WO2014096421A1 - Probability-directed isolation of nucleotide sequences (pins) - Google Patents
Probability-directed isolation of nucleotide sequences (pins) Download PDFInfo
- Publication number
- WO2014096421A1 WO2014096421A1 PCT/EP2013/077844 EP2013077844W WO2014096421A1 WO 2014096421 A1 WO2014096421 A1 WO 2014096421A1 EP 2013077844 W EP2013077844 W EP 2013077844W WO 2014096421 A1 WO2014096421 A1 WO 2014096421A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sample
- dna molecule
- target dna
- pcr
- pins
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Definitions
- the invention relates to a method for isolating a complex nucleotide fragment comprising a known nucleotide sequence element, i.e. a sequence encoding a conserved active site or domain, the method being applicable i.e. to high throughput screening for DNA fragments containing a known sequence element.
- PCR tests have been extensively developed for routine diagnostics of infectious diseases in clinical microbiology.
- PCR is suited for rapid detection of bacteria directly in clinical specimens, allowing early, sensitive and specific laboratory confirmation of related diseases [1].
- it allows a rapid assessment of the presence of antibiotic resistance genes or gene mutations.
- An approach combining pathogen detection, their mechanisms of antibiotic resistance, their virulence factors and bacterial load in clinical samples could lead to profound changes in the care of these infected patients. Therefore, complex and multiplex PCR assays are currently being developed to enhance the field of molecular diagnostics.
- PCR based diagnoses from mixed samples are often associated with challenges, as the presence of PCR products can arise from more than one DNA source in mixed complex samples.
- the presence of a specific antibiotic gene combined with the presence of specific bacterial strain does not necessarily mean that a resistant bacterial strain was present in the original sample. It only indicates that both a resistance gene and the bacterial strain were present in the sample, not necessarily that they arise from the same cell.
- Approaches to circumvent this problem have been suggested where the integration site of the antibiotic resistance gene was targeted by specific primers also known to target a specific bacterial strain. However, the exact integration site will then need to be known and this limits the use of the method.
- Metagenomics refers to a general sequencing approach, where a complex mixture of DNA is differentiated into small fractions and sequenced individually.
- the system does not rely on culturability and is, thus, applicable for both samples that can and cannot be cultivated in a laboratory.
- Targeted enrichment of DNA fragments encoding industrially relevant proteins or enzymes would substantially decrease the required amount of sequencing.
- the present invention provides in vitro method for enriching and/or isolating a target DNA molecule from a mixed polynucleotide sample comprising the steps: a) providing a mixed polynucleotide sample containing said target DNA molecule, wherein said target DNA molecule comprises one or more unique consecutive sequence of at least 10 nucleotides,
- step (d) detecting the presence or absence of said target DNA molecule in said replicate dilution samples amplified in step (d), wherein the frequency of said target DNA molecule in said replicate dilution sample is increased compared to the mixed polynucleotide sample in step (a); f) serially diluting at least one replicate dilution sample containing said DNA molecule until the probability of detecting said target DNA molecule in a diluted sample is less than 0.75, and repeating steps (c) to (e) or (f) at least once.
- the figure shows a 2% agarose gel of nine negative PCR reactions from the initial mixture.
- the boxed area indicates where a positive PCR product would be present in the gel.
- the PCR products outside the box are unspecific products and are disregarded in this context.
- FIG. 1 The figure shows a 2% agarose gel of ten PCR samples after the first round of PINS.
- Five Samples (A, B, C, D, & I) contain PCR products of the expected size whereas the remaining five samples do not.
- the correct product size is arrowed in the gel (left).
- the PCR products in other locations (not arrowed) are unspecific products and are disregarded in this context.
- Figure 3
- the figure shows a 2% agarose gel of ten PCR samples following the re- amplification of sample # 10.
- Six samples (A, C, E, F, I, & J) contain PCR products of the expected size whereas the remaining four samples do not.
- the correct product size is arrowed in the gel (left).
- the PCR products in other locations (not arrowed) are unspecific products and are disregarded in this context.
- the figure shows a 2% agarose gel of ten PCR samples after the second round of PINS using 2E-1 dilution prior to PCR.
- Five samples (C, D, E, G, & I) contain PCR products of the expected size whereas the remaining four samples do not.
- the correct product size is arrowed in the gel (left).
- the PCR products in other locations (not arrowed) are unspecific products and are disregarded in this context.
- the figure shows a schematic illustration of two rounds of PINS with the following parameters:
- A The initial sample - with 0,028 ng/ ⁇ .
- B 10 Phi samples, created from A, using 3.5 ⁇ "A" as template.
- K Gain, calculated from first round of PINS to second round of PINS, using comparison at different dilutions.
- Figure 6 The figure shows a 2% agarose gel of ten negative PCR reactions generated from an initial mixed polynucleotide sample comprising the target HPV18-DNA molecule.
- the boxed area indicates where a positive PCR product would be present in the gel.
- the PCR products outside the box are unspecific products and are disregarded in this context.
- Figure 7 The figure shows a 2% agarose gel of the products of three PCR designed to detect the presence of the target HPV18-DNA molecule.
- Lane # 1 is a positive control PCR reaction;
- lane #2 is the PCR product of the PINS (MDA- mediate) enriched mixed polynucleotide sample containing 2.5 target copies/ ⁇ ; and
- lane #3 is a negative PCR control.
- the arrow indicates the relative mobility of a DNA molecule of -667 bp in the agarose gel.
- Figure 8 The figure shows a 2% agarose gel of the PCR product obtained by re-amplification of the target HPV18-DNA molecule shown in Figure 7.
- the arrow indicates the relative mobility of a DNA molecule of -667 bp in the agarose gel
- Figure 9 Alignment of the retrieved sequences for the PINS enriched target HPV18-DNA molecule with HPV18 sequence (HPU89349), showing that the sequence is perfectly aligned with zero mismatches.
- FIG. 11 The figure illustrates the nucleotide sequence of a gene encoding endoglucanase enriched by PINS. Restriction sites (Mbol, EcoRl, and Hindlll) used for RGW are inserted in boxes. -35 & -10 illustrates the position of the putative promoter location and SD is the position of the ShineDalgarno. EndoGlu-Fw & EndoGlu-Re are the primers used during PINS. ORF indicates the position of the open reading frame.
- the present invention pertains to an in vitro method in which the frequency of the targeted nucleotide sequence containing the DNA fragment of interest is increased stepwise, by several rounds of 1) dilution of a sample containing the DNA fragment of interest in several replicates (separation), 2) randomly amplifying DNA in the replicates (concentration), 3) detecting the DNA fragment of interest in at least one of the diluted and amplified replicates (selection) and repeating steps 1) through 3) until the DNA fragment of interest can be sequenced by standard sequencing techniques.
- the invention is based on the principle that if a selected DNA fragment of interest, present in a mixed sample, is located at a dilution where the probability of finding it is small, the frequency of the DNA fragment of interest will be higher at that dilution than in the mixed sample, and its frequency can be further increased by rounds of selection (as above), until it can be sequenced by standard methods such as Sanger sequencing or Pyro sequencing or similar detection of DNA sequence or by PCR, hybridization or other detection assays.
- the method of the invention is surprisingly efficient, whereby the extent of screening can be reduced from screening of hundreds of thousands of clones in a clone library according to traditional screening methods [ 17], to screening less than a few hundred DNA samples (Table 1).
- a sample of mixed polynucleotides comprising a target DNA molecule A sample of mixed polynucleotides known to comprise a target DNA molecule, is selected for performing PINS.
- One or more nucleotide sequences of at least 10 (or 15) unique nucleotides located within the target DNA molecule is selected for screening and detecting the DNA molecule by a desired method, such as PCR detection, DNA detection with hybridization probes or similar.
- the frequency of the target DNA molecule sample of mixed polynucleotides is less than 10 "2 , it may for example lie between 10 3 and 10 "7 .
- the mixed polynucleotide sample is serially diluted by a desired number of dilutions until the probability of detecting the target DNA molecule in a diluted sample is less than 0.75, (this sample is designated dilution (N)).
- Serial dilutions preferably have a dilution factor of greater than 1 : 1, preferably between 1 : 2 to 1 : 20, e.g., 1 : 10.
- Each diluted sample is placed in a separate container, such as a well in a microtiter plate, a plastic tube or similar.
- sample (N) in the dilution series in which the probability of detecting the target DNA molecule is less than 0.75.
- the serial dilutions of the mixed polynucleotide sample may be amplified to increase the abundance of the DNA in each sample, followed by the step of detecting the presence or absence of said target
- DNA molecule in each amplified sample The most dilute sample within the dilution series in which the target DNA molecule can be detected is designated "P".
- the next dilution in the dilution series, designated "N" is the least diluted sample in the dilution series where the target DNA molecule cannot be detected.
- the dilution factor of "N" relative to the DNA sample in a) is designated Dt, and the dilution factor between P and N is designated, D.
- the frequency and abundance of the target DNA molecule in the mixed polynucleotide sample may be determined by real time PCR, from which the dilution required to prepare sample (N) can be calculated (see example 1).
- the target DNA molecule may be detected by hybridization based assays or by assays detecting an RNA or protein product of the target sequence. c) Creating replicate dilution samples having dilution N
- a sufficient number of replicates of the diluted sample (N) are generated until the probability of detecting the target DNA molecule in at least one of the replicate dilution samples is one.
- a suitable number of replicates lies between 2 and 500, preferably at least 10 - 20 replicates.
- a suitable number of replicates will correspond to the dilution factor used to create the dilution series, i.e. if the dilution factor is 1 : 10, then about 10 replicates should be sufficient.
- Each diluted sample is placed in a separate container, such as a well in a microtiter plate, a plastic tube or similar.
- DNA in each replicated diluted sample is amplified using any method of total DNA amplification to increase the abundance of the DNA in each sample. Suitable amplification methods including Degenerate
- the replicate samples (N) following genome amplification in step d) are screened for the presence of the target DNA molecule using the desired detection technigue.
- the freguency of the target DNA molecule will be increased compared to its freguency in the mixed polynucleotide sample in step (a).
- steps (c) to (e) are repeated at least once, preferably until the target DNA molecule has been amplified to an extent where the nucleotide sequence of the target DNA molecule or parts thereof can be readily sequenced, as described below in f).
- the number of repetitions of steps (c) to (e) is generally at least 1, but is more likely to require 2, 3, 4, 5 or 6 or more repetitions, whereby the eventual frequency reached of the target DNA molecule is greater than 10 3 , preferably greater than 10 "1 .
- Characterization of the enriched target DNA molecule is generally at least 1, but is more likely to require 2, 3, 4, 5 or 6 or more repetitions, whereby the eventual frequency reached of the target DNA molecule is greater than 10 3 , preferably greater than 10 "1 .
- the DNA can be subjected to direct DNA sequencing. Sequencing of the target DNA molecule; both the PCR amplified target DNA fragment used for detection and the nucleotide sequences flanking the 5' and 3' direction of the target DNA fragment, is implemented using the desired DNA sequencing method, such as Sanger sequencing, pyro sequencing or similar methods.
- PINS can be adapted to perform multiplex PINS.
- Multiplex PINS employs additional features that are designed to detect a 2nd consecutive sequence of at least 10 (or 15) nucleotides in the sample of mixed polynucleotides analysed, by amplification of this 2nd consecutive sequence with sequence specific primers to generate a 2nd target DNA fragment. If the 1st and 2nd consecutive sequence co-purify, at each cycle of PINS, then they must be located on the same MDA- amplified target DNA molecule.
- PINS may be applied to a sample of mixed polynucleotides known to comprise a target DNA molecule.
- a sample of mixed polynucleotides comprises a population of DNA molecules (e.g. chromosomal DNA molecules or plasmid DNA molecules) where the individual DNA molecules within the population differ with respect to a known consecutive sequence of at least 10 (or 15) nucleic acid base pairs in their DNA, such that a target molecule comprising the known consecutive sequence differs from and can be distinguished from non-target molecules in the sample.
- the sample of mixed polynucleotides may additionally comprise single stranded RNA or DNA polynucleotides.
- the population of DNA molecules in the sample of mixed polynucleotides comprises the target DNA molecule.
- a target DNA molecule comprises one or more known consecutive sequence of at least 10 (or 15) unique nucleic acid base pairs (or nucleotides).
- a target DNA molecule can be selected from a sample of mixed polynucleotides, by selecting for a target DNA molecule comprising this consecutive sequence of at least 10 nucleic acid base pairs (or nucleotides).
- the target DNA molecule can also be selected from the sample of mixed polynucleotides, by selecting for a target DNA molecule comprising at least two consecutive sequences of at least 10 (or 15) nucleic acid base pairs (or nucleotides), wherein the two consecutive sequences are comprised within a DNA molecule of 50 to 100,000 nucleic acid base pairs, preferably 150 to 3,000 nucleic acid base pairs, more preferably 150 to 1500 nucleic acid base pairs.
- the method of the invention is particularly suitable where the frequency of the target DNA molecule in the sample of mixed polynucleotides is less than 10 3 .
- the method of the invention is also suitable where the frequency of the target DNA molecule in the sample of mixed polynucleotides is 10 "4 , 10 "5 , 10 "6 , 10 "7 , or lower.
- the sample of mixed polynucleotides will be derived from a cell population comprising genomic DNA, while in other instances, the sample may be derived from samples where the polynucleotides are of diverse origin, such as samples collected from nature.
- the frequency of the target DNA molecule is defined as the number of genomes or genome equivalents containing the target DNA divided by the number of total genome equivalents.
- the frequency of the target DNA molecule in the sample of mixed polynucleotides is determined by making a dilution series in triplicate, detecting the presence or absence of target and determining the number of targets using, for instance, most probable number methods.
- the concentration of DNA is measured and the number of total genome equivalents is determined by dividing this concentration by the average molecular weight of the genome.
- the target DNA molecule is derived from the genome of a cell, where the genome may be either chromosomal or extrachromosomal DNA. Further, the target DNA molecule may be derived from a cell, where the cell is selected from amongst a microbial cell, a plant cell, an animal cell, or a mammalian cell.
- the mammalian cell may be a human cell.
- the microbial cell may be a bacterial cell, a yeast cell or a fungal cell.
- target DNA molecule may be derived from a fungal mycelium or fungal spores.
- the cell(s) may be part of a multicellular tissue or multicellular organism.
- the target DNA molecule may be derived from one or more viral particles, where the virus has an RNA or DNA genome.
- the target DNA molecule may be derived from a host genome comprising integrated DNA derived from a virus.
- the target DNA molecule may also be derived from a bacteriophage.
- the target DNA or RNA molecule is present in a sample of mixed polynucleotides, where the mixed polynucleotides may be derived from a sample collected from nature, for example a sample of soil, water or air.
- the sample may be derived from a multicellular organism, such as a mammal, for example an animal or a human subject.
- the sample for example a biopsy
- the sample may be derived from a body fluid (e.g. blood, plasma, serum, lymph and urine), from faeces or from a body tissue or organ.
- the multicellular organism from which the sample is derived may be a living or may be a dead organism.
- the sample of mixed polynucleotides comprising the target DNA molecule may be prepared from a sample collected from nature or from an organism (e.g. a biopsy). Methods for selective extraction of polynucleotides comprising DNA or RNA are known in the art [5].
- the step of cell disruption or cell permeabilisation is normally required in order to release total nucleic acid molecules (including DNA or RNA) from a cell, this step preceeding the subsequent step of selective extraction of
- polynucleotides comprising DNA or RNA.
- the target DNA molecule is derived from an RNA genome
- the RNA genome or parts thereof are first reverse transcribed to provide a cDNA molecule, where the nucleotide sequence of the cDNA corresponds to (is a reverse transcript of) the RNA genome.
- MDA Degenerate Oligonucleotide Primed (DOP) PCR and Multiple Displacement Amplification (MDA).
- DOP Oligonucleotide Primed
- MDA Multiple Displacement Amplification
- WGA whole-genome amplification
- MDA generates DNA molecules with a higher molecular weight, having better genome coverage.
- MDA employs a strand displacement polymerase that possesses two enzymatic activities: DNA synthesis (polymerase) and an exonucleolytic activity that degrades single stranded DNA in the 3'- to 5'-direction, as exemplified by bacteriophage phi29 DNA
- Isolation of the target DNA molecule by PINS is based on detection of one or more unique consecutive sequence of at least 15 nucleotides in said DNA molecule.
- detection is based on PCR, where the one or more unique consecutive sequences are amplified to generate a target DNA fragment, the nucleotide sequence of this fragment can be determined.
- the nucleotide sequences flanking the target DNA fragment in the 5' and 3' direction can be determined by rapid genome walking (RGW)[7] .
- RGW is a simple, PCR- based method for determining sequences upstream or downstream in a larger DNA molecule starting from a known sequence, such as a target DNA fragment.
- RGW enables individual amplification of up to 6 kb in a large DNA molecule using PCR.
- the sequences can be extended simply by taking multiple cycles of RGW, using new primers based on the sequence obtained in previous cycles.
- libraries are constructed from a purified sample of the large target DNA molecule, by digesting the DNA separately with four different restriction enzymes and ligating the products to a specially designed adaptor.
- the ligated DNA is then sequenced with primers annealing to the adaptors or to known sequences within the DNA, using the desired DNA sequencing method, such as Sanger sequencing, pyro sequencing, sequencing by synthesis, ligation or two base- coding sequencing or similar methods [8].
- PINS i Research and development applications of PINS and Multiplex PINS Use of PINS to isolate or enrich target DNA in mixed polynucleotide samples extracted from samples collected from nature, provides direct access to the genome, or parts thereof, of microorganisms that exist in nature and that frequently cannot be obtained as axenic cultures.
- PINS is particularly useful for isolating or enriching DNA encoding enzymes involved in producing chemical building blocks or active agents such as:
- acids such as maleic-, aspartic-, malonic-, propionic-, succinic-, fumaric-, citric-, acetic-, glutamic-, itaconic-, levulinic-, acotinic-, glucaric-, gluconic-, and lactic-acid
- amino acids such as serine, lysine, threonine
- antibiotics e.g. peptide-polyketides; lactam
- PINS is particularly useful for isolation or enrichment of target DNA encoding enzymes selected among an oxidoreductase, transferase, hydrolase, lyase, isomerase or ligase.
- Multiplex PINS is particularly useful for isolation or enrichment of target DNA comprising an operon of two or more open reading frames encoding two or more enzymes, where the enzymes may be part of a multifunctional enzyme complex, as the technique can take advantage of high fidelity of polymerases (like Phi29) in the MDA amplification to generate large amplified DNA fragments of up to 100000 bp.
- PINS or Multiplex PINS may be used to analyse target DNA in samples derived from multicellular organisms, such as biopsy or sample of body fluid or faeces obtained from a subject (e.g. human or animal subject), for the diagnosis or monitoring the progress of a medical indication or disease.
- samples derived from multicellular organisms such as biopsy or sample of body fluid or faeces obtained from a subject (e.g. human or animal subject)
- a subject e.g. human or animal subject
- Diagnosis of a wide range of medical indications in a subject such as a disease caused by an infectious agent (e.g. micro-organism or virus) can be assisted by the isolation or enrichment and detection of a target DNA or RNA molecule that is derived from the genome of the infectious agent by PINS or Multiplex PINS, where the target DNA molecule is detected in a sample of mixed polynucleotides derived from a biopsy or sample of body fluid obtained from a patient.
- infectious agent e.g. micro-organism or virus
- multiplex PINS in target DNA molecule isolation provides the additional feature, that additional diagnostic features of the disease can be determined.
- the genome of the infectious agent comprises resistance genes that confer resistance to certain therapeutic agents
- co-enrichment of a resistance gene and a sequence describing the infectious agent in the PINS procedure will indicate that the infectious agent is carrying the resistance gene.
- PINS or Multiplex PINS may also be used to assist diagnosis of a disease caused by, or originating from the presence of a viral agent in a subject.
- the presence and/or chromosomal integration of DNA that is derived from a viral genome, in a biopsy or sample of body fluid obtained from a patient can be detected by PINS by sequencing the entire DNA fragment comprising the viral DNA sequence.
- Using multiplex PINS the presence or absence of viral DNA at a known integration site can be determined by tracking the co-enrichment of the viral DNA and integration site DNA sequence. VII PINS and bias in amplification
- PINS is based on specifically selecting samples where amplification of a desired DNA region from a complex, mixed DNA sample has occurred.
- Phi29 based amplification MDA
- MDA Phi29 based amplification
- Pan et al. [ 18] states in general terms that a highly specific whole genome amplification (WGA) of complex DNA pools which avoids amplification bias remains a challenge.
- WGA whole genome amplification
- the challenge of TIP/bias is not seen when applying the PINS technique even though the initial concentration of the target DNA molecule is very low.
- the minimal negative TIP/bias observed in the PINS system is significantly lower than the overall gain obtained from the amplification process and the net result is therefore a substantial enrichment of the target DNA molecule with each cycle.
- the method does not require a dilute initial DNA template, as high
- concentrations of DNA also can efficiently be subjected to PINS. In this case only a few fold amplification by the WGA method is needed.
- Enzymes and reagents If not stated otherwise enzymes were supplied by MBI Fermentas (Germany) and used according to the suppliers recommendations. Amplification and detection methods: If not stated otherwise, the following procedures and conditions were employed for DNA fragment amplification by PCR; genome amplification by MDA; and extension of DNA fragment into flanking regions using RGW. The target DNA fragment was detected by 2% agarose gel electrophoresis. PCR amplification:
- PCR reactions were: carried out in 20 ⁇ reactions by mixing : nuclease free water (7 ⁇ ), 10 ⁇ 2x SSO Advance Sybr TR-Mixture (BioRad), 5 ⁇ fw-primer (1 ⁇ ), 6 ⁇ Re-primer (1 ⁇ ), with 1 ⁇ I DNA template.
- the composition of the 2x SSO Advance Sybr TR-Mixture is: dNTPs, Sso7d fusion polymerase, MgCI2, SYBR® Green I, and stabilizers.
- PCR amplification conditions were (15sec/15sec/15sec) x2 5 at temperatures (94°C/65.8°C /72°C).
- the PCR reactions were performed in a BioRad Connect RT-PCR machine.
- Mix 1 was initially prepared without the addition of DNA template* and 4 ⁇ mix 1 was added to each micro centrifuge tube. DNA template was then added to the mix by placing 1 ⁇ inside the lid of the microcentrifuge tube. The tubes were centrifuged, and then transferred to ice immediately after centrifugation.
- the final mixture (mixl + mix2) was incubated at 30°C for 16 hours (PCR machine). At the end of the incubation, the temperature of the final mixture was elevated to 65°C for 10 minutes to inactivate the
- DNA was quantified using QuantusTM fluorometer (Promega) as described by the manufacturer.
- Gel electrophoresis PCR results were evaluated on the basis of 2% agarose gel electrophoresis using BioRad SubCell Equipment. Gels were run at 80V in 1% agarose for 20-30 minutes. Visualization was done by casting Ethidium Bromide (O ⁇ g/ml) into the gels. MDA amplification was verified by loading 2 ⁇ onto a 0.7% agarose gel. All MDA gels were run at 80V in 0.7% agarose for approximately 30 minutes.
- the molecular marker on all agarose gels was Fermentas lbk+ ladder, with the band sizes (75, 200, 300, 400, 500, 1000, 2000, 3000, 4000, 5000, 7000, 10.000, 20.000).
- the probability of detecting a target DNA molecule in a sample was calculated using hypergeometric distribution, where the population is the originalsample volume of liquid in which the target is either present (positive) or not present and the test sample is the volume of liquid withdrawn from the original sample. Because the nucleic acid molecules only contribute to a minor part of the volume, both the population volume and test sample volumes are multiplied by 1000 in the calculations.
- the probability of detecting the target DNA molecule in at least one of the replicate dilution samples is:
- Example 1 Method of enrichment of a polynucleotide encoding HPV-18 virus from a mixed sample of human DNA.
- a mixed polynucleotide sample was prepared from reference DNA that was spiked with DNA derived from HeLa cells.
- the HeLa DNA was obtained from New England Biolabs (100 ⁇ g/ml) as a purified DNA sample.
- the reference DNA was extracted from cells derived from a human volunteer.
- the target DNA molecule in the HeLa DNA was efficiently amplified by the selected target PCR primers [SEQ ID NO: 1 and SEQ ID NO: 2], whereas the human reference DNA did not yield an amplification product with this primer pair. Both types of DNA were amplified separately using the MDA protocol prior to setting up the mixture.
- the quantity of target DNA copies in MDA amplified HeLa DNA was determined to be 71750 copies/ ⁇ using most probable number (MPN) calculation on triplicate 10-fold dilutions of HeLa DNA.
- the target DNA was diluted by a factor of 1 : 2.500.000 in undiluted MDA amplified reference DNA (employing serial dilution) to create the final spiked mixture containing 0.029 targets copies/ ⁇ and having a total DNA concentration of 0.187 ⁇ 9/ ⁇ .
- the total volume of mixed DNA sample was 45 ⁇ .
- polynucleotide sample is 0.078 (l-hypgeo(0;3500; l;45000)); i.e. less than 0.75.
- 3.5 ⁇ is the volume of sample used in the first round of PINS.
- DNA sequence from HPV18 was obtained from GenBank (GQ180790), and the following 2 primers were designed manually to target a DNA fragment of 96bp in the HPV18 genome (GenBank Acc. No : GQ180790) :
- Fw primer GTTTAGTGTGGGCCTGTGC [SEQ ID NO : 1]
- MDA amplified sample (# 1 - # 10) were screened for the presence of the target DNA molecule by PCR amplification, as described above using the target-specific PCR primer pair in 1.1., followed by agarose gel electrophoresis to visualize PCR products ( Figure 2). Because ten replicate samples were analysed, the probability of detecting the target DNA molecule in at least one of the ten replicate dilution samples was 0.778 (l-hypgeo(0;35000; l ;45000)) i.e. higher than 0.75. # 10 was the only sample found to result in positive PCR products of the correct size in all three replicates.
- the abundance of the HPV18 target before first round of PINS was 1 / 1.97*10 6 HPV18 positive genome equivalent / total genome equivalents.
- Example 2 The use of PINS to facilitate the sequencing of a target DNA molecule present in a mixed polynucleotide sample, where the amount of target DNA is below the limit of detection by PCR is demonstrated in this example.
- the selected target DNA molecule was a polynucleotide located within HPV18 genome.
- the amount of this target DNA molecule in the mixed sample corresponded to 0.0286 copies/ ⁇ .
- the mixed sample was prepared as described in Example 1. Using standard PCR protocols, the amount of template solution added to a PCR reaction is normally ⁇ , and the minimum target DNA concentration required for its positive detection by PCR is 1 copy/ ⁇ . Accordingly, the amount of target DNA molecule in the mixed polynucleotide sample was approximately 35 times below that required for PCR amplification and subsequent sequencing.
- the example demonstrates how PINS can be used to determine the sequence of target DNA in a mixed sample, which has otherwise been unattainable by known standard PCR based procedures.
- the target HPV18 DNA molecule in the mixed polynucleotide sample is not detectable by PCR
- HPV-264f 5 '- GTGGTGTATAG AG AC AGTATACC - 3 ' [SEQ ID NO: 3]
- HPV-911f 5'- CCTTCTGGATCAGCCATTGT [SEQ ID NO: 4]
- 2.2 PINS facilitates enrichment of the target HPV18 DNA molecule in the mixed polynucleotide sample to allow its PCR detection
- the initial copy number of the target DNA molecule in the mixed polynucleotide sample (0.0286 target copies/ ⁇ ) was increased to a final quantity of 2.5 target copies/ ⁇ by the implementation of PINS as described in Example 1.
- the MDA amplification products generated by performing 1 st round PINS on the initial mixed polynucleotide sample, were analysed by PCR as described above using 1 ⁇ I of the MDA amplified sample.
- a PCR product of the expected size (667 bp) was obtained as shown in Figure 7.
- Low levels of non-specific amplification of the initial mixed polynucleotide sample generated a low background detectable as a smear in lane #2 of Figure 7.
- the detectable product of -667 bp in lane #2 was isolated by gel-out (GeneJet Gel-out kit, Thermo Fischer Scientific) and PCR re- amplified to increase the amount of the target DNA molecule to allow
- the purified product isolated from lane #A ( Figure 8) was sequenced forward and reverse using both primers [SEQ ID NO : 3 and 4] .
- the retrieved sequences were aligned to the sequence of HPV18 (HPU89349) resulting in a perfect alignment with zero mismatches ( Figure9).
- the example confirms the efficacy of PINS for enriching for rare sequences to a level where their sequence can be determined.
- Example 3 Method of isolating a nucleotide fragment encoding an endoglucanase enzyme from a soil sample 3.1 Defining the primers for selection of the target DNA molecule encoding an endoglucanase:
- the selected primers are estimated to result in a PCR amplification product of 481bp.
- the sizes of PCR products may deviate from the expected size.
- Samples (8) of forest soils are collected as a source of diverse soil microorganisms. DNA from the 8 different samples are extracted using Bead Beating, as described by Kvist et. al [ 10] . Each extraction is amplified using MDA Repli-g Mini kit, using MDA amplification conditions as defined above (Materials and general methods). The quality of the amplified DNA is verified by visualization on 0,7% agarose gels.
- the initial PCR analysis is carried out to evaluate if the target DNA sequence could be observed using the selected primers [SEQ ID NO: 5 and 6] using the selected PCR conditions: 94°C(30 sec) + 60°C(30 sec) + 72°C(30 sec) and 30 cycles is carried out.
- PCR product is evaluated to have approximately the correct predicted size on an agarose gel.
- RT-PCR Real Time PCR
- the abundance of the target DNA molecule encoding a putative endoglucanase
- primers [SEQ ID NO : 5 and 6] are determined using primers [SEQ ID NO : 5 and 6] and compared to the abundance of 16S rRNA genes using primers [SEQ ID NO : 7 and 8] (where the 16S rRNA gene is used as a measure of total bacterial DNA abundance). It is found that 16S rRNA genes are approximately 550.000 higher in quantity compared to the putative
- DNA samples found to contain the targeted DNA molecule are subjected to PINS as follows:
- a dilution series is created using a dilution factor (D) of 1 : 10, aimed at then setting up multiple replicate dilutions of (N), 10 "2 .
- D dilution factor
- N replicate dilutions of (N)
- 10 "2 dilution factor
- Twenty identical samples of 10 "2 dilution are prepared and subjected to genomic amplification, using Repli-g Mini kit (Qiagen). Each amplified sample is individually analysed using the PCR primers [SEQ ID NO : 5 and 6] and the RT- PCR conditions described above in 1.3. Three out of 20 samples results in positive PCR amplification, with a DNA product of the predicted size.
- the associated PINS analysis output data are listed below.
- a total of at least 20 replicate samples are estimated for next round of replication.
- 20 samples of dilution 10 3 are prepared (i.e. a 10 fold dilution (D) increase over the previous total dilution of the sample (Dt)), and each of the individual samples are amplified using Repli-g MDA kit.
- Each sample is subsequently analyzed by RT-PCR using primers [SEQ ID NO : 5 and 6] which shows that one (out of 20) sample yielded a DNA product of the predicted size. This sample is selected for further progress.
- PINS analysis output data are listed below.
- the two positive samples from this round of analysis are pooled into one sample, and RT-PCR is carried out on the targeted gene using primers [SEQ ID NO : 5 and 6] and 16S rRNA genes using primers [SEQ ID NO: 7 and 8] in the same sample.
- Each of the amplification primers are combined with the linker ligation primers of the RGW.
- the target DNA molecule specific primers used for screening [SEQ ID NO: 5 and 6] are used in combination with the RGW primer [SEQ ID NO: 5] in a PCR amplification to generate larger PCR products that span the target DNA molecule and its flanking regions.
- This example illustrates the use of PINS to detect the presence of the mecA gene in a mixed sample (e.g. taken from a patient) and to determine whether the gene originates from the genome of Staphylococci present in the sample.
- This analysis relies on the use of PINS to monitor the simultaneous co-amplification of a Staphylococcus gene located approximately 13000 base pairs up-stream of the mecA gene.
- the experiment is designed to use the high fidelity of phi29 polymerase for multiple displacement amplification (MDA), allowing genome fragments up to +70000 bp to be generated during amplification.
- MDA multiple displacement amplification
- MR-Re 5' - CAATATGTATGCTTTGGTCTTTCTGC-3' [SEQ ID NO : 17],
- the extracted DNA is used as template for a 10-fold serial dilution.
- Each of the diluted tubes are directly analyzed by Real-Time (RT) PCR using 1 ⁇ I template in a 25 ⁇ RT-reaction mix with each of the two sets of primers MR (MR-fw and MR- Re) and SA (SA-fw and SA-re).
- RT Real-Time
- sample E one sample from the 10 samples
- 9 other samples does not comprise detectable levels of MR PCR product.
- RT-PCR guantification shows that the abundance of MR-PCR product is 1.27* 10 3 and the abundance of the SA-PCR product in sample 1.31* 10 3 .
- the ratio has now shifted towards comparable levels of the two target DNA molecules, from having an initial ratio of
- Staphylococcus aureus and not from other mecA containing bacteria such as coagulase-negative Staphylococci [ 12] .
- MR can be present in non- Staphylococcal bacterial strains, it was evidently amplified together with SA, due to the co-amplification of both targeted DNA molecules during MDA amplification.
- the primed sequences are separated by 13000 kb in the genome, it is possible to assign both properties to the same fraction of the genome, sufficient to diagnose the presence of MRSA.
- sequencing verifies this observation, and it was evident that the DNA was close to identical (+99.9%) to known MRSA genome sequences.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- General Chemical & Material Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DK13811247.9T DK2935617T3 (en) | 2012-12-21 | 2013-12-20 | Likelihood-oriented isolation of nucleotide sequences (PINS) |
| ES13811247.9T ES2630377T3 (es) | 2012-12-21 | 2013-12-20 | Aislamiento de secuencias nucleotídicas dirigido por probabilidad (PINS) |
| US14/653,795 US10214759B2 (en) | 2012-12-21 | 2013-12-20 | Probability-directed isolation of nucleotide sequences (PINS) |
| EP13811247.9A EP2935617B1 (en) | 2012-12-21 | 2013-12-20 | Probability-directed isolation of nucleotide sequences (pins) |
| AU2013366478A AU2013366478A1 (en) | 2012-12-21 | 2013-12-20 | Probability-directed isolation of nucleotide sequences (pins) |
| JP2015548661A JP6522511B2 (ja) | 2012-12-21 | 2013-12-20 | ヌクレオチド配列の確率指向性単離(pins) |
| CA2895904A CA2895904C (en) | 2012-12-21 | 2013-12-20 | Probability-directed isolation of nucleotide sequences (pins) |
| CN201380073618.4A CN105189781B (zh) | 2012-12-21 | 2013-12-20 | 核苷酸序列的概率导向分离(pins) |
| US16/238,753 US11078507B2 (en) | 2012-12-21 | 2019-01-03 | Probability-directed isolation of nucleotide sequences (PINS) |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DKPA201270822 | 2012-12-21 | ||
| DKPA201270822 | 2012-12-21 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/653,795 A-371-Of-International US10214759B2 (en) | 2012-12-21 | 2013-12-20 | Probability-directed isolation of nucleotide sequences (PINS) |
| US16/238,753 Division US11078507B2 (en) | 2012-12-21 | 2019-01-03 | Probability-directed isolation of nucleotide sequences (PINS) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014096421A1 true WO2014096421A1 (en) | 2014-06-26 |
Family
ID=49841687
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2013/077844 Ceased WO2014096421A1 (en) | 2012-12-21 | 2013-12-20 | Probability-directed isolation of nucleotide sequences (pins) |
Country Status (9)
| Country | Link |
|---|---|
| US (2) | US10214759B2 (https=) |
| EP (1) | EP2935617B1 (https=) |
| JP (1) | JP6522511B2 (https=) |
| CN (1) | CN105189781B (https=) |
| AU (1) | AU2013366478A1 (https=) |
| CA (1) | CA2895904C (https=) |
| DK (1) | DK2935617T3 (https=) |
| ES (1) | ES2630377T3 (https=) |
| WO (1) | WO2014096421A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10738354B2 (en) | 2015-06-26 | 2020-08-11 | Samplix Aps | Targeted enrichment of long nucleotide sequences using microfluidic partitioning |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2013366478A1 (en) * | 2012-12-21 | 2015-07-09 | Samplix S.A.R.L. | Probability-directed isolation of nucleotide sequences (pins) |
| CN105420375B (zh) * | 2015-12-24 | 2020-01-21 | 北京大学 | 一种环境微生物基因组草图的构建方法 |
| CN109402223A (zh) * | 2018-11-12 | 2019-03-01 | 河南弘腾农业有限公司 | 一种基于动物粪便样品构建测序文库的方法及其应用 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004058987A2 (en) * | 2002-12-20 | 2004-07-15 | Qiagen Gmbh | Nucleic acid amplification |
| WO2008096923A1 (en) * | 2007-02-05 | 2008-08-14 | Korea Research Institute Of Bioscience And Biotechnology | Methods for fabrication of uncultivated genome-probing microarrays by amplifying genome derived from a single microbial cell using multiple displacement amplification |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030228586A1 (en) | 1999-06-30 | 2003-12-11 | Rafick-Pierre Sekaly | Method for measuring de novo T-cell production in humans |
| AU2013366478A1 (en) * | 2012-12-21 | 2015-07-09 | Samplix S.A.R.L. | Probability-directed isolation of nucleotide sequences (pins) |
-
2013
- 2013-12-20 AU AU2013366478A patent/AU2013366478A1/en not_active Abandoned
- 2013-12-20 ES ES13811247.9T patent/ES2630377T3/es active Active
- 2013-12-20 JP JP2015548661A patent/JP6522511B2/ja not_active Expired - Fee Related
- 2013-12-20 WO PCT/EP2013/077844 patent/WO2014096421A1/en not_active Ceased
- 2013-12-20 CA CA2895904A patent/CA2895904C/en active Active
- 2013-12-20 CN CN201380073618.4A patent/CN105189781B/zh active Active
- 2013-12-20 DK DK13811247.9T patent/DK2935617T3/en active
- 2013-12-20 EP EP13811247.9A patent/EP2935617B1/en active Active
- 2013-12-20 US US14/653,795 patent/US10214759B2/en active Active
-
2019
- 2019-01-03 US US16/238,753 patent/US11078507B2/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004058987A2 (en) * | 2002-12-20 | 2004-07-15 | Qiagen Gmbh | Nucleic acid amplification |
| WO2008096923A1 (en) * | 2007-02-05 | 2008-08-14 | Korea Research Institute Of Bioscience And Biotechnology | Methods for fabrication of uncultivated genome-probing microarrays by amplifying genome derived from a single microbial cell using multiple displacement amplification |
Non-Patent Citations (4)
| Title |
|---|
| CHANDLER D P: "Redefining relativity: Quantitative PCR at low template concentrations for industrial and environmental microbiology", JOURNAL OF INDUSTRIAL MICROBIOLOGY AND BIOTECHNOLOGY, BASINGSTOKE, GB, vol. 21, no. 3, 1 September 1998 (1998-09-01), pages 128 - 140, XP002693076, ISSN: 1367-5435 * |
| ELLISON STEPHEN LR ET AL: "Routes to improving the reliability of low level DNA analysis using real-time PCR", BMC BIOTECHNOLOGY, BIOMED CENTRAL LTD. LONDON, GB, vol. 6, no. 1, 6 July 2006 (2006-07-06), pages 33, XP021017060, ISSN: 1472-6750, DOI: 10.1186/1472-6750-6-33 * |
| K. LUKYANOV ET AL: "Molecule by molecule PCR amplification of complex DNA mixtures for direct sequencing: an approach to in vitro cloning", NUCLEIC ACIDS RESEARCH, vol. 24, no. 11, 1 June 1996 (1996-06-01), pages 2194 - 2195, XP055099655, DOI: 10.1093/nar/24.11.2194 * |
| LENA ERLANDSSON ET AL: "Amp-PCR: Combining a Random Unbiased Phi29-Amplification with a Specific Real-Time PCR, Performed in One Tube to Increase PCR Sensitivity", PLOS ONE, vol. 5, no. 12, 31 December 2010 (2010-12-31), pages e15719, XP055098709, DOI: 10.1371/journal.pone.0015719 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10738354B2 (en) | 2015-06-26 | 2020-08-11 | Samplix Aps | Targeted enrichment of long nucleotide sequences using microfluidic partitioning |
| US11572584B2 (en) | 2015-06-26 | 2023-02-07 | Samplix Aps | Targeted enrichment of long nucleotide sequences using microfluidic partitioning |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2895904C (en) | 2021-06-08 |
| EP2935617B1 (en) | 2017-04-12 |
| US20160053291A1 (en) | 2016-02-25 |
| DK2935617T3 (en) | 2017-07-17 |
| CN105189781A (zh) | 2015-12-23 |
| US10214759B2 (en) | 2019-02-26 |
| JP2016500276A (ja) | 2016-01-12 |
| CA2895904A1 (en) | 2014-06-26 |
| JP6522511B2 (ja) | 2019-05-29 |
| US11078507B2 (en) | 2021-08-03 |
| AU2013366478A1 (en) | 2015-07-09 |
| CN105189781B (zh) | 2017-06-06 |
| EP2935617A1 (en) | 2015-10-28 |
| US20190233865A1 (en) | 2019-08-01 |
| ES2630377T3 (es) | 2017-08-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6666268B2 (ja) | 液滴ソートによるヌクレオチド配列排除富化(needls) | |
| Boughner et al. | Microbial ecology: where are we now? | |
| CN101680027A (zh) | 检测hiv耐药变异体的系统和方法 | |
| JP2009502137A (ja) | 核酸変種の迅速な同定および定量のための方法 | |
| US11078507B2 (en) | Probability-directed isolation of nucleotide sequences (PINS) | |
| JP2011139713A (ja) | 細菌株の検出および型決定 | |
| Huang et al. | Suppression Subtractive Hybridization (SSH) and its modifications in microbiological research | |
| US11104948B2 (en) | NGS systems control and methods involving the same | |
| WO2010062897A1 (en) | Methods and compositions to detect clostridium difficile | |
| JP2016500276A5 (https=) | ||
| CN105992827A (zh) | 用于测序测定的通用对照 | |
| CN116200475A (zh) | 一种检测tet(X)基因及其同源基因的简并引物对及其方法 | |
| Liu et al. | Epigenetic segregation of microbial genomes from complex samples using restriction endonucleases HpaII and McrB | |
| EP2347013B1 (en) | Method for the specific detection of low abundance rna species in a biological sample | |
| AU2011209624A1 (en) | Methods and kits used in the detection of fungus | |
| Orłowska et al. | Evaluation of direct metagenomics and target enriched approaches for high-throughput sequencing of field rabies viruses | |
| Graham et al. | PrimerSelect: a transcriptome-wide oligonucleotide primer pair design program for kinetic RT-PCR–based transcript profiling | |
| Ziebolz et al. | Toward a new era in sequencing | |
| Verma et al. | Gene Manipulation Strategies for Advancing Microbial Biotechnology for Bioproduct Innovation | |
| CN119307628A (zh) | 幽门螺杆菌左氧氟沙星耐药基因快速可视化检测系统及方法 | |
| JP5189747B2 (ja) | 黄色ブドウ球菌のコアグラーゼ型別用オリゴヌクレオチド | |
| JP2025542506A (ja) | マイノリティ遺伝子バリアントを検出するための方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201380073618.4 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13811247 Country of ref document: EP Kind code of ref document: A1 |
|
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| ENP | Entry into the national phase |
Ref document number: 2015548661 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14653795 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2895904 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2013811247 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013811247 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2013366478 Country of ref document: AU Date of ref document: 20131220 Kind code of ref document: A |