WO2014141210A2 - Multifunctional immature dental pulp stem cells and therapeutic applications - Google Patents

Multifunctional immature dental pulp stem cells and therapeutic applications Download PDF

Info

Publication number
WO2014141210A2
WO2014141210A2 PCT/IB2014/059850 IB2014059850W WO2014141210A2 WO 2014141210 A2 WO2014141210 A2 WO 2014141210A2 IB 2014059850 W IB2014059850 W IB 2014059850W WO 2014141210 A2 WO2014141210 A2 WO 2014141210A2
Authority
WO
WIPO (PCT)
Prior art keywords
idpscs
cells
idpsc
cell
composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2014/059850
Other languages
English (en)
French (fr)
Other versions
WO2014141210A3 (en
Inventor
Irina Kerkis
Sabina Glozman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Avita International Ltd
Original Assignee
Avita International Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=51538238&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2014141210(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to EP22171061.9A priority Critical patent/EP4095233A1/en
Priority to EP14765285.3A priority patent/EP2970880B1/en
Priority to IL280850A priority patent/IL280850B2/en
Priority to JP2015562539A priority patent/JP6491606B2/ja
Priority to HK16107564.3A priority patent/HK1219506B/en
Application filed by Avita International Ltd filed Critical Avita International Ltd
Priority to CA2904804A priority patent/CA2904804A1/en
Publication of WO2014141210A2 publication Critical patent/WO2014141210A2/en
Publication of WO2014141210A3 publication Critical patent/WO2014141210A3/en
Priority to IL241470A priority patent/IL241470B/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0652Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662Stem cells
    • C12N5/0664Dental pulp stem cells, Dental follicle stem cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/30Nerves; Brain; Eyes; Corneal cells; Cerebrospinal fluid; Neuronal stem cells; Neuronal precursor cells; Glial cells; Oligodendrocytes; Schwann cells; Astroglia; Astrocytes; Choroid plexus; Spinal cord tissue
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/32Bones; Osteocytes; Osteoblasts; Tendons; Tenocytes; Teeth; Odontoblasts; Cartilage; Chondrocytes; Synovial membrane
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/14Drugs for dermatological disorders for baldness or alopecia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • A61P21/02Muscle relaxants, e.g. for tetanus or cramps
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/02Drugs for disorders of the nervous system for peripheral neuropathies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/02Nutrients, e.g. vitamins, minerals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0618Cells of the nervous system
    • C12N5/0619Neurons
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0618Cells of the nervous system
    • C12N5/0621Eye cells, e.g. cornea, iris pigmented cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0618Cells of the nervous system
    • C12N5/0623Stem cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0676Pancreatic cells
    • C12N5/0678Stem cells; Progenitor cells; Precursor cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00Specific components of cell culture medium
    • C12N2500/05Inorganic components
    • C12N2500/10Metals; Metal chelators
    • C12N2500/20Transition metals
    • C12N2500/24Iron; Fe chelators; Transferrin
    • C12N2500/25Insulin-transferrin; Insulin-transferrin-selenium
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00Specific components of cell culture medium
    • C12N2500/30Organic components
    • C12N2500/38Vitamins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00Specific components of cell culture medium
    • C12N2500/70Undefined extracts
    • C12N2500/80Undefined extracts from animals
    • C12N2500/84Undefined extracts from animals from mammals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00Specific components of cell culture medium
    • C12N2500/90Serum-free medium, which may still contain naturally-sourced components
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30Hormones
    • C12N2501/38Hormones with nuclear receptors
    • C12N2501/385Hormones with nuclear receptors of the family of the retinoic acid recptor, e.g. RAR, RXR; Peroxisome proliferator-activated receptor [PPAR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30Hormones
    • C12N2501/38Hormones with nuclear receptors
    • C12N2501/39Steroid hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30Hormones
    • C12N2501/38Hormones with nuclear receptors
    • C12N2501/39Steroid hormones
    • C12N2501/392Sexual steroids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30Hormones
    • C12N2501/38Hormones with nuclear receptors
    • C12N2501/395Thyroid hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/13Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
    • C12N2506/1346Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells
    • C12N2506/1361Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells from dental pulp or dental follicle stem cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00Supports or coatings for cell culture, characterised by material
    • C12N2533/70Polysaccharides
    • C12N2533/76Agarose, agar-agar

Definitions

  • the present invention relates to compositions of multifunctional immature dental pulp stem cells (IDPSCs), methods for generating clinically useful amount of IDPSCs from the dental pulp (DP) of a patient or single donor at early passages with minimal risk of losing their "sternness" in order to use the stem cells thus obtained in stem cell therapy, and clinical and aesthetic use of IDPSC multi-lineage oriented therapeutic compositions to prevent and treat degenerative diseases and medicinal and aesthetic symptoms.
  • IDPSC dental pulp stem cells
  • DP dental pulp
  • clinical and aesthetic use of IDPSC multi-lineage oriented therapeutic compositions to prevent and treat degenerative diseases and medicinal and aesthetic symptoms.
  • SCs are found in all multicellular organisms. They have the capacity to self-renew and to develop into different specialized cells. Mammalian stem cells are categorized into two general types, embryonic stem cells (ES cells) found during early embryonic development and adult stem cells (ASCs) found in tissues of the organism at later stages and throughout life.
  • ES cells embryonic stem cells
  • ASCs adult stem cells
  • ASCs also called somatic stem cells; possess the same basic characteristics of all SCs. Namely they are capable of indefinite self-renewal, sometimes during an animal's entire life, and differentiation into specialized cell types.
  • the key tasks of ASCs are to sustain and heal the tissues in which where they are located. They remain as undifferentiated cells that may be activated upon tissue damage or other conditions to form multiple cell types and repair tissue damage (Friedenstein A et al. (1974). Precursors for fibroblasts in different populations of hematopoietic cells as detected by the in vitro colony assay method. Exp Hematol 2:83-92).
  • ASCs secrete a large number of bioactive molecules within the tissue which act by modulating the inflammatory response of cells microenvironment, controlling angiogenesis and proliferation of cells involved in tissue repair process, and are therefore also known as pericytes (Caplan AI (2009). Why are MSCs therapeutic? New data: new insight. J Pathol. 217:318-324).
  • ASCs have limited capacity for differentiation in comparison with pluripotent embryonic stem cells, and can usually differentiate to form only specific cell types of their tissue of origin. In contrast to embryonic stem cells, adult stem cells are not able to build a whole organism.
  • ES cells existing during early stages of embryonic development (e.g. blastocyst stage), which possess truly high plasticity and pluripotency enabling them to differentiate to cells derived from all germ layers (Evans, M., and Kaufman, M. (1981) Establishment in culture of pluripotent cells from mouse embryos. Nature 292, 154-6). Upon reintroduction into a blastocyst, ES cells may recommence their regular development and may colonize the germinative tissues and additional embryo tissues.
  • Cultured ES cells may conserve an undifferentiated state over a long period and numerous cell divisions.
  • cultured ES cells can also be induced to differentiate.
  • Ebs pluripotent ES cells
  • ES cells cultured in suspension form three-dimensional aggregates of pluripotent ES cells known as "embryoid bodies" (Ebs), which undergo cell specification to cells of all three germ lines (Ling, V., and Mau, S. (1997) In vitro differentiation of embryonic stem cells: immunophenotypic analysis of cultured embryoid bodies. J. Cell Physiol. 171, 104-5).
  • embryonic stem cells In view of their high pluripotency embryonic stem cells would theoretically be ideal cells to use in a large number of novel medical applications. However, the use of ES cells has generated a lot of controversy and significant ethical and legal concerns hinder their use in stem cell therapy. Treatment based on ASCs is much less controversial as it does not necessitate destruction of human embryos. Additionally ASCs do not produce teratomas and are of low immunogenicity.
  • MSCs mesenchymal stem cells
  • MSCs The main sources of MSCs currently used in medicine are the bone marrow and the umbilical cord. However, the isolation of pure populations of pluripotent SCs and in large amounts from these tissues is difficult. Alternative sources for the isolation of highly pluripotent and homogeneous stem cells are required, which will significantly increase the treatment efficacy of several diseases.
  • MSCs derived from teeth and dental tissues. Teeth present a readily accessible source for obtaining MSCs useful for tissue regeneration and repair. Similar to other organs in the human body, the teeth and their surrounding tissues are composed by mixed populations of cells, which include multipotent MSCs/pericytes, progenitor and differentiated cells (Arthur et al. (2008). Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells 26: 1787-1795; Giordano G et al. (2011) Stem cells from oral niches: a review. Ann Stomatol (Roma) 2:3-8).
  • stem cell therapies significant in vitro expansion of stem cells is necessary in order to generate sufficient quantities of these cells to treat human disease.
  • An object of the present invention is to provide therapeutic compositions and methods of use of multilineage-oriented, multifunctionality of non-tumorogenic and non-immunogenic IDPSCs wherein said multilineage orientation and non- tumorogenecity is proven in vitro and in vivo.
  • In vitro proof of multilineage orientation and is proven by multifunctional markers expression and multifunctionality towards various cell lineages and in vivo proven multilineage is based on in vivo grafting potential of IDPSCs into various tissue and characterized by tissue-specific functionalities. Strong proof in vivo multifunctionality is based on in utero transplantation of IDPSCs into multiple tissues without tumotogenicity and immuno- genicity.
  • IDPSCs Additional proof of non-tumorogenicity is p53, tumor suppressing gene, expression in LP-IDPSCs and need in low passage number following LP harvesting that prevent karyotype mutations and therefore also reduce risk of tumorogenicity.
  • Additonal advantage of disclosed methods of treatment by IDPSCs compositons are reduced immunogenicity potential is that said IDPSCs are negative for HLA-ABC and HLA-DR major histocompatibility (MHC) antigens, therefore allow allogenic transplantation.
  • MHC major histocompatibility
  • Multifuctionality and strong neuroepithelial lineages orientation of IDPSCs of the invention offer multiple uses for regenerative medicine, especially in treatment and prevention of CNS diseases (including but not limited to neurodegenerative disorders), treat renal disorders, pancreatic disorders (diabetes), skin diseases (not limited by wound healing), hair loss symptoms, and assist reproductive functions in women (improve in utero functioning) and men (improve spermatogenesis).
  • CNS diseases including but not limited to neurodegenerative disorders
  • treat renal disorders pancreatic disorders (diabetes)
  • skin diseases not limited by wound healing
  • hair loss symptoms and assist reproductive functions in women (improve in utero functioning) and men (improve spermatogenesis).
  • IDPSC n provides a method for treating or alleviating the symptoms of various pathological or physiological conditions including, but not limited to, neurodegenerative diseases, heart failure, myocardial ischemia, limb ischemia, reproductive disorders, aesthetic symptoms, immune disorders, diabetes, stroke, and skin, liver and kidney diseases by administrating the therapeutic composition comprising IDPSCs concentrate, suspension, mixture as a single active biological ingredient or as an adjunct to additional therapeutic ingredients, such as, but not limited to, cells, active pharmaceutical or biological, or natural ingredients agents.
  • aspects of the present disclosure are based on two approaches: the cultivation of organ and tissue explant, previously known and used for evaluation of the toxic effect of drugs, therapeutic substances and biological agents, for carcinogenic assays, and/or for susceptibility testing.
  • both techniques in combination was used for the first in present invention for isolation of stem cells from dental pulp, which in combination cell culture conditions used for the cultivation of ES cells, allowed the discovery of a novel non-enzymatic method of isolating a population of IDPSC.
  • organ culture tissue architecture One objective for in vitro culture of parts of organ or an entire organ is to maintain organ culture tissue architecture. For example, the parenchyma and stroma are conserved both in terms of its structure and function, and thus the organ culture resembles the in vivo organ in question. Organ culture is widely used in ophthalmology as the method of choice for the preservation of human donor corneas.
  • a second approach is to culture the explant used for isolation of cells. The tissue is isolated under aseptic conditions, chopped and the pieces are placed in a cell culture dish containing culture medium. Explant culture is a culture wherein the cells are left in their surrounding extracellular matrix that more accurately mimic the in vivo environment and over time, progenitor cells migrate out of the tissue and adhere to the surface of the culture dish.
  • Figure 1 depicts stem cell niches in dental pulp (at left) and production of a mixed population of migrating stem/progenitor cells that are isolated at immature dental pulp stem cells (IDPSCs).
  • IDPSCs immature dental pulp stem cells
  • Figure 2 depicts niches of dental stem cells (DSC) in deciduous teeth.
  • Primary teeth are composed of a crown and a root.
  • Al A longitudinal section of a primary tooth shows the perivascular niche (a) indicated with an arrow.
  • B) Resorption of the root in a primary tooth is shown.
  • Bl A longitudinal section of the crown shown in B) demonstrates two other niches of DSC in the subodontoblastic cell rich zone (b) and the cell poor zone containing unmyelinated nerve fibers and fibroblasts (c) and traversed by blood capillaries.
  • C) A magnification of the DSC niches from Bl) is shown.
  • Figure 3 depicts an image captured with phase contrast microscopy demonstrating the differentiation of IDPSC toward neural lineages.
  • A) and C) show differentiated IDPSC isolated from deciduous teeth (DD).
  • B) and D) show differentiated IDPSC isolated from adult teeth (i.e., permanent teeth) (DA). Note the morphological diversity of the neurons. 20X objective.
  • Figure 4 depicts images of IDPSC after neural differentiation captured with light microscopy and shown with hematoxylin and eosin (HE) staining.
  • D-F Nissl granules in neurons (shown with dark brown staining). 20X objective. Scale bar 40 ⁇ .
  • FIG. 5 depicts fluorescence in situ hybridization (FISH) analyses during IDPSC neuronal differentiation.
  • FISH fluorescence in situ hybridization
  • a red fluorescent hybridization probe for chromosome 21 was used. Nuclei are stained with DAPI and appear blue. Note the presence of polyploid cells (4n and 6n) and normal nuclei (2n).
  • Figure 6 depicts the quantification of polyploid cells during in vitro neuronal differentiation of IDPSC. The percentages of cell nuclei with two, four and six hybridization probe signals are indicated.
  • Figure 7 depicts expression on neuronal lineage markers in differentiated IDPSC.
  • J) and H Expression of NeuN, a marker of mature neuronal cells, in differentiated IDPSC.
  • DAPI blue was used for nuclear visualization.
  • Figure 8 depicts microscopic images of neurosphere-like structures formed from differentiated IDPSC.
  • A) and B) depict images using phase contrast microscopy.
  • C) shows positive immunofluorescence for Nestin.
  • Objectives were 40X for A) and B) and 63X for C).
  • Figure 9 depicts RT-PCR analysis of expression of neuronal genes in differentiated (lane 1) and undifferentiated (lane 2) IDPSC.
  • Lane 1 demonstrates the presence of mRNAs for beta-tubulin III, middle neurofilaments, and GFAP.
  • Lane 2 shows expression of middle neurofilaments.
  • Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is a housekeeping gene that was used as a loading control.
  • Figure 10 depicts a spectrum of glial IDPSC derived precursors.
  • Undifferentiated IDPSC express vimentin. Following astrocyte differentiation, the cells express a subset of markers, such as vimentin, CD44 and nestin. Mature astrocytes express GFAP.
  • Figure 11 depicts a spectrum of LP IDPSC derived neuron-like cells.
  • LP IDPSC express nestin, an early marker of neuroepithelial lineage. Following differentiation, IDPSC change their morphology and start to express nestin and beta-tubulin III (neuronal progenitors). Immature neurons express beta-tubulin III while more mature neurons express NeuN and neurofilaments during the maturation period.
  • Figure 12 depicts quantification of spared white matter.
  • A) Luxol fast blue (LFB)-stained area used for white-matter quantification.
  • B) The graph represents the mean values of spared white matter showing higher values in the human immature dental pulp stem cell (IDPSC) groups (*p ⁇ 0.05).
  • D) and E Images illustrating spinal cord sections stained by LFB used for quantification of spared white matter from the subacute + DMEM (D) and subacute + IDPSC (E) groups (DMEM, Dulbecco's modified Eagle's medium).
  • FIGS 13A-13D depict quantification of the immunolabeled trophic factors brain- derived neurotrophic factor (BDNF), nerve growth factor beta (NGF), neurotrophin-3 (NT-3), and neurotrophin-4 (NT-4).
  • BDNF brain- derived neurotrophic factor
  • NGF nerve growth factor beta
  • NT-3 neurotrophin-3
  • NT-4 neurotrophin-4
  • Figure 14 depicts semi-thin and ultra-thin sections of spinal cords from subacute DMEM-treated animals A) - C) and LP IDPSC-treated animals D) - 1).
  • A a semithin section, there are several cavitations (short red arrows).
  • B) is shown a Schwann cell (solid white arrow) with its typical basal laminae (inset), and in C) astrocyte processes (arrowhead), and several microcavitations (asterisks) are indicated.
  • D) shows a semi-thin section from an IDPSC-treated animal with a more preserved morphology.
  • E) shows many preserved fibers (long white arrows) and macrophages (black short arrows).
  • F Schwann cells (solid arrows) and oligodendrocytes (long black arrow) myelinating axons are seen.
  • G) shows an example of regenerative islands, and H) represents a preserved healthy-appearing neuron with intact terminals making synaptic contacts on its cell body, which are shown at higher magnification in I).
  • DMEM Dulbecco's modified Eagle's medium.
  • Figure 15 depicts semi-thin and ultra-thin sections of spinal cords from chronic DMEM- (A, C, and E), and LP IDPSC-treated (B, D, and F) animals.
  • F Preserved neuron cell body with many synaptic contacts terminating on it (rectangle area).
  • Figure 16 depicts functional analysis of the DMEM-treated and LP IDPSC-treated groups.
  • the global mobility test showed a progression of global mobility of the subacute and chronic groups 35 days after treatment.
  • the IDPSC-treated animals (B and E) walked longer distances (blue lines) in the open field than did the DMEM-treated animals (A and D) during the assessment period.
  • Figure 17 depicts progress in the treatment of a mild case of canine distemper, a viral disease, after LP IPDSC transplantation.
  • A) and B) show before IDPSC transplantation.
  • C) and D) show one month after a single application of IDPSCs.
  • Figure 18 depicts progress in the treatment of a severe case of canine distemper, a viral disease, after LP IPDSC transplantation.
  • A) and B) show before IDPSC transplantation.
  • C) and D) show one month after a single application of IDPSCs.
  • FIG 19 depicts cardiomyocyte (CM)-like cells obtained from LP IDPSC.
  • Figure 20 depicts LP IDPSC spontaneous cell fusions through co-culture with other cell types.
  • A), Al), and A2) show mouse bone marrow cells crossed with IDPSC.
  • Al IDPSC.
  • A2) Mouse bone marrow cells.
  • B), Bl), and B2) show human fibroblasts crossed with IDPSC.
  • Figure 21 depicts LP IDPSC (green) homing in muscle myocardium in a rat model of myocardial infarction by coronary artery ligation.
  • Figure 22 depicts the results of an analysis of the myogenic potential and spontaneous fusion of LP IDPSC in golden retriever muscular dystrophy (GRMD) dogs.
  • Different markers such as anti-human nucleus, anti-human dystrophin antibodies and DNA fluorescent probe against human Y chromosome, provide evidences of LP IDPSC homing in dog muscle.
  • Figure 23 depicts engraftment of LP IDPSC into the bone marrow of mice.
  • LP IDPSC were recognized by a specific antibody, and the cells in the bone marrow were identified with Dil, a lipophilic membrane stain.
  • Figure 24 depicts expression of CK18 and integrin beta 1 (CD29) Sertoli cells markers in undifferentiated LP IDPSC.
  • Figure 25 depicts a schematic representation of LP IDPSC transplantation into mouse testes.
  • FIG 26 depicts LP IDPSC transplantation into testes of a fertile mouse.
  • IDPSC morphology A. IDPSC stained with Vybrant (B).
  • C, D On day 1 after transplantation, IDPSC were detected mainly in the cell compartment where Leydig cells are usually located (E). Scale bar: ( ⁇ , ⁇ , ⁇ ) 20 ⁇ ; (C) ⁇ ; (D) 50 ⁇ .
  • Figure 27 depicts LP IDPSC transplantation into testes of a fertile mouse.
  • IDPSC On day 9 after transplantation IDPSC (red) were detected in the intratubular (IT) and tubular regions (TS) in fertile mice testes.
  • DAPI blue was used for nuclear visualization.
  • C Negative control; mice injected with saline. Bars (A) 20 ⁇ ; (B, C) 100 ⁇ .
  • Figure 28 depicts LP IDPSC transplantation into testes of a fertile mouse.
  • A, B On day 9 these cells formed fluorescent groups containing cells with different morphologies observed in the central lumen (B).
  • Sperm of mice are indicated by red arrows (B, C). Some of them exhibit morphology similar to human sperm (white arrows) (B, C). Bars (A-C) 20 ⁇ .
  • Figure 29 depicts images of testes from infertile mice transplanted with LP IDPSC. Localization of IDPSC was observed in the periphery of the TS, which are grafted in the tunica albuginea (A, B).
  • C The white arrow indicates probable round spermatids while the red arrow indicates the primordial germ cells.
  • D the presence of a tetrad a four spermatids is shown with Vibrant (IDPSC stained).
  • IDPSC stained Vibrant
  • Dl is shown another tetrad isolated from the same mouse testicle as a negative control.
  • PI (red) (C) and DAPI (blue) (D, Dl) used for nuclear visualization. Bars (A, B) 20 ⁇ , (C) 10 ⁇ .
  • Figure 30 depicts LP IDPSC derived spermatid-like cells shown in red at different stages of maturation in fertile mice (A-D).
  • A Round spermatid.
  • B-C elongated spermatids. Bars 10 ⁇ .
  • Figure 31 depicts phenotype identification in human and mouse sperm. Some fluorescently labeled sperm cells (shown in red) with morphology quite similar to human sperm were detected (A-C). (D) A human sperm -like morphology. (E) Morphology of mouse sperm. Bars 10 ⁇ .
  • Figure 32 depicts a cytogenetic analysis. FISH analysis using a probe specific for human X chromosome confirmed the presence of only one X signal within some cells suggesting a reduction of chromosomes, which occurs during meiosis. Note that the cells form pairs, which is consistent with the fact that if diploid cells divided the haploid cells would be situated close to each other. Scale Bars 5 ⁇ .
  • Figure 33 depicts cell fusion.
  • a and Al LP IDPSC cytoplasm stained with Vybrant in red; note the morphology of the nucleus (DAPI, blue) in (Al).
  • Mouse germ cell cytoplasm is stained in green (B) with a greater increase in the nucleolus (Bl).
  • C Cell with two fused nuclei and green-stained cytoplasm.
  • D A cell with two fused nucleus and red-stained cytoplasm.
  • E Overlap between (C) and (D).
  • Figure 34 depicts the fluctuations in urea levels during the course of LP IDPSC transplantation, which occurred at time points 4, 7, and 9.
  • Figure 35 depicts the fluctuations in creatinine levels during the course of LP IDPSC transplantation, which occurred at time points 4, 7, and 9.
  • Figure 36 depicts the fluctuations in electrolyte levels (potassium, calcium, and phosphorus) during the course of LP IDPSC transplantation, which occurred at time points 4, 7, and 9.
  • Figure 37 depicts a macroscopical presentation of cat kidney that received human IDPSC therapy.
  • Figure 38 depicts a histological presentation of left (A-A2) and right (B-B2) kidneys. Scale bars; Blood infiltration (red) can also be observed in Bl and B2. In B2 preservation of glomerular endothelial cell is visible.
  • Figure 39 depicts the presence of IDPSC in cat kidney.
  • Figure 40 depicts a histological presentation of skin remodeling demonstrated by Masson's Tri chrome staining: A) - A2) Representative images from animals which received LP EGFP-IDPSC. B) - B2) Representative images from animals which received only PBS. Objective 20X.
  • Figure 43 depicts the neuronal and retinal potential of differentiation of EP and LP IDPSC.
  • EP IDPSC are only able to follow neuronal, but not retinal differentiation expressing the early markers of neuronal differentiation nestin and beta-tubulin III.
  • LP IDPSC express early markers of both neuronal and retinal differentiation (Pax 6 and Chx- 10). Crx, Nrl, and Rhodopsin are late retinal neuronal markers, which areexpressed by differentiated LP IDPSC but not by EP IDPSC.
  • Figure 44 depicts LP IDPSC differentiation toward retinal cells.
  • Figure 45 depicts EP IDPSC, adherent neurospheres, which were not able to progress through retinal differentiation.
  • Figure 46 depicts LP IDPSC, adherent neurospheres, which were able to progress through retinal differentiation.
  • Figure 47 depicts neuronal differentiation of EP IDPSC.
  • F Nuclei stained with DAPI.
  • G Brightfield demonstrating the morphology of glial-like cells.
  • Figure 48 depicts expression of CD73 (A, B) and vimentin (D, E) by undifferentiated IDPSC.
  • Figure 49 depicts immunofluorescence and lack of expression of specific markers of retinal cells such as Pax-6, Chx-10, Crx, Nrl, calbindin and rhodopsin in undifferentiated LP IDPSC.
  • Figure 50 depicts flow cytometry and lack of expression of specific markers of retinal cells such as Pax-6, Chx-10, Crx, Nrl, calbindin and rhodopsin in undifferentiated LP IDPSC.
  • Figure 51 depicts differentiated LP IDPSC showing different types of neuronal morphology, such as neuron- and ganglion-like cells.
  • Figure 52 A) - B) Secondary neurospheres in suspension - 20X objective. C) - D) Secondary neurospheres adhered - objective 10X. E) - F) Rosette-like morphology - 20X objective.
  • Figure 53 depicts expression of CD73 in differentiated LP IDPSC neurospheres and migratory neurons (A-F). In (B) some cells, which are negative for this marker, can be observed.
  • Figure 54 depicts expression of Pax6 in LP IDPSC derived retinal precursor cells, which are organized into neurosphere-like structures. Anti-Pax-6 antibody showed positive immunostaining in 50% of differentiated cells.
  • Figure 55 depicts expression of ChxlO in LP IDPSC derived retinal precursor cells, which are organized into neurosphere-like structures. Anti-Chx-10 antibody showed positive immunostaining in 80% of differentiated cells.
  • Figure 56 depicts expression of Crx in LP IDPSC derived retinal precursor cells, which are organized into neurosphere-like structures. Higher magnification showed nuclear localization of this protein. Anti-Crx antibody showed positive immunostaining in 80% of differentiated cells.
  • Figure 57 depicts expression of N L (nuclear and perinuclear localization) in LP IDPSC derived retinal precursor cells, which are organized into neurosphere-like structures.
  • Anti-N L antibody showed positive immunostaining in 20% of differentiated cells.
  • Figure 58 depicts expression of calbindin (cytoplasm localization) in LP IDPSC derived retinal precursor cells, which are organized into neurosphere-like structures. Anti- calbindin antibody showed positive immunostaining in 20% of differentiated cells.
  • Figure 59 depicts expression of recoverin (cytoplasm localization) in LP IDPSC derived retinal precursor cells, which are organized into neurosphere-like structures. Anti- recoverin antibody showed positive immunostaining in 20% of differentiated cells.
  • Figure 60 depicts expression of rhodopsin (cytoplasm localization) in LP IDPSC derived retinal precursor cells, which are organized into neurosphere-like structures. Anti- rhodopsin antibody showed positive immunostaining in 20% of differentiated cells.
  • Figure 61 depicts a Scheme 1 exemplifying the uterine horns of the experimental model: the group of treated fetuses were in 1, 3, 4 and 5 of the right uterine horn (Cud); these fetuses received transplantation of EGFP LP IDPSC. The control group of fetuses were in 2 and 7 of the left uterine horn (Cue); these were collected for the experimental control.
  • Figure 62 depicts Quantification of EGFP LP IDPSC grafting and evaluation of these cells proliferation after transplantation performed by flow cytometry
  • A B) Quantification of grafting EGFP LP IDPSC in a fragment of lung tissue.
  • Figure 63 depicts quantification of EGFP LP IDPSC grafting and evaluation of these cells proliferation after transplantation performed by flow cytometry
  • A B) Quantification of grafting EGFP LP IDPSC in a fragment of muscle tissue.
  • A anti-IDPSC (52.8%) and B) anti-HuNu (50.2%) antibodies.
  • C Schematic evaluation of EGFP LP IDPSC at different phases of cell cycle after transplantation into dog fetus.
  • D Quantitative and comparative analysis of EGFP LP IDPSC at different phases of the cell cycle.
  • Figure 64 depicts quantification of EGFP LP IDPSC grafting and evaluation of these cells proliferation after transplantation performed by flow cytometry
  • A B) Quantification of grafting EGFP LP IDPSC in a fragment of renal tissue.
  • A anti-IDPSC (42,3%) and B) anti-HuNu (31,3%) antibodies.
  • C Schematic evaluation of EGFP LP IDPSC at different phases of cell cycle after transplantation into dog fetus.
  • D Quantitative and comparative analysis of EGFP LP IDPSC at different phases of the cell cycle.
  • Figure 65 depicts quantification of EGFP LP IDPSC grafting and evaluation of these cells proliferation after transplantation performed by flow cytometry
  • A B) Quantification of grafting EGFP LP IDPSC in a fragment of brain tissue.
  • A Anti-IDPSC (13,1%) and B) anti-HuNu (13,4%) antibodies.
  • C Schematic evaluation of EGFP LP IDPSC at different phases of cell cycle after transplantation into dog fetus.
  • D Quantitative and comparative analysis of EGFP LP IDPSC at different phases of the cell cycle.
  • Figure 66 depicts quantification of EGFP LP IDPSC grafting and evaluation of these cells proliferation after transplantation performed by flow cytometry
  • A B) Quantification of grafting EGFP LP IDPSC in a fragment of placenta maternal tissue.
  • A Anti-IDPSC 64,8%) and B) anti-HuNu (65,6%) antibodies.
  • C, D Schematic evaluation of EGFP LP IDPSC at different phases of cell cycle after transplantation into dog fetus.
  • E,F Quantitative and comparative analysis of EGFP LP IDPSC at different phases of the cell cycle.
  • Figure 67 depicts expression of human protein OCT3/4 (red) in EGFP LP IDPSC (green) grafted between muscle fibers of the fetal canine myocardium (A1-A3).
  • A2 Expression of EGFP protein in LP IDPSC A3
  • Positive immunostaining for Oct 3 ⁇ 4 showing myocyte-like localization.
  • Al-A2 Fcm.
  • Figure 68 depicts a flow cytometry analysis. Expression of markers of undifferentiated cells (MSCs and ES cells) in EGFP LP IDPSC grafted in myocardium. A) Control of cell volume. B-D) Expression of Oct3 / 4 -21.5% (C) CD146 - 0.0% and (D) ⁇ -integnn- 0.0%.
  • Figure 69 depicts a flow cytometry analysis. Expression of markers of undifferentiated cells (MSCs and ES cells) in EGFP LP IDPSC grafted in skeletal muscle tissue - Bisceps. A) Expression of Oct3 / 4 (45.4%) (B) Expression of CD 146 (0.4%) and (C) expression of ⁇ 1 -integral (36.7%).
  • Figure 70 depicts a flow cytometry analysis. Expression of markers of differentiated cells in cardiac tissue. The positive expression of cardiac proteins: myogenin (A), cardiotin (C) and negative for CK-18 (B). We observed positive expression of CD45 +, which quantity varies in myocadium (D) and in the aortic arch (E).
  • Figure 71 depicts a flow cytometry analysis. Expression of markers of differentiated cells in the skeletal muscle tissue - Biceps Femoris. The positive expression of the muscle proteins: (A) Myo Dl, (B) 7.5% Myogenin, (C) CK-18 with 7.7% and (D) 12.0% with CD45.
  • Figure 73 depicts a flow cytometry analysis. Expression of markers of undifferentiated cells (MSCs and Es cells) in EGFP LP IDPSC in the placental tissue.
  • Figure 74 depicts scaling-up of IDPSCs. Horizontally, the process of DP in vitro plating (Day 0, P0) followed by DP adherence and cells outgrowth (Day 3-4) is shown. This process is followed by enzymatic treatment (PI) of the cells and formation of multiple colonies (CFU-f : Colony Forming Units-fibroblast). After 5 days, enzymatic treatment is performed to harvest a population of multicolony-derived IDPSCs (P2). Next, in vitro expansion of IDPSCs (P3) is performed. The numbers above each plate in the figure represent approximate quantities of harvested IDPSCs in each passage. Vertically, the same process is shown albeit after multiple mechanical transfers of DP.
  • Figure 75 depicts strategies of isolation, in vitro expansion, and banking of SHED and IDPSC.
  • the process of SHED isolation by enzymatic treatment of the DP, SHED in vitro plating (Day 0, PI), and formation of multiple colonies in a heterogeneous population is shown at left.
  • the process of IDPSC isolation, shown at right, includes DP in vitro plating (Day 0, P0) followed by DP adherence and cells outgrowth (Day 3-4).
  • Scaling-up of IDPSCs is a process that includes enzymatic treatment (PI) of the cells and formation of multiple colonies (CFU-f: Colony Forming Units-fibroblast).
  • enzymatic treatment is performed to harvest a multicolony-derived IDPSCs (P2) population.
  • in vitro expansion of IDPSCs (P3) is performed.
  • the numbers above cell culture flasks in the figure represent approximate quantities of harvested IDPSCs in each passage. Vertically, the same process is shown albeit after multiple mechanical transfers of
  • Figure 76 depicts dental pulp and IDPSCs.
  • LP Karyotype analysis of IDPSCs
  • Figure 77 depicts BrdU immunostaining of DP.
  • Figure 78 depicts expression of nestin, STRO-1, vimentin, and Oct3/4 in DP.
  • Figures 5A-5H show nestin expression in the cell-rich zone ( Figures 5A-5C), the cell-free zone ( Figures 5D-5F) and in the odontoblastic layer ( Figures 5G-5H).
  • E A small capillary with two intensively stained nestin positive cells.
  • F Same as in E) with nestin positive cells in the lateral of the capillary (arrow).
  • L) and M Vimentin positive (black arrows) cell localization in cell rich (L) and cell free (M) zones.
  • Figure 79 depicts characterization of EP and LP of IDPSCs.
  • Figures 6A1-6F1 Flow cytometry showing EP of IDPSCs, which highly expressed such markers as SH2/CD105 (Al); SH3/CD73 (Bl); nestin (CI); vimentin (Dl); fibronectin (El).
  • Fl Low expression of Oct3/4 in EP;
  • A2-F2) Flow cytometry showing LP of IDPSCs, which expressed the same markers as EP.
  • F2 Higher expression of Oct3/4 in LP than in Fl .
  • A3-F3) Immunofluorescence of LP of IDPSCs using the same markers as in (A2-E2).
  • F3) Nuclear localization of Oct3/4 can be observed.
  • Figures 80A-D depict expression of Oct3/4 in IDPSC populations each isolated from four unrelated donors. The proportion of Oct3/4 positive cells in each population was A) 25%; B) 47%; C) 12%; D) 5%, respectively.
  • Figure 81 depicts the proliferation rate and gene expression of IDPSCs after cultivation in three distinct culture media. A) Proliferation curve of LP before cryopreservation; B) Proliferation curve of LP after cryopreservation. C) Gene expression of LP after cryopreservation.
  • Figure 82 depicts the flow cytometry expression profiles of IDPSC.
  • A-B IDPSC positive immunostaining of CD 105 and CD73 for human ES cell markers.
  • C-D Appropriate negative IgGl controls.
  • E-G Lack of expression of endothelial and hematopoietic markers such as CD34, CD45 and CD43 by IDPSC.
  • H Positive immunostaining for CD13. Phycoerythrin (PE) and FITC-conjugated secondary antibody were used.
  • Figure 83 depicts flow cytometry expression profiles of IDPSC.
  • A-B Lack of expression of HA-DR and HLA-ABC by IDPSC.
  • C-H Positive immunostaining for CD44 (86%), CD117 (80%), CD90 (100%), CD29 (99.5%), Nestin (99.2%), and Vimentin (95.6%).
  • Figure 84 depicts flow cytometry and RT-PCR analyses of IDPSCs.
  • A-E Flow cytometry expression profiles for neurotrophic factors BNDF (brain-derived neurotrophic factor), GNDF (glial cell line-derived neurotrophic factor), NGF- ⁇ (nerve growth factor), NT-3 (Neurotrophin-3), NT-4/5 (Neurotrophin-4/5).
  • F Flow cytometry expression profile for p75 by IDPSC.
  • G Reverse transcription-polymerase chain reaction (RT-PCR) analysis of expression of the neurotrophic factors and p75 in IDPSC. Lane 1 - cDNA template; Lane 2 - Negative control, no reverse transcriptase; Lane 3 - Negative control, no template.
  • H RT-PCR analysis of p75 expression; GAPD - housekeeping gene.
  • Figure 85 depicts undifferentiated human IDPSC showing positive immunostaining with human-specific antibodies against limbal stem cells and corneal epithelium.
  • RT-PCR analysis of expression of limbal stem cell markers in hIDPSC Lane 1, ladder 100 bp; Lane 2, human corneal tissues; Lane 3, human limbal tissue; Lane, 4 hIDPSC. RT-PCR analyses demonstrated presence of ABCG2, connexin 43 and K12 mRNAs in hIDPSC while those of K3 were not found in hIDPSC.
  • Figure 86 depicts expression of ES cell markers in IDPSC.
  • hESC human epithelia stem cells
  • Figure 87A depicts images of agarose gels with RT-PCR products for vimentin, tenascin-C, type 1 collagen, and fibronectin amplified from hIDPSCs isolated from deciduous teeth (DL-1 and DL-4) and from a third molar (DL-2).
  • Figure 87B depicts a densitometry analysis of the bands shown in Figure 87A.
  • Figure 88 depicts representative immunofluorescence images of (A) vimentin, (B) type I collagen, (C) fibronectin, and (D) tenascin-C in DL-1 cells (hIDPSCs isolated from a deciduous tooth).
  • A Vimentin appears as filament waved bundles branched out from the central body to reach the peripheral domains of the cell.
  • B Type I collagen is revealed as dots spread all over the cytoplasm with a higher concentration around the perinuclear area.
  • Fibronectin (C) as well as tenascin-C (D) appears as small dots homogeneously distributed throughout the cytoplasm (original magnification: 400X).
  • Figures 89A-B depict quantification of p53 expression and Figures 89C-D depict quantification of CD44 expression in two independent IDPSC populations isolated from different donors. p53 was expressed in 99.5% and 99.4% of the IDPSC cells of the two populations while CD44 was expressed in 98.5% and 98.6% of the IDPSC cells of the two populations.
  • Figure 90 depicts expression of SOX2 protein in IDPSC after varying cycles.
  • Figure 90a depicts expression of SOX2 protein in IDPSC after 15 cycles of mechanical transfer and after in vitro culturing, passages 2 (A) and 5 (B).
  • Figures 90A1 and 90B1 demonstrate cell passage dependent intracellular localization of SOX2: Al -nuclear, A2-perinuclear.
  • Figure 90b depicts expression of SOX2 protein in IDPSC after 45 cycles of mechanical transfer and after in vitro culturing, passages 2 (A) and 5 (B).
  • Figure 91a depicts expression of SOX1 and ⁇ -tubulin proteins in late population (LP) of hIDPSC derived neurons.
  • A. Nucleus (white arrow) of neurons stained with DAPI; A2. Positive immunostaining for SOX1 observed in the nucleus (white arrow) of neurons; A3 Positive immunostaining for ⁇ -tubulin; A3.
  • Merged images A-A2; A4. Major magnification of inset in A3 demonstrates superposition of DAPI and SOX1 in the nucleus of neurons (white arrow).
  • Epifluorescence, Scale bar 5 ⁇ .
  • Figures 91b-e depict enrichment of LP of hIDPSC with neural progenitors and neurons following 15-, 30- and 45 cycles of dental pulp mechanical transfer and induction of neural differentiation.
  • Figure 92a demonstrates a nucleus of IDPSC-neuroblasts positively immunostained with anti-BrdU antibody and neuronal bodies, which reacts positively with ⁇ -tubulin class III.
  • Figure 92b-c show the enrichment of differentiated IDPSC population with slightly differentiated neuroblasts following growing cycle numbers of DP mechanical transfer.
  • Figure 93a depicts enrichment of LP of hIDPSC with neural progenitors and neurons following 15-, 30- and 45 cycles of dental pulp mechanical transfer and induction of neural differentiation.
  • BrdU positive cells present red and SOX2 green nucleus, which are also stained with DAPI (blue).
  • Figure 92b demonstrates percentage of BrdU and SOX2 positive cells shown in relation with nucleus stained with DAPI (blue).
  • Figure 94a depicts a graphic abstract from Cimadamore et al., 2011.
  • Figure 94b depicts a summary of an embodiment disclosed herein.
  • Figure 95 depicts co-expression of neural markers in IDPSCs derived neuroblasts that form neurospheres and rosettes.
  • F) and H Dynein - Lisl- Ndel complex expression.
  • L) CD 146 expression and in M) control. Scale bar ⁇ , Nucleus stained with DAPI (blue).
  • Figure 96 depicts male karyotypes of in vitro cultured LP IDPSC at early and late passages.
  • Figure 97 depicts an effect of IDPSCs i.p. inoculation on cytokine production by lung cells of C57B1/6 mice i.t. infected with Mtb and M. bovis strains differed in virulence.
  • Figure 98 depicts wisdom tooth pulp tissue and immunohistochemical staining for CD105.
  • A General aspect of the tissue, HE staining; the arrow indicates the perivascular niche and the star indicates nerve plexus. Negative control reaction, only the secondary antibody was used.
  • B Positive staining for CD 105, observed in perivascular (black arrow) and vascular plexus (orange arrow).
  • C, D, F and G even in B at higher magnification.
  • H Positive staining for CD 105 - nerve plexus. Contracorado with hematoxylin and eosin (HE).
  • Figure 99 depicts wisdom tooth pulp tissue and immunohistochemical staining for CD73 - SH3 and SH4. A.
  • HE staining indicates the perivascular niche.
  • B C. Positive staining for SH3 observed in vascular (black arrow) and perivascular (orange arrow).
  • D nerve plexus, neuronal cells simile.
  • E F - very week staining for SH-4.
  • Figure 100 depicts wisdom tooth pulp tissue and immunohistochemical staining for N- cadherin (AC), ABCG2 (D, E) and Nanog (F).
  • A General aspect of the tissue, HE staining, positive staining for N-cadherin.
  • B C. Largest increase, positive staining for N- cadherin observed in perivascular niche (black arrow) (B) and site of pericytes (orange arrow) (C).
  • D, E positive expression of ABCG2 shows location on the membrane (black arrow).
  • F Positive staining for Nanog - transcription factor, less intense compared with ABCG2, cytoplasmic localization (black arrow).
  • Figure 101 depicts pulp tissue wisdom tooth comparative analysis of immunohistochemical staining for CD 105 + and + CD73/SH3 and N-cadherin.
  • A. General Appearance tissue, HE staining, marking CD 105 +.
  • B General appearance of the fabric, HE staining, marking CD73/SH3 +.
  • C Same as in (A), greater increase.
  • Figure 102 depicts fibroblastoid morphology of the cells immunopositive for CD105 (A) and neuronal cells immunopositive for the facsimile CD73/SH3 +. Black arrows.
  • Figure 103 depicts a dorsal region of a nude mouse without forming cell masses and/or teratoma after subcutaneous application of human IDPSC.
  • Figure 104 depicts a third molar tooth.
  • Figure 105 depicts an exemplary flow chart for a batch release process for industrial scale-up of hIPDSC by LP method in order to obtain clinically relevant quantities for multiple patient dosing.
  • Microgel refers to a gelatinous protein mixture secreted by Engelbreth-Holm-Swarm (EHS) mouse sarcoma cells that resembles the complex extracellular environment found in many tissues.
  • EHS Engelbreth-Holm-Swarm
  • a “harvesting cycle” constitutes a transfer of the DP to a new cell culture container after adherence and outgrowth of the IDPSCs followed by preservation (e.g. cryopreservation) and/or sub-culturing of the outgrowth of IDPSCs.
  • hypooxic conditions comprise culturing the cells under culture conditions comprising or equivalent to:
  • stem cells refers to immature, unspecialized cells that, under certain conditions, may differentiate into mature, functional cells.
  • hIDPSC refers to an undifferentiated stem cell that is capable to differentiate into a wide spectrum of cell types, including but not limited to cells from central and periphery neural systems, e.g. neurons, astrocytes, ganglial cells, and/or oligodendrocytes.
  • LP refers to IDPSCs after multiple DP transfer at least 15 cycles .
  • EP refers to IDPSCs isolated just after DP extraction.
  • cell culture or “cultured cell” refer to cells or tissues that are maintained, cultured, cultivated or grown in an artificial, in vitro environment.
  • pluripotent refers to precursor cells that have the ability to form any adult cell.
  • undifferentiated refers to cultured cells that display morphological characteristics of undifferentiated cells, distinguishing them from differentiated cells.
  • substantially homogenous population of cells refers to a population of cells wherein the majority (e.g., between about 50% to about 90%) of the total number of cells have a specified characteristic of interest (for example, expression of SOX1, SOX2 and beta tubulin).
  • co-express refers to the simultaneous detection of two or more molecular markers, e.g., SOX1 and SOX2, and beta-3 -tubulin in same cell population , preferably in/on same cell.
  • the terms “(cell) culture maintenance,” “proliferation”, “propagation”, “expansion” and “growth”, refers to continued survival of a cell or population of cells with an increase in numbers of cells.
  • long term refers to the cultivation of DP for multiple harvesting cycles of IDPSCs more than 15, preferably > 25, more preferably 25- 60 cycles, and more preferably 15-45 cycles and more, named “Late Population” (LP).
  • large scale refers to the isolation from DP and cultivation of SC under conditions which permit at least the doubling of cells after each nonenzymatic harvesting cycle.
  • neural progenitor cell refers to a cell derived from a stem cell that can produce progeny that are capable of differentiating into more than one cell type of CNS and PNS.
  • neuroprotective factors refer to factors that support neurogenesis selected from, without being limited thereto, NGF, BDNF, NT3, NT4.
  • nerve biomarkers SOX1 (for sex determining region Y-box 1) refers to a transcription factor which is involved in early central nervous system development. SOX1 may be expressed particularly in the ventral striatum.
  • SOX2 refers to a neural progenitor and sternness marker that is a transcription factor expressed by self-renewing and multipotent stem cells of the embryonic neuroepithelium (9).
  • SOX2 may be expressed by actively dividing neural progenitor cells in the neurogenic regions in the adult rat brain and may also be expressed by glial fibrillary acidic protein immunopositive astroglia, widely distributed in the brain parenchyma (10).
  • SOX2 is also known, in conjunction with Oct4, SOX2 as essential transcription factor for pluripotency (Ivanona et al, Nature 442:5330538 (2006); Methods of preparing induced pluripotent stem cells from mouse are also known (Takahashi and Yamanaka, 2006).
  • Induction of iPS cells typically require the expression of or exposure to at least one member from Sox family and at least one member from Oct family.
  • the terms “class III ⁇ -tubulin”, “beta.3-tubulin”, “microtubule- associated protein 2 (MAP-2), or neurofilament” refer to microtubule elements expressed exclusively in neurons and serves as a specific neuronal promoter, characteristic of neurons phenotypic marker of early neuronal precursors.
  • the term “bromodeoxyuridine” (5-bromo-2'-deoxyuridine, BrdU) refer to a synthetic nucleoside that is used in the detection of proliferating cells in living tissues. BrdU can be incorporated into the newly synthesized DNA of replicating cells (during the S phase of the cell cycle). Antibodies specific for BrdU can then be used to detect the incorporated chemical, thus indicating cells that were actively replicating their DNA. BrdU can be passed to daughter cells upon replication. BrdU has been demonstrated to be detectable over two years post-infusion.
  • Cognitive function refers to mental processes of an animal or human subject relating to information gathering and/or processing; the understanding, reasoning, and/or application of information and/or ideas; the specification of information; problem-solving, and mental processes such as learning, perception, and/or awareness of ideas and/or information.
  • Cognitive function may be defined via one or more tests or assays for cognitive function, for example valid diagnostic tests and/or computerized cognitive test
  • degenerative disorder includes any disease in which cell death or dysfunction is present.
  • degenerative disorders include but are not limited to neurodegenerative disorders, cardiac dysfunction, infertility, renal failure, skin disease, autoimmune disease, diabetes, retinal and other ophthalmologic diseases, and hyperproliferative disorders such as cancer.
  • neuralgenesis refers to the proliferation, migration, differentiation, and/or survival of a neural cell in vivo or in vitro.
  • neurodegenerative disorder is defined as disease, in which cells of the central or peripheral nervous system are lost.
  • Examples for neurological and/or neurodegenerative disorders are spinal cord injury, intracranial or intravertebral lesions including, but not limited to, contusion, penetration, shear, compression or laceration lesions of the spinal cord or whiplash shaken infant syndrome.
  • the neurological disorders also include ischaemic events, or ischaemia or ischaemic disorders which can be defined as any local or regional state of hypoxia in cells or tissues which are usually due to an inadequate blood supply (circulation), e.g. caused by a blockage or obstruction of a blood vessel in this area.
  • ischaemic events or ischaemia or ischaemic disorders which can be defined as any local or regional state of hypoxia in cells or tissues which are usually due to an inadequate blood supply (circulation), e.g. caused by a blockage or obstruction of a blood vessel in this area.
  • the hypoxia can cause acute injury as in hypoxia and/or ischemia including, but not limited to, cerebrovascular insufficiency, cerebral ischemia or cerebral infarction (including cerebral ischemia or infarctions originating from embolic occlusion and thrombosis), retinal ischemia (diabetic or otherwise), glaucoma, retinal degeneration, multiple sclerosis, ischemic optic neuropathy, reperfusion following acute cerebral ischemia, perinatal hypoxic-ischemic injury, or intracranial hemorrhage of any type (including, but not limited to, epidural, subdural, subarachnoid or intracerebral hemorrhage).
  • cerebrovascular insufficiency cerebral ischemia or cerebral infarction (including cerebral ischemia or infarctions originating from embolic occlusion and thrombosis), retinal ischemia (diabetic or otherwise), glaucoma, retinal degeneration, multiple sclerosis, ischemic optic
  • the IDPSCs of the disclosures herein demonstrated a new type of potency, referenced herein as "mixed-maxi-potency”.
  • Mixed-maxi-potency is a mix of multipotency characteristics of mesenchymal stem cells (MSC) (about 99% of the IDPSCs carry MSC markers), pluripotency characteristic of human pluripotent stem cells (hPSC) (up to 30%), neuropepithelial stem cell marker enrichment (90%, wherein the nestin expression is in 95% of cells), and relatively low STRO expression in contrast to DPSC derived by other methods.
  • Such mixed maxi-potent compositons of isolated IDPSC populations derived under long-term culturing (LP) result in a synergy of regenerative properties towards neuro-epithelial differentiation.
  • such mixed maxi-potent compositons of IDPSC populations are characterized by high scalability and safety (immunocompatibility and low risk of tumor formation).
  • Described herein are the distinct pattern and characteristics of a mixed population of human immature dental pulp stem cells isolated from their niche localized in the central region of the coronal and radicular pulp, which contains large nerve trunks and blood vessels. More specifically this region can be identified as the innermost pulp layer, which is a cell rich zone and contains fibroblasts and undifferentiated stem cells in close association with blood vessels.
  • a new immature dental pulp stem cell phenotype is described and characterized by the expression of hallmarkers of embryonic, mesenchymal, limbal and neuronal/neuroepihelial stem cells.
  • the IDPSCs are multipotent cells, which are able to produce the derivativess of the three germ layers, the endoderm, ectoderm and mesoderm.
  • stem cells can be found in a special microenvironment called a stem cell niche.
  • a niche is a specialized anatomic site, which interacts with stem cells. It is hypothesized that a stem cell niche prevents differentiation and thus regulates their fate.
  • niche factors act on embryonic stem cells inducing their proliferation or differentiation. These changes occur due to alteration of genes and specific proteins expression leading to the development of the fetus and formation of the entire organism.
  • stem cell niches continuously produce specialized cells that are necessary to complete development. In an adult organism, the niche maintains adult stem cells in a quiescent state.
  • Stem cell activation occurs in response to tissue injury when the surrounding microenvironment is sending signals to stem cells to promote self-renewal, proliferation and differentiation to restore damaged tissues.
  • Several factors are involved in regulation of stem cell behavior within the niche.
  • cell-cell interactions between stem cells as well as interactions between stem cells and neighboring differentiated cells, interactions between stem cells and adhesion molecules, extracellular matrix components, the oxygen tension, growth factors, cytokines, and the physiochemical nature of the environment including the pH, ionic strength (e.g., Ca 2+ concentration), and metabolites like ATP are also important.
  • Such reciprocal interaction between stem cells and the niche occurs during development and is maintained during adulthood.
  • hematopoietic stem cells of bone marrow have their niche composed of subendoosteal osteoblasts, sinusoidal endothelial cells and bone marrow stromal cells, such as fibroblasts, monocytes and adipocytes.
  • the intestinal stem cell niche is constituted by a subepithelial fibroblast/myofibroblast network which surrounds the intestinal crypts.
  • stem cell niches can been found in all adult tissues. Knowledge about stem cell niches in vivo is very relevant because it can help develop cell culture in vitro conditions and to preserve cell sternness after isolation. Identification of such niches within different tissues and discovery of their components and functioning is essential for regenerative therapies.
  • Crowns of the teeth contain coronal pulp.
  • the coronal pulp has six surfaces: the occlusal, the mesial, the distal, the buccal, the lingual, and the floor. Because of continuous deposition of dentin, the pulp becomes smaller with age. This is not uniform throughout the coronal pulp but progresses faster on the floor than on the roof or side walls.
  • the central region of the coronal and radicular pulp contains large nerve trunks and blood vessels. This area is lined peripherally by a specialized odontogenic area which has three layers (from innermost to outermost).
  • the innermost pulp layer is a cell rich zone, which contains fibroblasts and undifferentiated mesenchymal stem cells in close association with blood vessels.
  • Identification of a stem cell niche also helps to isolate homogeneous population of adult stem cell with unique characteristic similar to those of human embryonic stem cells, so their isolation does not involve any ethical considerations.
  • Such adult stem cells are a promising source for regenerative medicine and have an advantage when compared with recently described induced pluripotent stem cells because these are normal cells, which do not require the use of genetic manipulation or pre-selection methods for isolation.
  • a composition comprises an isolated population of immature dental pulp stem cells (IDPSCs), wherein at least 50% of the IDPSCs express a p75 neuroepithelial marker. In some embodiments, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the IDPSCs express a p75 neuroepithelial marker.
  • IDPSCs immature dental pulp stem cells
  • the present invention provides a composition comprising an isolated population of IDPSCs, wherein at least 50% of the IDPSCs express a p53 tumor suppressor marker. In some embodiments, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the IDPSCs express a p53 tumor suppressor marker. In one aspect, less than 50% of the IDPSCs express a marker selected from CD13 and CD31.
  • less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% of the IDPSCs express a marker selected from CD13 and CD31.
  • the IDPSCs are negative for CD34, CD43, and CD45 markers.
  • CD 13 is one of the earliest markers of cells committed to the myeloid lineage and is dispensable for normal hematopoiesis and myeloid cell functions. It plays an important functional role in vasculogenesis and is identified as a critical regulator of angiogenesis. In non-hematopoietic cells, CD 13 was found in endothelial cells, epithelial cells, certain renal areas, brain cells, bone marrow, osteoclasts. As an extracellular peptidase, CD 13 functions to cleave single neutral amino acids from the N-terminus of small peptides.
  • CD31 is also known as platelet endothelial cell adhesion molecule (PECAM-1).
  • At least 50% of the IDPSCs produce a neurotrophic factor selected from brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GNDF), nerve growth factor-beta (beta-NGF), neurotrophin-3 (NT3), neurotrophin-4 (NT4), and neurotrophin-5 (NT5).
  • BDNF brain-derived neurotrophic factor
  • GNDF glial cell line-derived neurotrophic factor
  • beta-NGF nerve growth factor-beta
  • NT3 neurotrophin-3
  • NT4 neurotrophin-4
  • NT5 neurotrophin-5
  • at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the IDPSCs produce a neurotrophic factor selected from BDNF, GNDF, beta-NGF, NT3, NT4, and NT5.
  • BDNF brain derived neurotrophic factor
  • GDNF glial derived neurotrophic factor
  • CNTF ciliary neurotrophic factor
  • BDNF is a member of the nerve growth factor family that promotes in vitro differentiation of NSC, human subependymal cells, and neuronal precursors to neurons and promotes neurite outgrowth of hippocarnal stem cells in vivo.
  • BDNF and EGF exclusive differentiation into tyrosine hydroxylase positive neurons has been seen.
  • GDNF is a member of the TGF-superfamily. In early neurogenesis, GDNF is expressed in the anterior neuroectoderm, suggesting that it may play a key role in neuronal development.
  • GDNF promotes survival of motor neurons in peripheral nerve and muscle and has neurotrophic and differentiation abilities.
  • At least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the IDPSCs express nestin. In other aspects, less than 20%, less than 15%, less than 10%, or less than 5% of the of the IDPSCs express Oct3/4.
  • composition comprising a phenotypically uniform multi- lineage population of isolated human post-natal IDPSCs is characterized by a multifunctional molecular profile of:
  • IDPSCs wherein at least 80% of the IDPSCs express a marker selected from nestin, p75, ATP-binding cassette sub-family G member 2 (ABCG2), p63, brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GNDF), nerve growth factor-beta (beta-NGF), neurotrophin-3 (NT3), NT4, and NT5; and
  • mesenchymal stem cell profile IDPSCs wherein at least 80% of the population express a marker selected from CD105, CD73, CD90, CD29, CD44, CD117, vimentin, fibronectin, alkaline phosphatase (ALP), alpha-fetoprotein (AFP), tenascin-C, matrix metalloproteinase-1 (MMP-1), MMP-2, MMP-9, syndecan 1 (SDC1), SDC2, SDC3, SDC4, p53, and collagen type 1;
  • a marker selected from CD105, CD73, CD90, CD29, CD44, CD117, vimentin, fibronectin, alkaline phosphatase (ALP), alpha-fetoprotein (AFP), tenascin-C, matrix metalloproteinase-1 (MMP-1), MMP-2, MMP-9, syndecan 1 (SDC1), SDC2, SDC3, SDC4, p53, and collagen type 1;
  • pluripotent stem cell profile IDPSCs wherein from 2% to 30% of the IDPSCs express at least one marker selected from Oct3/4, SOX2, Nanog, TRAl-60, TRA1-81, and SSEA4; and
  • mesenchymal stem cell profile IDPSCs wherein the IDPSCs are negative for HLA-ABC and HLA-DR major histocompatibility (MHC) antigens.
  • MHC major histocompatibility
  • HLA human leukocyte antigens
  • At least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the IDPSCs express a marker selected from nestin, p75, ATP-binding cassette sub-family G member 2 (ABCG2), p63, brain-derived neurotrophic factor (BDNF), glial cell line- derived neurotrophic factor (GNDF), nerve growth factor-beta (beta-NGF), neurotrophin- 3 (NT3), NT4, and NT5.
  • BDNF brain-derived neurotrophic factor
  • GNDF glial cell line- derived neurotrophic factor
  • beta-NGF nerve growth factor-beta
  • NT3 neurotrophin- 3
  • NT4 and NT5 neurotrophin- 3
  • less than 20%, less than 15%, less than 10%, or less than 5% of the of the IDPSCs express a marker selected from STRO-1 and CD 146.
  • from 2% to 30% or any range therein (e.g., from 5% to 30%, from 10% to 30%, from 2% to 10%, from 2% to 20%) of the IDPSCs express at least one marker selected from Oct3/4, SOX2, Nanog, TRA1-60, TRA1-81, and SSEA4.
  • a composition comprises a phenotypically uniform multi- lineage population of isolated human post-natal IDPSCs, wherein said population of human post-natal IDPSCs is obtained as an outgrowth from DP cultured for at least 10 harvesting cycles under hypoxic conditions.
  • LP IDPSCs are transferred mechanically without enzymatic treatment. This may preserve the DP and allow for a hypoxia-induced multi- lineage orientation of the IDPSCs.
  • the IDPSCs are cultured with an extracellular matrix (ECM) substrate comprising fibronectin, collagen, laminin, vitronectin, polylysine, heparan sulfate proteoglycans, entactin, or a combination thereof.
  • ECM extracellular matrix
  • the ECM substrate may be Matrigel.
  • the IDPSCs may be isolated as an outgrowth from DP cultured for at least 5 harvesting cycles, at least 10 harvesting cycles, at least 15 harvesting cycles, at least 20 harvesting cycles, at least 25 harvesting cycles, at least 30 harvesting cycles, at least 35 harvesting cycles, at least 40 harvesting cycles, at least 45 harvesting cycles, at least 50 harvesting cycles, at least 55 harvesting cycles or at least 60 harvesting cycles.
  • the IDPSCs may be isolated from dental pulp (DP) from a tooth selected from a deciduous tooth, a permanent tooth, and a third molar.
  • DP dental pulp
  • this dislcosure also provides a method of producing an isolated population of IDPSCs.
  • Unique advantages provided by this method relate to the ability to scale up production of IDPSCs and the resulting clinical utility of the IDPSCs.
  • the published therapeutic doses of cells used in central nervous system (CNS) clinical trials with stem cells are in the range of 10 x 10 6 to 10 x 10 9 cells per dose.
  • the average numbers of cells generated after 5-10 passages of the IDPSCs are as follows.
  • IDPSCs Starting from 5 x 10 5 cells following enzymatic digestion after 5 passages, 3 xlO 8 IDPSCs will be produced, and after 10 passages 5 x 10 9 cells of IDPSC will be produced.
  • One dental pulp (DP) after 15 harvesting cycles (about 1.5 month with harvesting cycles occurring once about every 3 days) will produce 5 x 10 12 IDPSCs at passage 5 using EP IDPSCs cultured with enzymatic treatment.
  • LP IDPSCs and mechanical transfer without enzymatic treatment After 15 harvesting cycles about 3 x 10 13 IDPSCs will be
  • An additional advantage of the method is that the proliferation rate of cells isolated from DP by explant culture is maintained constant and usually quadruples each 3-4 days. Proliferation rate of cells isolated from DP using enzymatic treatment usually triple each 3-4 days.
  • this disclosure provides a method of producing an isolated population of IDPSCs comprising:
  • Steps (d) and (e) may be repeated at least 10 times, at least 15 times, at least 20 times, at least 25 times, at least 30 times, at least 35 times, at least 40 times, at least 45 times, at least 50 times, at least 55 times or at least 60 times.
  • the DP may be cryopreserved and thawed prior to mechanically transferring the DP explant into another container with a culture medium.
  • clonogenicity is preserved both before and after cryopreservation.
  • the efficiency of clonogenecity before and/or after cryopreservation may be greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 96%, greater than 97%, greater than 98% or greater than 99%.
  • a method of this disclosure may comprise passaging the IDPSCs into a subculture with or without protease treatment.
  • Subculture may be repeated a maximum of 10 times, a maximum of 9 times, a maximum of 8 times, a maximum of 7 times, a maximum of 6 times, a maximum of 5 times, a maximum of 4 times, a maximum of 3 times, a maximum of 2 times or a maximum of 1 time.
  • culturing of the DP for about 3 days generates an isolated population of at least 1 x 10 5 IDPSCs, at least 2 x 10 5 IDPSCs, at least 3 x 10 5 IDPSCs, at least 4 x 10 5 IDPSCs, at least 5 x 10 5 IDPSCs, at least 6 x 10 5 IDPSCs, at least 7 x 10 5 IDPSCs, at least 8 x 10 5 IDPSCs, at least 9 x 10 5 IDPSCs or at least 1 x 10 6 IDPSCs.
  • the culture medium is DMEM/F12 medium or MEM-alpha medium.
  • the culture medium may be supplemented with about 5% to about 20% fetal bovine serum, about 1% of non-essential amino-acids, about 1% of L-glutamine or an L- glutamine substitute, and about 1% of an antibiotic.
  • aspects of this disclosure also encompass an isolated population of IDPSCs generated by any of the methods disclosed herein.
  • the stem cells of the disclosed method are dental pulp stem cells.
  • Dental pulp stem cells are a kind of somatic stem cells which is present in dental pulp tissue inside the dentine of teeth, and which is capable of differentiating into dental pulp, dentine and the like (capable of differentiating mainly into odontoblasts).
  • Dental pulp stem cells can be obtained by extirpating dental pulp tissue from (i) a tooth extracted for the sake of convenience in orthodontic treatment or a tooth extracted because of periodontal disease and the like, or from (ii) a wisdom tooth (aka a third molar) extracted for the sake of convenience in orthodontic treatment or of treatment of wisdom tooth periodontitis and the like.
  • any tooth retaining dental pulp tissue can be used as a source of dental pulp stem cells, it is preferable to select a tooth that is rich in dental pulp stem cells with a high potential for proliferation.
  • dental pulp stem cells are dental pulp tissue derived from a wisdom tooth of a young person (for example, in humans, about 12-16 years) having the wisdom tooth extracted for orthodontic purposes.
  • wisdom teeth at these ages are still in the midst of dental root formation during the initial stage of dental differentiation, and are characterized by a high abundance of dental pulp tissue, a relatively high density of dental pulp stem cells, and a very high potential for their proliferation.
  • wisdom teeth are sometimes extracted for orthodontic purposes in other age groups, and also because dental pulp tissue can be obtained from teeth other than wisdom teeth, extracted for the sake of convenience, the availability of these extracted teeth is high.
  • dental pulp stem cells include teeth extracted for the treatment of periodontal disease, wisdom teeth extracted because of wisdom tooth periodontitis and the like. In this case, there are disadvantages of an increased risk of contamination and a smaller amount of dental pulp tissue obtained. Because of the ease of obtaining these teeth from adults (particularly the elderly), however, these materials can serve as a major source of dental pulp stem cells when autologous transplantation of cells or tissue differentiated from these cells is desired.
  • the dental pulp stem cells that can be used in the present invention may be derived from any animal species, including mammals. Although dental pulp stem cells can be collected from any animal species, it is particularly preferable that the dental pulp stem cells be collected from the patient or from another person sharing the same type of human leukocyte antigen (HLA) because of the absence of graft rejection, when the stem cells obtained are used for human regenerative medicine.
  • HLA human leukocyte antigen
  • the stem cells are not administered (i.e., transplanted) to a human, but are used as, for example, as a source of cells for screening to determine the presence or absence of the patient's drug susceptibility and adverse drug reactions, the dental pulp stem cells must be collected from the patient or from another person sharing the same gene polymorphism correlating to the drug susceptibility and adverse drug reactions.
  • aspects of this disclosures described herein relate to a method for derivation of unique and previously non-isolated mixed population of human adult stem cells derived from dental germ (the dental germ are primitive embryonic cells that are the precursors of teeth), primary dental pulp of deciduous, third molar and permanent teeth (see Lizier et al. (2012) PLoS ONE 7:e39885).
  • Said mixed population comprises MSCs/ perycites/ neuro-epithelial/ pluripotent stem cells capable to differentiate into endoderm, ectoderm and mesoderm embryonic germ layers.
  • MSCs mesenchymal stem cells
  • MSCs mesenchymal stem cells
  • ALF alkaline phosphatase
  • AFP Alpha-Fetoprotein
  • tenascin matrix metalloproteinases 1,2,9, syndecans 1,2,3,4, p53
  • collagen type 1 and 52% CD 13 as well as CD45-,CD34- and HLA ABC (low), HLA DR- expression signature.
  • Said biomarker defined cell signature fingerprint is typical for MSCs with classic multipotent cell type characteristics.
  • said mixed population comprises MSCs / pericytes at least 24% characterized by STRO-1 and 36% characterized by CD146 (MUC18) and expression signature.
  • Said biomarker defined cell signature fingerprint is typical for MSCs with perivascular niche derived multipotent cell type characteristics.
  • said mixed population comprises MSCs/pluripotent stem cells at least 2% to 30 % characterized by an Oct3/4, SOX2, Nanog, TRA1-60, TRA1-81, and SSEA4 expression signature.
  • Said biomarker defined cell signature fingerprint is typical for pluripotent cell type characteristics.
  • said mixed population comprises MSCs/neuroepithelial stem cells at least 95% Nestin, at least 85% p75 (nerve growth factor receptor, CD271/p75(NTR) inhibits the differentiation of mesenchymal stem cells into osteogenic, adipogenic, chondrogenic, and myogenic lineages), ABCG2 (ABCG2 is a member of the ATP binding cassette (ABC) transporters, lays an important role in promoting stem cell proliferation and the maintenance of the stem cell phenotype), p63 (p63 is essential for the Proliferative Potential of Stem Cells in Stratified Epithelia; p63 and ABCG2 expression in the corneoscleral limbus: Implications for stem cell purification), Brain- derived neurotrophic factor (BDNF), Glial cell line-derived neurotrophic factor (GNDF), Nerve growth factor-beta (beta-NGF), Neurotrophin-3 (NT3), NT4,5, at least 20% ⁇ - tubulin ⁇ (BDNF),
  • a population of IDPSC cells comprising enriched stem cells characterized by MSCs/neuroepithelial biomarkers preferably various neuroprotective factors such as p75 and p63, BDNF, GNDF, beta-NGF, NT3, NT4/5.
  • a further embodiment relates to a method of continuous derivation of IDPSC from prolonged cultivation of dental DP explant ex vivo through multiple harvesting cycles.
  • Said method allows an unexpected and almost unlimited number of harvesting/ derivation cycles and therefore may reduce passage number of IDPSCs in order to obtain a similar number of cells as previously reported methods.
  • Said disclosed method is easy to perform and diminishes the probability of occurrence of spontaneous genomic mutations and eventual karyotype abnormalities, which may arise during multiple passages in stem cells which occur in traditional methods for derivation of IDPSCs using enzymatic digestion of dental pulp. Furthermore, aspects of this disclosure refer to the process for differentiation realized from said cells and concentrates containing these cells, as well as, to the differentiated cells obtained from said process and concentrates containing these cells.
  • the number of stem cells that present a MSC/pericyte phenotype is diverse in different populations of MSCs from dental tissue and it presents individual variations. Therefore it is a significant advantage for single donor-derived culturing for multiple batches including reduced variability, consistency and reproducibility.
  • a further embodiment relates to a method of prolonged culture of DP explants under hypoxic conditions for derivation of IDPSCs from the perivascular stem cell niche.
  • a further embodiment relates to a method of prolonged culture of DP explants under reduced nutrition supply conditions for derivation of IDPSCs from the non- perivascular stem cell niche.
  • the FDA recommends that cells will not be passed through over 15 passages.
  • An additional embodiment relates to a method of wherein a clinically sufficient number of IDPSCs can be obtained at low passage number.
  • a single donor explant is biopreserved in culture up to six months or more with preferable derivation of IDPSCs at PO for three days until viable, uni-clonal colonies are formed. Said explant is then replaced for the next sequential harvesting derivation cycle, such continuous cultivation may lead to 10 cycles per month for at least five months to a total of 50 transfers and derivation cycles at PO. From each transfer and derivation cycle IDPSCs are propagated and passaged a maximum of 5 times prior to cryopreservation or use.
  • IDPSC immature dental pulp stem cells
  • adipose tissue derived stem cells have an affinity to produce tumor in vivo. It seems that this affinity of ASC correlates with their isolation from the perivascular niche (Zhang et al. 2010). IDPSCs can be isolated from different niches in dental pulp thus minimizing the risk of tumor formation. Lizier et al. (2012) PLoS ONE 7:e39885. In this disclosure, we disclose a new lineage of DSCs from deciduous teeth (hIDPSC) can be isolated from different (non-perivascular) distinct niches in dental pulp or from ischemic/vascular-nutrient/oxygen deprived internal tissue of DP explant, thus putatively minimizing the risk of tumor formation.
  • hIDPSC deciduous teeth
  • the IDPSC compositions of some embodiments are administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount refers to an amount sufficient to treat a disease, condition, or disorder.
  • the level of the effective dosage can be determined according to the severity of the disease; the age, weight, health, and sex of a patient; the drug sensitivity in a patient; the administration time, route, and release rate; the treatment duration; or elements including drugs that are blended or simultaneously used with the composition of the some embodiments, or other elements well-known in the medical field.
  • the dosage of the IDPSCs varies within a wide range, and is determined according to the requirements of the individuals in specific cases.
  • the IDPSCs are usually administered in an amount of about 1 x 10 6 , about 1 x 10 7 , about 1 x 10 8 , about 1 x 10 9 , or about 1 x 10 10 cells/kg of a body weight of the individual.
  • the composition of some embodiments and other disease-treating substances known in the art can be simultaneously or sequentially administered to an individual.
  • the IDPSC compositions of some embodiments can be administered locally or systemically, may require ex vivo or in vivo manipulations to obtain therapeutic activity in order to induce a local effect (e.g., a direct regenerative effect of IDPSC in contact with degenerative tissue affecting cell proliferation/cell death, tissue integrity and functionality) and/or due to a systemic effect (e.g., by releasing protective trophic factors and reducing levels of pro-inflammatory cytokines).
  • a local effect e.g., a direct regenerative effect of IDPSC in contact with degenerative tissue affecting cell proliferation/cell death, tissue integrity and functionality
  • a systemic effect e.g., by releasing protective trophic factors and reducing levels of pro-inflammatory cytokines.
  • IDPSCs administration routes are selected from known medical methods of treating degenerative, reproductive clinical or aesthetic damage, and/or to preventing subject, tissue, cells from future damage.
  • IDPSC treatment herein encompass abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing or reduce the appearance of clinical or aesthetical symptoms of a condition.
  • administration of the composition is performed in accordance with any of the methods and/or treatments described in co-filed Provisional Patent Application by the present inventors, titled "MULTIFUNCTIONAL IMMATURE DENTAL PULP STEM CELLS OBTAINED BY A ROBUST, LONG-TERM CULTURING SYSTEM", and having U.S. Serial No. 61/791,594, the contents of which are incorporated herein by reference in their entirety. More particularly, the aspects of this disclosure relate to a method for obtaining a clinically sufficient number of a patient's own DTSCs without aberrant genetic and biologic changes based on tissue explant culture and mechanical (nonenzymatic) transfer in long-term culture of DP.
  • DP is maintained in culture following mechanical transfer during several months.
  • the following characteristics were evaluated: morphology, expression of specific MSC-phenotypes and ES cell proteins and genes, karyotype, growth rate and differentiation ability of IDPSCs just after DP extraction (early population, EP) and after multiple DP transfer (late population, LP).
  • Some of these parameters were evaluated after cryopreservation and with culturing IDPSCs in three distinct culture media.
  • the used of antibody against BrdU incorporated in DP just after plating and three days after DP cultivation gave insight into the mechanism of IDPSCs generation by explant culture. Additionally, to distinguish SCs in DP, immunohistochemical staining against nestin, vimentin, Oct3/4 and STRO-1 has been performed.
  • Also disclosed herein is a method of obtaining of a pure population of typical MSCs, which also almost pure in respect of neuro-crest stem cells (NCSC) and neuroepithelial stem cells.
  • a part of this population (no more than about 24%) may be presented as SHED and another part is presented by MSCs + NCSC + Pluripotent stem cells. It is impossible to separate these populations with such methods as flow cytometry and magnetic beads.
  • Another embodiment of offers the possibility to separate SHED cells, following LP method, by a more robust approach and with higher cell numbers than using traditional DP enzymatic dissociation technology or a EP DP outgrowth method.
  • the enrichment of neuroepithelial population is progressively enriched with these markers following harvesting cycles.
  • DP may also overcome some mechanical treatment such as perforation, or mincing as an alternative method to obtain such cells.
  • mechanical treatment such as perforation, or mincing
  • the first cells appear outgrowing about one week after DP plating; it is hypothesized that from nervous plexus the cells can migrate later because they are deeper into the DP than blood vessels.
  • the subodontoblastica niche which can also produce these cells, is peripherally located and enzymatic treatment can destroy it.
  • Mechanical treatment such as DP mincing is especially useful when the pulp is big.
  • the neuroepithelial markers can be induced by external cell culture media formulation components or gas equilibrium, inducing "stress" / hypoxic cell culture conditions.
  • the pluripotent stem cells marker expression may be induced by hypoxia.
  • An additional embodiment relates to the use of the disclosed methods to produce a new lineage of DPSCs that are derived from multiple niches of perivascular and non- perivascular origin.
  • the derivation from non-perivascular origin is induced due to deprivation of nutrients and oxygen to inner DP niches during prolonged culture / hypoxic conditions, and therefore inner niche cells migrate to the surface.
  • Such cells are characterized by nuclear expression of OCT 4 and robust expression of ectodermal/ NPC markers such as nestin, p75, p63 and more.
  • the IDPSC compositions of this disclosure are administered at a therapeutically effective amount that is sufficient to result in a reduction of the degenerative damage or disease or aesthetic symptoms can be administered through various administration routes including topical (dermal, and intraocular), local, transmucosal (including buccal, sublingual,), parenteral /systemically (including subcutaneous, intradermal, intramuscular, intravascular, and intraarticular), and, and preferably parenteral administration.
  • topical dermal, and intraocular
  • transmucosal including buccal, sublingual,
  • parenteral /systemically including subcutaneous, intradermal, intramuscular, intravascular, and intraarticular
  • parenteral administration including topical (dermal, and intraocular), local, transmucosal (including buccal, sublingual,), parenteral /systemically (including subcutaneous, intradermal, intramuscular, intravascular, and intraarticular), and, and preferably parenteral administration.
  • IDPSCs undifferentiated or induced to undergo special differentiation may be administered to a subject having degenerative disease may, for example, be injected directly into the disease loci/ cavitiy/mileau, transplanted elsewhere in the body, or may be adhered to a scaffold or delivery vehicle and surgically inserted/ tansplanted/grafted into an acceptable location in the body.
  • hIDPSC are NOT immunogenic and do not need, in most cases, the use of immunosuppression protocol, but in some immuno-over reactive orsensitive cases, immunomodulation may required or immuno- matched donors are preferably used.
  • IDPSCs can be administered to a subject with abnormal or degenerative symptoms obtained in any manner, including those obtained as a result of age, trauma, preferably (neuro)degenerative disease.
  • the present inventors have found that the IDPSCs are very effective for treating neurological diseases among other ailments.
  • IDPSCs may be introduced locally or systemically into the subject in order to treat a degenerative disorder, such as, but not limited to, a neurodegenerative disorder, reproductive disorder, ectodermal, or diabetes, in a subject by administering a therapeutically effective amount of a differentiated or undifferentiated IDPSCs.
  • a degenerative disorder such as, but not limited to, a neurodegenerative disorder, reproductive disorder, ectodermal, or diabetes
  • U.S. Pat. Application Nos. 2003/0219898, 2003/0148513 teach the implantation of stem cells for different therapeutic treatments of neuro degenerative conditions.
  • IDPSCs are preferably via a surgical procedure or injection , intrathecally, or intra- ventriculary.
  • U.S. Pat. That Nos. 5,762,926; 5,650,148; 5,082,670 teach methods of neural transplantation or grafting involves transplantation of cells into the central nervous system or into the ventricular cavities or subdurally onto the surface of a host brain (i.e. extraprenchymal transplantation). Additional intrabrain delivery methods include intraparenchymral transplantation achieved by injection. Multiple injections may be made using this procedure.
  • IDPSCs undifferentiated or differentiated to beta-like cells can be administered by injection, subcutaneous injection, intraperitoneal injection, injection under the kidney capsule, injection through the portal vein, and injection into the spleen, or by implantation under the kidney capsule, through the portal vein of the liver, or into the spleen, IDPSC may be implanted using delivery vehicle/ scaffold or encapsulation techniques.
  • the IDPSC compositions of some embodiments can be administered through various administration routes including topical (including buccal, sublingual, dermal, and intraocular), parenteral (including subcutaneous, intradermal, intramuscular, intravascular, and intraarticular), and transdermal administration, and preferably parenteral administration. Most preferable parenteral administration is intrathecal administration.
  • topical including buccal, sublingual, dermal, and intraocular
  • parenteral including subcutaneous, intradermal, intramuscular, intravascular, and intraarticular
  • transdermal administration and preferably parenteral administration.
  • Most preferable parenteral administration is intrathecal administration.
  • the present inventors have found that the IDPSCs are very effective for treating neurological diseases among other ailments.
  • the hair follicle when growing passes through three phases: a growth phase (anagen), regression phase (catagen), and a resting phase (telogen). Hair growth is a continuous process, which lasted during organism life. Therefore, hair follicle must have a stem cell niche, which are constantly active and especially in the time of hair follicle regeneration. According to current knowledge, the hair follicle stem cells, which originated from neural crest, reside in the bulge area of the hair follicle near the sebaceous gland. These cells express in nestin in undifferentiated state, which is a marker of neural and hair follicle stem cells.
  • Such nestin-expressing stem cells found in the bulge area of the hair follicles were to form the outer and inner route sheath of the hair follicle during anagen. It has been shown that these stem cells can not only produce the hair follicle but can regenerate or at least heal wounds in the epidermis. Moreover, hair follicle stem cells can be converted into neurons. They formed neurospheres, which in turn, formed neurons, glial cells, keratinocytes, smooth muscle cells, and other cell types. When hair follicle stem cells were injected subcutaneously in mice, they formed neurons.
  • the hair follicle stem cells can also greatly enhanced the rate of nerve regeneration and the restoration of nerve function. These results demonstrate the pluripotency of hair follicle stem cells and their potential use in regenerative medicine. These stem cells have characteristics that combine some advantages of embryonic and adult stem cells. Similar to embryonic stem cells, they have a high degree of plasticity, can be isolated at high levels of purity, and can be expanded in culture.
  • Human immature dental pulp stem cells are also originated from neural crest. It has been shown that shared similar characteristics with embryonic stem cells and hair follicle stem cells, expressing nestin and other embryonic stem cell markers. They are capable to form neurospheres and differentiate into neurons, glial cells, epithelium, keratinocytes, smooth muscle cells, and other cell types, presenting a high degree of plasticity. They are also can be isolated at abundant quantity from the central region of the coronal and radicular dental pulp, specifically from the region, which can be identified as a innermost pulp layer a undifferentiated stem cells cell rich zone, presenting high level of purity and can be expanded easily in culture.
  • IDPSC human immature dental pulp stem cells
  • LP cultured IDPSCS maintain their sternness also after cryopreservation.
  • GFP green fluorescent protein
  • IDPSC interleukin deficiency senor
  • senor multiple sclerosis
  • senor central nervous system
  • ALS peripheral neuropathies
  • Certain defects of the heart, and bone defects could also be treated through neural crest stem cell replacement therapy. They can be also expanded in culture into millions of cells without losing stem cell markers.
  • the IDPSC may become the stem cells of choice, able to substitute other source of epidermal neural crest stem cells in the future for regenerative medicine, since (1) they are readily available from essentially anyone, (2) they are easily cultured and expanded, (3) they are highly pluripotent, (5) they do not carry the ethical issues that embryonic stem cells and fetal stem cells, (6) they do not produce teratomas, (7) they are immune- compatible.
  • Stem cell-based therapies open new avenues for skin regeneration following injury and disease.
  • Preclinical studies have demonstrated that paracrine factors secreted by stem cells after their topical delivery into injured site may improve chronic wound healing and are the major mechanism by which stem cells can enhance repair.
  • Even conditioned media from mesenchymal stem cells (MSCs) have been shown to promote wound healing via activation of host cells.
  • IDPSC are already express several markers, which are associated with skin stem cells niches.
  • epithelial stem cells from the bulge and IDPSC have common features, including expression of cytokeratins, integrins and p63.
  • cytokeratins cytokeratins
  • integrins integrins
  • p63 p63
  • recent studies showed that a cell population within the dermal papilla of hair follicles may function as adult stem cells.
  • This dermal stem cell niche contains a unique population of progenitor cells, which express of the transcription factor SOX2 that is also expressed by IDPSC. Therefore IDPSC-based therapy may hold promise in overcoming wound healing, including burns and other sking degerative disorders.
  • IDPSCs regenerative (self-renewal and differentiation plasticity) and paracrine (protective factors release) effects of IDPSCs can promote the progress of skin remodelling. Creating a suitable microenvironment is the key issue for stem cells to survive and participate in regeneration and repair skin tissue. The success of tissue regeneration depends on optimal local vascularization and the successful integration of the implant into extracellular matrix and antiscarring effects.
  • IDPSC is used to overcome wound healing and skin remodeling challenges, such as:
  • Wound healing such as ntractable skin ulcers resulting from diabetes, ischemia and collagen diseases represent significant problems with few solutions.
  • IDPSC immunological disorders
  • the disclosed IDPSC therapy may be applied as the cell implantation, or through local delivery, or systemic infusion, of autologous or allogeneic IDPSCs to restore the viability or function of deficient tissues.
  • Germ cell transplantation provides a bioassay to study the biology of male germ cells develop systems of isolation and culture of spermatogonial stem cells to examine defects in spermatogenesis and to treat male infertility. Although most widely studied in rodents, the transplantation of germ cells was applied to larger mammals. In domestic animals, including pigs, goats and cattle as well as in primates, germ cells can be transplanted into a recipient testis guided by ultrasonographic cannulation in testicles. Germ cell transplantation was successful between unrelated species (pigs and goats) and without using the protocol of immunosuppression, while transplantation in rodents requires the use of animals syngeneic or immuno-compatible partners.
  • Germ line stem cells called spermatogonial stem cells (SSCS) which are found in postnatal period in mammals, are essential for spermatogenesis (process of sperm production), and with females oocytes, are essential to species continuity.
  • SSC reside in the seminiferous tubules basal membrane of the testicles and are surrounded by somatic Sertoli cells, which form a microenvironment or niche. Inside the niche, growth factors and extracellular signals regulate the differentiation of SSC for self-renewal or for expansion and the beginning of spermatogenesis differentiation process, resulting in the production of mature sperm after 40 days in mouse and 64 days in humans (Loeffler et al, 1997, Harrison et al, 1980). The timing of sequential steps in spermatogenesis is tightly regulated by genes of germ cells and Sertoli cells that support the differentiation process.
  • stem cells in the animal testicles are a powerful tool for studying the biological capacity of stem cells to differentiate to male gametes, to assess the factors that influence this process, to investigate the testicles functionality and the reasons that cause infertility. These studies will significantly increase our understanding of the testicles functionality and the ability to control and preserve male fertility.
  • the disclosed results suggest the differentiation potential of hIDPSC to germ cells and germ fate supporting cells. These data indicate IDPSC possible use restoration of human fertility after, for example cancer, which frequently lead to infertility due to chemotherapy application. This data suggest that IDPSC are able to engraft in different compartments mouse seminiferous tubes. IDPSC differentiation appears to be faster in fertile mice, suggesting the importance of the environment for cellular engraftment and differentiation of stem cells. When transplanted into mice testis, IDPSC following sequential order of differentiation of mice seminiferous epithelium and cells resembling round spermatids, elongated and even sperm can be observed, albeit at low efficiency.
  • Sertoli cells are sustentacular cells, i.e. - cells 'nurses' located on the periphery of a seminiferous tubule. They are also called “stem cell”, once they provide nutrition and mechanical support for the spermatogonial cells. They are also responsible for establishing and maintaining the niche of germline stem cells, ensuring their renewal and differentiation into mature spermatogonial cells regulating the progress that finish in the release of sperm.
  • hIDPSC are NOT immunogenic and do not need the use of immunosuppression protocol. They are migratory cells and can be widely distributed in mouse testicles, while SSC cannot migrate.
  • Renal failure also kidney failure or renal insufficiency
  • RF Renal failure
  • ectodermal markers To test whether high level of expression of ectodermal markers will enable IDPSC therapy on cat RF veterinary patients (RF representative case example is described based on written analysis of treatment/ symptoms by veterinary experts, other examples, not described here, were applied to treat RF disease in several pets via request/ informed concern by the hosts).
  • IDPSC cell therapy composition comprising IDPS and a method to treat RF disease in mammalian species including humans, using in vitro cultured, preferably LP- derived IDPSC.
  • IDPSC express CD 146 and VEGF after transplantation in rat model of renal failure indicating endothelial markers importance.
  • IDPSCs are administered i.v./systemically at a dose of approximately 0.01- 1 X 10 & cells per kg body weight by i.v. infusion in buffered saline or any other known in the state of the art other suitable vehicle for systemic administration. Infusions are repeated subsequently at therapeutically active levels, for example each every 1-3 week basis until significant improvement in renal function, then infusion interval increased to 1-6 months as per patient conditon.
  • the composition may include other cells, or/and active therapeutic agents or/and genes to deliver to treat RF patient.
  • Renal failure is a disease, which shows high incidence in dogs and cats, causing considerable morbidity and mortality among these species (Lees, GE, 2004).
  • structural injury occurs, favoring the reduction of renal mass associated with impaired metabolism and consequent loss of the physiological functions of the kidneys, thus culminating in organ failure.
  • the conventional medical therapies, fluid and dietary counseling, as well as corrections to the medical complications they cause disease are usually ineffective when serum creatinine exceeds 6 mg / dl and urea exceeds 90 mg / dl, leading to this point, a significant impairment quality of life of the animal (Fischer, Jr., et al, 2004).
  • the CNS is originated from ectoderm, more precisely from the pool of multipotent neuroepithelial stem cells (NSCs).
  • This cell's population is composed at least by two different groups of neural precursors: a first group can grow in monolayer cultures; a second group generally form neurospheres (i.e. grow in suspension culture).
  • both of cell types demonstrate the same differentiation potential (Noble et al, 2011, Kempermann, 2011).
  • NSCs are symmetrically dividing and under appropriate conditions can be rapidly conversed into neuroblasts, asymmetrically dividing precursors, which are able to develop into neurons after a migration phase.
  • Neuroblasts are slightly more differentiated than NSCs and can produce transit amplifying cell population. The ability to divide is main difference between neuroblasts and neurons, which are postmitotic. Neuroblast differentiates and matures into neurons but not in other cell types.
  • NSCs fate is regulated through signals that emanate from surrounding tissues. NSCs are found in specific regions, so-called stem cell niches that provide the microenvironmental cues that regulate stem cell proliferation, self- renewal and differentiation.
  • stem cell niches that provide the microenvironmental cues that regulate stem cell proliferation, self- renewal and differentiation.
  • fetal neuronal precursors obtained from abortion and, second, pluripotent stem cells (ES cells, iPSCs) induced to differentiated in vitro neuronal precursors.
  • ES cells pluripotent stem cells
  • iPSCs pluripotent stem cells
  • Fetal neuronal precursors raise many ethical problems, while there are certain safety risks associated with human use of ES and iPSCs that delay therapeutic applications.
  • Alternative methods of neurodegenerative therapies from other human types of stem cells are needed to exploit the uses of cell therapy for treatment of neurological diseases.
  • compositions of hIDPSCs which co-express SOXl, SOX2 and beta-3 -tubulin markers and especially methods of treating neurological conditions. Also disclosed herein are compositions and methods of enrichment of the co-expressed markers during LT hIDPSCS cell culture therefore increasing neuroectodermal lineage commitment of such LP hIDPSCs. Disclosed herein are new methods to the treatment of neurodegenerative diseases using hIDPSCs obtained through LT harvesting cycles and enriched with specific neuronal biomarkers, such as but not limited to SOX1, and SOX2, beta-3 -tubulin.
  • the contemplated embodiments provide a substantially homogenous population of cells enriched with population of cells that co- express said sternness neuronal markers (SOX1, SOX2 and beta-3 -tubulin) while maintaining normal karyotype and carry no risk of teratoma formation.
  • the homogenous population is likely advantageous for treating disease in a human (mammalian).
  • Other advantages of the cell-based therapies disclosed herein include, but are not limited to, incorporation of the cells central nervous system tissue, peripheral nervous system tissue. Such incorporated cells have the potential to differentiate or develop into neuronal, glial or other cells to replace or facilitate repair of the damaged, traumatized or degenerating tissue thereby resulting in a more permanent treatment of the degenerative, acute injury, traumatized, neurological condition.
  • Oxygen is one of critical signals that can affect stem cell properties under normal tissue homeostasis. Interestingly, low oxygen levels, or hypoxia, are a hallmark of stem cell niches (Panchision, 2009).
  • IDPSCs immature dental pulp stem cells isolated from DP after 30 times of mechanical transfer/harvesting cycle (late population (LP) of IDPSC) and tested for their capacity to produce neurons in vitro demonstrated the increased ability for neural differentiation, as well as enrichment of a population pre-committed LP IDPSC with neuronal precursor when compared with IDPSC isolated after 15 or 25 cycles of mechanical transfer/harvesting (early population (EP)).
  • LP mechanical transfer/harvesting cycle
  • EP early population
  • SOX1 (for sex-determining region Y-box 1) protein is a transcription factor involved in early central nervous system development.
  • SOX1 is a known marker characteristic of a developing central nervous system. The expression of SOX1 in the neural plate and tube seem to correlate with mitotically active progenitors that are not yet committed to a final stage.
  • SOX1 defines the dividing neural precursors of the embryonic CNS and expresses particularly in the ventral striatum (Pevny et al, 1998; Kempermann et al., 2003).
  • SOX2 is one of the earliest known transcription factors expressed in the developing neural tube and is expressed in certain cells of the adult brain. SOX2 is commonly known to play a critical role in the central nervous system. Recently, Terskikh and colleagues (2011) elucidate role of SOX2 in peripheral nervous system. They developed a hESC-based model in which migratory cells undergo epithelial to mesenchymal transition (EMT) to acquire properties of neural crest (NC) cells. They found that migratory NC progenitor's down-regulate SOX2, but then start re-expressing SOX2 as they differentiate to form neurogenic dorsal root ganglion (DRG)-like clusters.
  • EMT epithelial to mesenchymal transition
  • NC neural crest
  • SOX2 down regulation was sufficient to induce EMT and resulted in massive apoptosis when neuronal differentiation was induced. They also showed that SOX2 binds directly to NGN1 (neorogenin 1) and MASH1 promoters and is required for their expression. When neural crest stem cells were prevented from re-expressing SOX2, they die or can give rise to glia or smooth muscle cells. Thus, the function of SOX2 is to keep cells multipotent or pluripotent for become neurons later in development.
  • This combination of defining properties will identify the neural progenitor cell lines of the invention regardless of the method used for their isolation.
  • One method is to transplant undifferentiated stem cells that can differentiate into neural precursor cells, and then into fully differentiated neurons (including neurons, astro-glia, or oligodendrocytes).
  • Another method is to transplant undifferentiated or pre-differentiated IDPSCs that are capable to release neuroprotective factors into affected areas of the nervous system.
  • using the described hIDPSCs transplant method of neuroregeneration may be based on administering into patient pre-differentiated ex vivo neuronal precursors or fully differentiated neurons or combinations of thereof.
  • a cell culture composition comprises (co-expressing) SOX1 and SOX2 positive hIDPSC, which are neural crest stem cells.
  • the SOX1 and SOX2 may be obtained through LT cell culture. Enrichment of the transcription factors increases towards LP culture, which holds high potential to neuronal differentiation, keeps karyotypes normal, and does not carry the risk of teratoma in vivo.
  • a method for obtaining a homogenous population of hIDPSC comprises obtaining the population thorough LT mechanical/non-enzymatic harvesting cycles.
  • the number of harvesting cycles may comprise over 25 cycles, about 45 cycles, or more than 45 cycles.
  • An embodiment of the method may further comprise culturing the taken cells and passaging a plastic adherent cell from the cell culture.
  • the plastic adherent cell typically (i) self-renews, (ii) differentiates into cells of endodermal, mesodermal, or ectodermal lineage, and (iii) expresses markers SOX1, SOX2 and 3-beta- tubulin.
  • An embodiment of the method may further comprise administering the product to a patient as a pharmaceutical composition in a pharmaceutical accepted carrier/vehicle for cell therapy to treat CNS diseases.
  • a mitotically active homogeneous neural progenitor's (neuroblasts) composition comprises (co-expressing) such markers as SOX1, SOX2, and beta-3 -tubulin that are not yet committed to a final stage.
  • a method for obtaining a homogeneous population of pre-differentiated IDPSCs comprises one or more of the following steps. Obtaining IDPSCs-derived neurospheres by culturing IDPSC in non-adherent conditions (suspension).
  • the cells within the rosettes are presented by (i) transit amplifying cell population of neuroblasts positive for SOX1, SOX2, and BrdU and beta-3 -tubulin that are slightly more differentiated than IDPSC; (ii) neuroblasts differentiated terminally into NEURONAL LINEAGES OF CENTRAL AND PERIPHERAL NEURAL SYSTEM - (including neuronal precursors, astroglia nd oligodendrocytes and ganglion cells) upon external in vitro- or in vivo-induced microenvironment; (iii) use as a pharmaceutical composition in a pharmaceutical accepted carrier/vehicle for cell therapy to treat CNS diseases by administrating to a patient; and/or (iv) use as a pharmaceutical composition in pharmaceutical accepted carrier/vehicle for anti-cancer therapies, including gene therapy, to treat neuroblastoma and retinoblastoma but not limited to these tumor types.
  • substantially homogenous LP of hIDPSCs comprise a cell that co-expresses a marker selected from, but not limited to, the group comprising SOX1, SOX2, or beta-3 -tubullin.
  • IDPSC IDPSC were cultured before confluence, which is equal to 2x10 6 in 25 cm 2 in basal culture medium. Next the cells were washed two times in PBS, and the basal culture medium was changed to Neurobasal culture medium supplemented with 2% B27 (NB+B27). Culture medium should be changed in 3-4 days. After one week, the cells were harvested following a 0.25% trypsin/EDTA treatment for 2-3 min and neutralized with the same culture medium. Following centrifugation at 800xg for 5 min, the cell pellet was obtained and supernatant was removed. Next IDPSC were gently disaggregated in NB+B27 and seeded onto 6 Petri dishes 9.6 cm 2 . Retinoic acid was added at a final concentration 0.1 ⁇ for 24 hours after which time mature neurons were obtained.
  • the coverslips After washing with PBS the coverslips, these differentiated cells were fixed in 4% formaldehyde for a week and stored at 4 °C.
  • the material on the coverslips was dehydrated in serial alcohol (70%, 90% and 100%, Merck) for 3 minutes each at room temperature, and the coverslips were air dried.
  • the material was denatured at 72 °C with denaturation solution (70% formamide in 2xSSC, NaCl / sodium citrate; Sigma).
  • the material was again dehydrated in serial alcohol for 3 minutes each in ice and air dried.
  • the probes were added to this material and the coverslips were kept in a humid chamber at 37 °C for hybridization, for a period of 16 hours (overnight).
  • coverslips were washed twice in a solution containing 50% formamide in 2XSSC, followed by two washes in 2X SSC and 1% Tween 20 (Merck) diluted in 4XSSC, for 3 minutes each wash. Finally, the coverslips were mounted with DAPI containing Vectashield, and analyzes were performed under a fluorescence microscope.
  • mice monoclonal nestin and glial fibrillary acidic protein (GFAP) antibodies purchased from Santa Cruz Biotechnology (Santa Cruz, Calif, USA) and ⁇ - tubulin III from Chemicon.
  • the following immunostaining protocol was used: IDPSC growing on coverslips were washed twice in rinse buffer (20 m M Tris-HCl, pH 7.4, 0.15 M NaCl, 0.05% Tween-20), fixed with 4% paraformaldehyde, and permeabilized with 0.1% Triton X-100. After blocking with 5% bovine serum albumin, the cells were incubated with diluted primary antibodies for 1 hr at room temperature. Primary antibodies were diluted at a 1 : 100.
  • FITC fluorescein isothiocyanate
  • Cy3 -labeled appropriate secondary antibodies were added for 30 min at a 1 : 100 dilution.
  • Microscope slides were mounted in Vectashield mounting medium (Invitrogen) with or without DAPI. Analysis was performed with digital images that were acquired with a cooled CCD camera (PCO, VC44) and processed with ISIS software (MetaSystem, Belmont, Mass., USA).
  • Neural differentiation was also confirmed by expression of neural genes such as beta-tubulin, middle neurofilaments, and GFAP using reverse transcriptase polymerase chain reaction (RT-PCR) ( Figure 9).
  • neural genes such as beta-tubulin, middle neurofilaments, and GFAP using reverse transcriptase polymerase chain reaction (RT-PCR) ( Figure 9).
  • mice 6-8 weeks old were anesthetized with ketamine and xylazine (100 and 15 mg/kg, respectively) and subjected to a compression injury for 1 min at the T9 level, by means of a 30-g vascular clip (Kent Scientific Corporation, Torrington, CT), as previously described by Marques and coworkers (2009).
  • the animals were allowed to recover on a warm pad and received 1 mL of saline solution to compensate for dehydration and loss of blood and enrobaytril injections (2.5 mg/kg/d SC).
  • the bladders were manually expressed twice a day until spontaneous urinary function returned.
  • IDPSC transplantation was performed as follows. The cells were transplanted at two different time points in order to compare the recovery between a subacute and a chronic lesion.
  • the cells were injected into the epicenter of the lesion, using a 10- ⁇ Hamilton syringe. A sham group that received no cells but was subjected to all surgical procedures was included as a control.
  • BDNF brain-derived neurotrophic factor
  • NGF nerve growth factor beta
  • NT-3 neurotrophin-3
  • NT-4 neurotrophin-4
  • the IDPSC-treated group showed an increased immunoreaction per area compared to the DMEM-treated group, especially in the subacute group, which showed higher levels of all analyzed trophic factors.
  • the chronic group we only observed differences between the IDPSC-treated group and the DMEM-treated group for BDNF and NGF quantification.
  • the samples were washed three times with 0.1 M phosphate buffer (pH 7.4), dehydrated with a graded acetone series, embedded in resin, and polymerized for 48 hr at 60 C.
  • Semi-thin (500 nm) and ultra-thin sections were made using an RMC ultramicrotome.
  • the semi-thin sections were stained with toluidine blue and observed under a Zeiss microscope (Axioscop 2 Plus), and the images were acquired using the Axiovision Program version 4.5 (Zeiss).
  • the ultra-thin sections were collected on copper grids, stained with uranyl acetate and lead citrate, and observed in a Zeiss 900 transmission electron microscope.
  • Figures 14 and 15 show semi-thin and ultra-thin sections from all groups.
  • the ultrastructural analysis of the animals that received DMEM in the subacute phase ( Figures 14A-14C) or in the chronic phase ( Figures 15A, 15C, and 15E) revealed tissue disorganization with many cavitations (short red arrows in Figure 14A, and asterisks in Figures 14C and 15C), and strong astrocytosis (arrowhead in Figure 15E), few preserved fibers ( Figures 14B and 14C), and some myelinating Schwann cells with their typical basal laminae (solid arrow in Figure 14B and star in Figure 15C)
  • Behavioral analysis was performed as follows. The animals were evaluated before injury, 1 d after injury, and weekly up to 8 weeks after cell transplantation. To analyze the recovery, the global mobility test described by Marques and coworkers (2009) was used, which evaluates locomotor improvement by recording the animals in an open field for 1 min with a webcam (5 frames per sec). After that, the velocity (cm/sec) that the animals reached during this 1-min period was measured using ImageJ software.
  • the Basso Mouse Scale (BMS) test was also performed (Basso et al, 2006), which is a 9- point scale that indicates the locomotor ability and locomotion features such as ankle movement, paw position, weight support, plantar steps, hindlimb and forelimb coordination, and trunk stability. For statistical analysis, the mean of the scores obtained from the left and right hindlimb (HL) was used to establish a single score per animal.
  • One-way ANOVA and Tukey's test for post-hoc comparisons were determined.
  • the sham animals did not show any alteration in their locomotion and exhibited normal values around 16.21 - 1.73 cm/sec.
  • the subacute group that received IDPSC (6.94 - 1.85 cm/sec) showed higher values compared to the DMEM group (3.71 - 0.95 cm/sec), and the improvement in locomotion began 7 days after cell transplantation (i.e., 14 days after spinal cord injury (SCI)) and was maintained throughout the subsequent weeks of the study.
  • the chronic animals showed a slight improvement 7 days after the treatment.
  • 14 days after cell transplantation they exhibited higher locomotion speed with an average around 6.6 - 2.03 cm/sec versus 4.15 - 1.07 cm/sec in the DMEM group.
  • the animals did not reach normal rates, but they showed a better exploratory pattern, walking much more and crossing the open field several times during the test.
  • Figure 16 illustrates the displacement of these animals 35 days after IDPSC transplantation.
  • IDPSC-treated animals can also be attributed to the release of neurotrophic factors by these cells. This may act by stimulating collateral sprouting, which may bypass the lesion area and make new synaptic contacts, enhancing the functional outcome (Cummings et al., 2005). This is a plausible explanation because many healthy neurons, intact synapse contacts, and preserved axons were found in the ultrastructural analysis. This study demonstrated an important therapeutic potential of IDPSC transplantation, as applied in both subacute and chronic stages of a mouse compressive SCI. IDPSC appeared as excellent candidates for stem-cell-based treatments to be used in human trials in the near future.
  • Canine distemper is a viral disease of dogs, and this virus belongs to the paramyxovirus group. In humans, measles virus is also a member of this group. In approximately half of the cases, it is fatal. Impossible to cure, canine distemper is a serious viral illness that attacks a dog's body on all fronts. It can cause a persistent infection of the dog's central nervous system resulting in a progressive, multifocal demyelinating disease. Once an animal develops neurological symptoms of the disease, such as seizures or paralysis, its chances of surviving are slim and its quality of life is bound to become progressively worse. Thus, these animals are usually euthanized.
  • the animals were enrolled in an experimental procedure after having obtained informed consent signed by the animals' owners and in accordance with international animal care guidelines.
  • the treatment was realized also without any cost for the owners and animals received long-term follow-up after the treatment.
  • Xenogeneic IDPSC transplantation was performed only after the effect of the virus was ended. Undifferentiated IDPSC, which were cryopreserved at passages 3-5 were used. The cells were thawed just before transplantation and washed twice in pre- warmed (37 C) sterile PBS following centrifugation for 5 min at 800xg. At that moment, the viability of the cells was tested using Trypan blue staining and was approximately 98% of live cells. Cell number used in each application was established in accordance with the dog weights and varied between 2xl0 6 (8 kg) to 4xl0 6 (16kg). The cells were suspended in a mean volume of ⁇ 0.5 mL of sterile physiologic solution for subsequent intravenous injection.
  • the dog received an injectable anesthetic, which dose was computed according to the weight of the dog and sensitivity of certain breeds to anesthetic. According to disease severity the dogs received single or multiple (no more than three) applications. IDPSCs were transplanted without any immunosuppressive protocol. None of the animals showed signs of immune rejection following single or multiple IDPSC transplantations.
  • FIGS 17 and 18 two animals with mild and severe neurological forms of canine distemper (before cell application) and their progression of healing (after cell application) are presented.
  • the animal with a mild neurological form showed paralysis of the hind paws ( Figures 17A and 17B), which were completely restored after a single IDPSC application ( Figures 17C and 17D), and the animal was able to walk and to stand during sufficient time periods.
  • the animal with a severe neurological form showed both seizures and paralysis of the front and hind paws ( Figures 18A and 18B). Seizures disappeared after the first IDPSC application, and the dog was able to walk a short distance even presenting the symptoms of the disease of being unable to move paws correctly ( Figures 18C and 18D). This dog was almost completely restored to all movement after the third IDPSC application.
  • IDPSC cardiomyocytes
  • Cardiomyocyte apoptosis is critical for the progressive cardiac dysfunction that culminates in congestive heart failure.
  • Bone marrow cells can help to restore cardiac function following ischemia through their fusion with cardiomyocytes thus rescuing heart cells from apoptosis.
  • Cell fusion preserves cardiomyocytes from apoptosis following myocardial infarction, thus providing a new approach for targeting cardiac regenerative therapies. (Yang et al., 2012).
  • IDPSC can also be a good option for use in heart failure due to their natural spontaneous fusion capacity, which can be demonstrated in vitro ( Figure 20).
  • PHSF human skin fibroblasts
  • MBMC mouse bone marrow cells
  • IDPSC calcium- and magnesium-free Dulbecco's phosphate-buffered solution
  • DPBS calcium- and magnesium-free Dulbecco's phosphate-buffered solution
  • trypsin/ EDTA solution Invitrogen
  • IDPSC undifferentiated IDPSC
  • IDPSC homing was in muscle myocardium ( Figure 21).
  • Anti-IDPSC antibody which was obtained as described in Kerkis et al, (2006) Cells Tissues Organs 184: 105-116, was used to analyze IDPSC homing.
  • the cell suspension (10 5 cells) was stained with fluorescent dye Vybrant ( Figure 26A-26B) and injected into normal mouse testes or mouse testes sterilized by gamma irradiation (strain CD-I). Irradiation (150 rads) was performed three times (1 month) and cells were applied one month after irradiation. Control mice were injected with saline solution. Animals were sacrificed 3 and 9 days after injection. The thin frozen sections (5 ⁇ ) were prepared using a routine protocol. The presence of IDPSC in the testes of mice was evaluated by fluorescence emitted by the dye Vybrant.
  • Assessment of renal function was performed measuring urea> 250 mg / dl, creatinine 11.1 mg / dl, urine specific density 1012 and by ultrasound evaluation of the kidneys, both of which showed partial loss of the corticomeduUary boundary, small size, elevated cortical echogenicity. Measurement of the kidneys, left and right respectively, were 1.7 cm wide by 2.0 cm long and 2.0 cm wide by 2.5 cm long. No hematological changes were observed.
  • the first human IDPSC therapy was made 27 days after initiation of therapy support, with the second and third after 41 days and after 50 days.
  • the animal received 2x10 6 of undifferentiated LP IDPSC diluted in lmL of sterile phosphate solution: 0.6 mL was applied via intrarenal (only the right kidney) and 0.4 mL was applied subcutaneously.
  • the animal received analgesia with 5 mg/kg morphine and was induced with an inhaled anesthetic, isoflurane, in an aquarium.
  • the animal During the 12 days after IDPSC therapy and while still receiving the supporting treatment described above, the animal had a clinical picture without changes and without any other specific treatment. One month after the IDPSC therapy, 80% of improvement was observed. The animal demonstrated a decrease in urine output and water intake. In this period the concentrations of urea and creatinine reached the minimum of 172 mg / dl and 4.4 mg / dl, respectively.
  • a second IDPSC therapy was made 43 days after the first under the same conditions. During the 29 days after the second cell therapy, the animal remained well. Thirty days after the second CT scan showed a picture of apathy and normocytic / normochromic not regenerative.
  • the third cell therapy was performed fifty days after the second cell therapy under the same conditions, and the animal was good. Seven days after the third cell therapy, the animal was fine, playful, gained weight, normorexia, and normuria normodipsia. In this period the concentrations of urea and creatinine reached the minimum of 136.2 mg / dl and 3.8 mg / dl, respectively.
  • Figures 34-36 are summarized the fluctuations in urea, creatinine and electrolytes during the cell therapy. Measurements were performed 12 times, and the numbers 4, 7 and 9 corresponds to IDPSC transplantations.
  • Figure 35 shows that IDPSC cell therapy stabilized the level of criatinine, which was maintained low and stable. Although urea's level presents fluctuations during this period, it presents the tendency to decrease over a time (Figure 34) as well as electrolytes ( Figure 36).
  • FIG. 38 Histological evaluation demonstrated a significant difference between the right kidney, which received IDPSC transplantation via intrarenal injection and the left kidney (Figure 38).
  • the left kidney shows extensive fibrosis (Figures 38A-38A1) with thickened glomerular basement membranes and mesangial proliferation in a glomerulus ( Figure 38A2).
  • the right kidney shows a more preserved morphology (Figure 38B) with minimal fibrosis (Figure 38B1) and a preserved glomerulus ( Figure 38B2).
  • blood infiltration (red) in the right kidney was evident as observed in Figures 38B1 and 38B2.
  • Figure 38B2 shows preservation of glomerular endothelial cells, which are not visible in Figure 38A2.
  • LP Enhanced Green Fluorescent Protein (EGFP)-tagged IDPSC (EGFP-IDPSC) were cultured as described (Lizier et al, (2012) PLoS ONE 7:e39885)). Swiss mice (8 weeks old; female; body weight, 20 -23 g) were used. The animals were randomly divided into three groups, and an excisional wound splinting model was generated. In brief, after hair removal from the dorsal surface and anesthesia, two 5 -mm full thickness excisional skin wounds were created on each side of the midline in 12 mice. Each wound received 10 5 cells (LP EGFP-IDPSC) diluted in 100 ⁇ of PBS and the cells were injected intradermally around the wound at four injection sites. A control group received only PBS. No immunosuppression protocol was applied. The incision was saturated with nylon (4-0). The animals were housed individually. We tested the adhesive on the skin in mice prior to this experiment and did not observe any skin irritation or allergic reaction. The animals were euthanized after 7 days.
  • Histologic examination was performed as follows. Tissue specimens were fixed in 3% paraformaldehyde for 24 hours and embedded in OCT, an embedding medium used for frozen tissue to ensure Optimal Cutting Temperature. Six-micron-thick sections were stained with H&E and Masson's Tri chrome for light microscopy. Analysis of GFP expression in LP EGFP-IDPSC engrafts was performed by confocal microscopy.
  • Collagen in the form of elongated fibrils, can be normally found in skin.
  • the staining by Masson's Tri chrome demonstrated the presence of collagen in skin, which was remodeled by topical delivery of EGFP-IDPSC to the injured site.
  • the control group did not show skin remodeling (Figure 40).
  • both of these cells, retinal and IDPSC may preserve a common embryonic "memory" that can permit IDPSC to give rise not only the neurons of the central nervous system (CNS) but to retinal stem cells and retinal neurons-like cells.
  • CNS central nervous system
  • LP IDPSC neurogenic potential of LP IDPSC
  • these cells present a more controlled type of differentiation need and responded adequately when neurogenic induction was induced with retinoic acid.
  • induced LP IDPSC were plated in vitro, further differentiation was observed and the majority of cells expressed ⁇ - Tubulin III, a marker for immature neurons.
  • plated cells expressed markers for mature neurons or glial cells.
  • retina In vertebrates, the retina is considered part of the central nervous system (CNS). However, retina is a special class of neuronal cells, and it is a layered structure with several layers of neurons interconnected by synapses. Retina produce photoreceptor cells, which are neurons that are directly sensitive to light. Three types of retinal neurons can be identified: rods, cones, and ganglion cells. The rods provide black-and-white vision, cones support daytime vision and the perception of color, and the photosensitive ganglion cell is important for reflexive responses to bright daylight.
  • Neuronal and retinal cells differ in their spectrums of specific markers and while retinal cells can express early neuronal cell markers, the neuronal cells are limited by expression of only neuronal markers (e.g., nestin and beta-tubulin III) ( Figure 43).
  • EP IDPSC were able only to differentiate into neural cells, while LP IDPSC showed both neuronal and retinal differentiation ( Figures 45-47).
  • LP IDPSC were maintained and in vitro expanded as described in Lizier et al., 2012. Neurospheres were obtained from LP IDPSC, which were grown in culture flask of 25 cm 2 until they reach a semiconfluence of 70%. Then, cells were trypsinized and split into two 35 mm petri dishes, pre-treated with 1% agarose (Sigma), which formed a thin layer on the bottom of the plate. Neurobasal culture medium supplemented with 3% B27 (both from Gibco) was used. The dishes were incubated at 37 °C for 3 days in the humid atmosphere in a 5% C0 2 incubator.
  • the neurospheres were transferred to other dishes and were plated on coverslips for adhesion in IDPSC basal culture medium, which was changed on the next day for NB+B27.
  • Adhered neurospheres were maintained in NB+B27+ 0.5 ⁇ retinoic acid culture medium for five days until the cells started outgrowth from neurospheres.
  • an enzymatic digestion using 0.25% trypsin was carried out, and the cells were seeded in a new petri dish of 35 mm, keeping the same culture medium for another 10 days but without addition of 5 ⁇ retinoic acid, and culture medium was changed every 3 days.
  • the cell culture was maintained for another five days and then fixed in 4% formaldehyde.
  • a summarized protocol is shown in Figure 44A-44F and a timeline of differentiation is presented in Figure 44G.
  • EP IDPSC showed robust neuronal differentiation, expressing principal markers such as beta-tubulin III and GFAP ( Figure 47).
  • CD73 ecto- 5 '-nucleotidase
  • the adhered neurospheres formed by LP IDPSC subsequently released cells in large quantities, among which some had cells with morphology similar to neurons. After about five days of culture, we observed that adherent neurospheres presented highly concentrated areas of cells around the spheres. We passaged the cells and in order to enrich the dish with retinal like cells, we cultured these cells in NB+ B27 and RA for ten more days. The cells exhibited morphology similar for different types of neuronal cells (Figure 51)
  • CD73 also known as ecto-5'-nucleotidase, which catalyzes the conversion of extracellular adenosine 5 '-monophosphate to adenosine. It is a marker cell surface of precursors of both cones and rods (KOSO et al, 2009).
  • Figure 53 demonstrates the expression of CD73 in neurospheres and in differentiated cells.
  • PAX-6 which is a transcription factor, and its localization is mainly in nuclear and perinuclear areas of the cell.
  • the cytoplasmic expression can also be viewed because of the high ratio between the nucleus and cytoplasm, which is characteristic for this differentiation stage.
  • the expression of this marker did not occur in all cells. There are many cells that were negative for this marker (50%) depending on the stage of maturation they had reached ( Figure 54).
  • Chx-10 is also a transcription factor involved in differentiation of precursor of retinal early development. We observed that the number of Chx-10 positive cells was higher than of Pax-6 and reached around 80% of Chx-10 positive cells (Figure 55). Chx-10 activates transcription factor Crx.
  • the gene Crx encodes a transcription factor that coordinates the expression of photoreceptors and is considered a marker of photoreceptor precursors, and it is expressed in the nucleus and the perinuclear region ( Figure 56)
  • Nrl The gene Crx activates another factor transcription, Nrl ( Figure 57), which expressed in retinal neurons and promotes expression of rhodopsin by its connecting the rhodopsin gene promoter. It is expressed throughout the central nervous and peripheral systems during development, but in adulthood is restricted to the neocortex and retinal neurons.
  • the next marker expressed in retinal cells is Calbindin, which is also known as calcium binding vitamin D dependent protein and is expressed in neural tissues and horizontal retina cells.
  • Recoverin is a calcium ligand photoreceptor protein and is implicated with the regulation of rhodopsin kinase activity, an enzyme needed for luminous adaptation. We found a few cells expressing this protein. Both calbindin and recoverin are localized in the cell cytoplasm ( Figures 58-59).
  • Rhodopsin which is a visual pigment of photoreceptors, is responsible for the absorption of photons, more specifically, for adapting light / dark. Its location is more in the cellular cytoplasm, which can also be viewed on the core. The amount of cells expressing this protein also was much lower in the retinal precursor ( Figure 60).
  • Antibodies used for imaging of differentiated IDPSC cells are provided.
  • pancreatic ⁇ -cells which are of endodermal origin share common features with those of neurons that are of ectodermal, neural crest origin (Yang et al, 1999, Teitelman and Lee, 1987; Baekkeskov et al., 1990; De Vroede et al, 1990).
  • DPSC DPSC from deciduous teeth, which were obtained using enzymatic digestion, can be differentiated into pancreatic like ⁇ -cells (Govindasamy et al, 2011).
  • the islets of Langerhans are the regions of the pancreas that contain its endocrine (i.e., hormone-producing) cells, which constitute approximately 1% to 2% of the mass of the pancreas. These islands are composed by 5 different cell types, which produced hormones.
  • LP IDPSC express a set of different neural markers such as NGF, BDNF, NT-3, NT-4, as well as the low-affinity receptor, p75NTR (CD271). Accordingly normal pancreatic neural tissue also expresses some of the neurotrophins (Schneider et al 2001). Alternatively, NGF is able to induce neuron-like differentiation of an insulin-secreting pancreatic beta cell line (Polak et al, 1993). Once pancreatic beta cells arise from the embryonic endoderm, the induction of differentiation of insulin- secreting pancreatic beta cells by NGF indicates that endocrine and neuronal cells share a developmental pathway. LP IDPSC showed robust differentiation into neural and retinal cells, which strongly support the potential capacity of LP IDPSC population into pancreatic cells.
  • LP IDPSC can produce insulin producing (endocrine) cells or provide cellular basis for exocrine cells or both. They or supernatant of these cells rich of neurotrophins can be used in combination with ES cells, providing a diverse factor useful for pancreatic cell differentiation creating an appropriate cell niche.
  • An additionol advantage of LP IDPSC over ES cells is that they are MSC and also can act via multiple paracrine mechanisms.
  • LP IDPSC form the basis of a therapeutic treatment for some types of diabetes by inducing the proliferative differentiation of islet cells.
  • IDPSCs are transplanted into a fetus in utero they are distributed throughout the fetus while remaining viable in undifferentiated and differentiated forms and develop into multiple cellular types due to their unique multilineage orientation that was characterized with multiple tissue-specific molecular markers and robust differentiation potential in the other examples. Also surprisingly, IDPSCs and their differentiated progeny were not rejected by immunocompetent hosts and did not transform into inappropriate differentiation but were differentiated accordingly in the relevant host niche-coordinated manner. Therefore we conclude that the multilineage orientation of IDPSC is proven by in vivo distribution and engraftment of IDPSC into multiple tissues and organs.
  • the disclosed results support the use of IDPSCs for cellular therapy by administration via an intrauterine route to a fetus in an amount effective for treatment.
  • the transfected GFP -tagged IDPSCs distributed over the fetal and placental tissues.
  • the present disclosure relates to a method of obtaining genetically modified IDPSCs, comprising transducing IDPSCs with exogenous genetic material and the use of these modified IDPSCs as a delivery system for therapeutic proteins encoded by the exogenous gene for treatment of inherited genetic and/or acquired disorders.
  • MAPC Multipotent adult progenitor cells
  • MAPC plurity require the use of cell selection methods to obtain high purity population as in IDPSC, but this step is not necessary with IDPSC.
  • IDPSCs showed high level of engraftment without any selection, which means they are "stem cells".
  • stem cells for example, disclosed herein is the use of undifferentiated IDPSC, which have a capacity to home in stem cell niches, for example, muscle tissue - satellite cells - which is not the tissue of their origin (DP). In other words, they are TRUE stem cells!
  • differentiated and undifferentiated LP IDPSC do this appropriately, for example, in heart tissue they express appropriate markers, but not CK18, which is a marker of epithelium. They showed differentiation into human lymphocytes expressing CD45.
  • CK18 which is a marker of epithelium. They showed differentiation into human lymphocytes expressing CD45.
  • MAPC demonstrate a more limited potential to differentiate:
  • MAPCs were present in the intestine; however, cytokeratin staining was also negative, indicating that the MAPCs did not differentiate into intestinal epithelia.
  • MAPCs were also found in the cardiac and skeletal muscle, as well as in the spleen and skin but did not show any differentiation.
  • MAPCs differentiate into astrocytes and oligodendrocytes but not neurons and did not express neurotrophic factors. In contrast, with IDPSC Purkinje cells and brain vessels were observed.
  • disclose herein is a robust method of administration of multilineage-oriented IDPSCs, or differentiated progeny thereof, in the pharmaceutical carrier as a single or combined biological treatment (i.e, they can be mixed with other regenerative or therapeutic agents) to promote differentiation to a preferred cell type.
  • This can be advantageous when engraftment or gene delivery is desired according to the developmental progression of the organ systems in the fetus.
  • Embryonic stem cells transplanted into murine fetuses achieved low level (0.4%) chimerism (Moustafa et al, 2004).
  • Human placenta derived, amnion and chorion cells from term placenta also successfully engrafted in neonatal swine and rats after transplantation showing low level of chimerism (Bailo et al, 2004, Chen et al., 2009).
  • Donor cells were found in animal bones, and express genes of osteoblastic lineage producing extracellular structural protein bone - osteopontin. After treatment a marked reduction of fractures and skeletal abnormalities was observed (GUILLOT et al., 2008).
  • MSCs derived from human amnion and placenta were also used in animal model of IUT, albeit migration and localization in various organs were evidenced, the graft remained low level (Han et al., 2008, Chen et al. 2,009). Adipose tissue derived MSC showed similar low engraftment (Martinez-Gonzalez, 2012).
  • the allogeneic MSC derived from fetal rabbit liver was performed by two routes of administration: intra-hepatic and intra-amniotic.
  • the graft was studied after 10 and 16 days and low grafting of these cells were observed which nevertheless persisted for 16 weeks (Moreno et al., 2011).
  • ES cells were transplanted on day 14 of gestation in mice fetus in the lateral ventricle of the brain. This study demonstrated that ES cells were able to integrate in mouse brain and produce astrocytes localized predominantly in the parenchyma and functional neurons, which were found migrating in the subventricular along facial flow and also in the olfactory bulb, although these grafts in the brain was low > 0.1% (Muotri et al. 2005).
  • NSC neural crest stem cells
  • Post-migratory NCSC originate most cells and tissues which generate the peripheral nervous system, as well as various non-neural cell types such as smooth muscle cells of the cardiovascular system, epithelial cells of the skin, craniofacial bones, cartilage and connective tissue, corneal epithelium and dental pulp and others (LE DOUARIN, DUPIN, 2003; DOUARIN LE et al, 2004, 2008).
  • Intra-uterine stem cells transplantation is a method for the treatment of genetic, congenital, hematological, and immunological diseases. In basic research it provides a model for studying the dynamics of migration, graft and functional status of different types of stem cells. The cells can be transplanted in different moments of gestational period, which can be divided into quarters that are not functionally equivalent. The choice of the cells and quarter where the stem cells will be applied can influence cells behavior and results of transplantation. Fetal and adult hematopoietic or bone marrow derived mesenchymal stem cells (MSCs) were mainly used for IUSCT. We previously obtained human immature dental pulp stem cell (IDPSCs), which showed pluripotent potential and immune-compatible properties.
  • IUSCT Intra-uterine stem cells transplantation
  • Biodistribution of EGFP LP IDPSCs within the organs and tissues were analyzed on cryosections (5 ⁇ ) under Confocal Microscopy. Homing of EGFP LP IDPSCs was observed in organs derived from three germ lines, endoderm, ectoderm and mesoderm. In stomach and in intestine EGFP LP IDPSCs were found in the intraglandular space as well as in muscularis mucosae. In liver they appeared in hepatic parenchyma; in heart in myocardium and in brain in bold vessels, in cerebellum within Purkinje cells. Using Flow cytometry assay EGFP LP IDPSCs graft was quantified.
  • EGFP LP IDPSCs were also found in canine placenta, especially in blood vessels. These data were confirmed using anti-human nucleus (HuNu), anti-GFP and anti-IDPSCs anti-bodies. Human EGFP LP IDPSCs showed high migration capacity and proliferation potential after IUSCT in dog fetuses. Undifferentiated EGFP LP IDPSCs demonstrated homing in fetal hematopoietic (placenta), epithelial (gastric glands) and perivascular stem cells niches. Our data suggest that EGFP LP IDPSCs is a new promising source for genetic, congenital, hematological, and immunological treatment for those diseases through IUSCT.
  • the sonographic examinations were performed on days 3, 2 and 1 prior to the surgical procedure, with a handset GE ® brand, model Logic 100 MP, equipped with transducers: 7.5 MHz linear, convex 5.0 MHz and another endocavitary. The images were digitally documented.
  • the 7.5 MHz linear array transducer was used in all tests for clinical evaluation of organs and uterus, while the 5 MHz transducer was useful for evaluating the fetal body in its length and dimensions, especially when it exceeds the limits of zonary placenta, such as CR (body length - Crow-Rump) was measured from the distance between the most rostral skull to the base of the tail (DTC transverse diameter of the fetus) was obtained from the distance dorsum and ventral-lateral-lateral fetus. The measurement of PE (thickness of placenta) was obtained in defining the structure in relation membranes.
  • CR body length - Crow-Rump
  • Scheme 1 exemplifies the uterine horns of the experimental model: Group treatment fetuses 1, 3, 4 and 5 of the right uterine horn (Cud) - received transplants GFP- tagged IDPSC. The control group of fetuses were in 2 and 7 of the left uterine horn (Cue); these were collected for the experimental control ( Figure 61).
  • the cells were harvested by trypsinization and trypsin was inactivated with fetal bovine serum, the cells were placed in 15 ml tubes. Then, the material was centrifuged at 1500rpm for 10 minutes to form the cell pellet. After centrifugation, the supernatant was discarded and resuspended in 5 ml 0.9% saline solution to wash centrifuged at 1500RPM for 10 minutes and the supernatant again discarded and the FACS buffer Flow added, the suspension was transferred to tubes cytometry, and added all specific anti-human antibodies, such as Anti- HuNu anti-IDPSC, CD 45, CK18, CD 146, OCT 3/4, ⁇ 1 integrin, Cardiotin, MyoDl and Myogenin, human, incubated for 15 minutes at 4oC.
  • the expression analyzes were performed on FACS Calibur flow cytometer for 10,000 events and analyzed by the acquisitions program Mdi Win 2.8. The marker expression was determined by comparison with an isotype control label
  • PI solution prepared from 5ml of PBS to which was added 5 ⁇ 1 triton 100 (0.01% v / v), 50mL of RNAse A (2mg/ml ) and 20 ⁇ 1 of propidium iodide (5mg/ml). Then there was the acquisition of data flow cytometer FACS Calibur on 10,000 events, and analysis program was used Mdi Win 2.8. After the acquisition of cell populations, cells positive for EGFP protein contained in the gate or quadrant were selected and determined the cell cycle phases using the FL-2 channel for the quantification of PI (propidium iodide) incorporated GFP + cells.
  • Propidium iodide is a stoichiometric fluorochrome which intersperses the double strands of DNA. The fluorescence was captured in FL-2, and it is proportional to the DNA content in the cell. Diploid cells that are not replicating (GO/Gl phases of the cell cycle) have 2n cell contents, emitting signals of lower intensity than the cells located in the S phase, during which there is an increase of DNA content. S-phase cells, in turn, generate signals of lower intensity than those located in G2 / M until complete replication of the DNA content to 4n, which remains so during the G2 phase to mitosis, in which each mother cell gives rise to two daughter cells.
  • PI Propidium iodide
  • Cells located at the peak hipodiploide possess DNA content less than 2n, and may represent increased occurrence of cell debris and fragmented DNA, characteristic of cell death events.
  • All generated signals are amplified and converted into pulses by the apparatus, allowing the construction of distribution graphs of cells in cell cycle. Whereas there is a proportional relationship between the increase in DNA content and area of the pulse generated.
  • paraffin sections mounted on slides.
  • the material was previously included in paraformoldehyde to 4%, paraffin-embedded and cut to 5.4 ⁇ (Microtome, LEICA).
  • the tracking of EGFP LP IDSPC injected via IP was performed using antibodies: anti - IDPSC: marker of human tooth pulp, and anti-human nucleus - HuNu.
  • the blades have undergone a process of being immersed in xylene at 50 ° C for 30 minutes and then immersed in xylene at room temperature for 20 minutes.
  • To minimize the natural fluorescence of the tissue it was necessary to immerse slides in Methanol + Acetone "overnight".
  • the material was hydrated in a series of decreasing alcohols (100%, 95% and 75%) for 2 minutes and incubated for 10 minutes in ammonium hydroxide solution for removal of residual formalin.
  • the blades endogenous peroxidase was blocked with a solution of methanol and hydrogen peroxide (1 : 1).
  • the tissues were incubated with primary antibodies in a humid chamber "overnight" 4 0 C.
  • the material was revealed with the Dako Envision Kit and dehydrated in an ascending series of alcohols (50%, 75%, 95% and 100%).
  • the chromogen used was DAB (Dako ®), slides were counter-stained with Mayer's Hematolixina sealed with Permount and visualized by light microscopy.
  • the EGFP LP IDPSC showed positive immunostaining for Oct 3 ⁇ 4, which present nuclear and perinuclear localization ( Figure 72).
  • the rate of EGFP LP IDPSC Oct 3/4 was also assessed by Flow Cytometry and was 12.6%.
  • the expression of markers of MSCs, such as CD146 (pericytes) and ⁇ 1-integrin was 2.5% and 18.3% respectively ( Figure 73)
  • DP Human dental pulp
  • DP was gently rinsed in phosphate-buffered solution (PBS) (Invitrogen, Carlsbad, CA, USA), slightly dissected and placed into 35 mm plastic tissue culture dishes (Corning Inc., Corning, NY, USA).
  • PBS phosphate-buffered solution
  • DP tissue explants were cultured in Dulbecco's-modified Eagle's medium (DMEM)/Ham's F12 (DMEM/F12, Invitrogen Corporation - Carlsbad, CA, USA) supplemented with 15% fetal bovine serum (FBS, Hyclone, Logan, Utah, USA), 100 units/ml penicillin, 100 mg/ml streptomycin, 2 mM L-glutamine, and 2 mM nonessential amino acids (all from Invitrogen) in a 5% C02 humid atmosphere at 37°C.
  • DMEM Dulbecco's-modified Eagle's medium
  • F12 fetal bovine serum
  • penicillin 100 mg/ml streptomycin
  • 2 mM L-glutamine 2 mM nonessential amino acids
  • Fibroblast-like cells growing in monolayer were further washed twice with PBS and subjected to 0.5 g/L trypsin and 0.53 mmol/L Ethyl enediamine tetra-acetic acid (EDTA) (Invitrogen) for 3 to 5 minutes at 37°C.
  • EDTA Ethyl enediamine tetra-acetic acid
  • Passage 1 was counted after the first enzymatic digestion. Trypsin activity was inactivated by addition of culture medium supplemented with 10% fetal bovine serum (FBS). Approximately 5x10 5 cells were placed into 25 cm 2 cell culture flask (Corning). Sub-culturing was performed every 3 to 4 days, and the culture medium was changed daily.
  • FBS fetal bovine serum
  • Freshly extracted dental pulp is a tissue, which contains large nerve trunks and blood vessels in the central region of the coronal and radicular pulp ( Figure 76A).
  • the first outgrowth of fibroblast-like cells appeared between three to four days after DP plating ( Figure 76B).
  • Long-term culture was performed by mechanical transfer of DP into a new culture dish without using enzymatic treatment. After each transfer, DP produced large numbers of outgrowing cells approximately every three or four days, thus allowing constant production of stem cells (SCs) at passage zero (PO) (se Figures 74 and 75).
  • SCs stem cells
  • PO passage zero
  • Example 17 IDPSCs morphology (phenotype) following long-term culture of DP
  • TEM transmission electron microscopy
  • EP and LP of IDPSCs were fixed in 2.5% glutaraldehyde (Sigma) for 48 h, post-fixed in 1% phosphate buffered osmium tetroxide solution (pH 7.4) (Sigma) for 2 h at 4 C, and embedded in Spurr's Resin (Sigma).
  • Ultrathin sections were obtained using an automatic ultramicrotome (Ultracut R, Leica Microsystems, Germany). Sections were double-stained with uranyl acetate (Sigma) and lead citrate (Sigma) (2% and 0.5%, respectively) and analyzed using TEM (Morgagni 268D, FEI Company, The Netherlands; Mega).
  • Example 19 Stem cell migration within dental pulp: localization of BrdU positive cells in DP during in vitro cultivation
  • Example 20 DP tissue after enzymatic treatment
  • At least two methods may be used for tissues-specific stem cell isolation: enzymatic treatment and explant culture.
  • stem cells isolation soft tissues are cut into small pieces and treated with enzyme after tissue disaggregation.
  • Example 21 In vivo immunophenotype of dental pulp stem cells
  • IDPSC immunophenotyping was based on immunofluorescence and flow- cytometry analyses performed by using anti-human specific antibodies: vimentin, nestin, fibronectin, and Oct3/4 (all from Santa Cruz Biotechnology, Santa Cruz, CA,
  • CD105/SH-2 and CD73/SH-3 both from Case Western Reserve University, OH, USA
  • FITC-conjugated secondary antibodies (Chemicon, Temecula, CA, USA) were used and respective isotype matched controls. Immunofluorescence was analyzed using the aforementioned antibodies after cell fixation in 4% paraformaldehyde (Sigma) in PBS and permeabilization in 0.1% Triton X-100 (Sigma) in PBS.
  • IDPSCs were incubated with 5% bovine serum albumin (BSA, Sigma), diluted in PBS for 30 minutes, and further incubated for 1 h at room temperature with FITC-conjugated goat anti-mouse or anti-rabbit immunoglobulin (Chemicon) at a final dilution of 1 :500 in PBS (Invitrogen).
  • BSA bovine serum albumin
  • Microscope slides were mounted in Vectashield mounting medium with 49,6- Diamidino-2-phenylindol (DAPI, Vector Laboratories, Burlingame, CA) and immunofluorescence was detected using a Carl Zeiss Axioplan fluoromicroscope (LSM 410, Zeiss, Jena, Germany) or a Nikon Eclipse El 000 (Nikon, Kanagawa, Japan). Digital images were acquired with a CCD camera (Applied Imagingmodel ER 339) and the documentation system used was Cytovision v. 2.8 (Applied Imaging Corp. - Santa Clara, CA, USA).
  • Flow-cytometry was performed using EP and LP of IDPSC at passage 3.
  • Cells were detached by using a 10 min treatment at 37 C with PBS 0.02% EDTA, pelleted (10 min at 400 g) and washed in 0.1% BSA in 0.1 M PBS at 4 C.
  • cells at a concentration of 10 5 cells/ml were stained with a saturating concentration of the aforementioned antibodies (10 ml).
  • cells were washed three times with PBS and resuspended in 0.25 ml of cold PBS.
  • Nestin positive cells in the cell rich zone showed fibroblast-like as well as ES-like cell morphologies ( Figures 78B-78C).
  • nestin protein was found to be expressed in intermediate filaments in the cells from the plexus of nerves ( Figure 78D).
  • nestin positive cells were embedded in the wall of small capillaries ( Figure 78E) and in adjacent regions of these capillaries ( Figure 78F).
  • STRO-1 is a specific marker for stem cells/pericytes from DP. STRO-1 antibody was thus used as control. The expression of STRO-1 was mainly observed in small capillaries and middle size blood vessels ( Figure 78J), as well as in the plexus of nerves in the cell free zone ( Figure 78K). We also verified localization of vimentin expressing cells in DP. As expected, vimentin positive cells were localized in capillaries and in the innermost pulp layer, locations where nestin positive cells were also found ( Figures 78L-78M).
  • EPCs markers Early Population (EP) and Late Population (LP) stem cells were characterized using several markers including SH2/CD105, SH3/CD73 (MSCs markers) and Oct3/4 (ES cells marker). Additionally, expression of MSCs markers such as vimentin, nestin, fibronectin was evaluated in both EP and LP.
  • Representative Figure 79 Al-El, A2-E2 shows that all MSC markers were expressed in both populations (EP and LP) and slightly declined in LP SCs after six months of multiple DP transfer cycles ( Figures 79A2-79E2) with the exception of Oct3/4.
  • Proliferative capacity of EP and LP of IDPSCs before and after cryopreservation was also studied using three different culture media: DMEM/F12, DMEM-LG, and MEM-alpha. Starting from P2, non-cryopreserved cells were harvested following enzymatic dissociation and counted daily during 15 consecutive passages. IDPSCs cultured in DMEM/F12 and MEM-alpha medium presented a constant proliferative rate during the initial passages, which achieved their peak growth at passage 5 ⁇ 2 ( Figure 82A, Table 5). Based on the growth curves presented in Figure 81, statistical analyses were performed considering the cell number from passage 3 to 7 (Table 5).
  • proliferative rate of EP and LP cultivated in DMEM/F12 and MEM- alpha media were evaluated after thawing and showed similar proliferative potential, when compared with those before cryopreservation ( Figure 81B, Table 5).
  • Non- cryopreserved EP and LP of IDPSCs cultured in DMEM-LG presented spontaneous differentiation into osteogenic lineage (data not shown) and demonstrated rapid decrease of proliferative potential ( Figure 81A, Table 5).
  • EP and LP of IDPSCs, cultured in DMEM-LG after thawing maintained their proliferative state (Figure 81B, Table 6).
  • DMEM/F12 and MEM-alpha media did not induce any spontaneous differentiation in non-cryopreserved and cryopreserved EP and LP of IDPSCs.
  • Table 5 Number of IDPSCs cultured in three different growth media and at different passages before and after cryopreservation.
  • the final concentrations of reagents were: 20 ⁇ of PCR reactions were prepared with 2 ⁇ cDNA, 0,2 ⁇ of each primer, 1 unit of Taq DNA Polymerase, 0,2 ⁇ of dNTPs, 1,5 mM of magnesium chloride and buffer Taq DNA Polymerase (Fermentas Life Science).
  • Example 25 Expression pattern of MSCs markers in immature dental pulp stem cells
  • HLA human leukocyte antigens
  • CD44 is a 80-250 kDa type I (extracellular N-terminus) transmembrane glycoprotein and the hyaluronan receptor plays an important role in MSCs migration and seems to be critical for recruitment of MSCs into wound sites for the proposition of tissue regeneration (Zhu et al, 2006); ii) Stem Cell Factor/c-kit (tyrosine-protein kinase Kit) or CD117;
  • CD90 or Thy-1 can be used as a marker for a variety of stem cells and for the axonal processes of mature neurons;
  • CD29 - surface antigen expression revealed neural crest-like and mesenchymal immunophenotypes (Pruszak et al, 2009); v) nestin is a marker for multipotent neural stem cells and is also expressed in hair follicle bud stem cells; and
  • vimentin is a neural stem cells marker, which is also expressed in immature cells before being replaced later by more specialized networks (Langa et al, 2000).
  • Example 26 Expression of neuroepithelial stem cell markers in LP IDPSC
  • BDNF BDNF
  • NGF NTGF
  • NT- 3 and NT-4 LP IDPSC.
  • the primary antibodies used were: rabbit anti-human BDNF (Preprotech, 1 : 100), rabbit anti-human NGF (Preprotech, 1 : 100), goat antimouse NT-3 (Preprotech, 1 : 100), goat anti-mouse NT-4 (Preprotech, 1 : 100).
  • Expression of p75 protein was monitored by FACS analysis using Ab3125 mouse monoclonal antibody (Abeam, Cambridge, UK) or isotype control.
  • PCR consisted of 35 cycles of 45 sec at 94°C, 45 sec at 55°C and 1 min at 72°C with the following primer pairs: BDNF-F (5'-AGA GGC TTGACA TCA TTG GCT G-3') (SEQ ID NO:21), BDNF-R (5'-CAA AGG CAC TTG ACT ACT GAG CAT C-3') (SEQ ID NO:22); GDNF-F (5'-CAC CAG ATA AAC AAA TGG CAG TGC-3') (SEQ ID NO:23), GDNF-R (5'-CGA CAG GTC ATC ATC AAA GGC G-3') (SEQ ID NO:24); NGF-P-F (5'-ATA CAG GCG GAA CCA CAC TCA G-3') (SEQ ID NO:25), NGF-P-R (5'-GTC CAC AGT AAT GTT GCG GGT C-3') (SEQ ID NO:26); NT-3-F (5'-TGG GGG AGA
  • Amplicons had 147 bp (brain-derived neurotrophic factor, human - BDNF), 335 bp (glial cell derived neurotrophic factor, human - GDNF), 174 bp (nerve growth factor, beta polypeptide, human - NGF- ⁇ ), 201 bp (neurotrophin 3, human - NT-3), 198 bp (neurotrophin 4/5, human - NT-4/5).
  • RNA expression of p75 was analyzed by RT-PCR using specific primers (forward primer: 5'-tcgtggagagtctgtgcagt-3' (SEQ ID NO:31), reverse primer: 5'- tggacaggaagtgtggtcag-3 ' (SEQ ID NO:32)).
  • Total RNA was extracted with the RNeasy Kit (Qiagen, Valencia, CA), reverse transcribed and amplified for 20 cycles on a PTC- 100 Programmable Thermal Controller (MJ Research, Inc., Watertown, MA) using the Superscript amplification system (Life Technologies, Inc.).
  • PCR products were size fractionated by 2% agarose gel electrophoresis and stained with 2% ethidium bromide (Sigma, St. Louis, MO, USA). GAPD was co-amplified as a housekeeping gene to normalize p75 expression levels.
  • adult dental pulp stem cells may originate from neural crest stem cells (NCSC) and these dental pulp stem cells with NCSC features might persist until adulthood, able to generate a broad variety of cells depending on their environment.
  • NCSC neural crest stem cells
  • LP IDPSC naturally constitutively express high levels of neurotrophic factors, such as BNDF (brain-derived neurotrophic factor), GNDF (glial cell line-derived neurotrophic factor), NGF- ⁇ (nerve growth factor), NT-3 (Neurotrophin-3), NT-4/5 (Neurotrophin-4/5) that are known to promote sensory and motor axon growth ( Figures 84A-84E and 84G) as well as p75 (a neurotrophin receptor and marker of NCSC) ( Figures 84F and 84H).
  • BNDF brain-derived neurotrophic factor
  • GNDF glial cell line-derived neurotrophic factor
  • NGF- ⁇ nerve growth factor
  • NT-3 Neurotrophin-3
  • NT-4/5 Neurotrophin-4
  • Fluorescence-activated cell sorting (FACS) analysis demonstrated a proportion of BDNF (100%), GNDF (99%), NGF- ⁇ (99%), NT-3 (70%), NT-4/5 (80%) and p75 (90%) in the LP IDPSC populations.
  • Example 27 Expression of limbal stem cell and corneal epithelial markers in LP IDPSCs
  • LP IDPSCs were also shown to express a subset of markers, which are important for epithelial cell fate and especially for the eye surface epithelium. Using immunohistochemical analysis, the presence of several limbal stem cells and epithelial proteins were evaluated in undifferentiated LP IDPSCs.
  • mouse anti-human monoclonal antibodies anti-integrin betal (integrin ⁇ ) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), connexin 43 (Chemicon), ABCG2 (Chemicon) and vimentin (NeoMarkers, Fremont, CA, USA), and cytoplasmic/nuclear monoclonal antibodies: mouse anti-cytokeratin 3/12 (K3/ 12) (RDI, Flanders, NJ, USA), reacts with human and rabbit, and mouse anti-human anti-p63 (Chemicon). Cells were grown on glass cover-slips up to 70% confluence, washed in PBS (Gibco) and fixed overnight with 4% paraformaldehyde (Sigma).
  • TBS Tris buffered saline
  • 20 mm Tris-HCl pH 7.4 (Vetec, Duque de Caxias, RJ, Brazil), 0.15 M NaCl (Dinamica Reagent, Sao Paulo, SP, Brazil), and 0.05% Tween- 20 (Sigma). Permeabilization was performed using 0.1% Triton X-100 for 15 min (Santa Cruz Biotechnology). Cells were washed three times and incubated for 30 min in 5% bovine serum albumin (Sigma) in PBS pH 7.4 (Gibco).
  • Microscope slides were mounted in antifade solution (Vectashield mounting medium, Vector Laboratories, Hercules, CA, USA) with 4',6- diamidino-2-phenylindole (DAPI) and analyzed using a confocal microscope. Control reactions were incubated with PBS instead of primary antibody, followed by washing and incubation with respective secondary antibody.
  • antifade solution Vectashield mounting medium, Vector Laboratories, Hercules, CA, USA
  • DAPI 4',6- diamidino-2-phenylindole
  • Primers used for analysis of expression of limbal stem cell markers in LP IDPSCs were as follows with the gene sense primer, anti-sense primer and annealing temperature specified: ABCG2 (379 bp) AGTTCCATGGCACTGGCCATA
  • ACCAAGGACACCACCAGCAT (SEQ ID NO:35) 55 °C; K3 (145 bp) GGCAGAGATCGAGGGTGTC (SEQ ID NO: 36) GTCATCCTTCGCCTGCTGTAG (SEQ ID NO:37) 58 °C; K12 (150bp) ACATGAAGAAGAACCACGAGGATG TCTGCTCAGCGATGGTTTCA (SEQ ID NO:38) 58 °C; ⁇ -actin (208 bp) GGCCACGGCTGCTTC (SEQ ID NO:39); GTTGGCGTACAGGTCTTTGC (SEQ ID NO:40) 55 °C.
  • Reagents' final concentrations were l xPCR buffer, 0.2 mM dNTP mix, 0.2 ⁇ of each primer (above); 1.5 mm of MgCi 2 , and 2 units of Platinum Taq DNA polymerase (Invitrogen), with a final volume of 50 ⁇ 1.
  • PCR was performed using a MiniCycler (MJ Research, San Francisco, CA, USA). PCRs were performed under the following conditions: 1 cycle at 94° C for 5 min, followed by 35 cycles at 94°C for 1 min, at annealing temperature for 1 min, and at 72°C for 1 min. PCR products were size fractionated by 2% agarose gel electrophoresis and stained with 2% ethidium bromide (Sigma, St. Louis, MO, USA). Human ⁇ -actin gene was used as control.
  • Human-specific antibodies such as p63, integrin ⁇ -l (CD29), vimentin, connexin 43 and ABCG2 presented positive immunostaining with LP IDPSCs while anti-K3/12 antibody showed only weak positive immunostaining in a few cells ( Figures 85A-85G). Expression of some genes previously analyzed using immunofluorescent proteins was also assessed by RT-PCR. Undifferentiated LP IDPSCs demonstrated expression of ABCG2, connexin 43 and K12, while expression of K3 was not found ( Figure 851). As expected, ABCG2, connexin 43 and K12 were expressed in human limbal tissue used as control, while mRNAs of K3 were undetectable ( Figure 851, Lane 3). In human corneal control samples connexin 43, K12 and K3 mRNAs, were present ( Figure 851, Lane 2). Predictably, expression of ABCG2 was not detected in human control cornea ( Figure 851, Lane 2).
  • Example 28 Expression of embryonic stem cell markers in LP IDPSC
  • RT-PCR Primer Sequence are: (5' to 3') Oct3/4 (End-S) GAC AGG GGG AGG GGA GGA GCT AGG, (SEQ ID NO:41); (End-AS) CTT CCC TCC AAC CAG TTG CCC CAA AC (SEQ ID NO: 42); SOX2 (End-S) GGG AAA TGG GAG GGG TGC AAA AGA GG (SEQ ID NO:43), (End-AS) TTG CGT GAG TGT GGA TGG GAT TGG TG (SEQ ID NO:44); Nanog (S) CAG CCC CGA TTC TTC CAC CAG TCC C (SEQ ID NO:45), (AS) CGG AAG ATT CCC AGT CGG GTT CAC C (SEQ ID NO:46); GAPDH (S) GCA CCG TCA AGG CTG AGA AC (SEQ ID NO:47), (AS) TGG TGA AGA CGC CAG TGG A (SEQ ID NO:48
  • hESC human epithelial stem cells
  • LP IDPSC showed expression of Oct3/4, Nanog, SOX2, and p53 with Oct3/4 and Nanog having a nuclear localization ( Figures 86A-86C1). Quantitative PCR indicated that Oct3/4 had the highest relative level of expression among Oct3/4, Nanog, and SOX2.
  • the relative expression of Oct3/4 in LP IDPSCs varied between unrelated donors ( Figures 80A-80D). Additionally, the proportion of p53 positive cells in LP IDPSC derived from two unrelated donors was also quantified ( Figure 89A-89B). p53 positive cells were also positive for CD44, a marker of MSC described above ( Figure IOC) and were found in LP IDPSC in similar amounts ( Figure 89C-89D).
  • RNA from cell samples of LP IDPSCs isolated from deciduous teeth (DL-1 and DL-4) and from a third molar (DL-2) were prepared with RNeasy Mini kit (Qiagen, Duesseldorf, Germany) according to the instructions of the manufacturer. Complimentary DNA synthesis was performed on -800 ng of total RNA by using the QIAGEN OneStep RT-PCR Kit (Qiagen), and the resulting cDNA products were amplified using the gene- specific primers shown below.
  • Primers were designed by using Primer3 software v. 0.4.0. The products were electrophoresed on 1.5% agarose gels, stained with ethidium bromide, and visualized with a transluminator Gel Logic 100 Imaging System (Kodak, New Haven, CT) using the Software Kodak ID V.3.6.5K2 (Kodak). Comparative densitometry of bands was obtained with the software Adobe Photoshop CS2.
  • Figures 87A and 87B shows the images of the agarose gels and the graphs of the corresponding optical densities of the bands for the four genes analyzed.
  • All LP IDPSCs studied expressed the vimentin, tenascin-C, type I collagen, and fibronectin genes.
  • the three populations of LP IDPSCs exhibited similar expression of vimentin, tenascin, and fibronectin genes.
  • the densitometry analysis showed that the total RNA for the type I collagen in the DL-2 cells was significantly less than that observed in the other hIDPSCs (p ⁇ 0.05).
  • Vimentin was detected by a mouse monoclonal antibody from Neomarkers (Lab Vision Corporation, Fremont, CA) diluted 1 :250.
  • Type I collagen was detected by a mouse monoclonal antibody from Chemicon (Chemicon, Victoria, Australia) diluted 1 :25.
  • Fibronectin was detected by a mouse monoclonal antibody from Calbiochem (Calbiochem, San Diego, CA) diluted 1 :50.
  • Tenascin-C was detected by a mouse monoclonal antibody from Neomarkers diluted 1 : 100.
  • the secondary antibody was the anti-immunoglobulin G from mouse conjugated to fluorescein diluted in PBSA (1 :500) at room temperature. All the incubations were performed for 60 minutes at room temperature and omission of the primary antibodies served as negative controls. The observations and photographic recording were performed on a fluorescence microscope (LSM 410 Zeiss; Oberkochen, Baden- Wurttemberg, Germany). For each reaction, at least 100 cells were observed.
  • the LP IDPSC populations expressed vimentin, a cytoskeleton protein from mesenchymal cells. Vimentin appeared as filament waved bundles branched out from the central body to reach the peripheral domains of the cell ( Figure 88A). Type I collagen appeared as dots spread all over the cytoplasm with higher concentration around the perinuclear area ( Figure 88B). Fibronectin ( Figure 88C) as well as tenascin ( Figure 88D) appeared as small dots homogeneously distributed throughout the cytoplasm.
  • IDPSC neural crest stem cells isolated from a young organism.
  • SOX2 neural crest stem cells isolated from a young organism.
  • Undifferentiated EP IDPSC obtained after 15 cycles of DP transfer demonstrate robust expression if SOX2 protein at passage 2 ( Figure 90a, A-Al), while following in vitro culture, SOX2 expression gradually decreased.
  • Figure 90a, B-Bl expression of SOX2
  • IDPSC are migratory neural crest stem cells which are capable of aggregating into neurospheres. It is known that in development, SOX2 is regained only by those cells fated to become neurons. Neural crest stem cells that remain SOX2-free differentiate into other cell types, but never become neurons.
  • Figure 91a A-A4 demonstrate expression of SOXl in the nucleus, while ⁇ - tubulin shows cytoplasmic localization in the neural precursors derived from LP of IDPSC, which are organized in neurospheres. More specifically, Figure 91a depicts xpression of Soxl and ⁇ -tubulin proteins in late population (LP) of hIDPSC derived neurons. The following are also shown in Figure 91a: A. a nucleus (white arrow) of neurons stained with DAPI; Al. Positive immunostaining for SOXl observed in the nucleus (white arrow) of neurons; A2. Positive immunostaining for ⁇ -tubulin; A3. Merged images A-A2; and A4.
  • inset in A3 demonstrates superposition of DAPI and Soxl in the nucleus of neurons (white arrow).
  • Figure 91b-e demonstrate enrichment of LP of hIDPSC with neural progenitors and neurons following 15, 30 and 45 cycles of dental pulp mechanical transfer and induction of neural differentiation.
  • Figure 91b-A a percentage of SOXl negative cells, nucleus stained only with DAPI (blue) are shown; SOXl positive cells are presented in green.
  • Figure 91d-B a percentage of ⁇ -tubulin negative cells, nucleus stained only with DAPI (blue); ⁇ -tubulin positive cells are presented in red.
  • Figure 92a demonstrates nucleus of IDPSC-neuroblasts positively immunostained with anti-BrdU antibody and neuronal bodies which react positively with ⁇ -tubulin class III.
  • Figure 92b-c show clearly the enrichment of differentiated IDPSC population with slightly differentiated neuroblasts following growing cycle numbers of DP mechanical transfer.
  • Figure 94a is a graphic abstract from Cimadamore et al., 2011, which suggested the method of isolation of SOX2 cells from human ES cells.
  • This protocol is started from isolation of SOX2+ cells and induction of their migratory capacity in order to induce epithelial mesenchymal transition. At this moment the cells in contrast with IDPSC lack expression of SOX2, which is re-expressed during these cells differentiation into neurons.
  • This protocol which presents great academic interest to study the mechanism of regulation of SOX2 expression during neuronal differentiation, is sophisticated. It is less probable that this protocol will be used to isolate neuronal cells for the cell therapy.
  • Figure 94b depicts a non-limiting embodiment of aspects of this disclosure which clearly demonstrate the simplicity of suggested method as well as underline IDPSC composition utility for the treatment of neurodegenerative disease.
  • unique biomarkers fingerprint hIDPSCs-derived neuroblasts and early neurons.
  • P75NTR a member of the Tumor Necrosis Factor receptor (TNFR) of super family of transmembrane proteins.
  • the ligands for CD271 are neurotrophins, which are Nerve Growth Factor (NGF), Brain-Derived Growth factor (BDNF), Neurotrophin 3 (NT3), and Neurotrophin 4/5 (NT4/5). Expression of these in undifferentiated IDPSCs was also demonstrated and described elsewhere in this document.
  • CD271 also serves as a receptor for the pro-forms of these neurotrophins (Rogers ML, Beare A, Zola H, Rush RA. CD 271 (P75 neurotrophin receptor) J Biol Regul Homeost Agents. 2008 Jan-Mar;22(l):l-6).
  • CD271 marker is also expressed in hIDPSCs-derived neuroblasts that form neurospheres (3 -dimensional clusters of embryonic neural progenitor) and rosettes (neuroepithelial structures reminiscent of early neural tubes - 3-D neural islands).
  • the cells within rosettes are also express CD 146, which is considered the marker of perycites originally derived from neural capillaries.
  • CD 146 is actively involved in development, signaling transduction, cell migration, mesenchymal stem cells differentiation, angiogenesis and immune response.
  • CD 146 interacts with neurite outgrowth factor and involved in neurite extension in vitro. Moreover, CD 146 nervous system knockout mice exhibited lower body weights and smaller food intake when compared with wild type (Tu et al, 2013).
  • LP IDPSC culture of pos-natal cells of neural crest origin are characterized by unique properties. These unique properties are usually typical for neural precursors derived from fetal brain or from ES or iPS cells induced to neural differentiation in vitro.
  • Example 32 IDPSCs Derived Neuroblasts Further Differentiation and Maturation
  • IDPSCs derived neuroblasts following in vitro neural maturation, start to express neural key markers:
  • myelin P2, 04 2. involved in the generation of the myelin sheath: myelin P2, 04;
  • Dynein is a minus-end directed motor protein which, in the cells, converts the chemical energy contained in ATP into the mechanical energy of movement. Through retrograde axoplasmic transport, dynein carries organelles, vesicles, and possibly microtubule fragments along the axons of neurons toward the cell body.
  • Lis 1 Platelet-activating factor acetylhydrolase IB subunit alpha, is an enzyme that in humans is encoded by the PAFAHIBI gene.
  • Lisl is the protein product of a gene mutated in the human neuronal migration defect lissencephaly, binds to and regulates dynein motor function in the cell.
  • NDEL-1 Nuclear distribution protein nudE-like 1 is a protein that in humans plays a role in nervous system development, including cytoskeletal organization, cell signaling and neuron migration, outgrowth and maintenance.
  • Hirotsune S A LISl/NUDEL/cytoplasmic dynein heavy chain complex in the developing and adult nervous system. Neuron. 2000 Dec;28(3):681-96.
  • Myelin P2 protein and myelin basic protein together constitute a major fraction of peripheral nervous system myelin protein. They are intimately involved in the generation of the myelin sheath. They are also implicated in a number of neurological diseases, including autoimmune diseases of both the central and peripheral nervous systems.
  • Oligodendrocyte marker 04 Monoclonal Anti-Oligodendrocyte Marker 04 recognizes Oligodendrocyte marker 04. Oligodendrocytes are myelinating cells in the central nervous system (CNS) that form the myelin sheath of axons to support rapid nerve conduction.
  • CNS central nervous system
  • Retinoic acid receptor-alpha (RAR-alpha) has a high affinity for all
  • transretinoic acids and belongs to the same class of nuclear transcription factors as
  • thyroid hormone receptors vitamin D3 receptor and ecdysone receptor.
  • Synapsin Ia/b exists as two alternatively spliced isoforms designated Synapsin la and Synapsin lb, has been characterized as one of the major phosphoproteins in nerve terminals and is thought to be involved in the regulation of neurotransmitter release.
  • Table 8 presents the type, origin, dilution, and purchase place for various primary antibodies
  • FIG. 96 depicts male karyotypes of in vitro cultured LP IDPSC at early and late passages, representative figure.
  • This nerve provides sensation to the anterior aspects of the chin and lower lip as well as the buccal gingivae of the mandibular anterior teeth and the premolars. It is a branch of the posterior trunk of the inferior alveolar nerve, which is itself a branch of the mandibular division of the trigeminal nerve (CNV).
  • CNV trigeminal nerve
  • Teratomas formation is an essential tool in determining the pluripotency of any pluripotent cells, such as embryonic or induced pluripotent stem cells (ES and iPS cells).
  • ES and iPS cells embryonic or induced pluripotent stem cells
  • a consistent protocol for assessment of teratoma forming ability of the cells was established and then used in studies.
  • Some recently published methods of the inventors are based on subcutaneous co-transplantation of defined numbers of undifferentiated IDPSCs and Matrigel into immunodeficient mice. The method was shown to be highly reproducible and efficient when 10 6 cells of mouse and human pluripotent cells were used. In 100% of cases we observed teratoma formation in a large number of animals and in long follow-up (up to 6 months).
  • MSC adult/mesenchymal
  • This protocol was adapted for population of IDPSC, especially in respect of cell number used, which was calculated on the basis that 20% of IDPSC express pluripotent markers.
  • ES and iPS cells we used 10 6 cells, while in to test IDPSC and control cells teratogenicity 5x10 6 cells were used.
  • mice After 4 months, even if macroscopically the tumors were not observed, the mice were sacrificed and frozen cuts were obtained from diverse organs, such as brain, lung, kidney, spleen, liver and were analyzed by pathologist.
  • Example 36 Paracrine Effects of LP hIDPSCS: Anti-Inflammatory, Immunomodulatory and Antimicrobial Properties of IDPSCs
  • MSCs assist via paracrine mechanisms and modulate the regenerative environment via anti-inflammatory and immunomodulatory mechanisms.
  • BIOPLEX test data is provided in Figure 97.
  • IDPSCs inoculation reduced production of cytokines by the infected lung cells. Strong reduction of pro-inflammatory (TNF-a, IL-lb, MIP-2, IL- 17) and anti-inflammatory (IL-10) cytokines was observed in the lungs infected with highly virulent Mtb strains.
  • TNF Tumor necrosis factor
  • cachexin or cachectin, and formerly known as tumor necrosis factor alpha or TNFa
  • TNFa Tumor necrosis factor alpha
  • the primary role of TNF is in the regulation of immune cells. TNF, being an endogenous pyrogen, is able to induce fever, apoptotic cell death, cachexia, inflammation and to inhibit tumorigenesis and viral replication and respond to sepsis via IL1 & IL6 producing cells. Dysregulation of TNF production has been implicated in a variety of human diseases including Alzheimer's disease.
  • Interferon gamma is a dimerized soluble cytokine that is the only member of the type II class of interferon, is known as immune interferon a cytokine that is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control.
  • IFNy is an important activator of macrophages. Aberrant IFNy expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFNy in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects.
  • Interleukin 17 is a cytokine that acts as a potent mediator in delayed-type reactions by increasing chemokine production in various tissues to recruit monocytes and neutrophils to the site of inflammation, similar to Interferon gamma.
  • Interleukin 17 as a family functions as a proinflammatory cytokine that responds to the invasion of the immune system by extracellular pathogens and induces destruction of the pathogen's cellular matrix.
  • Interleukin-1 beta also known as catabolin, is a cytokine protein, that an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis.
  • the most notable role of IL-17 is its involvement in inducing and mediating proinflammatory responses. IL-17 is commonly associated with allergic responses.
  • Interleukin-10 also known as human cytokine synthesis inhibitory factor (CSIF) is an anti-inflammatory cytokine.
  • IL-10 is a cytokine with pleiotropic effects in immunoregulation and inflammation.
  • Chemokine (C-X-C motif) ligand 2 (CXCL2), also called macrophage inflammatory protein 2 (MTP-2), plays a major role in mediating the neutrophilic inflammatory response and a mediator in the development of sepsis.
  • CXCL2 C-X-C motif ligand 2
  • MTP-2 macrophage inflammatory protein 2
  • KC and MIP-2 are CXC chemokines that exhibit distinct temporal patterns of expression in the skin following surgical injury.
  • KC and Mip 2 are neutrophil chemoattractant genes. Both chemokines are known to be expressed in a broad spectrum of acute and chronic inflammatory settings and are believed to be critical determinants of the nature and magnitude of the ensuing inflammatory reaction.
  • Example 37 IDPSCs Isolated From Third Molar (Wisdom) Tooth.
  • Figure 104 depicts an extracted third molar wisdom tooth.
  • CD 105 is a major marker in MSCs. It was used to verify the distribution of MSCs and identify their niche in the dental pulp. We demonstrate that MSCs expressing this marker is located in perivascular multiple niches, vascular plexus and nerve plexus in the network of vessels or nerves ( Figure 98). Although vascular plexus and nerve plexus are very similar structures, this definition was included in order to distinguish being smaller networks (vascular plexus) as major (nerve plexus).
  • CD73 Another marker of extreme importance for the identification of MSC and their niches is CD73, which is composed of two antibodies: SH-3 and SH-4 that recognize different epitopes on MSCs. We use both antibodies and observed a noticeable difference between them.
  • SH3 showed positive staining distributed throughout the pulp tissue and perivascular location (Figure 99A).
  • SH3 positive cells in vessels which are located in the layer of endothelial cells ( Figure 99B, C), as well as some SH3 + cells present location of pericytes.
  • SH3 + cells were found in the neural plexus in the cells that exhibit a distinct, neuronal like (Figure 99D) morphology, when compared with CD 105 + cells located in the same anatomic site ( Figure 98H).
  • SH4 it showed a very subtle marking (Figure 99E, F) when compared to SH3 (Figure 99A-D) and control ( Figure 98A).
  • N-cadherin which is an adhesion molecule of neural cells and considered a key molecule of neural crest cells during embryogenesis.
  • the expression of N-cadherin was visualized mainly in the perivascular niche, but around the blood vessels of smaller diameter (Figure lOOA-C). Moreover staining was not observed around all vessels ( Figure 100A).
  • Figure lOOC shows the location of the N-cadherin in the anatomical site of pericytes.
  • ABCG2 is associated with the cell membrane protein which transports various molecules across internal and external cell membranes. ABCG2 is also considered a marker of stem cells and is abundantly expressed in placenta. We observed cells distributed by pulp connective tissue that showed an intense expression of this marker (Figure 100D, E) similarly observed for SH-3 ( Figure 99). We also verified the expression of Nanog, which is a transcription factor whose expression was observed in the perivascular region and vascular plexus ( Figure 100F), but it showed no cytoplasmic and nuclear localization .
  • Example 39 Batch Release Process for Industrial Scale-Up of hIDPSC by LP Method
  • Figure 105 depicts an exemplary flow chart for a batch release process for industrial scale-up of hIPDSC by LP method in order to obtain clinically relevant quantities for multiple patient dosing.
  • dental pulp derived from deciduous teeth is plated on a cell culture flask.
  • Cells from the dental pulp (DP) are passaged by an enzymatic dissociation reagent from passage 1 (PI) to the passage 3 (P3) at each harvest cycle (H).
  • PI enzymatic dissociation reagent from passage 1
  • P3 passage 3
  • H harvest cycle
  • DP is transferred by non-enzymatic method.
  • cells from 1-10 dental pulps are pooled and undergo a process of freezing at P4. Thereafter cells are thawed and 50% of the cells are released as a single batch at p%. Afterwards, cells are frozen and ready for therapeutic administration, preferably to induce direct neurogeneration, such as but not limited to intrathecal (IT) or intraspinal cord injection (Product 1-IT).
  • direct neurogeneration such as but not limited to intrathecal (IT) or intraspinal cord injection (Product 1-IT).
  • Table 9 presents various methods of analysis performed in relation to the batch release process described above and shown in Figure 105.
  • Morphological Morphology Normal fibroblast confirms
  • Methods may include but are not limited to:
  • Dental Pulp Isolation In regards to the teeth preparation just before the sampling, there are different methods. Stem cells isolated from human dental pulp derive from mesenchymal cells produced by neural crests. In order to isolate stem cells from human dental pulp it is necessary that the teeth are healthy and without any communication between pulp and oral cavity.
  • the common culture system for use comprises a culture matrix comprising extracellular matrix (ECM).
  • ECM extracellular matrix
  • the ECM is selected from, without being limited thereto, fibronectin, laminin and gelatin.
  • the culture system may be further supplemented by an antibacterial agent.
  • the antibacterial agent may be selected from, without being limited thereto, penicillin and streptomycin, preferably gentamycin (in order to reduce risk of transplantation to penicillin allergic population in traces).
  • the culture system may be further supplemented by a growth factors, also as described by Stern et al. in US Patent no 8,481,308 using sustained release growth factor to maintain cells in homogenous undifferentiated stage.
  • KOSR knockout serum replacement
  • FBS fetal bovine serum
  • NeurobasalTM medium is a basal medium especially formulated for growth of neuronal cells, and supplemented with FBS, or B27, or N2 serum replacement and retinoic acid (RA).
  • the undifferentiated or differentiated cell line is preserved by preservation methods, such as cryopreservation.
  • contemplated disclosures are provided an undifferentiated hIDPSC wherein the cell is immunoreactive with markers for human pluripotent stem cells including Oct3/4, Nanog and SOX2, and wherein said cell may differentiate under differentiating conditions to neural cells.
  • the cells express the transcription factor SOXl; SOX2 and tubulin as demonstrated by RT-PCR.
  • the said cells maintain a stable diploid karyotype during prolonged cultivation in vitro. Sox and Oct3/4 transcription factors are thought to be central to the transcriptional regulatory hierarchy that specifies ES cell identity.
  • hIDPSC were previously shown to express Oct 4 (Insert ref 2006; and Liezer et al.
  • hIDPSC human immunodeficiency protein
  • LP harvesting method where enrichment with SOX1, SOX2, BrdU, beta-3-tubullin molecular markers in LP indicate on the capability of these LP to proliferation in vitro and differentiation (in vivo or ex vivo) into neural progenitor cells, neuron cells and/or glial cells and ganglion cells.
  • the undifferentiated hIDPSCs cells have the potential to differentiate into neural progenitor cells, neuron cells and/or glial cells when subjected to differentiating conditions or in vivo micro-environment.
  • hIDPScs are normally non-HLA typing.
  • a method comprising providing a compositon of hIDPSCS for transplantation to a patient is contemplated.
  • hIDPSCs are derived from a LT culture system comprising undifferentiated hIDPSCs in accordance with disclosure, followed by incubating the undifferentiated SCs in a culture system that supports directed differentiation of SCs into the selected somatic cells, preferably maintaining strong neuroectodermal committement.
  • the selected population of somatic cells consists essentially of neural precursor cells. In accordance with another embodiment the selected population of somatic cells consists essentially of dopaminergic neuronal cells. Culture systems which support directed differentiation of SCs into a specifically desirable type of somatic cell, such as neural precursor cells or dopaminergic neuronal cells are well known in the art.
  • an undifferentiated cell line capable of differentiation into neural progenitor cells, neuron cells and glial cells and preferably produced by a method of the present invention.
  • a differentiated committed progenitor cell line that may be cultivated for prolonged periods and give rise to large quantities of progenitor cells.
  • a differentiated committed progenitor cell line capable of differentiation into mature neurons and/or glial cells.
  • a committed neural progenitor cell capable of giving rise to mature neuron cells and glial cells.
  • a differentiated committed progenitor cell line capable of establishing a graft in a recipient brain, to participate in histogenesis of the nervous system and to constitute the neuronal, astrocyte and oligodendrocyte lineages in vivo.
  • an undifferentiated hIDPSC, a hIDPSC-derived neural progenitor cell-neuroblasts, a neuronal cell and a glial cell that may be used in pharmaceutical composition for cell therapy and gene therapy through cell transplantation systemically, intrathecally, intranasally or locally.
  • the disclosed/anticipated therapeutic neuroprotective action may be activated though protective anti- inflammatory and/or release of nerve growth factors, and/ or expression and/or repair of neurogenesis, and/or to improve functional outcomes, such as motor and/or cognitive outcomes.
  • Such neuroprotective methods offer treatment of CNS and/or PNS diseases by directly replenishing, replacing, and/or supplementing damaged or dysfunctional neural cells (i.e. neurons/glial/oligodendrocytes), and/or by enhancing the growth and/or survival of existing neural cells, and/or slow or reverse the loss of such cells in a neurodegenerative conditions.
  • damaged or dysfunctional neural cells i.e. neurons/glial/oligodendrocytes
  • compositions comprising hIDPSCs and methods for the prophylaxis and treatment of diseases, conditions and injuries of the central (CNS) and peripheral nervous systems (PNS).
  • diseases and conditions treatable by the disclosed hIDPSC transplantation are neurodegenerative disorders and neural disease, such as neurodegenerative disorders (e.g., Alzheimer's, Parkinson's disease, Parkinson's disorders, Huntington's disease (Huntington's Chorea), Lou Gehrig's disease, multiple sclerosis, Pick's disease, Parkinsonism dementia syndrome), progressive subcortical gliosis, progressive supranuclear palsy, thalmic degeneration syndrome, hereditary aphasia, amyotrophic lateral sclerosis, Shy-Drager syndrome, and Lewy body disease; vascular conditions (e.g., infarcts, hemorrhage, cardiac disorders); mixed vascular and Alzheimer's; bacterial meningitis; Creutzfeld- Jacob Disease; and Cushing's
  • neurodegenerative disorders e
  • hIDPSCs cells are typically formulated in a unit dosage injectable form, such as a solution, suspension, or emulsion.
  • Dosage forms/ pharmaceutical formulations of the aqueous suspension of cells/medium will typically involve adjusting the ionic strength of the suspension to isotonicity to about 0.1 to 0.2 and to physiological pH of about pH 6.8 to 7.5. Said formulation will also typically contain a fluid lubricant.
  • compositions suitable for injection of cells, and/are conditioned medium typically are sterile aqueous solutions and dispersions.
  • Carriers for injectable formulations can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, or other suitable vehicle, and suitable mixtures thereof.
  • the skilled pharmaceutical expert can determine the amount of cells and optional carrier and additives in compositions to be administered in methods of the invention.
  • any additives/excipients or active compounds to the hIDPSCs cells are present in an amount of 0.001 to 50 wt % in phosphate buffered saline.
  • compositions can be administered in dosages and by techniques well known to those skilled in the medical and pharmaceutical arts. Doses for humans/mammals can be determined without undue experimentation by the skilled medical practitioner, from this disclosure, the documents cited herein, and the knowledge in the art.
  • a skilled expert/medical practitioner will be able to determine the appropriate situation in which subjects are susceptible to or at risk of, for example, stroke as well as suffering from stroke for administration of hIDPSC systemically, intrathecally, or locally, as described in the present invention.
  • aspects also relate to therapeutic use of the combined therapy where hIDPSC administration is combined with therapeutic chemical or bioactive or/and pharmaceutical compounds agents for neurodegenerative disorders.
  • compositions and methods may be used to moderate, and/or alleviate, and/or to improve medical condition in the patient diagnosed with a neurodegenerative disease as described above.
  • methods of use of hIDPSC neuronal precursors neuroblasts with unique biomarkers fingerprint are contemplated, surprisingly expressing C271 and P57. These cells grown in culture are of high interest for future neuroregeneration medicine and drug discovery.
  • hIDPSCs such as (i) immunomodulatory properties, (ii) anti-inflammatory properties and, even, (iii) antimicrobial properties. Such characteristics open new fields of use for IDPSCs.
  • treatment of multiple clinical applications is contemplated: (i) as immunoprotection against immunosuppressive diseases, for example- Graft vs Host; AIDS; cancer chemotherapy side effects; (ii) use of hIDPSCs as anti-inflammatory therapy, for example against arthritis, or IBD- inflammatory bowel disease; and/or (iii) an infectious diseases, such as sepsis and resistant nosocomial infections, etc.
  • immunosuppressive diseases for example- Graft vs Host
  • AIDS cancer chemotherapy side effects
  • use of hIDPSCs as anti-inflammatory therapy, for example against arthritis, or IBD- inflammatory bowel disease
  • an infectious diseases such as sepsis and resistant nosocomial infections, etc.
  • Panchision DM The role of oxygen in regulating neural stem cells in development and disease. J Cell Physiol. 2009 Sep;220(3): 562-8.
  • Stem cell quiescence in the hippocampal neurogenic niche is associated with elevated transforming growth factor-beta signaling in an animal model of Huntington disease. J Neuropathol Exp Neurol. 2010 Jul;69(7):717-28.
  • Cimadamore F Fishwick K, Giusto E, Gnedeva K, Cattarossi G, Miller A, Pluchino S, Brill LM, Bronner-Fraser M, Terskikh AV.
  • Human ESC-derived neural crest model reveals a key role for SOX2 in sensory neurogenesis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Neurology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Neurosurgery (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Rheumatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Dermatology (AREA)
  • Hematology (AREA)
  • Pain & Pain Management (AREA)
  • Cardiology (AREA)
  • Reproductive Health (AREA)
  • Psychology (AREA)
  • Heart & Thoracic Surgery (AREA)
PCT/IB2014/059850 2013-03-15 2014-03-15 Multifunctional immature dental pulp stem cells and therapeutic applications Ceased WO2014141210A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
CA2904804A CA2904804A1 (en) 2013-03-15 2014-03-15 Multifunctional immature dental pulp stem cells and therapeutic applications
EP14765285.3A EP2970880B1 (en) 2013-03-15 2014-03-15 Multifunctional immature dental pulp stem cells and therapeutic applications
IL280850A IL280850B2 (en) 2013-03-15 2014-03-15 Multifunctional Immature Stem Cells of Dental Floss and Medical Uses
JP2015562539A JP6491606B2 (ja) 2013-03-15 2014-03-15 多機能未成熟歯髄幹細胞および療法適用
HK16107564.3A HK1219506B (en) 2013-03-15 2014-03-15 Multifunctional immature dental pulp stem cells and therapeutic applications
EP22171061.9A EP4095233A1 (en) 2013-03-15 2014-03-15 Multifunctional immature dental pulp stem cells and therapeutic applications
IL241470A IL241470B (en) 2013-03-15 2015-09-10 Multifunctional immature dental pulp stem cells and therapeutic applications

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201361800245P 2013-03-15 2013-03-15
US201361791594P 2013-03-15 2013-03-15
US61/791,594 2013-03-15
US61/800,245 2013-03-15

Publications (2)

Publication Number Publication Date
WO2014141210A2 true WO2014141210A2 (en) 2014-09-18
WO2014141210A3 WO2014141210A3 (en) 2015-04-30

Family

ID=51538238

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2014/059850 Ceased WO2014141210A2 (en) 2013-03-15 2014-03-15 Multifunctional immature dental pulp stem cells and therapeutic applications

Country Status (7)

Country Link
US (4) US9790468B2 (https=)
EP (2) EP2970880B1 (https=)
JP (2) JP6491606B2 (https=)
BR (1) BR102014006335B8 (https=)
CA (1) CA2904804A1 (https=)
IL (2) IL280850B2 (https=)
WO (1) WO2014141210A2 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017529068A (ja) * 2014-08-14 2017-10-05 アヴィタ・インターナショナル・リミテッド 幹細胞組成物および療法適用のための幹細胞を産生する方法
WO2019213256A1 (en) * 2018-05-02 2019-11-07 Morse Leslie Dental pulp stem cells and uses thereof
CN119868281A (zh) * 2025-03-28 2025-04-25 新北辰(湖北)生物科技集团有限公司 一种含有牙髓干细胞的修复注射制剂及其制备方法

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11278574B2 (en) 2013-03-15 2022-03-22 Avita International Ltd. Use of stem cells expressing mesenchymal and neuronal markers and compositions thereof to treat neurological disease
US11306290B2 (en) 2013-03-15 2022-04-19 Avita International Ltd. Stem cells expressing mesenchymal and neuronal markers, compositions thereof, and methods of preparation thereof
WO2017153956A1 (en) * 2016-03-09 2017-09-14 Avita International Ltd. Uses of dental pulp stem cells expressing mesenchymal and neuronal markers and compositions thereof to treat neurological disease
US11207352B2 (en) 2013-03-15 2021-12-28 Avita International Ltd. Compositions comprising stem cells expressing mesenchymal and neuronal markers and uses thereof to treat neurological disease
GB201703058D0 (en) * 2017-02-24 2017-04-12 Ucl Business Plc Biomarkers
US20190167724A1 (en) * 2017-12-04 2019-06-06 Caire Medical-Biotechnology International Co. Neuroprotective composition, preparation process thereof and medical uses thereof
BR112020022168A2 (pt) * 2018-04-30 2021-01-26 Avita International Ltd. células-tronco imaturas de polpa dentária e métodos de uso para tratar falência da medula óssea
EP3970794A4 (en) * 2019-05-14 2023-06-14 University of Tsukuba NERVOUS SYSTEM CELL POPULATION, PREPARATION CONTAINING NERVOUS SYSTEM CELLS AND PROCESS FOR MAKING SUCH POPULATION AND PREPARATION
KR20210029569A (ko) * 2019-09-06 2021-03-16 경상국립대학교산학협력단 치아 주변조직 유래 다분화능 줄기세포를 포함하는 비만 또는 비알코올성 지방간의 예방 또는 치료용 약학적 조성물
WO2023227972A1 (en) 2022-05-24 2023-11-30 Iceta - Instituto De Ciências, Tecnologias E Agroambiente Da Universidade Do Porto Process for preparation and cryopreservation of dental pulp from definitive teeth and products thereof based on isolated mesenchymal stem cells
WO2024166074A1 (en) * 2023-02-10 2024-08-15 Avita International Ltd. Method of producing and preparation of exosomes (nestaexo) derived from human immature dental pulp stem cells for therapeutic applications

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5082670A (en) 1988-12-15 1992-01-21 The Regents Of The University Of California Method of grafting genetically modified cells to treat defects, disease or damage or the central nervous system
US5650148A (en) 1988-12-15 1997-07-22 The Regents Of The University Of California Method of grafting genetically modified cells to treat defects, disease or damage of the central nervous system
US5817773A (en) 1990-06-08 1998-10-06 New York University Stimulation, production, culturing and transplantation of stem cells by fibroblast growth factors
US5928947A (en) 1992-07-27 1999-07-27 California Institute Of Technology Mammalian multipotent neural stem cells
WO2001060981A1 (en) 2000-02-18 2001-08-23 King's College London Tooth progenitor cell and method for its production
WO2002007679A2 (en) 2000-07-21 2002-01-31 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Adult human dental pulp stem cells in vitro and in vivo
US20020119180A1 (en) 2000-11-29 2002-08-29 President And Fellows Of Harvard College Methods and compositions for culturing a biological tooth
US20030148513A1 (en) 2002-01-14 2003-08-07 Kiminobu Sugaya Novel mammalian multipotent neural stem cells and compositions, methods of preparation and methods of administration thereof
US7927587B2 (en) 1999-08-05 2011-04-19 Regents Of The University Of Minnesota MAPC administration for the treatment of lysosomal storage disorders
WO2011076507A1 (en) 2009-12-23 2011-06-30 Ismeca Semiconductor Holding Sa Wafer handler comprising a vision system
US20110158962A1 (en) 2008-06-26 2011-06-30 Federico Ferro Dental pulp marrow similar cells (dpmsc) and methods of isolating and using
US8192987B2 (en) 2002-02-06 2012-06-05 Tissuedent Gmbh & Co. Kg Human dental follicle stem cells and methods for obtaining
US8481308B2 (en) 2010-07-01 2013-07-09 Regenerative Research Foundation Methods for culturing undifferentiated cells using sustained release compositions

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001076507A2 (en) 2000-04-11 2001-10-18 The University Of Miami Use of oxygen carriers to improve grafted cell survival in neural transplantation
AUPR540301A0 (en) * 2001-06-01 2001-06-28 Walter And Eliza Hall Institute Of Medical Research, The A method of purification of cells
US7323334B2 (en) * 2002-10-04 2008-01-29 The Regents Of The University Of California Screening and therapeutic methods relating to neurogenesis
US7597885B2 (en) 2004-03-26 2009-10-06 Aderans Research Institute, Inc. Tissue engineered biomimetic hair follicle graft
EP1705245B1 (en) * 2005-03-23 2009-05-20 Stiftung CAESAR Neural stem cells
WO2007035843A2 (en) 2005-09-21 2007-03-29 Dask Technologies, Llc Methods and compositions for organ and tissue functionality
EP1987135A2 (en) 2006-01-27 2008-11-05 Auxocell Laboratories, Inc. Methods and compositions relating to stem cell transplantation
WO2008080200A1 (en) 2006-12-29 2008-07-10 Irina Kerkis Process for obtaining stem cells
JP5408578B2 (ja) 2007-12-05 2014-02-05 国立大学法人名古屋大学 歯髄幹細胞を用いた自家又は同種移植用組成物及びその用途
US20120219531A1 (en) 2008-03-17 2012-08-30 Agency For Science, Technology And Research Microcarriers for Stem Cell Culture
WO2010013845A1 (en) 2008-07-30 2010-02-04 Kyoto University Method of efficiently establishing induced pluripotent stem cells
SG10201807935SA (en) * 2008-09-04 2018-10-30 Abt Holding Co Use of stem cells to prevent neuronal dieback
US7847353B2 (en) * 2008-12-05 2010-12-07 Bae Systems Information And Electronic Systems Integration Inc. Multi-thickness semiconductor with fully depleted devices and photonic integration
US20100297094A1 (en) 2009-01-30 2010-11-25 Harlan John M Therapy or prevention of diseases with cells or cell supernatant
ES2360434B1 (es) * 2009-07-21 2012-04-12 Universitat Internacional De Catalunya Celulas madre pluripotenciales obtenidas a partir de la pulpa dental.
US20120009601A1 (en) 2010-07-08 2012-01-12 The General Hospital Corporation Methods and compositions for reprogramming cells
WO2012020687A1 (en) 2010-08-13 2012-02-16 Kyoto University Method of inducing differentiation from pluripotent stem cells to germ cells
BR102013021202B1 (pt) 2013-08-20 2022-09-06 Ccb - Centro De Criogenia Brasil Ltda Processo de produção de células tronco multipotentes e progenitores

Patent Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5650148A (en) 1988-12-15 1997-07-22 The Regents Of The University Of California Method of grafting genetically modified cells to treat defects, disease or damage of the central nervous system
US5762926A (en) 1988-12-15 1998-06-09 The Regents Of The University Of California Method of grafting genetically modified cells to treat defects, disease or damage of the central nervous system
US5082670A (en) 1988-12-15 1992-01-21 The Regents Of The University Of California Method of grafting genetically modified cells to treat defects, disease or damage or the central nervous system
US5817773A (en) 1990-06-08 1998-10-06 New York University Stimulation, production, culturing and transplantation of stem cells by fibroblast growth factors
US5928947A (en) 1992-07-27 1999-07-27 California Institute Of Technology Mammalian multipotent neural stem cells
US7927587B2 (en) 1999-08-05 2011-04-19 Regents Of The University Of Minnesota MAPC administration for the treatment of lysosomal storage disorders
WO2001060981A1 (en) 2000-02-18 2001-08-23 King's College London Tooth progenitor cell and method for its production
WO2002007679A2 (en) 2000-07-21 2002-01-31 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Adult human dental pulp stem cells in vitro and in vivo
US20020119180A1 (en) 2000-11-29 2002-08-29 President And Fellows Of Harvard College Methods and compositions for culturing a biological tooth
US20030148513A1 (en) 2002-01-14 2003-08-07 Kiminobu Sugaya Novel mammalian multipotent neural stem cells and compositions, methods of preparation and methods of administration thereof
US20030219898A1 (en) 2002-01-14 2003-11-27 Kiminobu Sugaya Novel mammalian multipotent stem cells and compositions, methods of preparation and methods of administration thereof
US8192987B2 (en) 2002-02-06 2012-06-05 Tissuedent Gmbh & Co. Kg Human dental follicle stem cells and methods for obtaining
US20110158962A1 (en) 2008-06-26 2011-06-30 Federico Ferro Dental pulp marrow similar cells (dpmsc) and methods of isolating and using
WO2011076507A1 (en) 2009-12-23 2011-06-30 Ismeca Semiconductor Holding Sa Wafer handler comprising a vision system
US8481308B2 (en) 2010-07-01 2013-07-09 Regenerative Research Foundation Methods for culturing undifferentiated cells using sustained release compositions

Non-Patent Citations (39)

* Cited by examiner, † Cited by third party
Title
ARTHUR ET AL.: "Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues", STEM CELLS, vol. 26, 2008, pages 1787 - 1795
BAXTER MA ET AL.: "Study of telomere length reveals rapid aging of human marrow stromal cells following in vitro expansion", STEM CELLS, vol. 22, 2004, pages 675 - 682
CAPLAN AI: "Why are MSCs therapeutic? New data: new insight", J PATHOL., vol. 217, 2009, pages 318 - 324
CIMADAMORE FFISHWICK KGIUSTO EGNEDEVA KCATTAROSSI GMILLER APLUCHINO SBRILL LMBRONNER-FRASER MTERSKIKH AV: "Human ESC-derived neural crest model reveals a key role for SOX2 in sensory neurogenesis", CELL STEM CELL, vol. 8, no. 5, 6 May 2011 (2011-05-06), pages 538 - 51, XP028350001, DOI: 10.1016/j.stem.2011.03.011
DAVIE, N.L. ET AL.: "Streamlining Cell Therapy Manufacture from Clinical to Commercial Scale", BIOPROCESS INERNATIONAL, vol. 10, no. 3, 2012, pages 24 - 29
ERDAL KARAOZ ET AL., HISTOCHEMISTRY AND CELL BIOLOGY, vol. 136, no. 4, 2011, pages 455 - 473
EVANS, M.KAUFMAN, M.: "Establishment in culture of pluripotent cells from mouse embryos", NATURE, vol. 292, 1981, pages 154 - 6, XP000941713, DOI: 10.1038/292154a0
EXP HEMATOL, vol. 2, pages 83 - 92
GIORDANO G ET AL.: "Stem cells from oral niches: a review", ANN STOMATOL, vol. 2, 2011, pages 3 - 8
GRONTHOS ET AL.: "Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo", PROCEEDINGS OF THE NATIOAL ACADEMY OF SCIENCES OF USA, vol. 97, no. 25, 2000, pages 13625 - 30, XP002201506, DOI: 10.1073/pnas.240309797
HANDA ET AL.: "Progenitor cells from dental follicle are able to form cemetum matrix in vivo", CONNECTIVE TISSUE RESEARCH, vol. 43, no. 2-3, 2002, pages 406 - 408, XP009008973
HARADA ET AL.: "Localization of putative stem cells in dental epithelium and their association with Notch and FGF signaling", JOURNAL OF CELL BIOLOGY, vol. 147, no. 1, 1999, pages 105 - 20, XP002237265, DOI: 10.1083/jcb.147.1.105
IVANONA ET AL., NATURE, vol. 442, 2006, pages 5330538
KANDASAMY MCOUILLARD-DESPRES SRABER KASTEPHAN MLEHNER BWINNER BKOHL ZRIVERA FJNGUYEN HPRIESS O: "Stem cell quiescence in the hippocampal neurogenic niche is associated with elevated transforming growth factor-beta signaling in an animal model of Huntington disease", J NEUROPATHOL EXP NEUROL, vol. 69, no. 7, July 2010 (2010-07-01), pages 717 - 28
KEMPERMANN G: "The pessimist's and optimist's views of adult neurogenesis", CELL, vol. 145, no. 7, 24 June 2011 (2011-06-24), pages 1009 - 11, XP028230589, DOI: 10.1016/j.cell.2011.06.011
KEMPERMANN GGAST DKRONENBERG GYAMAGUCHI MGAGE FH: "Early determination and long-term persistence of adult-generated new neurons in the hippocampus of mice", DEVELOPMENT, vol. 130, no. 2, January 2003 (2003-01-01), pages 391 - 9, XP002315758, DOI: 10.1242/dev.00203
KERKIS ET AL.: "Isolation and characterization of a population of immature dental pulp stem cells expressing OCT-4 and other embryonic stem cell markers", CELLS TISSUES ORGANS, vol. 184, 2006, pages 105 - 116, XP009088212, DOI: 10.1159/000099617
KERKIS IRINA ET AL., CELLS TISSUE ORGANS, vol. 184, no. 3-4, 2006, pages 105 - 116
KERKIS IRINA ET AL., TISSUE ENGINEERING PART B-REVIEWS, vol. 18, no. 2, 2012, pages 129 - 138
KOMITOVA MERIKSSON PS: "Sox-2 is expressed by neural progenitors and astroglia in the adult rat brain", NEUROSCI. LETT., vol. 369, no. 1, 2004, pages 24, XP004565967, DOI: 10.1016/j.neulet.2004.07.035
KREBSBACH ET AL.: "Dental and skeletal stem cells: potential cellular therapeutics for craniofacial regeneration", JOURNAL OF DENTAL EDUCATION, vol. 66, no. 6, 2002, pages 766 - 73, XP001147187
KUEHLE, I.GOODELL, M .A.: "The therapeutic potential of stem cells from adults", B.M.J., vol. 325, 2002, pages 372 - 376
LING, V.NEBEN, S.: "In vitro differentiation of embryonic stem cells: immunophenotypic analysis of cultured embryoid bodies", J. CELL PHYSIOL., vol. 171, 1997, pages 104 - 5, XP002964187, DOI: 10.1002/(SICI)1097-4652(199704)171:1<104::AID-JCP12>3.0.CO;2-G
LIZIER ET AL., PLOS ONE, vol. 7, 2012, pages e39885
MOLERO AEGOKHAN SGONZALEZ SFEIG JLALEXANDRE LCMEHLER MF: "Impairment of developmental stem cell-mediated striatal neurogenesis and pluripotency genes in a knock-in model of Huntington's disease", PROC NATL ACAD SCI USA, vol. 106, no. 51, 22 December 2009 (2009-12-22), pages 21900 - 5
NAKASHIMA ET AL.: "Induction of dental pulp stem cell differentiation into odontoblasts by electroporation-mediated gene delivery of growth/differentiation fadctor 11 (Gdfll", GENE THERAPY, vol. 9, no. 12, 2002, pages 814 - 18
NELSON F. LIZIER ET AL., PLOS ONE, vol. 7, no. 6, 2012, pages e39885
NOBLE MMAYER-PROSCHEL MDAVIES JEDAVIES SJPROSCHEL C: "Cell therapies for the central nervous system: how do we identify the best candidates?", CURR OPIN NEUROL, vol. 24, no. 6, December 2011 (2011-12-01), pages 570 - 6
PANCHISION DM: "The role of oxygen in regulating neural stem cells in development and disease", J CELL PHYSIOL, vol. 220, no. 3, September 2009 (2009-09-01), pages 562 - 8
PEVNY LHSOCKANATHAN SPLACZEK MLOVELL-BADGE R: "A role for SOX1 in neural determination", DEVELOPMENT, vol. 125, no. 10, May 1998 (1998-05-01), pages 1967 - 78, XP002998439
PITTENGER, M.F.MARTIN, BJ.: "and mesenchymal stem cells and their potential as cardiac therapeutics", CIRC. RES., vol. 95, 2004, pages 9 - 20, XP002348585, DOI: 10.1161/01.RES.0000135902.99383.6f
ROGERS MLBEARE AZOLA HRUSH RA: "CD 271 (P75 neurotrophin receptor)", J BIOL REGUL HOMEOST AGENTS, vol. 22, no. 1, January 2008 (2008-01-01), pages 1 - 6
SAKAKIBARA AANDO RSAPIR TTANAKA T: "Microtubule dynamics in neuronal morphogenesis", OPEN BIOL, vol. 3, no. 7, 17 July 2013 (2013-07-17), pages 130061
SASAKI SSHIONOYA AISHIDA MGAMBELLO MJYINGLING JWYNSHAW-BORIS AHIROTSUNE S: "A LISl/NUDEL/cytoplasmic dynein heavy chain complex in the developing and adult nervous system", NEURON, vol. 28, no. 3, December 2000 (2000-12-01), pages 681 - 96, XP002304791, DOI: 10.1016/S0896-6273(00)00146-X
SELYE HBAJUSZ EGRASSOS SMENDELL P: "Simple techniques for the surgery occlusion of coronary vessels in the rat", ANGIOLOGY, vol. 11, 1960, pages 398 - 407
SHI ET AL.: "Comparison of human dental pulp and bone marrow stromal stem cells by cDNA microarray analysis", BONE, vol. 29, no. 6, 2001, pages 532 - 39, XP002237266, DOI: 10.1016/S8756-3282(01)00612-3
WAGNER W ET AL.: "Aging and replicative senescence have related effects on human stem and progenitor cells", PLOS ONE, vol. 4, 2009, pages e5846
WANG YET: "An increase in telomere sister chromatid exchange in murine embryonic stem cells possessing critically shortened telomeres", PROC NATL ACAD SCI USA, vol. 102, no. 29, 19 July 2005 (2005-07-19), pages 10256 - 60
ZAPPONE, M. V ET AL.: "Sox2 regulatory sequences direct expression of a (beta)-geo transgene to telencephalic neural stem cells and precursors of the mouse embryo, revealing regionalization of gene expression in CNS stem cells", DEVELOPMENT, vol. 127, 2000, pages 2367 - 2382

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017529068A (ja) * 2014-08-14 2017-10-05 アヴィタ・インターナショナル・リミテッド 幹細胞組成物および療法適用のための幹細胞を産生する方法
WO2019213256A1 (en) * 2018-05-02 2019-11-07 Morse Leslie Dental pulp stem cells and uses thereof
CN119868281A (zh) * 2025-03-28 2025-04-25 新北辰(湖北)生物科技集团有限公司 一种含有牙髓干细胞的修复注射制剂及其制备方法

Also Published As

Publication number Publication date
US12480095B2 (en) 2025-11-25
IL280850B2 (en) 2023-10-01
JP2016517405A (ja) 2016-06-16
EP4095233A1 (en) 2022-11-30
BR102014006335B8 (pt) 2022-05-03
BR102014006335B1 (pt) 2022-04-19
US9790468B2 (en) 2017-10-17
US20200339954A1 (en) 2020-10-29
JP6491606B2 (ja) 2019-03-27
US20150050248A1 (en) 2015-02-19
HK1219506A1 (en) 2017-04-07
JP6920363B2 (ja) 2021-08-18
US20180187158A1 (en) 2018-07-05
IL280850B1 (en) 2023-06-01
WO2014141210A3 (en) 2015-04-30
US20230313143A1 (en) 2023-10-05
IL241470B (en) 2021-02-28
EP2970880A4 (en) 2016-08-17
CA2904804A1 (en) 2014-09-18
BR102014006335A2 (pt) 2016-06-07
IL280850A (en) 2021-04-29
IL241470A0 (en) 2015-11-30
EP2970880A2 (en) 2016-01-20
JP2019116490A (ja) 2019-07-18
EP2970880B1 (en) 2022-05-04

Similar Documents

Publication Publication Date Title
US12480095B2 (en) Multifunctional immature dental pulp stem cells and therapeutic applications
JP4950661B2 (ja) 分娩後由来細胞類を使用する、神経組織の再生および修復
US9795637B1 (en) Human cord blood as a source of neural tissue repair of the brain and spinal cord
US9399758B2 (en) SSEA3(+) pluripotent stem cell that can be isolated from body tissue
JP6000982B2 (ja) 臍由来細胞を使用する筋萎縮性側索硬化症の治療
AU2001243464A1 (en) Human cord blood as a source of neural tissue for repair of the brain and spinal cord
JPH09507383A (ja) 卵黄嚢幹細胞およびその使用
WO2012133948A1 (ja) 生体組織から単離できるssea-3陽性の多能性幹細胞を含む他家移植用細胞治療用組成物
KR20180115657A (ko) 개과동물 양막-유래 다분화능 줄기세포
WO2021201286A1 (ja) ハイポテンシャル多能性幹細胞
WO2012133942A1 (ja) 生体の臍帯又は脂肪組織から単離できる多能性幹細胞
KR20120006386A (ko) 1기 태반조직 유래 줄기세포 및 이를 함유하는 세포치료제
HK40082342A (en) Multifunctional immature dental pulp stem cells and therapeutic applications
HK1219506B (en) Multifunctional immature dental pulp stem cells and therapeutic applications
WO2019216380A1 (ja) 脊髄損傷の治療剤
Siddiqui et al. Stem Cells
Packthongsuk Detection of porcine umbilical cord matrix stem cells in the intestine and other organs after oral and intraperitoneal administration to allogeneic recipients

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14765285

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2904804

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 241470

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2015562539

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2014765285

Country of ref document: EP

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14765285

Country of ref document: EP

Kind code of ref document: A2