 | 1998-01-06 | The Procter & Gamble Company | Automatic dishwashing compositions comprising cobalt catalysts |
| US5710115A (en) | 1994-12-09 | 1998-01-20 | The Procter & Gamble Company | Automatic dishwashing composition containing particles of diacyl peroxides |
| US5801039A (en) | 1994-02-24 | 1998-09-01 | Cognis Gesellschaft Fuer Bio Und Umwelttechnologie Mbh | Enzymes for detergents |
| US5855625A (en) | 1995-01-17 | 1999-01-05 | Henkel Kommanditgesellschaft Auf Aktien | Detergent compositions |
| WO1999006521A1 (en) | 1997-08-02 | 1999-02-11 | The Procter & Gamble Company | Detergent tablet |
| US5874276A (en) | 1993-12-17 | 1999-02-23 | Genencor International, Inc. | Cellulase enzymes and systems for their expressions |
| US5879584A (en) | 1994-09-10 | 1999-03-09 | The Procter & Gamble Company | Process for manufacturing aqueous compositions comprising peracids |
| EP0922499A2 (de) | 1993-12-15 | 1999-06-16 | Ing. Erich Pfeiffer GmbH | Austragvorrichtung für Medien |
| WO1999034011A2 (en) | 1997-12-24 | 1999-07-08 | Genencor International, Inc. | Method of assaying for a preferred enzyme and/or detergent |
| US5929022A (en) | 1996-08-01 | 1999-07-27 | The Procter & Gamble Company | Detergent compositions containing amine and specially selected perfumes |
| US5935826A (en) | 1997-10-31 | 1999-08-10 | National Starch And Chemical Investment Holding Corporation | Glucoamylase converted starch derivatives and their use as emulsifying and encapsulating agents |
| US5955340A (en) | 1984-05-29 | 1999-09-21 | Genencor International, Inc. | Modified subtilisins having amino acid alterations |
| WO2000032601A2 (en) | 1998-11-30 | 2000-06-08 | The Procter & Gamble Company | Process for preparing cross-bridged tetraaza macrocycles |
| US6077316A (en) | 1995-07-19 | 2000-06-20 | Novo Nordisk A/S | Treatment of fabrics |
| US6225464B1 (en) | 1997-03-07 | 2001-05-01 | The Procter & Gamble Company | Methods of making cross-bridged macropolycycles |
| US6294514B1 (en) | 1998-11-24 | 2001-09-25 | The Procter & Gamble Company | Process for preparing mono-long chain amine oxide surfactants with low nitrite, nitrosamine and low residual peroxide |
| US6306812B1 (en) | 1997-03-07 | 2001-10-23 | Procter & Gamble Company, The | Bleach compositions containing metal bleach catalyst, and bleach activators and/or organic percarboxylic acids |
| US6312936B1 (en) | 1997-10-23 | 2001-11-06 | Genencor International, Inc. | Multiply-substituted protease variants |
| US6326348B1 (en) | 1996-04-16 | 2001-12-04 | The Procter & Gamble Co. | Detergent compositions containing selected mid-chain branched surfactants |
| US6376445B1 (en) | 1997-08-14 | 2002-04-23 | Procter & Gamble Company | Detergent compositions comprising a mannanase and a protease |
| US6376450B1 (en) | 1998-10-23 | 2002-04-23 | Chanchal Kumar Ghosh | Cleaning compositions containing multiply-substituted protease variants |
| US6440991B1 (en) | 2000-10-02 | 2002-08-27 | Wyeth | Ethers of 7-desmethlrapamycin |
| WO2002102955A1 (en) | 2001-06-18 | 2002-12-27 | Unilever Plc | Water soluble package and liquid contents thereof |
| US6566114B1 (en) | 1998-06-10 | 2003-05-20 | Novozymes, A/S | Mannanases |
| US6582914B1 (en) | 2000-10-26 | 2003-06-24 | Genencor International, Inc. | Method for generating a library of oligonucleotides comprising a controlled distribution of mutations |
| EP1321513A1 (en) * | 2001-12-21 | 2003-06-25 | Direvo Biotech AG | Subtilisin variants with improved characteristics |
| US6602842B2 (en) | 1994-06-17 | 2003-08-05 | Genencor International, Inc. | Cleaning compositions containing plant cell wall degrading enzymes and their use in cleaning methods |
| US6605458B1 (en) | 1997-11-21 | 2003-08-12 | Novozymes A/S | Protease variants and compositions |
| JP2004154003A (ja) * | 2002-11-01 | 2004-06-03 | Kao Corp | アルカリプロテアーゼ |
| JP2004313043A (ja) * | 2003-04-14 | 2004-11-11 | Kao Corp | アルカリプロテアーゼ |
| WO2004111178A1 (en) | 2003-05-23 | 2004-12-23 | The Procter & Gamble Company | Cleaning composition for use in a laundry or dishwashing machine |
| WO2005056782A2 (en) | 2003-12-03 | 2005-06-23 | Genencor International, Inc. | Perhydrolase |
| WO2007044993A2 (en) | 2005-10-12 | 2007-04-19 | Genencor International, Inc. | Use and production of storage-stable neutral metalloprotease |
| WO2007145964A2 (en) | 2006-06-05 | 2007-12-21 | The Procter & Gamble Company | Enzyme stabilizer |
| US20080090747A1 (en) | 2006-07-18 | 2008-04-17 | Pieter Augustinus | Protease variants active over a broad temperature range |
| EP2100947A1 (en) | 2008-03-14 | 2009-09-16 | The Procter and Gamble Company | Automatic dishwashing detergent composition |
| WO2013063460A2 (en) | 2011-10-28 | 2013-05-02 | Danisco Us Inc. | Variant maltohexaose-forming alpha-amylase variants |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ATE530560T1 (de) | 2003-11-06 | 2011-11-15 | Danisco Us Inc | Vegf bindende und geträgerte peptide zur behandlung von hautkrankheiten |
| MX2010013121A (es) * | 2008-06-06 | 2011-01-21 | Danisco Inc | Composiciones y metodos que comprenden proteasas microbianas variantes. |
-
2014
- 2014-09-11 JP JP2016542111A patent/JP6678108B2/ja active Active
- 2014-09-11 US US15/021,681 patent/US20160222368A1/en not_active Abandoned
- 2014-09-11 WO PCT/US2014/055223 patent/WO2015038792A1/en not_active Ceased
- 2014-09-11 EP EP14784386.6A patent/EP3044313B1/en active Active
- 2014-09-11 BR BR112016005286A patent/BR112016005286A2/pt not_active IP Right Cessation
- 2014-09-11 EP EP19199383.1A patent/EP3653707B1/en active Active
- 2014-09-11 CN CN201480050677.4A patent/CN105593365B/zh active Active
- 2014-09-11 DK DK14784386.6T patent/DK3044313T3/da active
Patent Citations (108)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US202535A (en) | 1878-04-16 | Improvement in devices for supplying feed-water to boilers | ||
| GB1296839A (enExample) | 1969-05-29 | 1972-11-22 | ||
| GB1372034A (en) | 1970-12-31 | 1974-10-30 | Unilever Ltd | Detergent compositions |
| US4246612A (en) | 1979-02-28 | 1981-01-20 | Barr & Stroud Limited | Optical raster scanning system |
| US4302544A (en) | 1979-10-15 | 1981-11-24 | University Of Rochester | Asporogenous mutant of B. subtilis for use as host component of HV1 system |
| US4435307A (en) | 1980-04-30 | 1984-03-06 | Novo Industri A/S | Detergent cellulase |
| US4430243A (en) | 1981-08-08 | 1984-02-07 | The Procter & Gamble Company | Bleach catalyst compositions and use thereof in laundry bleaching and detergent compositions |
| US4450235A (en) | 1982-04-21 | 1984-05-22 | Cpc International Inc. | Asporogenic mutant of bacillus subtilis useful as a host in a host-vector system |
| US4561998A (en) | 1982-05-24 | 1985-12-31 | The Procter & Gamble Company | Near-neutral pH detergents containing anionic surfactant, cosurfactant and fatty acid |
| US4550862A (en) | 1982-11-17 | 1985-11-05 | The Procter & Gamble Company | Liquid product pouring and measuring package with self draining feature |
| US4597898A (en) | 1982-12-23 | 1986-07-01 | The Proctor & Gamble Company | Detergent compositions containing ethoxylated amines having clay soil removal/anti-redeposition properties |
| US4515707A (en) | 1983-06-27 | 1985-05-07 | The Chemithon Corporation | Intermediate product for use in producing a detergent bar and method for producing same |
| EP0134048A1 (en) | 1983-07-06 | 1985-03-13 | Gist-Brocades N.V. | Molecular cloning and expression in industrial microorganism species |
| US4515705A (en) | 1983-11-14 | 1985-05-07 | The Procter & Gamble Company | Compositions containing odor purified proteolytic enzymes and perfumes |
| US4537706A (en) | 1984-05-14 | 1985-08-27 | The Procter & Gamble Company | Liquid detergents containing boric acid to stabilize enzymes |
| US5700676A (en) | 1984-05-29 | 1997-12-23 | Genencor International Inc. | Modified subtilisins having amino acid alterations |
| US5264366A (en) | 1984-05-29 | 1993-11-23 | Genencor, Inc. | Protease deficient bacillus |
| USRE34606E (en) | 1984-05-29 | 1994-05-10 | Genencor, Inc. | Modified enzymes and methods for making same |
| US5955340A (en) | 1984-05-29 | 1999-09-21 | Genencor International, Inc. | Modified subtilisins having amino acid alterations |
| US4760025A (en) | 1984-05-29 | 1988-07-26 | Genencor, Inc. | Modified enzymes and methods for making same |
| US4683202B1 (enExample) | 1985-03-28 | 1990-11-27 | Cetus Corp | |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| EP0214761A2 (en) | 1985-08-07 | 1987-03-18 | Novo Nordisk A/S | An enzymatic detergent additive, a detergent, and a washing method |
| EP0218272A1 (en) | 1985-08-09 | 1987-04-15 | Gist-Brocades N.V. | Novel lipolytic enzymes and their use in detergent compositions |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4683195B1 (enExample) | 1986-01-30 | 1990-11-27 | Cetus Corp | |
| EP0238023A2 (en) | 1986-03-17 | 1987-09-23 | Novo Nordisk A/S | Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus |
| US4965188A (en) | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| EP0258068A2 (en) | 1986-08-29 | 1988-03-02 | Novo Nordisk A/S | Enzymatic detergent additive |
| US4810410A (en) | 1986-12-13 | 1989-03-07 | Interox Chemicals Limited | Bleach activation |
| US4972017A (en) | 1987-03-24 | 1990-11-20 | The Clorox Company | Rinse soluble polymer film composition for wash additives |
| US4765916A (en) | 1987-03-24 | 1988-08-23 | The Clorox Company | Polymer film composition for rinse release of wash additives |
| WO1988009367A1 (en) | 1987-05-29 | 1988-12-01 | Genencor, Inc. | Cutinase cleaning composition |
| EP0305216A1 (en) | 1987-08-28 | 1989-03-01 | Novo Nordisk A/S | Recombinant Humicola lipase and process for the production of recombinant humicola lipases |
| JPS6474992A (en) | 1987-09-16 | 1989-03-20 | Fuji Oil Co Ltd | Dna sequence, plasmid and production of lipase |
| WO1989006270A1 (en) | 1988-01-07 | 1989-07-13 | Novo-Nordisk A/S | Enzymatic detergent |
| EP0331376A2 (en) | 1988-02-28 | 1989-09-06 | Amano Pharmaceutical Co., Ltd. | Recombinant DNA, bacterium of the genus pseudomonas containing it, and process for preparing lipase by using it |
| US4977252A (en) | 1988-03-11 | 1990-12-11 | National Starch And Chemical Investment Holding Corporation | Modified starch emulsifier characterized by shelf stability |
| US4968451A (en) | 1988-08-26 | 1990-11-06 | The Procter & Gamble Company | Soil release agents having allyl-derived sulfonated end caps |
| WO1990009446A1 (en) | 1989-02-17 | 1990-08-23 | Plant Genetic Systems N.V. | Cutinase |
| WO1991016422A1 (de) | 1990-04-14 | 1991-10-31 | Kali-Chemie Aktiengesellschaft | Alkalische bacillus-lipasen, hierfür codierende dna-sequenzen sowie bacilli, die diese lipasen produzieren |
| US5354559A (en) | 1990-05-29 | 1994-10-11 | Grain Processing Corporation | Encapsulation with starch hydrolyzate acid esters |
| EP0495257A1 (en) | 1991-01-16 | 1992-07-22 | The Procter & Gamble Company | Compact detergent compositions with high activity cellulase |
| US5227084A (en) | 1991-04-17 | 1993-07-13 | Lever Brothers Company, Division Of Conopco, Inc. | Concentrated detergent powder compositions |
| US5340735A (en) | 1991-05-29 | 1994-08-23 | Cognis, Inc. | Bacillus lentus alkaline protease variants with increased stability |
| US5500364A (en) | 1991-05-29 | 1996-03-19 | Cognis, Inc. | Bacillus lentus alkaline protease varints with enhanced stability |
| WO1992021760A1 (en) | 1991-05-29 | 1992-12-10 | Cognis, Inc. | Mutant proteolytic enzymes from bacillus |
| WO1994006915A1 (en) * | 1992-09-24 | 1994-03-31 | Genencor International, Inc. | Cleaning compositions containing novel alkaline proteases |
| WO1994012621A1 (en) | 1992-12-01 | 1994-06-09 | Novo Nordisk | Enhancement of enzyme reactions |
| US5646101A (en) | 1993-01-18 | 1997-07-08 | The Procter & Gamble Company | Machine dishwashing detergents containing an oxygen bleach and an anti-tarnishing mixture of a paraffin oil and sequestrant |
| WO1994026859A1 (de) | 1993-05-08 | 1994-11-24 | Henkel Kommanditgesellschaft Auf Aktien | Silberkorrosionsschutzmittel i |
| WO1994026860A1 (de) | 1993-05-08 | 1994-11-24 | Henkel Kommanditgesellschaft Auf Aktien | Silberkorrosionsschutzmittel ii |
| WO1995001426A1 (en) | 1993-06-29 | 1995-01-12 | Novo Nordisk A/S | Enhancement of laccase reactions |
| US5698504A (en) | 1993-07-01 | 1997-12-16 | The Procter & Gamble Company | Machine dishwashing composition containing oxygen bleach and paraffin oil and benzotriazole compound silver tarnishing inhibitors |
| US5486303A (en) | 1993-08-27 | 1996-01-23 | The Procter & Gamble Company | Process for making high density detergent agglomerates using an anhydrous powder additive |
| EP0922499A2 (de) | 1993-12-15 | 1999-06-16 | Ing. Erich Pfeiffer GmbH | Austragvorrichtung für Medien |
| US5874276A (en) | 1993-12-17 | 1999-02-23 | Genencor International, Inc. | Cellulase enzymes and systems for their expressions |
| WO1995023221A1 (en) | 1994-02-24 | 1995-08-31 | Cognis, Inc. | Improved enzymes and detergents containing them |
| US5801039A (en) | 1994-02-24 | 1998-09-01 | Cognis Gesellschaft Fuer Bio Und Umwelttechnologie Mbh | Enzymes for detergents |
| US5686014A (en) | 1994-04-07 | 1997-11-11 | The Procter & Gamble Company | Bleach compositions comprising manganese-containing bleach catalysts |
| US5565145A (en) | 1994-05-25 | 1996-10-15 | The Procter & Gamble Company | Compositions comprising ethoxylated/propoxylated polyalkyleneamine polymers as soil dispersing agents |
| US6602842B2 (en) | 1994-06-17 | 2003-08-05 | Genencor International, Inc. | Cleaning compositions containing plant cell wall degrading enzymes and their use in cleaning methods |
| US5695679A (en) | 1994-07-07 | 1997-12-09 | The Procter & Gamble Company | Detergent compositions containing an organic silver coating agent to minimize silver training in ADW washing methods |
| US5879584A (en) | 1994-09-10 | 1999-03-09 | The Procter & Gamble Company | Process for manufacturing aqueous compositions comprising peracids |
| US5516448A (en) | 1994-09-20 | 1996-05-14 | The Procter & Gamble Company | Process for making a high density detergent composition which includes selected recycle streams for improved agglomerate |
| US5489392A (en) | 1994-09-20 | 1996-02-06 | The Procter & Gamble Company | Process for making a high density detergent composition in a single mixer/densifier with selected recycle streams for improved agglomerate properties |
| US5691297A (en) | 1994-09-20 | 1997-11-25 | The Procter & Gamble Company | Process for making a high density detergent composition by controlling agglomeration within a dispersion index |
| US5710115A (en) | 1994-12-09 | 1998-01-20 | The Procter & Gamble Company | Automatic dishwashing composition containing particles of diacyl peroxides |
| US5855625A (en) | 1995-01-17 | 1999-01-05 | Henkel Kommanditgesellschaft Auf Aktien | Detergent compositions |
| US5595967A (en) | 1995-02-03 | 1997-01-21 | The Procter & Gamble Company | Detergent compositions comprising multiperacid-forming bleach activators |
| US5574005A (en) | 1995-03-07 | 1996-11-12 | The Procter & Gamble Company | Process for producing detergent agglomerates from high active surfactant pastes having non-linear viscoelastic properties |
| US5569645A (en) | 1995-04-24 | 1996-10-29 | The Procter & Gamble Company | Low dosage detergent composition containing optimum proportions of agglomerates and spray dried granules for improved flow properties |
| US5705464A (en) | 1995-06-16 | 1998-01-06 | The Procter & Gamble Company | Automatic dishwashing compositions comprising cobalt catalysts |
| US5597936A (en) | 1995-06-16 | 1997-01-28 | The Procter & Gamble Company | Method for manufacturing cobalt catalysts |
| US5565422A (en) | 1995-06-23 | 1996-10-15 | The Procter & Gamble Company | Process for preparing a free-flowing particulate detergent composition having improved solubility |
| US6077316A (en) | 1995-07-19 | 2000-06-20 | Novo Nordisk A/S | Treatment of fabrics |
| US5576282A (en) | 1995-09-11 | 1996-11-19 | The Procter & Gamble Company | Color-safe bleach boosters, compositions and laundry methods employing same |
| WO1997011151A1 (en) | 1995-09-18 | 1997-03-27 | The Procter & Gamble Company | Delivery systems |
| US6326348B1 (en) | 1996-04-16 | 2001-12-04 | The Procter & Gamble Co. | Detergent compositions containing selected mid-chain branched surfactants |
| US5929022A (en) | 1996-08-01 | 1999-07-27 | The Procter & Gamble Company | Detergent compositions containing amine and specially selected perfumes |
| US6306812B1 (en) | 1997-03-07 | 2001-10-23 | Procter & Gamble Company, The | Bleach compositions containing metal bleach catalyst, and bleach activators and/or organic percarboxylic acids |
| US6225464B1 (en) | 1997-03-07 | 2001-05-01 | The Procter & Gamble Company | Methods of making cross-bridged macropolycycles |
| WO1999006521A1 (en) | 1997-08-02 | 1999-02-11 | The Procter & Gamble Company | Detergent tablet |
| US6376445B1 (en) | 1997-08-14 | 2002-04-23 | Procter & Gamble Company | Detergent compositions comprising a mannanase and a protease |
| US6482628B1 (en) | 1997-10-23 | 2002-11-19 | Genencor International, Inc. | Multiply-substituted protease variants |
| US6312936B1 (en) | 1997-10-23 | 2001-11-06 | Genencor International, Inc. | Multiply-substituted protease variants |
| US5935826A (en) | 1997-10-31 | 1999-08-10 | National Starch And Chemical Investment Holding Corporation | Glucoamylase converted starch derivatives and their use as emulsifying and encapsulating agents |
| US6605458B1 (en) | 1997-11-21 | 2003-08-12 | Novozymes A/S | Protease variants and compositions |
| WO1999034011A2 (en) | 1997-12-24 | 1999-07-08 | Genencor International, Inc. | Method of assaying for a preferred enzyme and/or detergent |
| US6566114B1 (en) | 1998-06-10 | 2003-05-20 | Novozymes, A/S | Mannanases |
| US6376450B1 (en) | 1998-10-23 | 2002-04-23 | Chanchal Kumar Ghosh | Cleaning compositions containing multiply-substituted protease variants |
| US6294514B1 (en) | 1998-11-24 | 2001-09-25 | The Procter & Gamble Company | Process for preparing mono-long chain amine oxide surfactants with low nitrite, nitrosamine and low residual peroxide |
| WO2000032601A2 (en) | 1998-11-30 | 2000-06-08 | The Procter & Gamble Company | Process for preparing cross-bridged tetraaza macrocycles |
| US6610642B2 (en) | 2000-04-20 | 2003-08-26 | The Procter And Gamble Company | Cleaning compositions containing multiply-substituted protease variants |
| US6440991B1 (en) | 2000-10-02 | 2002-08-27 | Wyeth | Ethers of 7-desmethlrapamycin |
| US6582914B1 (en) | 2000-10-26 | 2003-06-24 | Genencor International, Inc. | Method for generating a library of oligonucleotides comprising a controlled distribution of mutations |
| WO2002102955A1 (en) | 2001-06-18 | 2002-12-27 | Unilever Plc | Water soluble package and liquid contents thereof |
| EP1321513A1 (en) * | 2001-12-21 | 2003-06-25 | Direvo Biotech AG | Subtilisin variants with improved characteristics |
| JP2004154003A (ja) * | 2002-11-01 | 2004-06-03 | Kao Corp | アルカリプロテアーゼ |
| JP2004313043A (ja) * | 2003-04-14 | 2004-11-11 | Kao Corp | アルカリプロテアーゼ |
| WO2004111178A1 (en) | 2003-05-23 | 2004-12-23 | The Procter & Gamble Company | Cleaning composition for use in a laundry or dishwashing machine |
| WO2005056782A2 (en) | 2003-12-03 | 2005-06-23 | Genencor International, Inc. | Perhydrolase |
| WO2007044993A2 (en) | 2005-10-12 | 2007-04-19 | Genencor International, Inc. | Use and production of storage-stable neutral metalloprotease |
| WO2007145964A2 (en) | 2006-06-05 | 2007-12-21 | The Procter & Gamble Company | Enzyme stabilizer |
| US20080090747A1 (en) | 2006-07-18 | 2008-04-17 | Pieter Augustinus | Protease variants active over a broad temperature range |
| EP2100947A1 (en) | 2008-03-14 | 2009-09-16 | The Procter and Gamble Company | Automatic dishwashing detergent composition |
| EP2100949A1 (en) | 2008-03-14 | 2009-09-16 | The Procter and Gamble Company | Automatic dishwashing detergent composition |
| WO2013063460A2 (en) | 2011-10-28 | 2013-05-02 | Danisco Us Inc. | Variant maltohexaose-forming alpha-amylase variants |
Non-Patent Citations (66)
| Title |
|---|
| "Molecular Biological Methods for Bacillus", 1990, JOHN WILEY & SONS |
| ALTSCHUL ET AL., NUCLEIC ACIDS RES, vol. 25, 1997, pages 3389 - 402 |
| ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, no. 17, 1997, pages 3389 - 3402 |
| ALTSCHUL, J. MOL. BIOL., vol. 215, 1990, pages 403 - 410 |
| ARIGONI ET AL., MOL. MICROBIOL., vol. 31, 1999, pages 1407 - 1415 |
| B. SCHMIDT ET AL., APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 61, 1995, pages 4490 - 4493 |
| BEAUCAGE ET AL., TETRAHEDRON LETTERS, vol. 22, 1981, pages 1859 - 69 |
| CALDWELL ET AL., J. BACTERIOL., vol. 183, 2001, pages 7329 - 7340 |
| CHANG ET AL., MOL. GEN. GENET., vol. 168, 1979, pages 11 - 115 |
| CHRISTIANSON ET AL., ANAL. BIOCHEM., vol. 223, 1994, pages 119 - 129 |
| CONTENTE ET AL., PLASMID, vol. 2, 1979, pages 555 - 571 |
| DARTOIS ET AL., BIOCHEM. BIOPHYS. ACTA, vol. 1131, 1993, pages 253 - 260 |
| DATABASE Geneseq [online] 26 August 2004 (2004-08-26), "Bacillus sp. KSM-LD1 alkaline protease mature protein.", XP002734385, retrieved from EBI accession no. GSP:ADP70361 Database accession no. ADP70361 * |
| DATABASE Geneseq [online] 27 January 2005 (2005-01-27), "Novel Bacillus KS alkaline protease protein sequence SeqID2.", XP002734384, retrieved from EBI accession no. GSP:ADU05756 Database accession no. ADU05756 * |
| DEL MAR, ANAL. BIOCHEM., vol. 99, 1979, pages 316 - 320 |
| DEVEREUX ET AL., NUCL. ACID RES., vol. 12, 1984, pages 387 - 395 |
| EMANUELSSON ET AL., NATURE PROTOCOLS, vol. 2, 2007, pages 953 - 971 |
| FAHNESTOCK; FISCHER, J. BACTERIOL., vol. 165, 1986, pages 796 - 804 |
| FENG; DOOLITTLE, J. MOL. EVOL., vol. 35, 1987, pages 351 - 360 |
| FERRARI ET AL.: "Bacillus", 1989, PLENUM PUBLISHING CORP., article "Genetics", pages: 57 - 72 |
| FERRARI ET AL.: "Genetics", 1989, PLENUM PUBLISHING CORP., pages: 57 - 72 |
| FISHER ET AL., ARCH. MICROBIOL., vol. 139, 1981, pages 213 - 217 |
| HAIMA ET AL., MOL. GEN. GENET., vol. 223, pages 185 - 191 |
| HAN-SEUNG JOO ET AL: "Purification and Characterization of a Novel Alkaline Protease from Bacillus horikoshii", JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY, vol. 22, no. 1, 28 January 2012 (2012-01-28), pages 58 - 68, XP055161644, ISSN: 1017-7825, DOI: 10.4014/jmb.1109.09006 * |
| HASS ET AL., GENE, vol. 109, 1991, pages 117 - 113 |
| HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 10915 |
| HIGGINS; SHARP, CABIOS, vol. 5, 1989, pages 151 - 153 |
| HOCH ET AL., GENETICS, vol. 73, 1973, pages 215 - 228 |
| HOCH ET AL., J. BACTERIOL., vol. 93, 1967, pages 1925 - 1937 |
| HOLUBOVA, FOLIA MICROBIOL., vol. 30, 1985, pages 97 |
| HSIA ET AL., BIOCHEM., vol. 242, 1999, pages 221 - 227 |
| ITAKURA ET AL., ANN. REV. BIOCHEM., vol. 53, 1984, pages 323 |
| ITAKURA ET AL., SCIENCE, vol. 198, 1984, pages 1056 |
| KALISZ: "Advances in Biochemical Engineering/Biotechnology", 1988, article "Microbial Proteinases" |
| KROLL ET AL., DNA CELL BIOL., vol. 12, 1993, pages 441 - 53 |
| KUGIMIYA ET AL., BIOSCI. BIOTECH. BIOCHEM., vol. 56, 1992, pages 716 - 719 |
| MADDOX ET AL., J. EXP. MED., vol. 158, 1983, pages 1211 |
| MANN ET AL., CURRENT MICROBIOL., vol. 13, 1986, pages 131 - 135 |
| MATTHES ET AL., EMBO J., vol. 3, 1984, pages 801 - 805 |
| MCDONALD, J., GEN. MICROBIOL., vol. 130, 1984, pages 203 |
| MSADEK ET AL., J. BACTERIOL., vol. 172, 1990, pages 824 - 834 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| OLMOS ET AL., MOL. GEN. GENET., vol. 253, 1997, pages 562 - 567 |
| PALMEROS ET AL., GENE, vol. 247, 2000, pages 255 - 264 |
| PALVA ET AL., GENE, vol. 19, 1982, pages 81 - 87 |
| PEARSON; LIPMAN, PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444 |
| PEREGO ET AL., MOL. MICROBIOL., vol. 5, 1991, pages 173 - 185 |
| PEREGO ET AL.: "Bacillus subtilis and Other Gram-Positive Bacteria: Biochemistry, Physiology and Molecular Genetics", 1993, AMERICAN SOCIETY FOR MICROBIOLOGY, article "Integrational Vectors for Genetic Manipulations in Bacillus subtilis", pages: 615 - 624 |
| PORATH, PROTEIN EXPR. PURIF., vol. 3, 1992, pages 263 - 281 |
| SAITOU, N.; NEI, M., MOLBIOL. EVOL., vol. 4, 1987, pages 406 - 425 |
| SAITOU, N.; NEI, M.: "The neighbor-joining method: a new method for reconstructing Guide Trees", MOL BIOL EVOL, vol. 4, 1987, pages 406 - 425, XP001154601 |
| SAUNDERS, J. BACTERIOL., vol. 157, 1984, pages 718 - 726 |
| SCHIMADA ET AL., J. BIOCHEM., vol. 106, 1989, pages 383 - 388 |
| SMITH ET AL., APPL. ENV. MICROBIOL., vol. 51, 1986, pages 634 |
| SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 |
| STAHL ET AL., J. BACTERIOL., vol. 158, 1984, pages 411 - 418 |
| THOMPSON ET AL., NUCLEIC ACIDS RESEARCH, vol. 22, 1994, pages 4673 - 4680 |
| VOROBJEVA ET AL., FEMS MICROBIOL. LETT., vol. 7, 1980, pages 261 - 263 |
| WANG ET AL., GENE, vol. 69, 1988, pages 39 - 47 |
| WARD: "Microbial Enzymes and Biotechnology", 1983, APPLIED SCIENCE, article "Proteinases", pages: 251 - 317 |
| WEINRAUCH ET AL., J. BACTERIOL., vol. 154, 1983, pages 1077 - 1087 |
| WEINRAUCH ET AL., J. BACTERIOL., vol. 169, 1987, pages 1205 - 1211 |
| WELLS ET AL., NUCLEIC ACIDS RES., vol. 11, 1983, pages 7911 - 25 |
| WELLS ET AL., NUCLEIC ACIDS RES., vol. 11, 1983, pages 7911 - 7925 |
| YAMAGUCHI ET AL., GENE, vol. 103, 1991, pages 61 - 67 |
| YASUSHI TAKIMURA ET AL: "Alkaliphilic Bacillus sp. strain KSM-LD1 contains a record number of subtilisin-like serine proteases genes", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, SPRINGER, BERLIN, DE, vol. 76, no. 2, 15 June 2007 (2007-06-15), pages 395 - 405, XP019538683, ISSN: 1432-0614, DOI: 10.1007/S00253-007-1022-9 * |
Cited By (70)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3611259A1 (en) | 2015-03-12 | 2020-02-19 | Danisco US Inc. | Compositions and methods comprising lg12-clade protease variants |
| WO2016145428A1 (en) | 2015-03-12 | 2016-09-15 | Danisco Us Inc | Compositions and methods comprising lg12-clade protease variants |
| EP4219704A2 (en) | 2015-05-13 | 2023-08-02 | Danisco US Inc | Aprl-clade protease variants and uses thereof |
| EP3872174A1 (en) | 2015-05-13 | 2021-09-01 | Danisco US Inc. | Aprl-clade protease variants and uses thereof |
| JP2018524970A (ja) * | 2015-05-13 | 2018-09-06 | ダニスコ・ユーエス・インク | AprL−CLADEプロテアーゼ変異体及びその使用 |
| JP7274819B2 (ja) | 2015-05-13 | 2023-05-17 | ダニスコ・ユーエス・インク | AprL-CLADEプロテアーゼ変異体及びその使用 |
| CN107922934A (zh) * | 2015-06-17 | 2018-04-17 | 丹尼斯科美国公司 | 具有经修饰的前肽区域的蛋白酶 |
| EP4234693A2 (en) | 2015-06-17 | 2023-08-30 | Danisco US Inc | Bacillus gibsonii-clade serine proteases |
| WO2016205755A1 (en) | 2015-06-17 | 2016-12-22 | Danisco Us Inc. | Bacillus gibsonii-clade serine proteases |
| WO2016205710A1 (en) * | 2015-06-17 | 2016-12-22 | Danisco Us Inc. | Proteases with modified propeptide regions |
| EP4141113A1 (en) | 2015-11-05 | 2023-03-01 | Danisco US Inc | Paenibacillus sp. mannanases |
| EP4483721A2 (en) | 2015-11-05 | 2025-01-01 | Danisco US Inc. | Paenibacillus and bacillus spp. mannanases |
| WO2017079756A1 (en) | 2015-11-05 | 2017-05-11 | Danisco Us Inc | Paenibacillus and bacillus spp. mannanases |
| WO2017079751A1 (en) | 2015-11-05 | 2017-05-11 | Danisco Us Inc | Paenibacillus sp. mannanases |
| WO2017106676A1 (en) | 2015-12-18 | 2017-06-22 | Danisco Us Inc | Polypeptides with endoglucanase activity and uses thereof |
| WO2017192692A1 (en) | 2016-05-03 | 2017-11-09 | Danisco Us Inc | Protease variants and uses thereof |
| US20190136218A1 (en) * | 2016-05-05 | 2019-05-09 | Danisco Us Inc | Protease variants and uses thereof |
| WO2017192300A1 (en) | 2016-05-05 | 2017-11-09 | Danisco Us Inc | Protease variants and uses thereof |
| CN109072213A (zh) * | 2016-05-05 | 2018-12-21 | 丹尼斯科美国公司 | 蛋白酶变体及其用途 |
| EP3845642A1 (en) | 2016-05-05 | 2021-07-07 | Danisco US Inc. | Protease variants and uses thereof |
| WO2017210295A1 (en) | 2016-05-31 | 2017-12-07 | Danisco Us Inc. | Protease variants and uses thereof |
| EP4527923A2 (en) | 2016-06-17 | 2025-03-26 | Danisco US Inc | Protease variants and uses thereof |
| EP4151726A1 (en) | 2016-06-17 | 2023-03-22 | Danisco US Inc | Protease variants and uses thereof |
| WO2017219011A1 (en) | 2016-06-17 | 2017-12-21 | Danisco Us Inc | Protease variants and uses thereof |
| WO2018022271A1 (en) * | 2016-07-28 | 2018-02-01 | The Procter & Gamble Company | Process for reblending a first liquid detergent composition into a second liquid detergent composition |
| EP3275990A1 (en) * | 2016-07-28 | 2018-01-31 | The Procter and Gamble Company | Process for reblending a first liquid detergent composition into a second liquid detergent composition |
| US10323219B2 (en) | 2016-07-28 | 2019-06-18 | The Procter & Gamble Company | Process for reblending a first liquid detergent composition into a second liquid detergent composition |
| WO2018085524A2 (en) | 2016-11-07 | 2018-05-11 | Danisco Us Inc | Laundry detergent composition |
| WO2018112123A1 (en) | 2016-12-15 | 2018-06-21 | Danisco Us Inc. | Polypeptides with endoglucanase activity and uses thereof |
| EP4520820A2 (en) | 2016-12-21 | 2025-03-12 | Danisco Us Inc | Protease variants and uses thereof |
| WO2018118917A1 (en) | 2016-12-21 | 2018-06-28 | Danisco Us Inc. | Protease variants and uses thereof |
| EP4212622A2 (en) | 2016-12-21 | 2023-07-19 | Danisco US Inc. | Bacillus gibsonii-clade serine proteases |
| EP4424805A2 (en) | 2016-12-21 | 2024-09-04 | Danisco Us Inc | Bacillus gibsonii-clade serine proteases |
| WO2018118950A1 (en) | 2016-12-21 | 2018-06-28 | Danisco Us Inc. | Bacillus gibsonii-clade serine proteases |
| WO2018169750A1 (en) | 2017-03-15 | 2018-09-20 | Danisco Us Inc | Trypsin-like serine proteases and uses thereof |
| WO2018184004A1 (en) | 2017-03-31 | 2018-10-04 | Danisco Us Inc | Alpha-amylase combinatorial variants |
| WO2019036721A2 (en) | 2017-08-18 | 2019-02-21 | Danisco Us Inc | VARIANTS OF ALPHA-AMYLASES |
| WO2019108599A1 (en) | 2017-11-29 | 2019-06-06 | Danisco Us Inc | Subtilisin variants having improved stability |
| WO2019245705A1 (en) | 2018-06-19 | 2019-12-26 | Danisco Us Inc | Subtilisin variants |
| WO2019245704A1 (en) | 2018-06-19 | 2019-12-26 | Danisco Us Inc | Subtilisin variants |
| WO2020028443A1 (en) | 2018-07-31 | 2020-02-06 | Danisco Us Inc | Variant alpha-amylases having amino acid substitutions that lower the pka of the general acid |
| WO2020068486A1 (en) | 2018-09-27 | 2020-04-02 | Danisco Us Inc | Compositions for medical instrument cleaning |
| WO2020077331A2 (en) | 2018-10-12 | 2020-04-16 | Danisco Us Inc | Alpha-amylases with mutations that improve stability in the presence of chelants |
| WO2020112599A1 (en) | 2018-11-28 | 2020-06-04 | Danisco Us Inc | Subtilisin variants having improved stability |
| WO2020242858A1 (en) | 2019-05-24 | 2020-12-03 | Danisco Us Inc | Subtilisin variants and methods of use |
| WO2020247582A1 (en) | 2019-06-06 | 2020-12-10 | Danisco Us Inc | Methods and compositions for cleaning |
| WO2021080948A2 (en) | 2019-10-24 | 2021-04-29 | Danisco Us Inc | Variant maltopentaose/maltohexaose-forming alpha-amylases |
| WO2022047149A1 (en) | 2020-08-27 | 2022-03-03 | Danisco Us Inc | Enzymes and enzyme compositions for cleaning |
| WO2022165107A1 (en) | 2021-01-29 | 2022-08-04 | Danisco Us Inc | Compositions for cleaning and methods related thereto |
| WO2023278297A1 (en) | 2021-06-30 | 2023-01-05 | Danisco Us Inc | Variant lipases and uses thereof |
| WO2023034486A2 (en) | 2021-09-03 | 2023-03-09 | Danisco Us Inc. | Laundry compositions for cleaning |
| WO2023114932A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2023114936A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2023114939A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2023114988A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Variant maltopentaose/maltohexaose-forming alpha-amylases |
| WO2023168234A1 (en) | 2022-03-01 | 2023-09-07 | Danisco Us Inc. | Enzymes and enzyme compositions for cleaning |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
| WO2023250301A1 (en) | 2022-06-21 | 2023-12-28 | Danisco Us Inc. | Methods and compositions for cleaning comprising a polypeptide having thermolysin activity |
| WO2024050339A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Mannanase variants and methods of use |
| WO2024050346A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Detergent compositions and methods related thereto |
| WO2024050343A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Subtilisin variants and methods related thereto |
| WO2024102698A1 (en) | 2022-11-09 | 2024-05-16 | Danisco Us Inc. | Subtilisin variants and methods of use |
| DE102022213537A1 (de) | 2022-12-13 | 2024-06-13 | Henkel Ag & Co. Kgaa | Wasch- und reinigungsmittel enthaltend protease |
| WO2024125930A1 (de) * | 2022-12-13 | 2024-06-20 | Henkel Ag & Co. Kgaa | Wasch- und reinigungsmittel enthaltend protease |
| DE102022213538A1 (de) | 2022-12-13 | 2024-06-13 | Henkel Ag & Co. Kgaa | Wasch- und reinigungsmittel enthaltend protease |
| WO2024163584A1 (en) | 2023-02-01 | 2024-08-08 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2024186819A1 (en) | 2023-03-06 | 2024-09-12 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2024191711A1 (en) | 2023-03-16 | 2024-09-19 | Nutrition & Biosciences USA 4, Inc. | Brevibacillus fermentate extracts for cleaning and malodor control and use thereof |
| WO2025071996A1 (en) | 2023-09-28 | 2025-04-03 | Danisco Us Inc. | Variant cutinase enzymes with improved solubility and uses thereof |
| WO2025085351A1 (en) | 2023-10-20 | 2025-04-24 | Danisco Us Inc. | Subtilisin variants and methods of use |
Also Published As
| Publication number | Publication date |
|---|---|
| US20160222368A1 (en) | 2016-08-04 |
| CN105593365A (zh) | 2016-05-18 |
| CN105593365B (zh) | 2021-08-27 |
| JP6678108B2 (ja) | 2020-04-08 |
| EP3044313A1 (en) | 2016-07-20 |
| EP3044313B1 (en) | 2019-11-06 |
| EP3653707A1 (en) | 2020-05-20 |
| DK3044313T3 (da) | 2020-02-17 |
| JP2016537011A (ja) | 2016-12-01 |
| EP3653707B1 (en) | 2025-07-16 |
| BR112016005286A2 (pt) | 2017-09-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12305205B2 (en) | AprL-clade protease variants and uses thereof | |
| EP3044313B1 (en) | Compositions and methods comprising lg12-clade protease variants | |
| EP3268471B1 (en) | Compositions and methods comprising lg12-clade protease variants | |
| US10696958B2 (en) | Metalloproteases | |
| US20200407703A1 (en) | Serine proteases of bacillus species | |
| US20190264187A1 (en) | Novel metalloproteases | |
| EP3882346B1 (en) | Novel metalloproteases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14784386 Country of ref document: EP Kind code of ref document: A1 |
|
| REEP | Request for entry into the european phase |
Ref document number: 2014784386 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014784386 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2016542111 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15021681 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112016005286 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112016005286 Country of ref document: BR Kind code of ref document: A2 Effective date: 20160310 |