WO2014144649A1 - Generation of acyl amino acids - Google Patents

Generation of acyl amino acids Download PDF

Info

Publication number
WO2014144649A1
WO2014144649A1 PCT/US2014/029150 US2014029150W WO2014144649A1 WO 2014144649 A1 WO2014144649 A1 WO 2014144649A1 US 2014029150 W US2014029150 W US 2014029150W WO 2014144649 A1 WO2014144649 A1 WO 2014144649A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
domain
acyl
engineered
peptide synthetase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/029150
Other languages
English (en)
French (fr)
Inventor
Kevin A. Jarrell
Gabriel O. Reznik
Prashanth Vishwanath
Michelle PYNN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Modular Genetics Inc
Original Assignee
Modular Genetics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN202311749532.0A priority Critical patent/CN117965408A/zh
Priority to CN201480026841.8A priority patent/CN105531367A/zh
Priority to EP14764638.4A priority patent/EP2970928A4/en
Priority to JP2016502994A priority patent/JP6741572B2/ja
Priority to CA2907229A priority patent/CA2907229A1/en
Priority to US14/776,805 priority patent/US9970036B2/en
Application filed by Modular Genetics Inc filed Critical Modular Genetics Inc
Priority to BR112015023453A priority patent/BR112015023453A2/pt
Publication of WO2014144649A1 publication Critical patent/WO2014144649A1/en
Anticipated expiration legal-status Critical
Priority to US15/978,634 priority patent/US10640799B2/en
Priority to US16/823,173 priority patent/US11155843B2/en
Priority to US17/481,290 priority patent/US12031167B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/02Amides, e.g. chloramphenicol or polyamides; Imides or polyimides; Urethanes, i.e. compounds comprising N-C=O structural element or polyurethanes
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N37/00Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids
    • A01N37/36Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing at least one carboxylic group or a thio analogue, or a derivative thereof, and a singly bound oxygen or sulfur atom attached to the same carbon skeleton, this oxygen or sulfur atom not being a member of a carboxylic group or of a thio analogue, or of a derivative thereof, e.g. hydroxy-carboxylic acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07CACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C235/00Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms
    • C07C235/02Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton
    • C07C235/04Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton the carbon skeleton being acyclic and saturated
    • C07C235/06Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton the carbon skeleton being acyclic and saturated having the nitrogen atoms of the carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/78Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y603/00Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/02Acid—amino-acid ligases (peptide synthases)(6.3.2)

Definitions

  • Acyl amino acids are commercially important compounds. Many have advantageous characteristics and are sold as surfactants, antibiotics, anti-insect agents and as a variety of other important agents.
  • acyl amino acids have been manufactured chemically.
  • Such chemical manufacturing methods are hampered by a variety of shortcomings including the ease of obtaining and storing the starting materials, the necessity of using harsh and sometimes dangerous chemical reagents in the manufacturing process, the difficulty and efficiency of the synthesis itself, the fiscal and environmental cost of disposing of chemical by-products, etc.
  • new compositions and methods for the efficient and cost-effective synthesis of acyl amino acids and manufacture on a commercial scale would be beneficial.
  • the present invention comprises compositions and methods useful in the generation of acyl amino acids.
  • the present invention provides an engineered polypeptide comprising a peptide synthetase domain; in some such embodiments, the engineered polypeptide comprises only a single peptide synthetase domain.
  • the present invention provides an engineered peptide synthetase that is substantially free of a thioesterase domain, and/or a reductase domain.
  • the present invention provides an acyl amino acid composition comprising a plurality of different forms of an acyl amino acid. In some such compositions, substantially all of the acyl amino acids within the composition contain the same amino acid moiety and differ with respect to acyl moiety. We also described populations where the fatty acid si for example 95% one length (C14, myristic)
  • the present invention provides a method of making an acyl amino acid composition by contacting an engineered peptide synthetase with an amino acid substrate and an acyl entity substrate for the engineered peptide synthetase, under conditions and for a time sufficient for an acyl amino acid composition to be made.
  • the method comprises providing a cell engineered to express the engineered peptide synthetase.
  • the engineered peptide synthetase does not include a thioesterase domain; in some embodiments, the engineered peptide synthestase does not include a reductase domain; in some embodiments, the engineered peptide synthetase includes neither a thioesterase domain not a reductase domain.
  • an amino acid substrate is or comprises an amino acid as set forth herein.
  • an acyl entity substrate is or comprises a fatty acid moiety. In some embodiments, an acyl entity substrate is or comprises a fatty acid.
  • the present invention provides cells engineered to express at least one engineered peptide synthetase that synthesizes an acyl amino acid.
  • the present invention comprises an an acyl amino acid composition produced by an engineered peptide synthetase.
  • the present invention provides methods of preparing a product comprising: providing or obtaining an acyl amino acid composition prepared in an engineered host (e.g., microbial) cell; optionally enriching the acyl amino acid composition for a particular acyl amino acid; and, in some embodiments, combining the enriched acyl amino acid composition with at least one other component to produce a product.
  • an engineered host e.g., microbial
  • the invention provides a method comprising steps of:
  • an engineered peptide synthetase polypeptide that comprises a single peptide synthetase domain and lacks either of a thioesterase domain, and/or a reductase domain with (i) an amino acid substate of the peptide synthetase polypeptide; and (ii) an acyl moiety substrate of the peptide synthetase polypeptide, the contacting being performed under conditions and for a time sufficient that the engineered peptide synthetase polypeptide covalently links the acyl moiety from the acyl moiety substrate to the amino acid so that an acyl amino acid is generated.
  • acyl amino acid refers to an amino acid that is covalently linked to a fatty acid moiety.
  • the amino acid and fatty acid are covalently linked via an amide bond formed between a carboxylic acid group of a fatty acid and an amino group of an amino acid.
  • a fatty acid moiety or entity utilized or included in an acyl amino acid includes a ⁇ -hydroxyl group; in some embodiments, a fatty acid moiety or entity utilized or included in an acyl amino acid does not include a ⁇ - hydroxyl group.
  • a fatty acid moiety utilized or included in an acyl amino acid includes a ⁇ -amino group; in some embodiments, a fatty acid moiety or entity utilized or included in an acyl amino acid does not include a ⁇ -aminno group. In some embodiments, a fatty acid moiety utilized or included in an acyl amino acid is unmodified at the ⁇ -position.
  • amino acid in its broadest sense, refers to any compound and/or substance that can be utilized in peptide synthesis (e.g., ribosomal or non- ribosomal synthesis).
  • an amino acid is any compound and/or substance that can be incorporated into a polypeptide chain, e.g., through formation of one or more peptide bonds.
  • an amino acid is any compound and/or substance that is a substrate for a peptide synthetase; in some such embodiments, an amino acid is any compound and/or substance onto which a peptide synthetase can link an acyl entity, for example through formation of an amide bond.
  • an amino acid has the general structure H 2 N-C(H)(R)-COOH.
  • an amino acid is a naturally-occurring amino acid.
  • an amino acid is a synthetic amino acid; in some embodiments, an amino acid is a D-amino acid; in some embodiments, an amino acid is an L-amino acid.
  • Standard amino acid refers to any of the twenty standard L-amino acids commonly found in naturally occurring peptides.
  • Nonstandard amino acid refers to any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or obtained from a natural source.
  • an amino acid, including a carboxy- and/or amino- terminal amino acid in a polypeptide can contain a structural modification as compared with the general structure above.
  • an amino acid may be modified by methylation, amidation, acetylation, and/or substitution as compared with the general structure.
  • such modification may, for example, alter the circulating half life of a polypeptide containing the modified amino acid as compared with one containing an otherwise identical unmodified amino acid.
  • such modification does not
  • amino acid is used to refer to a free amino acid; in some embodiments it is used to refer to an amino acid residue of a polypeptide.
  • a "naturally occurring" amino acid is one of the standard group of twenty amino acids that are the building blocks of polypeptides of most organisms, including alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.
  • a "naturally occurring" amino acid may be one of those amino acids that are used less frequently and are typically not included in this standard group of twenty but are nevertheless still used by one or more organisms and incorporated into certain
  • the codons UAG and UGA normally encode stop codons in most organisms. However, in some organisms the codons UAG and UGA encode the amino acids selenocysteine and pyrrolysine. Thus, in certain embodiments, selenocysteine and pyrrolysine are naturally occurring amino acids.
  • Two events or entities are "associated" with one another, as that term is used herein, if the presence, level and/or form of one is correlated with that of the other.
  • a particular entity e.g., polypeptide
  • two or more entities are physically "associated” with one another if they interact, directly or indirectly, so that they are and remain in physical proximity with one another.
  • two or more entities that are physically associated with one another are covalently linked to one another; in some embodiments, two or more entities that are physically associated with one another are not covalently linked to one another but are non- covalently associated, for example by means of hydrogen bonds, van der Waals interaction, hydrophobic interactions, magnetism, and combinations thereof.
  • Beta-hydroxy fatty acid linkage domain refers to a polypeptide domain that covalently links a beta-hydroxy fatty acid to an amino acid to form an acyl amino acid.
  • a variety of beta-hydroxy fatty acid linkage domains are known to those skilled in the art. However, different beta-hydroxy fatty acid linkage domains often exhibit specificity for one or more beta-hydroxy fatty acids.
  • the beta-hydroxy fatty acid linkage domain from surfactin synthetase is specific for the beta-hydroxy myristic acid, which contains 13 to 15 carbons in the fatty acid chain.
  • beta-hydroxy fatty acid linkage domain from surfactin synthetase can be used in accordance with the present invention to construct an engineered polypeptide useful in the generation of an acyl amino acid that comprises the fatty acid beta-hydroxy myristic acid.
  • Beta-hydroxy fatty acid refers to a fatty acid chain comprising a hydroxy group at the beta position of the fatty acid chain. As is understood by those skilled in the art, the beta position corresponds to the third carbon of the fatty acid chain, the first carbon being the carbon of the carboxylate group. Thus, when used in reference to an acyl amino acid of the present invention, where the carboxylate moiety of the fatty acid has been covalently attached to the nitrogen of the amino acid, the beta position corresponds to the carbon two carbons removed from the carbon having the ester group.
  • a beta- hydroxy fatty acid to be used in accordance with the present invention may contain any number of carbon atoms in the fatty acid chain.
  • a beta-hydroxy fatty acid may contain 3, 4, 5, 6, 7, 8,9, 10, 11, 12, 3, 14, 15, 15, 16, 17, 18, 19, 20 or more carbon atoms.
  • Beta- hydroxy fatty acids to be used in accordance with the present invention may contain linear carbon chains, in which each carbon of the chain, with the exception of the terminal carbon atom and the carbon attached to the nitrogen of the amino acid, is directly covalently linked to two other carbon atoms.
  • beta-hydroxy fatty acids to be used in accordance with the present invention may contain branched carbon chains, in which at least one carbon of the chain is directly covalently linked to three or more other carbon atoms.
  • Beta- hydroxy fatty acids to be used in accordance with the present invention may contain one or more double bonds between adjacent carbon atoms.
  • beta-hydroxy fatty acids to be used in accordance with the present invention may contain only single-bonds between adjacent carbon atoms.
  • a non-limiting exemplary beta-hydroxy fatty acid that may be used in accordance with the present invention is or comprises a beta-hydroxy, acid which contains 13 to 15 carbons in the fatty acid chain; in some embodiments, an exemplary beta-hydroxy fatty acid that may be used in accordance with the present invention is or comprises myristic acid myrisitc is usually used to mean 14 carbons Those of ordinary skill in the art will be aware of various beta-hydroxy fatty acids that can be used in accordance with the present invention.
  • beta-hydroxy fatty acid linkage domains that exhibit specificity for other beta-hydroxy fatty acids (e.g., naturally or non-naturally occurring beta-hydroxy fatty acids) may be used in accordance with the present invention to generate any acyl amino acid of the practitioner's choosing.
  • Characteristic sequence element refers to a sequence element found in a polymer (e.g., in a polypeptide or nucleic acid) that represents a characteristic portion of that polymer.
  • presence of a characteristic sequence element correlates with presence or level of a particular activity or property of the polymer.
  • presence (or absence) of a characteristic sequence element defines a particular polymer as a member (or not a member) of a particular family or group of such polymers.
  • a characteristic sequence element typically comprises at least two monomers (e.g., amino acids or nucleotides).
  • a characteristic sequence element includes at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, or more monomers (e.g., contiguously linked monomers).
  • a characteristic sequence element includes at least first and second stretches of continguous monomers spaced apart by one or more spacer regions whose length may or may not vary across polymers that share the sequence element.
  • Combination therapy refers to those situations in which a subject is simultaneously exposed to two or more therapeutic agents. In some embodiments, such agents are administered simultaneously; in some embodiments, such agents are administered sequentially; in some embodiments, such agents are administered in overlapping regimens.
  • Comparable refers to two or more agents, entities, situations, sets of conditions, etc that may not be identical to one another but that are sufficiently similar to permit comparison therebetween so that conclusions may reasonably be drawn based on differences or similarities observed. Those of ordinary skill in the art will understand, in context, what degree of identity is required in any given circumstance for two or more such agents, entities, situations, sets of conditions, etc to be considered comparable.
  • corresponding to is often used to designate the position/identity of a residue in a polymer, such as an amino acid residue in a polypeptide or a nucleotide residue in a nucleic acid.
  • residues in such a polymer are often designated using a canonical numbering system based on a reference related polymer, so that a residue in a first polymer "corresponding to" a residue at position 190 in the reference polymer, for example, need not actually be the 190 th residue in the first polymer but rather corresponds to the residue found at the 190 th position in the reference polymer; those of ordinary skill in the art readily appreciate how to identify "corresponding" amino acids, including through use of one or more
  • Domain, Polypeptide domain The terms "domain” and "polypeptide domain” as used herein generally refer to polypeptide moieties that display a particular activity, even when isolated (e.g., cleaved) from other polypeptides or polypeptide domains. In some embodiments, a polypeptide domain folds into a particular discrete structure in three-dimensional space. In some embodiments, a polypeptide domain within a longer polypeptide is separated from one or more other polypeptide domains within the longer polypeptide by virture of a linker element, for example, that may comprise a substantially unstructured stretch of amino acids.
  • a linker element for example, that may comprise a substantially unstructured stretch of amino acids.
  • the terms refer to domains that naturally occur in longer polypeptides; in some embodiments, the term refers to engineered polypeptide moieties that correspond and/or show significant homology and/or identity to such naturally occurring polypeptide moieties, or to other reference polypeptide moieties (e.g., historical engineered moieties). In some embodiments, an engineered domain that corresponds and/or shows significant homology and/or identity to a naturally occurring or other reference moiety shares a characteristic structure (e.g., primary structure such as the amino acid sequence of the domain, and/or secondary, tertiary, quaternary, etc. structures); alternatively or additionally, such an engineered domain may exhibit one or more distinct functions that it shares with its reference polypeptide moieties.
  • a characteristic structure e.g., primary structure such as the amino acid sequence of the domain, and/or secondary, tertiary, quaternary, etc. structures
  • polypeptides are modular and are comprised of one or more polypeptide domains; in some such embodiments, each domain exhibits one or more distinct functions that contribute to the overall function of the polypeptide. In some embodiments, the structure and/or function of many such domains are known to those skilled in the art.
  • Engineered refers to a non-naturally occurring moiety that has been created by the hand of man.
  • an “engineered polypeptide” refers to a polypeptide that has been designed and/or produced by the hand of man.
  • an engineered polypeptide has an amino acid sequence that includes one or more sequence elements that do(es) not occur in nature.
  • an engineered polypeptide has an amino acid sequence that includes one or more sequence elements that does occur in nature, but that is present in the engineered polypeptide in a different sequence context (e.g., separated from at least one sequence to which it is linked in nature and/or linked with at least one sequence element to which it is not linked in nature) from that in which it occurs in nature.
  • an engineered polypeptide is one in which naturally- occurring sequence element(s) is/are separated from at least one sequence with which they/it is associated (e.g., linked) in nature and/or is otherwise manipulated to comprise a polypeptide that does not exist in nature.
  • an engineered polypeptide comprises two or more covalently linked polypeptide domains.
  • engineered polypeptides of the present invention comprise two or more covalently linked domains, at least one of which is naturally occurring.
  • two or more naturally occurring polypeptide domains are covalently linked to generate an engineered polypeptide.
  • naturally occurring polypeptide domains from two or more different polypeptides may be covalently linked to generate an engineered polypeptide.
  • naturally occurring polypeptide domains of an engineered polypeptide are covalently linked in nature, but are covalently linked in the engineered polypeptide in a way that is different from the way the domains are linked nature.
  • two polypeptide domains that naturally occur in the same polypeptide but which are separated by one or more intervening amino acid residues may be directly covalently linked (e.g., by removing the intervening amino acid residues) to generate an engineered polypeptide of the present invention.
  • two polypeptide domains that naturally occur in the same polypeptide which are directly covalently linked together may be indirectly covalently linked (e.g., by inserting one or more intervening amino acid residues) to generate an engineered polypeptide of the present invention.
  • one or more covalently linked polypeptide domains of an engineered polypeptide may not exist naturally. For example, such polypeptide domains may be engineered themselves.
  • Fatty acid linkage domain refers to a polypeptide domain that covalently links a fatty acid to an amino acid to form an acyl amino acid.
  • a fatty acid linkage domain is a condensation domain; in some embodiments such a fatty acid linkage domain is part of a single polypeptide or a polypeptide complex with at least or only an adenylkation domain, a thiolation domain, or both.
  • a variety of fatty acid linkage domains are known in the art, such as for example, fatty acid linkage domains present in various peptide synthetase complexes that produce lipopeptides.
  • a fatty acid linkage domain links a beta-hydroxy fatty acid to an amino acid; in some embodiments, a fatty acid linkage domain links a beta-amino fatty acid to an amino acid; in some embodiments, a fatty acid linkage domain links a fatty acid that is unmodified at the beta position to an amino acid. In some embodiments, a fatty acid linkage domain catalyzes condensation of a fatty acid and an amino acid so that an amide both is formed, for example between a carboxylic acid moiety on a fatty acid and an amino moiety on an amino acid.
  • homology refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules.
  • polymeric molecules are considered to be “homologous” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical.
  • polymeric molecules are considered to be "homologous" to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%), 85%), 90%), 95%, or 99% similar (e.g., containing residues with related chemical properties at corresponding positions).
  • certain amino acids are typically classified as similar to one another as “hydrophobic” or “hydrophilic”amino acids, and/or as having "polar” or “non-polar” side chains. Substitution of one amino acid for another of the same type may often be considered a "homologous" substitution.
  • Typical amino acid categorizations are summarized below:
  • the length of a sequence aligned for comparison purposes is at least 30%, at least 40%>, at least 50%>, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence.
  • the nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position; when a position in the first sequence is occupied by a similar nucleotide as the corresponding position in the second sequence, then the molecules are similar at that position.
  • the percent homology between the two sequences is a function of the number of identical and similar positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
  • Representative algorithms and computer programs useful in determining the percent homology between two nucleotide sequences include, for example, the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • the percent homology between two nucleotide sequences can, alternatively, be determined for example using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.
  • Identity refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules.
  • polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical.
  • the length of a sequence aligned for comparison purposes is at least 30%, at least 40%>, at least 50%>, at least 60%>, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence.
  • the nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
  • Representative algorithms and computer programs useful in determinng the percent identity between two nucleotide sequences include, for example, the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • the percent identity between two nucleotide sequences can, alternatively, be determined for example using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.
  • Isolated refers to a substance and/or entity that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and/or in an experimental setting), and/or (2) designed, produced, prepared, and/or manufactured by the hand of man. Isolated substances and/or entities may be separated from about 10%>, about 20%>, about 30%>, about 40%>, about 50%>, about 60%>, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%o, about 97%, about 98%>, about 99%, or more than about 99% of the other components with which they were initially associated.
  • isolated agents are about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%), about 98%>, about 99%, or more than about 99% pure.
  • a substance is "pure” if it is substantially free of other components.
  • a substance may still be considered “isolated” or even “pure”, after having been combined with certain other components such as, for example, one or more carriers or excipients (e.g., buffer, solvent, water, etc.); in such embodiments, percent isolation or purity of the substance is calculated without including such carriers or excipients.
  • isolation involves or requires disruption of covalent bonds (e.g., to isolate a polypeptide domain from a longer polypeptide and/or to isolate a nucleotide sequence element from a longer oligonucleotide or nucleic acid).
  • Naturally occurring refers to an agent or entity that is known to exist in nature.
  • nucleic acid refers to any compound and/or substance that is or can be incorporated into an oligonucleotide chain.
  • a nucleic acid is a compound and/or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage.
  • nucleic acid refers to individual nucleic acid residues (e.g., nucleotides and/or nucleosides); in some embodiments, “nucleic acid” refers to an oligonucleotide chain comprising individual nucleic acid residues.
  • a "nucleic acid” is or comprises R A; in some embodiments, a “nucleic acid” is or comprises DNA.
  • a nucleic acid is, comprises, or consists of one or more natural nucleic acid residues.
  • a nucleic acid is, comprises, or consists of one or more nucleic acid analogs.
  • a nuclic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone.
  • a nucleic acid is, comprises, or consists of one or more "peptide nucleic acids", which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention.
  • a nucleic acid has one or more phosphorothioate and/or 5'-N-phosphoramidite linkages rather than phosphodiester bonds.
  • a nucleic acid is, comprises, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxy cytidine).
  • adenosine thymidine, guanosine, cytidine
  • uridine deoxyadenosine
  • deoxythymidine deoxyguanosine
  • deoxy cytidine deoxy cytidine
  • a nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2- aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5- methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5- bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8- oxoguanosine, 0(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations
  • a nucleic acid comprises one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids.
  • a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or protein.
  • a nucleic acid includes one or more introns.
  • nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis.
  • a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long.
  • Peptide synthetase complex refers to an enzyme that catalyzes the non-ribosomal production of peptides.
  • peptide synthetase complexes are modular, and are comprised of individual peptide synthetase modules that perform different steps in the synthesis of the ultimate peptide; typically, each module performs one step (e.g., adds a single amino acid).
  • a peptide synthetase complex may comprise a single enzymatic subunit (e.g., a single polypeptide), or may comprise two or more enzymatic subunits (e.g., two or more polypeptides).
  • a peptide synthetase complex typically comprises at least one peptide synthetase domain, and may further comprise one or more additional domains such as for example, a fatty acid linkage domain, a thioesterase domain, a reductase domain, etc.
  • Peptide synthetase domains of a peptide synthetase complex may comprise two or more enzymatic subunits, with two or more peptide synthetase domains present in a given enzymatic subunit.
  • the surfactin peptide synthetase complex (also referred to herein simply as "surfactin synthetase complex") comprises three distinct polypeptide enzymatic subunits: the first two subunits comprise three peptide synthetase domains, while the third subunit comprises a single peptide synthetase domain.
  • Peptide synthetase domain refers to a polypeptide domain that minimally comprises three domains: an adenylation (A) domain, responsible for selectively recognizing and activating a specific amino acid, a thiolation (T) domain, which tethers the activated amino acid to a cofactor via thioester linkage, and a condensation (C) domain, which links amino acids joined to successive units of the peptide synthetase by the formation of amide bonds.
  • a peptide synthetase domain typically recognizes and activates a single, specific amino acid, and in the situation where the peptide synthetase domain is not the first domain in the pathway, links the specific amino acid to the growing peptide chain.
  • Polypeptide refers to a series of amino acids joined together in peptide linkages.
  • a polypeptide has a structure as achieve through synthesis by ribosomal machinery in naturally occurring organisms.
  • a "polpeptide” has a structure as achieved through chemical synthesis (e.g., in vitro).
  • a "polypeptide” has a structure as achieved through joining of a series of amino acids joined together by non-ribosomal machinery, such as by way of non- limiting example, polypeptides synthesized by peptide synthetases.
  • non-ribosomally produced polypeptides exhibit a greater diversity in covalent linkages than polypeptides synthesized by ribosomes (although those skilled in the art will understand that the amino acids of ribosomally-produced polypeptides may also be linked by covalent bonds that are not peptide bonds, such as the linkage of cystines via di-sulfide bonds).
  • the term is used to refer to specific functional classes of polypeptides, such as, for example, autoantigen polypeptides, nicotinic acetylcholine receptor polypeptides, alloantigen polypeptides, etc.
  • polypeptide refers to any member of the class that shows significant sequence homology or identity with a relevant reference polypeptide. In many embodiments, such member also shares significant activity with the reference polypeptide.
  • a member polypeptide shows an overall degree of sequence homology or identity with a reference polypeptide that is at least about 30-40%, and is often greater than about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%), 95%), 96%), 97%), 98%>, 99% or more and/or includes at least one region (i.e., a conserved region, often including a characteristic sequence element) that shows very high sequence identity, often greater than 90%> or even 95%, 96%, 97%, 98%, or 99%.
  • a conserved region usually encompasses at least 3-4 and often up to 20 or more amino acids; in some embodiments, a conserved region encompasses at least one stretch of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
  • Polypeptides can be two or more amino acids in length, although most polypeptides produced by ribosomes and peptide synthetases are longer than two amino acids.
  • polypeptides may be 2, 3, 4, 5, 6, 7, 8,9, 10,
  • reductase domain refers to a polypeptide domain that catalyzes release of an acyl amino acid produced by a peptide synthetase complex from the peptide synthetase complex.
  • a reductase domain is covalently linked to a peptide synthetase domain and a fatty acid linkage domain such as a beta-hydroxy fatty acid linkage domain to generate an engineered polypeptide useful in the synthesis of an acyl amino acid.
  • a variety of reductase domains are found in nature in nonribosomal peptide synthetase complexes from a variety of species.
  • a non- limiting example of a reductase domain that may be used in accordance with the present invention includes the reductase domain from linear gramicidin (ATCC8185). However, any reductase domain that releases an acyl amino acid produced by a peptide synthetase complex from the peptide synthetase complex may be used in accordance with the present invention. In some
  • reductase domains are characterized by the presence of the consensus sequence: [LIVSPADNK]-x(9)- ⁇ P ⁇ -x(2)-Y-[PSTAGNCV]-[STAGNQCIVM]-[STAGC]-K- ⁇ PC ⁇ - [SAGFYR]-[LIVMSTAGD]-x- ⁇ K ⁇ -[LIVMFYW]- ⁇ D ⁇ -x- ⁇ YR ⁇ -[LIVMFYWGAPTHQ]- [GSACQRHM] (SEQ ID NO: 1), where square brackets ("[]”) indicate amino acids that are typically present at that position, squiggly brackets (" ⁇ ”) indicate amino acids that amino acids that are typically not present at that position, and "x” denotes any amino acid or a gap.
  • X(9) for example denotes any amino acids or gaps for nine consecutive positions.
  • Small molecule means a low molecular weight organic compound that may serve as an enzyme substrate or regulator of biological processes.
  • a "small molecule” is a molecule that is less than about 5 kilodaltons (kD) in size.
  • provided nanoparticles further include one or more small molecules.
  • the small molecule is less than about 4 kD, 3 kD, about 2 kD, or about 1 kD.
  • the small molecule is less than about 800 daltons (D), about 600 D, about 500 D, about 400 D, about 300 D, about 200 D, or about 100 D.
  • a small molecule is less than about 2000 g/mol, less than about 1500 g/mol, less than about 1000 g/mol, less than about 800 g/mol, or less than about 500 g/mol.
  • one or more small molecules are encapsulated within the nanoparticle.
  • small molecules are non-polymeric.
  • small molecules are not proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, polysaccharides, glycoproteins, proteoglycans, etc.
  • a small molecule is a therapeutic.
  • a small molecule is an adjuvant.
  • a small molecule is a drug.
  • Surfactin is cyclic lipopeptide that is naturally produced by certain bacteria, including the Gram-positive endospore-forming bacteria Bacillus subtilis. Surfactin is an amphiphilic molecule (having both hydrophobic and hydrophilic properties) and is thus soluble in both organic solvents and water. Surfactin exhibits exceptional surfactant properties, making it a commercially valuable molecule. Due to its surfactant properties, surfactin also functions as an antibiotic. For example, surfactin is known to be effective as an anti-bacterial, anti-viral, anti-fungal, anti-mycoplasma and hemolytic compound.
  • Surfactin is capable of penetrating the cell membranes of all types of bacteria, including both Gram-negative and Gram- positive bacteria, which differ in the composition of their membrane.
  • Gram-positive bacteria have a thick peptidoglycan layer on the outside of their phospholipid bilayer.
  • Gram- negative bacteria have a thinner peptidoglycan layer on the outside of their phospholipid bilayer, and further contain an additional outer lipopolysaccharide membrane.
  • Surfactin's surfactant activity permits it to create a permeable environment for the lipid bilayer and causes disruption that solubilizes the membrane of both types of bacteria.
  • the minimum inhibitory concentration (MIC) is in the range of 12- 50 ⁇ g/ml.
  • surfactin In addition to its antibacterial properties, surfactin also exhibits antiviral properties, and its known to disrupt enveloped viruses such as HIV and HSV. Surfactin not only disrupts the lipid envelope of viruses, but also their capsids through ion channel formations. Surfactin iso forms containing fatty acid chains with 14 or 15 carbon atoms exhibited improved viral inactivation, thought to be due to improved disruption of the viral envelope. Surfactin consists of a seven amino acid peptide loop, and a hydrophobic fatty acid chain (beta-hydroxy myristic acid) that is thirteen to fifteen carbons long. The fatty acid chain allows permits surfactin to penetrate cellular membranes.
  • the peptide loop comprises the amino acids L-asparagine, L- leucine, glycine, L-leucine, L-valine and two D-leucines. Glycine and asparagine residues at positions 1 and 6 respectively, constitute a minor polar domain. On the opposite side, valine residue at position 4 extends down facing the fatty acid chain, making up a major hydrophobic domain.
  • Surfactin is synthesized by the surfactin synthetase complex, which comprises the three surfactin synthetase polypeptide subunits SrfA-A, SrfA-B, and SrfA-C.
  • the surfactin synthetase polypeptide subunits SrfA-A and SrfA-B each comprise three peptide synthetase domains, each of which adds a single amino acid to the growing surfactin peptide, while the monomodular surfactin synthetase polypeptide subunit SrfA-C comprises a single peptide synthetase domain and adds the last amino acid residue to the heptapeptide.
  • the SrfA-C subunit comprises a thioesterase domain, which catalyzes the release of the product via a nucleophilic attack of the beta-hydroxy of the fatty acid on the carbonyl of the C-terminal Leu of the peptide, cyclizing the molecule via formation of an ester.
  • the spectrum of the beta-hydroxy fatty acids was elucidated as iso, anteiso CI 3, iso, normal C14 and iso, anteiso CI 5, and a recent study has indicated that surfactin retains an R configuration at C-beta (Nagai et al., Study on surfactin, a cyclic depsipeptide. 2.
  • Surfactin B2 produced by Bacillus natto KMD 2311. Chem Pharm Bull (Tokyo) 44: 5-10, 1996).
  • Surfactin is a lipopeptide synthesized by the surfactin synthetase complex. Surfactin comprises seven amino acids, which are initially joined by peptide bonds, as well as a beta- hydroxy fatty acid covalently linked to the first amino acid, glutamate.
  • the polypeptide upon addition the final amino acid (leucine), the polypeptide is released and the thioesterase domain of the SRFC protein catalyzes the release of the product via a nucleophilic attack of the beta-hydroxy of the fatty acid on the carbonyl of the C-terminal Leu of the peptide, cyclizing the molecule via formation of an ester, resulting in the C-terminus carboxyl group of leucine attached via a lactone bond to the b-hydroxyl group of the fatty acid.
  • Thioesterase domain refers to a polypeptide domain that catalyzes release of an acyl amino acid produced by a peptide synthetase complex from the peptide synthetase complex.
  • a variety of thioesterase domains are found in nature in nonribosomal peptide synthetase complexes from a variety of species.
  • a non- limiting example of a thioesterase domain that may be used in accordance with the present invention includes the thioesterase domain from the Bacillus subtilis surfactin synthetase complex, present in Srf-C subunit.
  • thioesterase domains are characterized by the presence of the consensus sequence: [LIV]- ⁇ KG ⁇ -[LIVFY]-[LIVMST]- G-[HYWV]-S- ⁇ YAG ⁇ -G-[GSTAC] (SEQ ID NO: 2), where square brackets ("[]”) indicate amino acids that are typically present at that position, and squiggly brackets (" ⁇ ") indicate amino acids that amino acids that are typically not present at that position.
  • compositions of the present invention comprise engineered polypeptides that are useful in the production of acyl amino acids.
  • engineered polypeptides of the present invention comprise a peptide synthetase domain.
  • the present invention encompasses the recognition that a single peptide synthetase domain, not associated (e.g., not associated covalently and/or not otherwise associated) with, for example, another domain typically found in a peptide synthetase complex (e.g., a fatty acid linkage domain, a thioesterase domain, a reductase domain, etc. and/or a combination thereof), can be sufficient to produce an acyl amino acid as described herein.
  • peptide synthetase domains useful for the production of acyl amino acids as described herein correspond and/or show significant homology and/or identity to a first peptide synthetase domain found in a naturally-occurring peptide synthetase complex. That is, as is known in the art, some peptide synthetase domains (i.e., some polypeptides comprising adenylation (A), thiolation (T), and condensation (C) domains) catalyze condensation of a fatty acid with an amino acid, and some catalyze condensation of two amino acids with one another.
  • A adenylation
  • T thiolation
  • C condensation
  • peptide synthetase domains useful for the production of acyl amino acids as described herein are those that catalyze condensation of an amino acid with a fatty acid; such peptide synthetase domains are typically utilized herein in a form (e.g., as part of a polypeptide) that is separated from and/or does not include another peptide synthetase domain.
  • Many naturally-occurring peptide synthetase domains are found in nature within peptide synthetase complexes that synthesize lipopeptides.
  • Such peptide synthetase complexes are multienzymatic complexes found in both prokaryotes and eukaryotes, and comprising one or more enzymatic subunits that catalyze the non-ribosomal production of a variety of peptides (see, for example, Kleinkauf et al., Annu. Rev. Microbiol. 41 :259-289, 1987; see also U.S. Patent Number 5,652,116 and U.S. Patent Number 5,795,738).
  • Non-ribosomal synthesis is also known as thiotemplate synthesis (see e.g., Kleinkauf et al).
  • Peptide synthetase complexes typically include one or more peptide synthetase domains that recognize specific amino acids and are responsible for catalyzing addition of the amino acid to the polypeptide chain.
  • the catalytic steps in the addition of amino acids typically include: recognition of an amino acid by the peptide synthetase domain, activation of the amino acid (formation of an amino-acyladenylate), binding of the activated amino acid to the enzyme via a thioester bond between the carboxylic group of the amino acid and an SH group of an enzymatic co-factor, which cofactor is itself bound to the enzyme inside each peptide synthetase domain, and formation of the peptide bonds among the amino acids.
  • a peptide synthetase domain comprises subdomains that carry out specific roles in these steps to form the peptide product.
  • One subdomain, the adenylation (A) domain is responsible for selectively recognizing and activating the amino acid that is to be incorporated by a particular unit of the peptide synthetase.
  • the activated amino acid is joined to the peptide synthetase through the enzymatic action of another subdomain, the thiolation (T) domain, that is generally located adjacent to the A domain.
  • Amino acids joined to successive units of the peptide synthetase are subsequently linked together by the formation of amide bonds catalyzed by another subdomain, the condensation (C) domain.
  • Peptide synthetase domains that catalyze the addition of D-amino acids often also have the ability to catalyze the recemization of L-amino acids to D-amino acids.
  • Peptide synthetase complexes also typically include a conserved thioesterase domain that terminates the growing amino acid chain and releases the product.
  • genes that encode peptide synthetase complexes have a modular structure that parallels the functional domain structure of the complexes (see, for example, Cosmina et al, Mol. Microbiol. 8:821, 1993; Kratzxchmar et al, J. Bacteriol. 171 :5422, 1989; Weckermann et al, Nuc. Acids res. 16: 11841, 1988; Smith et al., EMBO J. 9:741, 1990; Smith et al, EMBO J. 9:2743, 1990; MacCabe et al, J. Biol. Chem. 266:12646, 1991; Coque et al, Mol. Microbiol. 5: 1125, 1991; Diez et al, J. Biol. Chem. 265: 16358, 1990).
  • Nonribosomally-produced peptides often have non-linear structures, including cyclic structures exemplified by the peptides surfactin, cyclosporin, tyrocidin, and mycobacillin, or branched cyclic structures exemplified by the peptides polymyxin and bacitracin.
  • nonribosomally-produced peptides may contain amino acids not usually present in ribosomally-produced polypeptides such as for example norleucine, beta-alanine and/or ornithine, as well as D-amino acids.
  • nonribosomally- produced peptides may comprise one or more non-peptide moieties that are covalently linked to the peptide.
  • surfactin is a cyclic lipopeptide that comprises a beta- hydroxy fatty acid covalently linked to the first glutamate of the lipopeptide.
  • Other non-peptide moieties that are covalently linked to peptides produced by peptide synthetase complexes are known to those skilled in the art, including for example sugars, chlorine or other halogen groups, N-methyl and N-formyl groups, glycosyl groups, acetyl groups, etc.
  • each amino acid of the non ribosomally-produced peptide is specified by a distinct peptide synthetase domain.
  • the surfactin synthetase complex which catalyzes the polymerization of the lipopeptide surfactin consists of three enzymatic subunits. The first two subunits each comprise three peptide synthetase domains, whereas the third has only one. These seven peptide synthetase domains are responsible for the recognition, activation, binding and polymerization of L-Glu, L-Leu, D-Leu, L-Val, L-Asp, D-Leu and L-Leu, the amino acids present in surfactin.
  • a similar organization in discrete, repeated peptide synthetase domains occurs in various peptide synthetase genes in a variety of species, including bacteria and fungi, for example srfA (Cosmina et al., Mol. Microbiol. 8, 821-831, 1993), grsA and grsB (Kratzxchmar et al, J. Bacterial. 171, 5422-5429, 1989) tycA and tycB (Weckermann et al, Nucl. Acid. Res. 16, 11841-11843, 1988) and ACV from various fungal species (Smith et al, EMBO J.
  • Exemplary lipopeptides synthesized by peptide synthetase complexes in nature are listed below in Table 1 (See also the NORINE database, which provides access to information on peptides and lipopeptides that are known to be, or in some cases believed to be, produced by peptide synthetase enzymes; still further, see Segolene et al. (Ref 4)). Table 1
  • the present invention appreciates that, typically, in peptide synthetase complexes that synthesize lipopeptides, the first active peptide synthetase domain is the one that links a fatty acid to an amino acid; subsequent peptide synthetase domains typically add additional amino acids.
  • an acyl amino acid is prepared through use of an engineered peptide synthetase that comprises a first peptide synthetase domain found in a peptide synthetase complex that synthesizes a lipopeptide, and is engineered in that it is separated from at least some other domains found in the peptide synthetase complex.
  • Fatty acids utilized by naturally -occurring peptide synthetases can be ⁇ -hydroxy fatty acids (e.g., as found in surfactin and other ⁇ -hydroxy lipo-peptides described in Table 1). In other cases, utilized fatty acids are a ⁇ -amino fatty acid (for example, Iturin; see Table 1). In certain instances, utilized fatty acids are unmodified at the ⁇ -position (e.g., as in daptomycin and certain other lipo-peptides described in Table 1).
  • the present invention encompasses the appreciation that, for all three types of fatty acids utilized by peptide synthetases that synthesize lipopeptides, the first protein domain of the first module of the relevant peptide synthetase complex typically plays a critical role in lipo-initiation. However, the precise mechanism of lipo-initiation differs for each of the three types of fatty acid.
  • the first modules of a peptide synthetase enzyme which naturally creates a lipo-peptide, has a particular organization. Each module begins with a condensation domain that is required for the lipo-initiation reaction.
  • the condensation domain is followed by an adenylation domain, which is followed by a thiolation domain (also known as a peptidyl carrier protein (PCP) domain).
  • adenylation domain selects the 1st amino acid that will be incorporated into the lipo-peptide and creates an amino acid adenylate.
  • the amino acid becomes tethered to the enzyme via linkage to a phosphopantethione moiety, which is attached to the thiolation domain.
  • the chemical reaction that results in tethering of the amino acid releases AMP as a byproduct.
  • the condensation domain of the first module utilizes ⁇ -hydroxy fatty acid CoA as a substrate, and transfers the fatty acid to the N-terminus of the amino acid substrate, which is tethered to the thiolation domain.
  • No enzyme activity, other than the activity of the C-domain itself, is required for this particular reaction, although it has been reported that the srfD protein stimulates the lipo- initiation reaction (see whilr et al, which was cited in 7,981,685) (Ref 5).
  • the condensation domain has several sub-domains, each of which has a particular function (see Figure 6 of Duitman et al.) (Ref 6). Considering the iturin synthetase as a specific examples (also known as the
  • mycosubtilin synthetase the mechanism of lipo-initiation is the following (see Hansen et al., (Ref 7) and Aron et al., (Ref 8) for details): the acyl ligase domain adenylates a long-chain fatty acid (in this case myristic) and the fatty acid is then transferred to an enzyme-linked 4- phosphopantetheine and AMP is released, in a separate reaction, the fenF gene product catalyzes the transfer of malonate (from manonyl-CoA) to a second acyl carrier domain (located within module 1).
  • the ⁇ -ketoacyl synthetase domain catalyzes the condensation of the malonyl and acyl thioesters, creating a ⁇ -keto thioester, the B-keto thioester is converted into a ⁇ -amino fatty acid by a transaminase domain homologous to amino acid transferases, the ⁇ amino fatty acid is transferred to a thiolation domain and is then joined to the substrate amino acid (in this case asparagine), which was previously linked to the enzyme via the action of the module 1 adenylation domain. This series of reactions results in the joining of a beta-amino fatty acid to an amino acid.
  • the condensation domain of the 1st module catalyzes the transfer of the fatty acid to the N-terminus of the amino acid substrate, which is tethered to the thiolation domain.
  • the daptomycin synthetase two additional proteins are involved: an acyl-CoA ligase (DptE) (sequence listing GenBank: AAX31555.1) and an acyl carrier protein (DptF) (sequence listing GenBank: AAX31556.1).
  • DptE activates the fatty acid substrate by linking it to CoA, and the activated fatty acid is then transferred to DptF, and subsequently transferred to the enzyme- bound amino acid substrate (see Wittmann et al.) (Ref 9). Note that studies conducted in vitro have confirmed that DptE transfers the fatty acid to DptF, but experiments aimed at
  • Non-limiting examples of peptide synthetase complexes that may contain peptide synthetase domains useful in the identification, selection, design, and/or production of engineered peptide synthetases as described herein include, for example, surfactin synthetase, fengycin synthetase, arthrofactin synthetase, lichenysin synthetase, syringomycin synthetase, syringopeptin synthetase, saframycin synthetase, gramicidin synthetase, cyclosporin synthetase, tyrocidin synthetase, mycobacillin synthetase, polymyxin synthetase, bacitracin synthetase, and combinations thereof.
  • the present invention provides engineered peptide synthetases, which in some embodiments comprise or consist of isolated peptide synthetase domains from reference peptide synthetase complexes that synthesize lipopeptides.
  • reference peptide synthetase complexes are known peptide synthetase complexes.
  • reference peptide synthetase complexes are naturally occurring peptide synthetase complexes.
  • provided engineered peptide synthetases comprise or consist of a single peptide synthetase domain.
  • provided engineered peptide synthetases comprises or consist of a first peptide synthetase domain from a peptide synthetase complex that synthesizes a lipopeptide.
  • an engineered peptide synthetase, peptide synthetase domain, or component thereof may contain one or more sequence modifications as compared with a reference peptide synthetase, domain, or component.
  • an engineered peptide synthetase, peptide synthetase domain, or component thereof shows a high overall degree of sequence identitiy and/or homology with its reference peptide synthetase, domain, or component.
  • an engineered peptide synthetase, peptide synthetase domain, or component thereof contains insertions, deletions, substitutions or inversions of 1, 2, 3, 4, 5, 6,7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more amino acids as compared to its relevant reference.
  • amino acid substitutions result in an engineered polypeptide that comprises an amino acid whose side chain contains a structurally similar side chain as compared to the corresponding amino acid in the relevant reference.
  • amino acids with aliphatic side chains including glycine, alanine, valine, leucine, and isoleucine
  • amino acids having aliphatic-hydroxyl side chains including serine and threonine
  • amino acids having amide-containing side chains including asparagine and glutamine
  • amino acids having aromatic side chains including phenylalanine, tyrosine, and tryptophan
  • amino acids having basic side chains including lysine, arginine, and histidine
  • amino acids having sulfur-containing side chains, including cysteine and methionine may be substituted for each other.
  • amino acid substitutions result in an engineered polypeptide that comprises an amino acid whose side chain exhibits similar chemical properties to a corresponding amino acid present in a relevant reference.
  • amino acids that comprise hydrophobic side chains may be substituted for each other.
  • amino acids may be substituted for each other if their side chains are of similar molecular weight or bulk.
  • an amino acid in an engineered domain may be substituted for an amino acid present in the relevant reference if its side chains exhibits a minimum/maximum molecular weight or takes up a minimum/maximum amount of space.
  • an engineered polypeptide shows at least about 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% homology or identity with a relevant reference (e.g., over a portion that spans at least 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more amino acids).
  • a relevant reference e.g., over a portion that spans at least 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more amino acids.
  • engineered polypeptides of the present invention comprise two or more polypeptide domains that occur in one or more naturally occurring or other known reference polypeptides, but that are i) separated from one or more sequence elements with which they are associated in the reference polypeptide; ii) associated with one or more sequence elements with which they are not associated in the reference polypeptide(s); and/or iii) associated in a different way (e.g., in a different order or via a different linkage) with one or more sequence elements with which they are associated in the reference polypeptide.
  • two naturally occurring polypeptide domains that are directly covalently linked in nature may be separated in an engineered polypeptide by one or more intervening amino acid residues.
  • two naturally occurring polypeptide domains that are indirectly covalently linked in nature may be directly covalently linked in an engineered polypeptide, e.g. by removing one or more intervening amino acid residues.
  • two naturally occurring peptide domains that are from different peptide synthetases are covalently joined to generate an engineered polypeptide of the present invention.
  • engineered peptide synthetases provided by and/or for use in accordance with the present invention do not include thioesterase and/or reductase domains.
  • Such domains are known to function in the release of peptides and lipopeptides from the nonribosomal peptide synthetase complexes that produce them.
  • the present invention provides the surprising finding that, notwithstanding their central role in release of lipopeptides from peptide synthetase complexes, such domains are often not required for release of acyl amino acids from engineered peptide synthetases as described herein.
  • This thioesterase and/or reductase domains may optionally be included in some embodiments of the present invention, but are specifically excluded in some embodiments.
  • compositions and methods of the present invention are useful in large-scale production of acyl amino acids.
  • acyl amino acids are produced in commercially viable quantities using compositions and methods of the present invention.
  • engineered polypeptides of the present invention may be used to produce acyl amino acids to a level of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000 mg/L or higher.
  • acyl amino acids using engineered polypeptides of the present invention achieves certain advantages over other methods of producing acyl amino acids.
  • production of acyl amino acids using compositions and methods of the present invention utilizes more readily available and starting materials that are easier to store, reduces the necessity of using harsh and sometimes dangerous chemical reagents in the manufacturing process, reduces the difficulty and efficiency of the synthesis itself by utilizing host cells as bioreactors, and reduces the fiscal and environmental cost of disposing of chemical by-products.
  • compositions and methods of the present invention are provided.
  • compositions comprising acyl amino acids produced by engineered peptide synthetases as described herein. In some embodiments, such
  • compositions comprise a collection of individual acyl amino acid molecules, that are related to one another in that they are each synthesized by the same engineered peptide synthetase and together represent a distribution of chemical entities, varied in precise chemical structure (e.g., due to varying length and/or composition of acyl chains, linkages within such acyl chains and/or between an acyl chain and the amino acid, etc), that are synthesized by the relevant engineered peptide synthetase, under the conditions of synthesis (e.g., in vivo or in vitro).
  • a provided composition includes straight-chain acyl moieties, branched acyl moieties, and/or combinations thereof.
  • one feature of engineered production of acyl amino acids is that engineered peptide synthetases may not generate pure populations of single chemical entities, particularly when acting in vivo.
  • the present invention provides acyl amino acid compositions comprising distributions of chemical entities.
  • the present invention provides acyl amino acid compositions in which substantially all acyl amino acids comprise the same amino acid moiety, but the composition includes a distribution of acyl moieties.
  • the present invention provides a wide variety of acyl amino acids and compositions.
  • the present invention provides acyl amino acids and compositions in which the amino acid moiety is or comprises one found in an amino acid selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine,
  • the present invention provides acyl amino acids and compositions in which the amino acid moiety is or comprises one found in an amino acid selected from the group consisting of selenocysteine and/or pyrro lysine. In some embodiments, the present invention provides acyl amino acids and compositions in which the amino acid moiety is or comprises one found in an amino acid selected from the group consisting of norleucine, beta-alanine and/or ornithine.
  • the present invention provides acyl amino acids and compositions in which the amino acid moiety is or comprises one found in an amino acid selected from the group consisting of L-amino acids. In some embodiments, the present invention provides acyl amino acids and compositions in which the amino acid moiety is or comprises one found in an amino acid selected from the group consisting of D-amino acids. In some embodiments, the present invention provides acyl amino acids and compositions in which the amino acid moiety is or comprises or comprises one found in an amino acid D-glu or D-diaminopropionic acid.
  • amino acid substrates usable by peptide synthetases as described herein (and particularly by engineered peptide synthetases as described herein) to generate acyl amino acids containing such amino acid moieties.
  • the amino acid substrate is or comprises the recited amino acid.
  • the present invention provides acyl amino acids and compositions in which the acyl group is found in a saturated fatty acid such as butryic acid, caproic acid, caprylic acid, capric acid, lauric acid, myristic acid, palmitic acid, stearic arachidic acid, behenic acid, and/or lignoceric acid
  • the present invention provides acyl amino acids and compositions in which the acyl group is found in an unsaturated fatty acids such as, without limitation, myristoleic acid, palmitoleic acid, oliec acid, linoleic acid, alpha-linolenic acid, arachidonic acid, eicosapentaenoic acid, erucic acid, and/or docosahexaenoic acid.
  • acyl amino acids and compositions provided by present invention comprise beta-hydroxy fatty acids as the fatty acid moiety.
  • beta-hydroxy fatty acids comprise a hydroxy group attached to the third carbon of the fatty acid chain, the first carbon being the carbon of the carboxylate group.
  • the present invention provides acyl amino acids and compositions in which the acyl group comprises or consists of fatty acid chains with a length within a range bounded by a shorter length selected from the group consisting of C2, C3, C4, C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19, C20, C21, C22, C23, C24, C25, C26, C27, C28, C29, C30, and an upper length selected from the group consisting of C30, C29, C28, C27, C26, C25, C24, C23, C22, C21, C20, C19, C18, C17, C16, C15, C14, C13, C12, Cl l, CIO, C9, C8, C7, C6, C5, C4, C3, C2, and CI, wherein the upper length is the same as or larger than the lower length.
  • the present invention provides acyl amino acids and compositions in which the acyl group comprises or consists of C10-C14 fatty acid chains, CI 3- 16 fatty acid chains, CI 3- 15 fatty acid chains, CI 6-24 fatty acid chains, CI 8-22 fatty acid chains, CI 8-24 fatty acid chains, C8-C16 fatty acid chains.
  • the present invention provides acyl amino acids and compositions in which the acyl group comprises, consists predominantly of, or consists of C5, C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19, and/or C20 fatty acid chains.
  • the present invention provides acyl amino acids and compositions in which the acyl group comprises, consists predominantly of, or consists of comprises, consists predominantly of, or consists of C8, C9, CIO, Cl l, C12, C13, C14, C15, and/or C16 fatty acid chains. In some embodiments, the present invention provides acyl amino acids and compositions in which the acyl group comprises, consists predominantly of, or consists of comprises, consists
  • the present invention provides acyl amino acid compositions in which all acyl amino acids comprise the same amino acid moiety (or comprise an amino acid moiety from the same amino acid. [0073] In some embodiments, the present invention provides acyl amino acid compositions in which different acyl amino acids within the composition have different acyl moieties (e.g., acyl moieties that differ, in composition, structure, branching, and/or length (of one or more chains). In some embodiments, such compositions predominantly include acyl moieties of a length (or within a range of lengths) as set forth above.
  • such predominant acyl moieties are present in the composition at a level of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% ⁇ 98%, or 99%.
  • acyl amino acids and/or acyl amino acid compositions that are provided by and can be prepared in accordance with certain embodiments of the present invention.
  • the present invention specifically exemplifies and/or otherwise provides certain acyl amino acids and/or acyl amino acid compositions comprising, consisting predominantly of, or consisting of 2,4 diaminobutyric acid, (2S)-2,3-diaminobutyric acid, 2, 3-diaminoproprionic acid, ⁇ -hydroxy myristoyl glutamate, ⁇ -hydroxy myristoyl diaminopropionic acid, betaines, cocyl glycinate, gycine laureate, glutamine laureate, etc.
  • the present invention provides acyl amino acid compositions in which the amino acid moiety within acyl amino acids in the composition is from glycine or glutamate, and the fatty acid moiety is predominantly a C12 fatty acid (i.e.g, is from lauric acid).; in some such embodiments, all acyl amino acids in the composition have the same amino acid moiety.
  • Engineered polypeptides of the present invention may be introduced in any of a variety of host cells for the production of acyl amino acids.
  • engineered polypeptides will typically be introduced into a host cell in an expression vector. So long as a host cell is capable of receiving and propagating such an expression vector, and is capable of expressing the engineered polypeptide, such a host cell is encompassed by the present invention.
  • An engineered polypeptide of the present invention may be transiently or stably introduced into a host cell of interest.
  • an engineered polypeptide of the present invention may be stably introduced by integrating the engineered polypeptide into the chromosome of the host cell.
  • an engineered polypeptide of the present invention may be transiently introduced by introducing a vector comprising the engineered polypeptide into a host cell, which vector is not integrated into the genome of the host cell, but is nevertheless propagated by the host cell.
  • a host cell is a bacterium.
  • bacteria that are useful as host cells of the present invention include bacteria of the genera Escherichia, Streptococcus, Bacillus, and a variety of other genera known to those skilled in the art.
  • an engineered polypeptide of the present invention is introduced into a host cell of the species Bacillus subtilis.
  • Bacterial host cells of the present invention may be wild type.
  • bacterial host cells of the present invention may comprise one or more genetic changes as compared to wild type species.
  • such genetic changes are beneficial to the production of acyl amino acids in the bacterial host.
  • such genetic changes may result in increased yield or purity of the acyl amino acid, and/or may endow the bacterial host cell with various advantages useful in the production of acyl amino acids (e.g., increased viability, ability to utilize alternative energy sources, etc.).
  • the host cell is a plant cell.
  • Those skilled in the art are aware of standard techniques for introducing an engineered polypeptide of the present invention into a plant cell of interest such as, without limitation, gold bombardment and agrobacterium
  • the present invention provides a transgenic plant that comprises an engineered polypeptide that produces an acyl amino acid of interest.
  • Any of a variety of plants species may be made transgenic by introduction of an engineered polypeptide of the present invention, such that the engineered polypeptide is expressed in the plant and produces an acyl amino acid of interest.
  • the engineered polypeptide of transgenic plants of the present invention may be expressed systemically (e.g. in each tissue at all times) or only in localized tissues and/or during certain periods of time. Those skilled in the art will be aware of various promoters, enhancers, etc. that may be employed to control when and where an engineered polypeptide is expressed.
  • Insects including insects that are threats to agriculture crops, produce acyl amino acids that are likely to be important or essential for insect physiology.
  • an enzyme related to peptide synthetases produces the product of the Drosophila Ebony genes, which product is important for proper pigmentation of the fly, but is also important for proper function of the nervous system (see e.g., Richardt et al, Ebony, a novel nonribosomal peptide synthetase for beta-alanine conjugation with biogenic amines in Drosophila, J. Biol. Chem., 278(42):41160- 6, 2003).
  • Acyl amino acids are also produced by certain Lepidoptera species that are a threat to crops.
  • compositions and methods of the present invention may be used to produce transgenic plants that produce an acyl amino acid of interest that kills such insects or otherwise disrupts their adverse effects on crops.
  • an engineered polypeptide that produces an acyl amino acid that is toxic to a given insect species may be introduced into a plant such that insects that infest such a plant are killed.
  • an engineered polypeptide that produces an acyl amino acid that is toxic to a given insect species may be introduced into a plant such that insects that infest such a plant are killed.
  • an engineered polypeptide that produces an acyl amino acid that is toxic to a given insect species may be introduced into a plant such that insects that infest such a plant are killed.
  • an engineered polypeptide that produces an acyl amino acid that is toxic to a given insect species may be introduced into a plant such that insects that infest such a plant are killed.
  • an engineered polypeptide that produces an acyl amino acid that is toxic to a given insect species may be introduced into a plant such
  • an acyl amino acid of the present invention that mitigates an insect's adverse effects on a plant is an acyl amino acid that is naturally produced by such an insect.
  • an acyl amino acid of the present invention that mitigates an insect's adverse effects on a plant is a structural analog of an acyl amino acid that is naturally produced by such an insect.
  • polypeptides that produce any of a variety of acyl amino acids, which acyl amino acids can be used in controlling or eliminating harmful insect infestation of one or more plant species.
  • Acyl amino acids and compositions may be produced by engineered peptide synthetases as described herein.
  • acyl amino acids are produced in vitro.
  • acyl amino acids are produced in vivo, for example in host cells engineered to express an engineered peptide synthetase or component or domain thereof.
  • acyl amino acids are produced in association with one or more components of a cell and/or with an engineered peptide synthetase.
  • acyl amino acid compositions are subjected to one or more isolation procedures, for example as is known in the art, e.g., to separate produced acyl amino acid compounds from one or more components of their production system (e.g., from an engineered peptide synthetase or component or domain thereof, and/or from one or more components of a cell such as an engineered cell.
  • Example 1 Engineering Peptide Synthetases to Produce Acyl Amino Acids with ⁇ -Hydroxy Amino Acids
  • an engineered peptide synthetase that produces an acyl amino acid is designed and/or produced by isolating and/or otherwise engineering a known peptide synthetase domain (e.g., by separating a first peptide synthetase domain that is found in a peptide synthetase complex that synthesizes a lipopeptide from other elements, domains, or components of the lipopeptide-synthesizing complex) to produce the acyl amino acid.
  • an acyl amino acid with a ⁇ -hydroxy fatty acid can be created by expressing Module 1 of a synthetase, such as the srf (surfactin) synthetase in an appropriate host organism. Since Module 1 of the srfAA (sequence listing srfAA module 1) is glutamate-specific, the expression of Module 1 in an appropriate host leads to the production of ⁇ -hydroxyl myristoyl glutamate.
  • a synthetase such as the srf (surfactin) synthetase
  • a new ⁇ -hydroxy acyl amino acid can be produced by using standard molecule biology techniques to specifically identify "Module 1" of one of those synthetases (which belongs to the set “Module 1 's” that have not yet been sequenced) and expressing that Module 1 in an appropriate host.
  • This approach would lead to the generation of additional new ⁇ -hydroxy acyl amino acids, including ⁇ -hydroxy acyl : Phe, D-Ala, 2,3-dehydro-2-aminobutyric acid, NMe-Ile, Gly, Thr and D-allo-threonine.
  • the Table below summarizes various attributes of known lipopeptides and the peptide synthetases that synthesize them in nature, including the amino acid acyl group and amino acid specificity of the relevant Module 1.
  • Theonella Theonella
  • Theonella Theonella
  • arylomycin C11 Arylomycins A synthetase D-Nme- not not N/A to and B, new biaryl- genes have not Ser identified identified
  • corrugatin C8 Corrugatin A synthetase OH-His not not N/A lipopeptide genes have not identified identified siderophore from been identified
  • Friulimicin C13 Friulimicins novel Sequencing and Asp or LipA LipD N/A to lipopeptide analysis of the Asn
  • additional new ⁇ -hydroxy acyl amino acids can be produced by operationally linking a condensation domain, which specifies the addition of a ⁇ -hydroxy fatty acid, to an adenylation domain which specifies a particular desired amino acid.
  • a condensation domain is operationally linked to an adenylation domain that is specific for glycine and, upon expression of the chimera in an appropriate host, ⁇ - hydroxy myristyl glycine is produced.
  • this approach can be used to create any desired ⁇ -hydroxy acyl amino acid, as long as an adenylation domain is available that is specific for the desired amino acid.
  • Naturally occurring peptide synthetase modules are available that specify the use of each of the standard 20 amino acids, and in addition adenylation domains are available that are specific for about 300 additional amino acids, or amino acid-like molecules (Kleinkauf et al) (Ref 10). This approach can be used to link a ⁇ -hydroxy fatty acid to any of these amino acids, or amino acid- like molecules.
  • Example 2 Engineered Peptide Synthetases Comprising or Consisting of Mycosubtilin Module 1 (MycA)
  • a particular ⁇ -amino fatty acid can be produced in an appropriate host by expressing a module known to specify the joining of a ⁇ -amino fatty acid to a particular amino acid, along with any gene or genes that encode critical additional functions that are not naturally found in the host organism (such as for example FenF).
  • Additional new ⁇ -amino acyl amino acids can be produced by operationally linking a condensation domain, which specifies the addition of a ⁇ -amino fatty acid, to an adenylation domain which specifies a particular desired amino acid.
  • additional required factors such as homologs of FenF
  • This approach can be used to link a ⁇ -amino fatty acid to any amino acid, as long as an adenylation domain is available that is specific for the desired amino acid.
  • Example 3 Engineered Peptide Synthetases Comprising or Consisting of Daptomycin
  • a particular acyl amino acid (unmodified at the ⁇ -position) can be produced in an appropriate host by expressing a module known to specify the joining of a fatty acid to a particular amino acid, along with any gene or genes that encode critical additional functions that are not naturally found in the host organism (such as for example DptE and DptF).
  • Additional new acyl amino acids can be produced by operationally linking a condensation domain, which specifies the addition of a fatty acid, to an adenylation domain which specifies a particular desired amino acid.
  • fatty acid that is unmodified at the beta position can be attached to glycine using a chimeric synthetase composed of the condensation domain of dptAl module 1 linked to that adenylation and thiolation domains of dptAl module 5 (which is specific for glycine) (sequence listing dptAl Module 5)
  • CDA Calcium-Dependent Antibiotic
  • the distribution of fatty acids produced by a typical engineered strain that utilizes an engineered peptide synthetase to synthesisze FA-Glu is composed of fatty acids that all have a ⁇ -hydroxyl but that have varying chain lengths.
  • the chain lengths vary in the following manner: C12, 1.6%; C13, 16.2%; C14, 55%; C15, 25.9%; C16, 1.2% and C17, 0.01%.
  • some of the even numbered fatty acids are branched and some are straight chain.
  • none of the odd numbered fatty acids are straight chain (i.e, they are all branched). Odd numbered chains can be either iso or anteiso; in some embodiments, the present invention provides different compositions with different relative amounts (e.g., ratios) of these forms. Branching nomenclature is well presented in Figure 1 of Ref 16. Fatty Acids of the Genus Bacillus: an example ofbranched-chain preference, Toshi Kaneda,
  • the fatty acid chain distribution changes when particular keto acids are fed to the strain (see Table 1 below). Dramatic changes in fatty acid chain distribution can be generated when the enzyme that synthesizes the keto acids used to initiate fatty acid synthesis in Bacillus is knocked out and single keto acids are fed to the strain. In some embodiments, as the concentration of the keto acid is changed, the pattern of fatty acid species is altered.
  • compositions are provided containing FA-Glu with 95% C14 fatty acid by feeding 20 mM isobutyric to the mutant.
  • feeding of low levels of keto acids that can only be used to produce branched fatty acids with odd number chains is utilized to produce a population of fatty acids with about 80% (100 uM 2-methylbutyric or 100 uM isovaleric) surfactant with C14 length fatty acid.
  • the mutant since the mutant cannot synthesize its own keto acid starters for even numbered branched chain fatty acid synthesis, feeding of low concentrations of either of these ketos acids (100 uM 2-methylbutyric or 100 uM isovaleric) allows the production of a population of surfactant that is predominantly even numbered and straight chain.
  • the present invention surprising provides methods and compositions for generating, and compositions comprising mostly straight chain (rather than branched) fatty acid, produced by B. subtilis.
  • the present invention specifically describes strategies for generating a Bacillus strain (and strains so generated) that exclusively produces straight chain fatty acid.
  • the present Example describes use of engineered peptide synthetases (in engineered host cells) to produce amphoteric surfactants with one region or regions that harbor a negative charge and another region or regions that harbor a positive charge.
  • Examples of amino acids that can be used to produce such surfactants are shown in the Figure below.
  • the amino acids all have two amino groups and include: 2,4-diaminobutyric acid, (2S)-2,3-diaminobutyric acid, 2,3- diaminopropionic acid, ornithine and lysine.
  • This surfactant will be zwitterionic at physiological pH given that the p a of the beta amine of 2,3 diaminoprionic acid is 9.57 and the pKa of an alpha carboxyl is about 2.2.
  • a condensation domain capable of directing the linkage of ⁇ -hydroxyl fatty acid to an amino acid is linked to the adenylation and thiolation domain of a module that is specific for 2,3-diaminopropionic acid (DAP).
  • DAP 2,3-diaminopropionic acid
  • Felnagle et al described a peptide synthetase that incorporates DAP. The synthetase is found in Saccharothrix mutabilis subsp. capreolus ATCC 23892.
  • the DAP -specific module is the second module of CmnA (Sequence listing
  • Bacillus subtilis 168 does not synthesize DAP. Two genes need to be added to Bacillus in order to enable conversion of serine to DAP. The genes are described in references cited below. The genes are found in Staphylococcus aureus and other bacteria. The genes are called sbnA and sbnB. For example, the genes are present in Staphylococcus aureus strain JH9, and also in Staphylococcus aureus strain Mu50 / ATCC 700699.
  • the sbnA gene (sequence listing sbnA) is also known as SaurJH9 0103.
  • the sbnB gene (sequence listing sbnB) is also known as SaurJH9 0104.
  • Homologues of the sbnA and sbnB genes can be used instead of, or in addition to, sbnA and sbnB.
  • the charge of the primary amine of the surfactant shown in the Figure above will depend on pH, and will be positive in the vicinity of pH 7.0. As the pH is elevated, the amine will lose a hydrogen and become neutral in charge.
  • a surfactant with a positive charge that is independent of pH can be produced by converting the surfactant shown above into a betaine (which harbors a quaternary ammonium group) see Figure below.
  • methylation can be accomplished in vivo using a methyltransferase.
  • a methyltransferase One of the symbols did not translate it's shown as a boxBacterial -N- methyltrasferases have been described by Zhang, et al.
  • methyltrasnferases can be obtained from Bacillus subtilis (sequence listing Bacillus prmA) or E. coli (sequence listing E. coli prmA).
  • a methyltransferase that modifies cypemycin can be used (sequencing listing cypemycin methyltrasferase) ; the gene is found in Streptomyces sp. OH- 4156.
  • a gene encoding a similar protein (76% identical) can be obtained from Streptomyces griseus subsp. griseus NBRC 13350 (sequencing listing Streptomyces griseus
  • Example 7 Production of fatty acids and fatty acid derivatives with particular fatty acid branching patterns
  • Naturally occurring fatty acids produced by living organisms typically have two sorts of modifications that affect the melting temperature of the fatty acids and their derivatives.
  • Certain organisms including particular gram positive and gram negative bacteria, as well as typical eukaryotes such as yeast, control the fluidity of membranes by desaturation of fatty acids.
  • the ability to introduce desaturated fatty acids into membranes is important with regard to maintenance of membrane fluidity as temperature decreases.
  • Certain bacteria, such as Bacillus subtilis do not rely on desaturation to increase membrane fluidity. Instead, these bacteria control membrane fluidity via the synthesis of branched fatty acids (for a list of representative bacterial genera that synthesize branched fatty acids, see Table 3 of Ref 13.).
  • E. coli As background information, we will consider E. coli as an example of an organism that synthesizes straight chain fatty acids (i.e., fatty acids that lack branching), fatty acid synthesis initiates when the enzyme fadH ( ⁇ -ketoacyl-ACP synthase III) catalyzes condensation of acetyl-coenzyme A (acetyl Co A) with malonyl-acyl carrier protein (malonyl-ACP)(Ref 14). This condensation produces an acetoacetyl-ACP that is then elongated by the iterative action of the E. coli fatty acid synthesis machinery.
  • fadH ⁇ -ketoacyl-ACP synthase III
  • malonyl-ACP malonyl-acyl carrier protein
  • Bacillus subtilis encodes two ⁇ -ketoacyl-ACP synthase III enzymes (fadHA and fadHB). Although these enzymes will utilize acetyl-CoA as a substrate, they prefer to use branched substrates such as isobutyryl-CoA, 2-methylbutyryl-CoA and isovaleryl-CoA (REF 15). These CoA derivatives are produced from the amino acids L-valine, L-isoleucine and L- leucine, respectively (REF 16).
  • Initiation of fatty acid synthesis with a branched starter unit leads to the syntheses of a terminally branched fatty acid.
  • the precise chemical composition of the branched starter impacts the length and specific branching of the synthesized fatty acid. For example,initiation with isobutyrate in Bacillus leads to production of "iso" fatty acids with even number lengths, such as 14 carbons (CI 4) and 16 carbons (CI 6).
  • Initiation with 2-methyl butyrate leads to synthesis of odd numbered "anteiso" fatty acids (e.g., C15 and C17).
  • feeding isobutyrate to the mutant leads to the exclusive synthesis of fatty acids with even numbered chain length.
  • These fatty acid chains include fatty acids derived from the isobutyrate starter (il4:0, 33%; il6:0, 51%) and also straight chain fatty acids produced using de novo synthesized acetate as a starter (14:0, 2%; 16:0, 13%) (see Ref 17).
  • the odd numbered fatty acids are eliminated when a strain that lacks ⁇ -keto acid dehydrogenase activity is fed isobutyrate (but not fed 2-methyl butyrate and/or isovalerate).
  • Feeding of isovalerate leads to the following pattern: il5:0, 56%; al5:0, 7%; il7:0, 12%; al7:0, 2%; 14:0, 3% and 16:0, 16%).
  • the presence of anteiso fatty acids is unexpected and suggests that the isovalerate used in the study was contaminated with a keto acid such as 2- methyl butyrate.
  • the straight chain even numbered fatty acids are produced utilizing de novo produced acetate (these data are taken from Ref 17).
  • Li and coworkers converted a strain of Streptomyces coelicolor (which typically predominantly synthesizes branched fatty acids) into a strain that synthesizes 86% straight chain fatty acids by replacing the endogenous ⁇ -ketoacyl-ACP synthase III enzyme with E. coli fabH (Ref 18).
  • a general method can be followed to identify enzymes that function in a manner analogous to E. coli fadH, that is they initiate fatty acid synthesis using predominantly straight chain starter units, such as acetyl CoA, which will result in the synthesis of straight chain fatty acids.
  • Methods such as gas-liquid-chromatography can be used to determine whether an organism synthesizes straight chain fatty acids, or instead synthesizes a mixture of straight chain and branched fatty acids.
  • Kaneda (Ref 16) used gas-liquid-chromatography to characterize the fatty acids of sixteen species of Bacillus, and found that all sixteen species synthesized a mixture of straight chain and branched fatty acids.
  • Kaneda and Smith reported that certain bacteria and yeasts exclusively synthesize straight chain fatty acids, and indeed it is true that most organisms synthesize exclusively straight chain fatty acids.
  • Kaneda and Smith reported that the bacteria E.
  • coli and Pseudomonas fluorescens exclusively synthesize straight chain fatty acids.
  • Other examples of organisms that exclusively synthesize straight chain fatty acids are reported in Ref 20 and include various Streptococcus and Enterococcus species, and other species.
  • an organism that exclusively or predominantly synthesizes straight chain fatty acids will encode an enzyme that is functionally equivalent to E. coli fabH, but that does not have homology to fabH.
  • the Pseudomonas aeruginosa PA5174 gene encodes a fabY enzyme that is not homologous to fadH, but serves the same function and prefers to use acetyl CoA as the starter for fatty acid synthesis(see this Ref 22 Fatty Acid Biosynthesis in Pseudomonas aeruginosa is initiated by the FabY Class of -Ketoacyl Acyl Carrier Protein Synthases).
  • Genes homologus to PA5174, that can be used for this purpose include the following genes and their homologues ⁇ see Sequence listing: Pmen_0396,
  • heterologous enzyme which prefers straight chain starters
  • branched fatty acid synthesis can be further reduced by reducing, altering or eliminating ⁇ -keto acid dehydrogenase activity.
  • the level of branched fatty acid can be reduced by reducing, altering or eliminating the activity of the endogenous Bacillus fadHA and/or fadHB genes (also known as fadHl or fadH2).
  • Psychrobacter urativorans (Ref 23)(sequence listing EF617339) and the 9-fatty acid desaturase from Mortierella alpine (Ref 24) (sequence listing ABO 15611).
  • constitutive des expression can be enabled via deletion of desk (Seq listing DesK gen)(Ref 26). It has been demonstrated that strains with a lip A (yutB) knockout are not able to synthesize fatty acids and require both keto acids and acetate for growth Ref 26. Constitutive expression of des was achieved by knocking out desK, which leads to
  • acyl amino acid surfactants with straight chain fatty acids is to express the peptide synthetase enzyme that produces the acyl amino acid in a strain that does not produce branched fatty acids, such as E. coli. It has been reported that the srfA operon required for production of surfactin has been cloned and expressed in E. coli (Ref 27). However, the lipopoetide was not characterized directly, rather the authors report that the engineered strain produces a new hydrophobic compound, which was analyzed by TCL using surfactin as a control. Surfactin's Rf value was 0.63 and the new hydrophobic compound showed an Rf value of 0.52. The authors did not speculate on why the Rf values differed.
  • An acyl amino acid with a straight chain fatty acid can be produced by cloning a gene that encodes a peptide synthetase enzyme capable of directing the synthesis of an acyl amino acid (such as Module 1 of srfAA) into an E. coli plasmid under the control of a promoter such as the T7 promoter and introducing the cloned gene into E. coli. It is also necessary to clone and express a gene such as Bacillus sfp, which is a phosphpantetheinyl transferase needed to modify peptide synthetase, enzymes in order to functionally activate those enzymes (see Ref 28). The amount of surfactant produced, and the length of the fatty acid tails present on the population of surfactant molecules, can be determine using LCMS as described in Ref 29.
  • the strain can be further modified to increase the yield of the acyl amino acid.
  • One strategy for increasing yield is to inactivate (e.g., delete) genes that limit production of the acyl amino acid. Once genes are identified that, when deleted, increase yield of an acyl amino acid, a strain harboring multiple such deletions can be generated. In addition, genes that either do not affect surfactant yield, or that negatively affect surfactant yield, can be replaced with genes that stimulate acyl amino acid production. Examples herein describe genes that, when deleted, increase yield of an acyl glutamate surfactant referred to as FA-Glu
  • Example 8 Production of ⁇ -hydroxy myristoyl glycinate by fermentation
  • Modular Genetics, Inc. has shown that an engineered peptide synthetase enzyme can be used to produce an acyl amino acid ( ⁇ -hydroxy myristoyl glutamate). This approach has been expanded to produce ⁇ -hydroxy myristoyl glycinate. Here is the detailed information on production of ⁇ -hydroxy myristoyl glycinate.
  • This fragment was annealed to the PCR product obtained from the template pUC19 and primers 35664-B4 : 5 ' - AGGC ATGC AAGCTTGGCGtAATC ATGGTC ATAGCTGTTTCCTGTG-3 ' and 35664- A4 : 5 ' - ATATGGTGC ACTCTC AGTAC AaTCTGCTCTGATGCCGC AT AGTT-3 ' .
  • the annealed mixture was transformed into SURE cells to produce the plasmid Psrf-Glu-TE-pUC19.
  • Psrf-Glu-TE-pUC19 was used as a template to engineer a variant of this plasmid that contained a fusion of the condensation domain of srfAA module 1 to the adenylation domain of Module 2 of Linear Gramicidin (which adenylation domain is specific for the amino acid glycine), followed by the TE.
  • This fragment was annealed to the PCR product obtained from the template Psrf-Glu- TE-pUC19 using primers 35664-C7:5'-
  • OKB105A(upp)SpectRFA-GLY-TE shows that the strain was able to produce detectable amounts of FA-GLY. Data was obtained using LC-MS analysis. MS-MS analysis of the material derived from OKB105A(upp)SpectRFA-GLY-TE revealed that the product was indeed FA- GLY. (sequence listing Psrf-Gly-lgr_m2-F3-TE-pUC19).
  • LCMS analysis of FA-Gly The 300 Dalton species is FA-Glu with a 14 carbon fatty acid tail.
  • the 600 Dalton species is a dimer of the 300 Dalton species.
  • the 314 Dalton species is FA-Glu with a 15 carbon fatty acid tail.
  • the 628 Dalton species is a dimer of the 314 Dalton species.
  • the Bacillus a-keto acid dehydrogenase activity was knocked out by deleting the genes that encode two enzymes bkdAA and bkdAB. These genes encode the Bacillus El and ⁇ components of a-keto acid dehydrogenase (also known as branched chain -oxo acid dehydrogenase) see Ref 30. These genes were knocked out in a strain that produces an acyl amino acid surfactant called FA-Glu, which is composed of fatty acid (FA) linked to the amino acid glutamic acid (Glu).
  • FA-Glu acyl amino acid surfactant
  • the surfactant is composed of a population of molecules with fatty acid tails that vary in length from C12 to CI 7, with C14 predominant (55%).
  • the mutant strain which lacks a-keto acid dehydrogenase activity
  • the mutant strain is fed 20mM isobutyrate the fatty acid composition of the surfactant population narrows to about 95% CI 4.
  • Surfactants with a fatty acid tail length of C14 are particularly useful for certain applications, such as use in personal care products such as shampoos, body washes and other products.
  • the population of surfactant fatty acid tail lengths can be specifically modified by feeding the mutant strain a starter keto acid that results in production of odd numbered branched fatty acids.
  • a population of surfactant molecules with a fatty acid tail composition of C13:0,27%>;C 15:0,65%) was produced upon feeding the mutant 20mM 2-methylbutyric acid.
  • the strain produced surfactant with over 90%) odd numbered branched fatty acid tails (presumably anteiso).
  • acylases can be used to specifically cleave an acyl amino acid surfactant to generate a free fatty acid and an amino acid. This approach can be used with the surfactant populations described above to produce particular purified populations of fatty acids, for example a population composed of over 90% C14 fatty acid or a population composed of over 90%> anteiso C13 and C15 or over 90%> iso C 13 and CI 5, or over 80%> straight chain (even numbered fatty acids).
  • ATCTTTATTTGC ATTATTCGTGGAT-3 ' The resulting PCR was used as a template to amplify both upstream and downstream fragments.
  • the upstream fragment was amplified using primers 47020:5 '- GTGTAAATCATTTAATGAAAAAAGGAAAAATTGACGTG-3' and 47023:5'- ATCATTAAGCCTTCCTGGCAGTC AGCCCTAGTGCTTGATGTCGGTTTG-3 ' .
  • the downstream fragment was amplified using primers 47026:5'-
  • the genes encoding for UPP/Kan were amplified from the template pUC19-UPP-KAN using primers 47024:5'- ACACGATATAGCCAGGAAGGCGGGTTTTTTGACGATGTTCTTGAAACTC-3 ' and 47025 :5 '-AATTAAAAGCCACAAAGGCCTAGGTACTAAAACAATTCATCCAGTAA-3 ' .
  • Kaneda "Iso- and anteiso-fatty acids in bacteria: biosynthesis, function, and taxonomic significance," Microbiological Reviews, 55(2):288-302, 1991.
  • a Bacillus subtilis gene induced by cold shock encodes a membrane phospholipid desaturase, Aguilar et al, Journal of bacteriology, 180(8) :2194-2200, 1998.
  • OS Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
  • SV 1
  • GenBank AAX31555.1 acyl-CoA ligase [Streptomyces roseosporus NRRL 11379]
  • Gen Bank AAX31556.1 probable acyl carrier protein [Streptomyces roseosporus NRRL

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Dentistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Environmental Sciences (AREA)
  • Pest Control & Pesticides (AREA)
  • Plant Pathology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2014/029150 2013-03-15 2014-03-14 Generation of acyl amino acids Ceased WO2014144649A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
BR112015023453A BR112015023453A2 (pt) 2013-03-15 2014-03-14 composição de acil aminoácidos, método para sua produção, célula manipulada e método de preparação de um produto
CN201480026841.8A CN105531367A (zh) 2013-03-15 2014-03-14 酰基氨基酸的产生
EP14764638.4A EP2970928A4 (en) 2013-03-15 2014-03-14 Generation of acyl amino acids
JP2016502994A JP6741572B2 (ja) 2013-03-15 2014-03-14 アシルアミノ酸の生成
CA2907229A CA2907229A1 (en) 2013-03-15 2014-03-14 Generation of acyl amino acids
CN202311749532.0A CN117965408A (zh) 2013-03-15 2014-03-14 酰基氨基酸的产生
US14/776,805 US9970036B2 (en) 2013-03-15 2014-03-14 Generation of acyl amino acids
US15/978,634 US10640799B2 (en) 2013-03-15 2018-05-14 Generation of acyl amino acids
US16/823,173 US11155843B2 (en) 2013-03-15 2020-03-18 Generation of acyl amino acids
US17/481,290 US12031167B2 (en) 2013-03-15 2021-09-21 Generation of acyl amino acids

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361788346P 2013-03-15 2013-03-15
US61/788,346 2013-03-15

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US14/776,805 A-371-Of-International US9970036B2 (en) 2013-03-15 2014-03-14 Generation of acyl amino acids
US15/978,634 Continuation US10640799B2 (en) 2013-03-15 2018-05-14 Generation of acyl amino acids
US15/978,634 Division US10640799B2 (en) 2013-03-15 2018-05-14 Generation of acyl amino acids

Publications (1)

Publication Number Publication Date
WO2014144649A1 true WO2014144649A1 (en) 2014-09-18

Family

ID=51537750

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/029150 Ceased WO2014144649A1 (en) 2013-03-15 2014-03-14 Generation of acyl amino acids

Country Status (7)

Country Link
US (4) US9970036B2 (cg-RX-API-DMAC7.html)
EP (1) EP2970928A4 (cg-RX-API-DMAC7.html)
JP (4) JP6741572B2 (cg-RX-API-DMAC7.html)
CN (2) CN117965408A (cg-RX-API-DMAC7.html)
BR (1) BR112015023453A2 (cg-RX-API-DMAC7.html)
CA (1) CA2907229A1 (cg-RX-API-DMAC7.html)
WO (1) WO2014144649A1 (cg-RX-API-DMAC7.html)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2842542A1 (en) * 2013-08-27 2015-03-04 Evonik Industries AG A method for producing acyl amino acids
WO2016049484A1 (en) * 2014-09-26 2016-03-31 Dow Agrosciences Llc Chimeric non-ribosomal peptide synthase
WO2017011592A1 (en) * 2015-07-13 2017-01-19 Modular Genetics, Inc. Generation of acyl alcohols
US9970036B2 (en) 2013-03-15 2018-05-15 Modular Genetics, Inc. Generation of acyl amino acids
WO2020018853A3 (en) * 2018-07-18 2020-03-05 Modular Genetics, Inc. Generation of acyl amino acids

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111454338B (zh) * 2019-01-22 2024-10-01 四川复通科技有限公司 塞普霉素前体肽的突变体、其应用及制得的塞普霉素类似物
WO2020181779A1 (zh) 2019-03-14 2020-09-17 江南大学 一种基于低共熔溶剂的脂氨基酸类化合物的制备方法
CN111575251B (zh) * 2020-05-29 2022-03-11 上海交通大学 一种用于达托霉素生物合成的dptC1突变体的构建
WO2022201968A1 (ja) 2021-03-26 2022-09-29 コニカミノルタ株式会社 情報処理装置、制御プログラム、および制御方法
CN114891837B (zh) * 2022-04-26 2023-04-25 青岛普瑞邦生物工程有限公司 一种产虾夷扇贝毒素的海杆菌及虾夷扇贝毒素的制备方法

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5652116A (en) 1993-07-13 1997-07-29 Eniricerche S.P.A. Method for genetically manipulating peptide synthetases
US5795738A (en) 1995-08-09 1998-08-18 Eniricerche S.P.A. Engineered peptide synthetases and their use for the non-ribosomal production of peptides
WO2008131002A2 (en) 2007-04-16 2008-10-30 Modular Genetics, Inc. Generation of acyl amino acids
US20110030103A1 (en) * 2007-04-16 2011-02-03 Gabriel Reznik Lipopeptides and lipopeptide synthetases
US20120128603A1 (en) * 2010-11-18 2012-05-24 Tanaka Shuhei Nmn Cosmetic Compositions
US8318950B2 (en) * 2005-06-15 2012-11-27 Otkrytoe Aktsionernoe Obschestvo-Otechestvennye Lekarstva N-acyl amino acid derivatives, a method for the preparation thereof, a pharmaceutical composition and use thereof as anti-allergic, anti-inflammatory and hypolipidemic agents

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002059322A2 (en) 2000-10-17 2002-08-01 Cubist Pharmaceuticlas, Inc. Compositions and methods relating to the daptomycin biosynthetic gene cluster
EP1421097A4 (en) 2001-08-06 2005-07-06 Cubist Pharm Inc COMPOSITIONS AND METHODS RELATING TO THE BIOSYNTHETIC MULTIGENIC FAMILY OF DAPTOMYCIN
KR20040032891A (ko) 2001-08-06 2004-04-17 큐비스트 파마슈티컬즈 인코포레이티드 답토마이신 생합성 유전자 클러스터에 관련된 조성물 및방법
DE602004030000D1 (de) * 2003-01-17 2010-12-23 Danisco Verfahren zur in-situ-herstellung eines emulgators in einem nahrungsmittel
JP2005132833A (ja) * 2003-10-08 2005-05-26 Ajinomoto Co Inc N−長鎖アシルグリシン塩の結晶及びその製造方法、並びに、該n−長鎖アシルグリシン塩の結晶を用いた洗浄料組成物
US8470883B2 (en) * 2010-07-12 2013-06-25 Conopco, Inc. Preservative system and composition based on glycinate and hydroxyethyl sulfonate salt combination
JP5714359B2 (ja) * 2011-02-28 2015-05-07 株式会社マンダム 半固体状洗浄剤
US8822711B2 (en) * 2011-07-28 2014-09-02 Conopco, Inc. Method for preparing fatty acyl amido carboxylic acid based surfactants
CA2907229A1 (en) 2013-03-15 2014-09-18 Modular Genetics, Inc. Generation of acyl amino acids

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5652116A (en) 1993-07-13 1997-07-29 Eniricerche S.P.A. Method for genetically manipulating peptide synthetases
US5795738A (en) 1995-08-09 1998-08-18 Eniricerche S.P.A. Engineered peptide synthetases and their use for the non-ribosomal production of peptides
US8318950B2 (en) * 2005-06-15 2012-11-27 Otkrytoe Aktsionernoe Obschestvo-Otechestvennye Lekarstva N-acyl amino acid derivatives, a method for the preparation thereof, a pharmaceutical composition and use thereof as anti-allergic, anti-inflammatory and hypolipidemic agents
WO2008131002A2 (en) 2007-04-16 2008-10-30 Modular Genetics, Inc. Generation of acyl amino acids
US20110030103A1 (en) * 2007-04-16 2011-02-03 Gabriel Reznik Lipopeptides and lipopeptide synthetases
US20110030102A1 (en) * 2007-04-16 2011-02-03 Modular Genetics, Inc. Generation of acyl amino acids
US7981685B2 (en) 2007-04-16 2011-07-19 Modular Genetics, Inc. Generation of acyl amino acids
US20120128603A1 (en) * 2010-11-18 2012-05-24 Tanaka Shuhei Nmn Cosmetic Compositions

Non-Patent Citations (49)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. AAX31556.1
AGUILAR ET AL.: "A Bacillus subtilis gene induced by cold shock encodes a membrane phospholipid desaturase", JOURNAL OF BACTERIOLOGY, vol. 180, no. 8, 1998, pages 2194 - 2200
ARON ET AL.: "FenF: Servicing the Mycosubtilin Synthetase Assembly Line in trans", CHEMBIOCHEM, vol. 8, 2007, pages 613 - 616
BEASLEY ET AL.: "Mutation of L-2,3-diaminopropionic acid synthase genes blocks staphyloferrin B synthesis in Staphylococcus aureus", BMC MICROBILOGY, vol. 11, 2011, pages 199, XP021108747, DOI: 10.1186/1471-2180-11-199
CHOI ET AL.: "D -ketoacyl-acyl carrier protein synthase III (FabH) is a determining factor in branched-chain fatty acid biosynthesis", JOURNAL OF BACTERIOLOGY, vol. 182, no. 2, 2000, pages 365 - 370, XP002451176, DOI: 10.1128/JB.182.2.365-370.2000
COQUE ET AL., MOL. MICROBIOL., vol. 5, 1991, pages 1125 - 1133
COSMINA ET AL., MOL. MICROBIOL., vol. 8, 1992, pages 821 - 831
COSMINA ET AL., MOL. MICROBIOL., vol. 8, 1993, pages 821 - 831
DAVID WELCH: "Application of cellular fatty acid analysis", CLINICAL MICROBIOLOGY REVIEWS, October 1991 (1991-10-01), pages 422 - 438
DIEZ ET AL., J. BIOL. CHEM., vol. 265, 1990, pages 16358 - 16365
DUITMAN ET AL.: "The Mycosubtilin synthetase of Bacillus subtilis ATCC6633: A Multifunctional Hybrid Between a Peptide Synthetase, an Amino Transferase, and a fatty Acid Synthase", PNAS, vol. 96, no. 23, 1999, pages 13294 - 13299, XP002145095, DOI: 10.1073/pnas.96.23.13294
FELNAGLE ET AL.: "Identification of the biosynthetic gene cluster and an additional gene for resistance to the antituberculosis drug capreomycin", APPLIED AND ENVIRONMANTAL MICROBIOLOGY, vol. 73, no. 13, 2007, pages 4162 - 4170, XP002492137, DOI: 10.1128/AEM.00485-07
HANSEN ET AL.: "The Loading Module of Mycosubtilin: An adenylation Domain with fatty Acid Selectivity", J AM CHEM SOC, vol. 129, no. 20, 2007, pages 6366 - 6367
KANEDA: "Fatty acids of the genus Bacillus: an example of branched-chain preference", BACTERIOLOGICAL REVIEWS, vol. 41, no. 2, 1977, pages 391 - 418, XP009037990
KANEDA: "Iso- and anteiso-fatty acids in bacteria: biosynthesis, function, and taxonomic significance", MICROBIOLOGICAL REVIEWS, vol. 55, no. 2, 1991, pages 288 - 302, XP002627085
KANEDASMITH: "Relationship of primer specificity of fatty acid de novo synthetase to fatty acid composition in 10 species of bacteria and yeasts", CAN. J. MICROBIOL., vol. 26, 1980, XP009038001
KHANDEKAR ET AL.: "Identification, substrate specificity, and inhibition of the Streptococcus pneumonia b-ketoacyl-acp carrier protein synthase III (FabH", JBC, vol. 276, no. 32, 2001
KLEINKAUF ET AL., ANNU. REV. MICROBIOL., vol. 41, 1987, pages 259 - 289
KLEINKAUF ET AL.: "A nonribosomal system of peptide biosynthesis", EUR J BIOCHEM, vol. 236, 1996, pages 335 - 351, XP009009210, DOI: 10.1111/j.1432-1033.1996.00335.x
KOMIYAMA ET AL.: "A new antibiotic, cepemycin taxonomy, fermentation, isolation and biological characteristics", THE JOURNAL OF ANTIBIOTICS, vol. 46, no. 11, 1993, pages 1666 - 1671
KRASS ET AL.: "Functional Dissection of Surfactin Synthetase Initiation Module Reveals Insights into the Mechanism of Lipoinitiation", CHEMISTRY & BIOLOGY, vol. 17, 2010, pages 872 - 880
KRATZXCHMAR ET AL., J. BACTERIAL., vol. 171, 1989, pages 5422 - 5429
KRATZXCHMAR ET AL., J. BACTERIOL., vol. 171, 1989, pages 5422
LEE ET AL.: "Cloning of srfA operon from Bacillus subtilis C9 and its expression in E. coli", APPL MICROBIOL BIOTECHNOL, vol. 75, no. 3, 2007, pages 567 - 572, XP019513669, DOI: 10.1007/s00253-007-0845-8
LI ET AL.: "Identification and functional expression of a 0 9-fatty acid desaturase from Psychrobacter urativorans in Escherichia coli", LIPIDS, vol. 43, 2008, pages 207 - 213
MACCABE ET AL., J. BIOL. CHEM., vol. 266, 1991, pages 12646 - 12654
MARTIN ET AL.: "a lipA (yutB) mutant, encoding lipoic acid synthase, provides insight into the interplay between branched-chain and unsaturated fatty acid biosynthesis in Bacillus subtilis", JOURNAL OF BACTERIOLOGY, vol. 191, no. 24, 2009, pages 7447 - 7455
MEYERSMILLER, CABIOS, vol. 4, 1989, pages 11 - 17
MIAO ET AL.: "Daptomycin biosynthesis in Streptomyces roseosporus: cloning and analysis of the gene cluster and revision of peptide stereochemistry", MICROBIOLOGY, vol. 151, 2005, pages 1507 - 1523, XP055103297, DOI: 10.1099/mic.0.27757-0
NAGAI ET AL.: "Study on surfactin, a cyclic depsipeptide. 2. Synthesis of surfactin B2 produced by Bacillus natto KMD 2311", CHEM PHARM BULL, vol. 44, 1996, pages 5 - 10
QUADRI ET AL.: "Characterization of Sfp, a Bacillus subtilis phosphopantetheinyl transferase for peptididyl carrier domains in peptide synthetases", BIOCHEMISTRY, vol. 37, no. 6, 1998, pages 1585 - 1595, XP002170303, DOI: 10.1021/bi9719861
RAUSCH ET AL.: "Phylogenetic analysis of condensation domains in NRPS sheds light on their functional evolution", BMC EVOLUTIONARY BIOLOGY, vol. 7, no. 78, 2007, pages 1 - 15
REZNIK ET AL.: "Use of sustainable chemistry to produce an acyl amino acid surfactant", APPL MICROBIOL BIOTECHNOL, 2010
ROONGSAWANG ET AL.: "Phylogeneticv analysis of condensation domains in nonribosomal peptide synthetases", FEMS MICROBIOLOGY LETTERS, vol. 252, 2005, pages 143 - 151
SAKURADANI ET AL.: "A9-fatty acid desaturase from arachidonic acid-producing fungus unique gene sequence and its heterologous expression in a fungus, Aspergillus", EUR. J. BIOCHEM., vol. 260, 1999, pages 208 - 219
SEGOLENE ET AL.: "NORINE: a database of nonribosomal peptides", NUCLEIC ACIDS RESEARCH, vol. 36, 2008, pages D327 - D331
SIMONSHOKAT: "Methods in Enzymology, Volue 512, Nuclososomes: Histones & Chromatin", vol. 512, 2012, ELSEVIER, INC., article "A method to site-specifically incorporate methyl-lysine analogues into recombinant proteins"
SMITH ET AL., EMBO J., vol. 9, 1990, pages 2743 - 2750
STELLER ET AL.: "initiation of Surfactin Biosynthesis and the Role of the SrfD-Thioesterase Protein", BIOCHEMISTRY, vol. 43, 2004, pages 11331 - 11343
TOSHI KANEDA: "Fatty Acids of the Genus Bacillus: an example of branched-chain preference", BACTERIOLOGICAL REVIEW, vol. 41, no. 2, 1977, pages 391 - 418, XP009037990
TSAY ET AL.: "Isolation and characterization of the D □-ketoacyl-acyl carrier protein synthatse III gene (fabH) from Escherichia coli K-12", JBC, vol. 267, no. 10, 1992, pages 6807 - 6814, XP002931345
VAN WAGONER ET AL.: "FeeM, an N-Acyl Amino Acid Synthase from an Uncultured Soil Microbe: Structure, Mechanism, and Acyl Carrier Protein Binding", STRUCTURE, vol. 14, no. 9, 1 September 2006 (2006-09-01), pages 1425 - 1435, XP027993359, DOI: 10.1016/J.STR.2006.07.005 *
WANG ET AL.: "The primary structure of branched-chain a-oxo acid dehydrogenase from bacillus subtilis and its similarity to other a-oxo acid dehydrogenases", EUR. J. BIOCHEM., vol. 213, 1993, pages 1091 - 1099
WECKERMANN ET AL., NUC. ACIDS RES., vol. 16, 1988, pages 11841
WECKERMANN ET AL., NUCL. ACID. RES., vol. 16, 1988, pages 11841 - 11843
WILLECKE ET AL.: "Fatty acid-requiring mutant of bacillus subtilis defective in branched chain a-keto acid dehydrogenase", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 246, no. 17, pages 5264 - 5272, XP002627084
WITTMANN ET AL.: "Role of DptE and DptF in the lipidation reaction of daptomycin", FEBS JOURNAL, vol. 275, 2008, pages 5343 - 5353
ZHANG ET AL.: "Catalytic promiscuity of a bacterial D-N-methyltransferase", FEBS LETTERS, vol. 586, 2012, pages 3391 - 3397, XP028941375, DOI: 10.1016/j.febslet.2012.07.050
ZOHREH ET AL.: "Structure, biosynthetic origin, and engineering Biosynthesis of calcium-Dependent Antibiotics from Streptomyces coelicolor", CHEMISTRY & BIOLOGY, vol. 9, 2002, pages 1175 - 1187

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11155843B2 (en) 2013-03-15 2021-10-26 Modular Genetics, Inc. Generation of acyl amino acids
US12031167B2 (en) 2013-03-15 2024-07-09 Modular Genetics, Inc. Generation of acyl amino acids
US9970036B2 (en) 2013-03-15 2018-05-15 Modular Genetics, Inc. Generation of acyl amino acids
US10640799B2 (en) 2013-03-15 2020-05-05 Modular Genetics, Inc. Generation of acyl amino acids
WO2015028423A1 (en) * 2013-08-27 2015-03-05 Evonik Industries Ag A method for producing acyl amino acids
EP2842542A1 (en) * 2013-08-27 2015-03-04 Evonik Industries AG A method for producing acyl amino acids
WO2016049484A1 (en) * 2014-09-26 2016-03-31 Dow Agrosciences Llc Chimeric non-ribosomal peptide synthase
US20160201099A1 (en) * 2014-09-26 2016-07-14 Dow Agrosciences Llc Chimeric non-ribosomal peptide synthetase
US11371066B2 (en) 2015-07-13 2022-06-28 Modular Genetics, Inc. Generation of acyl alcohols
WO2017011592A1 (en) * 2015-07-13 2017-01-19 Modular Genetics, Inc. Generation of acyl alcohols
US12110524B2 (en) 2015-07-13 2024-10-08 Modular Genetics, Inc. Generation of acyl alcohols
WO2020018853A3 (en) * 2018-07-18 2020-03-05 Modular Genetics, Inc. Generation of acyl amino acids
US12123004B2 (en) 2018-07-18 2024-10-22 Modular Genetics, Inc. Generation of acyl amino acids

Also Published As

Publication number Publication date
CA2907229A1 (en) 2014-09-18
US20220259626A1 (en) 2022-08-18
US11155843B2 (en) 2021-10-26
CN105531367A (zh) 2016-04-27
JP6803434B2 (ja) 2020-12-23
US10640799B2 (en) 2020-05-05
US20210062234A1 (en) 2021-03-04
JP6741572B2 (ja) 2020-08-19
US9970036B2 (en) 2018-05-15
JP2021052771A (ja) 2021-04-08
JP7432489B2 (ja) 2024-02-16
US12031167B2 (en) 2024-07-09
JP2016512692A (ja) 2016-05-09
JP2023053308A (ja) 2023-04-12
EP2970928A1 (en) 2016-01-20
BR112015023453A2 (pt) 2017-12-05
US20160076065A1 (en) 2016-03-17
CN117965408A (zh) 2024-05-03
JP2020000247A (ja) 2020-01-09
US20180340198A1 (en) 2018-11-29
EP2970928A4 (en) 2017-02-15

Similar Documents

Publication Publication Date Title
US12031167B2 (en) Generation of acyl amino acids
US20230242923A1 (en) Generation of acyl amino acids
Choi et al. Identification of a polymyxin synthetase gene cluster of Paenibacillus polymyxa and heterologous expression of the gene in Bacillus subtilis
Kraas et al. Functional dissection of surfactin synthetase initiation module reveals insights into the mechanism of lipoinitiation
ES2837485T3 (es) Células y procedimiento para la producción de ramnolípidos
Yakimov et al. Recombinant acylheptapeptide lichenysin: high level of production by Bacillus subtilis cells
US20250270567A1 (en) Generation of acyl amino acids
Huang et al. Biosynthesis of the new broad-spectrum lipopeptide antibiotic paenibacterin in Paenibacillus thiaminolyticus OSY-SE
US20110030103A1 (en) Lipopeptides and lipopeptide synthetases
JP5587763B2 (ja) 二次代謝物の製造方法
EP1041150A1 (en) Hybrid synthetase, fungus/bacterium strain, hybrid peptide and compositions containing same
Kishen et al. Lantibiotics: Strengthening Our Armor Against Antibiotic-Resistant Pathogens
馮智 Biosynthetic Studies on a D-tryptophan-containing Lasso Peptide, MS-271
GB2483075A (en) Derivatives of the calcium dependant antibiotic comprising altered acyl side chains
Copp Catalysed activation of cyanobacterial biosynthetic pathways by phosphopantetheinyl transferases

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201480026841.8

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 2016502994

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2907229

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14776805

Country of ref document: US

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14764638

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2014764638

Country of ref document: EP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015023453

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112015023453

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20150914