WO2013189778A1 - Bag3 as biochemical serum and tissue marker - Google Patents

Bag3 as biochemical serum and tissue marker Download PDF

Info

Publication number
WO2013189778A1
WO2013189778A1 PCT/EP2013/061976 EP2013061976W WO2013189778A1 WO 2013189778 A1 WO2013189778 A1 WO 2013189778A1 EP 2013061976 W EP2013061976 W EP 2013061976W WO 2013189778 A1 WO2013189778 A1 WO 2013189778A1
Authority
WO
WIPO (PCT)
Prior art keywords
bag3
antibodies
cancer
serum
bag
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2013/061976
Other languages
English (en)
French (fr)
Inventor
Maria Caterina Turco
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biouniversa SRL
Original Assignee
Biouniversa SRL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP13728180.4A priority Critical patent/EP2861618B1/en
Priority to AU2013279604A priority patent/AU2013279604B2/en
Priority to BR112014031958A priority patent/BR112014031958A2/pt
Priority to JP2015517672A priority patent/JP6654432B2/ja
Priority to PL13728180T priority patent/PL2861618T3/pl
Priority to CA2876922A priority patent/CA2876922C/en
Priority to KR1020157001313A priority patent/KR102150903B1/ko
Priority to CN201380032138.3A priority patent/CN104507965B/zh
Application filed by Biouniversa SRL filed Critical Biouniversa SRL
Priority to ES13728180T priority patent/ES2795981T3/es
Publication of WO2013189778A1 publication Critical patent/WO2013189778A1/en
Priority to IN10561DEN2014 priority patent/IN2014DN10561A/en
Priority to US14/572,654 priority patent/US10359433B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57525Immunoassay; Biospecific binding assay; Materials therefor for cancer of the liver or pancreas
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57555Immunoassay; Biospecific binding assay; Materials therefor for cancer of the prostate
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57557Immunoassay; Biospecific binding assay; Materials therefor for cancer of other specific parts of the body, e.g. brain
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • G01N33/57595Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites involving intracellular compounds
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6887Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from muscle, cartilage or connective tissue
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47Assays involving proteins of known structure or function as defined in the subgroups
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/32Cardiovascular disorders
    • G01N2800/324Coronary artery diseases, e.g. angina pectoris, myocardial infarction
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/32Cardiovascular disorders
    • G01N2800/325Heart failure or cardiac arrest, e.g. cardiomyopathy, congestive heart failure
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/70Mechanisms involved in disease identification
    • G01N2800/7095Inflammation

Definitions

  • the present invention concerns anti-BAG3 antibodies for use as biochemical markers in the diagnosis of a pathological state.
  • BAG3 (RefSeq: NP_ 004272; Gene ID 9531) is a 74 kDa cytoplasmic protein particularly concentrated in the rough endoplasmic reticulum.
  • BAG3 protein belongs to the family of co-chaperones that interact with the ATPase domain of the heat shock protein HSP70 through the structural domain known as BAG domain (110-124 amino acids) .
  • BAG3 contains a WW domain and a proline-rich repeat (PXXP) , that can mediate binding to other proteins.
  • PXXP proline-rich repeat
  • bag3 gene expression is constitutive in a few normal cell types, including myocytes, and in several primary tumours or tumour cell lines. Moreover it can be induced by a variety of stressors: indeed stressful stimuli activate the heat shock transcription factor (HSF) 1, that is responsible for the expression of stress- activated genes, including bag3 (Rosati A, Graziano V, De Laurenzi V, Pascale M, Turco MC .
  • HSF heat shock transcription factor
  • BAG3 a multifaceted protein that regulates major cell pathways. Cell Death Dis. 2011; 2: el41) .
  • Evidence indicates that BAG3 has a role in sustaining cell survival, by modulating, in either Hsp70- dependent or -independent fashion, the levels or localisation of apoptosis- regulating proteins, such as ⁇ , Bax or BRAF, depending on cell context .
  • BAG3 protein appears to be expressed during cardiomyoblasts differentiation and to sustain myogenin expression. These findings indicate an involvement of BAG3 in late heart development (De Marco M, Turco MC, Rosati A. BAG3 protein is induced during cardiomyoblast differentiation and modulates myogenin expression. Cell Cycle. 2011; 10: 850-852). Moreover, in cardiomyocytes BAG3 has been shown to localize at Z-disc and interact with the actin capping protein, CapZpl, stabilizing myofibril structure and possibly preserving myofibrillar integrity during mechanical stress. BAG3 mutations can impair the Z-disc assembly and increase the sensitivity to stress-induced apoptosis.
  • the present invention concerns anti-BAG3 antibodies for use as biochemical markers in the diagnosis of a pathological state.
  • anti-BAG3 antibodies are bound to soluble BAG3 to form immune complexes.
  • said diagnosis is in vitro or ex vivo .
  • a further aspect of the present invention is that the recipient of said diagnosis is a mammalian, preferably a human.
  • the use of the anti-BAG-3 antibodies of the present invention has the advantages of being specific for a pathological state selected from the group consisting of a heart disease, cancer, diabetes, inflammation and inflammatory related diseases of the skin, nerves, bones, blood vessels and connective tissues.
  • said heart disease is selected from: angina pectoris, pre-infarction angina, myocardial infarction, heart failure, ischemia, acute coronary disease, acute heart failure, chronic heart failure and iatrogenic heart disease.
  • said cancer is selected from: pancreatic cancer, bladder cancer and prostate cancer.
  • a further embodiment of the present invention is a method for detecting the presence of an anti- BAG3 antibody or an anti-BAG3 antibody bound to soluble BAG3 to form an immune complex in a biological sample, comprising the steps of:
  • the method of the present invention further comprises the additional step of :
  • said determination step b. is performed by an ELISA test.
  • said serum, plasma, urine or saliva is from a mammalian, preferably a human.
  • the presence of said anti-BAG3 antibody or said immune complex is associated with a pathological condition.
  • said pathological condition is selected from the group consisting of a heart disease, cancer, diabetes, inflammation and inflammatory related diseases of the skin, nerves, bones, blood vessels and connective tissues .
  • said heart disease is selected from: angina pectoris, pre-infarction angina, myocardial infarction, heart failure, ischemia, acute coronary disease, acute heart failure, chronic heart failure and iatrogenic heart disease .
  • said cancer is selected from: pancreatic cancer, bladder cancer and prostate cancer .
  • a further embodiment of the present invention is an ELISA kit, comprising a BAG3 recombinant protein or BAG3-specific mouse monoclonal antibodies AC-1, AC-2 AC-3, AC-4, AC-5, AC-rbla, AC-rblb, AC-rb2a, AC-rb2b, AC-rb3a, AC-rb3b, AC- rb4a and AC-rb4b for capturing soluble BAG3 and antibodies able to recognize human immunoglobulins, as well as its use for the detection of anti-BAG3 antibodies or anti-BAG3 antibodies bound to soluble BAG3 to form an immune complexes in a biological sample.
  • a BAG3 recombinant protein or BAG3-specific mouse monoclonal antibodies AC-1, AC-2 AC-3, AC-4, AC-5, AC-rbla, AC-rblb, AC-rb2a, AC-rb2b, AC-rb3a, AC-rb3b, AC- rb
  • said biological sample is a serum, plasma, urine or saliva sample.
  • said serum, plasma, urine or saliva sample is from a mammalian, preferably a human.
  • the invention still further relates to a immunohistochemistry (IHC) kit for the detection of BAG3 protein in a biological sample, wherein said biological sample is preferably a tissue sample, comprising BAG3- specific antibodies and reagents including probes needed for the staining .
  • IHC immunohistochemistry
  • FIG. 1A detection of BAG3 protein in supernatants from cultured cardiomyocytes .
  • Human (HCMa) and rat (H9c2) cardiomyocytes at 80% confluency were incubated with or without 10% FBS for 16 hours at 37°C in a 5% CO 2 atmosphere.
  • Figure IB detection of BAG3 protein in exocytic vesicles.
  • Surnatants obtained from H9c2 cells were subjected to sequential centrifugations : (i) 2' 000xg for 15 min, to remove cells; (ii) 10'OOOxg for 30 min, to remove cellular debris; (iii) 150' 000xg for 90 min, to pellet exocytic vesicles. The pellet was washed once in PBS at 150' 000xg for 90 min and analyzed with the anti- BAG3 TOS-2 polyclonal antibody in comparison with a whole-cell lysate by western blot. Rab-4 was analyzed as a marker for exocytic vesicles.
  • GAPDH a cytosolic protein, was analyzed as a control .
  • Figure 1C Sera from two healthy donors and from two patients affected by chronic heart failure were analyzed with the anti-BAG3 antibody TOS-2 polyclonal antibody in western blotting.
  • FIG. 2A detection of BAG3 protein in sera from CHF patients.
  • BAG3 recombinant protein and whole- cell lysate from HCMa cells were analyzed by western blotting with serum (1:40) obtained from a patient with heart failure. Analysis with serum from a healthy donor was performed as negative control .
  • Figure 2B detection of anti-BAG3 antibodies by ELISA test. Sera from 50 CHF patients (with ejection fraction ⁇ 60%) were compared with sera from 50 healthy donor for the presence of anti- BAG3 antibodies in a specific ELISA test. Results are plotted as arbitrary units.
  • Figure 2C ROC analysis of ELISA test results. Cut-off on 0.083 A.U. results in 74% sensitivity and 68% specificity.
  • FIG. 3A Confocal microscopy analysis of direct fluorescence performed for detection of rBAG3- FITC binding to HCMa cells (a, b, c) and J774 Al cells (d, e, f, g, h, i) .
  • BAG3 recombinant protein and purified BSA albumin from bovine serum purchased from SIGMA
  • BSA-FITC Conjugation Kit purchased from SIGMA following the manufacturer instructions.
  • ⁇ -integrin was analyzed as control (a, d, g) .
  • Cells were analyzed by a Zeiss LSM confocal microscope. Merged images are shown in c, f and i .
  • FIG. 3B BAG3 binds macrophages. J774 Al macrophages (lxlO 6 cells/ml) were incubated with different concentration of Fitc-BAG3 protein (7, 14 and 70 nm) . FITC-BSA (70 nM) was used as a negative control (grey) . Cells fluorescence was analyzed by flow cytometry.
  • J774 Al cells at 80% confluency were incubated with control medium, BSA, LPS or rBAG3, for 20 hours.
  • Polymixin was added where indicated to verify that the effects of E. coli- derived rBAG3 were independent from the presence of contaminating endotoxin.
  • Cox-2 and iNOS expression were analyzed in cell lysates by Western blotting.
  • J774 Al cells at 80% confluency were incubated with control medium, BSA, LPS or rBAG3 for 24 hours.
  • 100 ⁇ of supernatants from each sample were incubated with 100 ⁇ of Griess reagent; the optical density at 550 nm (OD550) was measured with a Beckman DU62 spectrophotometer.
  • Nitrite concentration was evaluated by comparing the OD550 of the sample with that of a standard curve of sodium nitrite.
  • FIG. 3C panel c - Analysis of IL-6 release from J774 Al macrophages incubated with BAG3.
  • J774 Al cells at 80% confluency macrophages were incubated with control medium, BSA, LPS or recombinant BAG3 for 5 hours.
  • BAG3 peptides peptide 1, peptide 2, peptide 3, peptide 4 or scrambled peptide 625 nM were added where indicated to verify their ability to block BAG3 activity.
  • IL-6 production was measured in cell culture medium using an ELISA test.
  • IL-6 concentration was evaluated by comparing the OD of the sample with that of a standard curve of recombinant IL-6.
  • FIG. 5 Representative image of BAG3 staining in synovial tissues from several rheumatoid arthritis. BAG3 positivity is observed in synovial fibroblasts and inflammatory infiltrates. Sections were counterstained with hematoxylin.
  • bag3 mRNA relative expression evaluated by qRT- PCR is shown in a graph where values are reported as mean + S.D.
  • the blue line represents the median value calculated.
  • Pancreatic cancer cell lines (PSN1, Capan-1, AsPC-1, PANC-1 and MIA PaCa-2 ) were treated with different concentrations of gemcitabine as indicated in the graph. After 48 hours, apoptotic cell death was analyzed. Graph depicts mean percentage of Sub G0/G1 cells ( ⁇ S.D.). Data are representative of three independent experiments.
  • Figure 8B
  • MIA PaCa-2 and PANC-1 cell lines were treated with 2 ⁇ gemcitabine (GEM) for the indicated times BAG3 protein expression levels were monitored by western blot .
  • GEM gemcitabine
  • bag3 mRNA levels were analyzed by RT-PCR; graph depicts relative bag3 mRNA levels ( ⁇ S.D.) and data are representative of three indipendent experiments .
  • MIA PaCa-2 and PANC-1 cell lines were transfected with BAG3 siRNA or a non- targeted siRNA (NTsiRNA) for 72 hours and then treated with 2 ⁇ gemcitabine (GEM) for 24h.
  • BAG3 levels were analyzed by western blot and GAPDH levels were detected to monitor equal loading conditions.
  • MIA PaCa-2 and PANC-1 cells were transfected as described above and treated with 2 ⁇ gemcitabine (GEM) for 24h or 48h. Apoptotic cell death was analyzed as described. Graph depicts mean percentage of Sub G0/G1 cells ( ⁇ S.D.). Data are representative of three independent experiments.
  • Figure 9A Detection of BAG3 specific immuno- complexes by ELISA test. Sera from 55 pancreatic adenocarcinoma patients were compared with sera from 51 healthy donors for the presence of BAG3 specific immune-complexes in a specific ELISA test. Results are plotted as arbitrary units +S . E .
  • Figure 9B ROC analysis of ELISA test results. Cut-off on 0.183 A.U. results in 65% sensitivity and 78% specificity.
  • Detection of BAG3-specific antibodies in patients sera from 49 female subjects at 0-1 years pre- diagnosis for pancreatic adenocarcinoma were compared with sera from 235 female control subjects sera for the presence of BAG3 specific antibodies in a specific ELISA test. Control sera were about five for each case subjects and age matched with the respective case. Others time points included: 53 subjects at 1-2 years pre- diagnosis for PDAC compared to 251 controls; 44 subjects at 2-3 years pre-diagnosis for PDAC compared to 212 controls; 42 subjects at 3-4 years pre-diagnosis for PDAC compared to 187 controls .
  • Results are plotted as arbitrary units _+S . P value was calculated with student's t test.
  • the present invention concerns anti-BAG3 antibodies for use as biochemical markers in the diagnosis of a pathological state.
  • diagnosis in the present invention we refer to medical diagnosis (often simply termed diagnosis) that refers to the process of attempting to determine or identify a possible disease or disorder.
  • diagnosis of the present invention encompasses also the early diagnosis
  • Anti-BAG3 antibodies have now been advantageously detected in serum, plasma, urine or saliva. Until now such antibodies had never been found in serum either in physiological or pathological condition.
  • the detection of anti-BAG3 antibodies in serum has the advantage of being a rapid and non-invasive technique be exploited for diagnostic, early diagnosis and prognostic purposes, risk stratification, as a tool for the identification and for monitoring therapies.
  • a further advantage of the detection of antibodies is that a very small amount of serum is required for the detection.
  • soluble BAG3 protein can also be detected in the serum of patients suffering from some pathologies, but the amount of serum requested for the detection of the soluble protein is much higher than that required for the detection of antibodies.
  • soluble BAG3 protein levels can be much lower than those of antibodies and/or that, respect to soluble BAG3 protein, antibodies can be detectable in earlier phases of specific pathologies and/or can more efficiently predict risk of complications or monitor the effects of therapies.
  • a further embodiment of the present invention is that said anti-BAG3 antibodies can be advantageously detected in different biological samples selected from serum, plasma, urine or saliva .
  • serum is intended the component of blood that is neither a blood cell nor a clotting factor; it is the blood plasma with the fibrinogens removed.
  • Serum includes all proteins not used in blood clotting (coagulation) and all the electrolytes, antibodies, antigens, hormones, and any exogenous substances .
  • plasma is intended the straw-coloured/pale-yellow liquid component of blood that normally holds the blood cells in whole blood in suspension. It contains clotting factors, such as fibrinogens.
  • the invention provides the use of anti-BAG3 antibodies as biochemical markers, wherein said anti-BAG3 antibodies are bound to soluble BAG3 to form immune complexes.
  • Anti-BAG3 antibodies either free or bound to soluble BAG3 to form immune complexes have advantageously been now detected in a biological sample, and may be used as a marker in the diagnosis of a pathological condition.
  • the detection of such antibodies and/or immune complexes in a biological sample also has the advantage of being a rapid and non-invasive technique for diagnostic and/or prognostic purposes .
  • said diagnosis is in vivo or ex vivo .
  • a further embodiment of the present invention is that recipient of said diagnosis is a mammalian, preferably a human.
  • immune complex or protein/antibody complex is intended the integral binding of an antibody to a soluble antigen, the bound antigen acting as a specific epitope, bound to an antibody is referred to as a singular immune complex.
  • Immune complexes have the same advantages seen as for the detection of antibodies, since a very small amount of serum is required also for the detection of the immune complex.
  • the amount of serum required for the detection of soluble BAG3 is much higher also than that required for the detection of the protein/antibody (immune) complexes.
  • Immune complexes as well as free antibodies can be detectable in earlier phases of specific pathologies and can more efficiently predict risk of complications or monitor the effects of therapies.
  • a still further embodiment of the invention is the use of anti-BAG3 antibodies or said immune complexes (formed by anti-BAG3 antibodies bound to soluble BAG3 ) as biological markers of a pathological state, wherein said pathological state is a heart disease, cancer, diabetes, inflammation and inflammatory related diseases of the skin, nerves, bones, blood vessels and connective tissues.
  • said heart disease is selected from the group consisting of: angina pectoris, preinfarction angina, ischemia, myocardial infarction, heart failure, acute coronary disease, acute heart failure, chronic heart failure and iatrogenic heart disease.
  • said cancer is selected from: pancreatic cancer, bladder cancer and prostate cancer .
  • a further embodiment of the present invention is a method for detecting the presence of an anti- BAG3 antibody or an anti-BAG3 antibody bound to soluble BAG3 to form an immune complex in a biological sample, comprising the steps of:
  • the method according to the present invention has the advantage of allowing to detect significant differences between anti-BAG3 antibodies and/or BAG3 /antibodies complexes between healthy individuals and patients affected by BAG3- involving pathologies.
  • the proposed assay method allows a statistically significant separation of the group of cardiac patients from the group of healthy people. It can also stratify such patients with heart disease in subgroups of patients at increased risk (heart failure, HF).
  • HF heart failure
  • the method according to the present invention is a method wherein said determination step b. is performed by an ELISA test .
  • said serum, plasma, urine or saliva is from a mammalian, preferably a human .
  • the method according to the present invention has the advantage of allowing the rapid and noninvasive detection of the biological markers allowing the evaluation of pathologies, risks for diseases and/or their complications, and monitoring of therapies.
  • the invention relates to a detection method wherein the presence of said anti-BAG3 antibody or said anti- BAG3 antibody bound to soluble BAG3 to form an immune complex is associated with a pathological condition .
  • said pathological condition is chosen from the group consisting of heart disease, cancer, diabetes, inflammation and inflammatory related diseases of the skin, nerves, bones, blood vessels and connective tissues.
  • said heart disease is selected from the group consisting of: angina pectoris, pre-infarction angina, myocardial infarction, ischemia, heart failure, acute coronary disease, acute heart failure, chronic heart failure or iatrogenic heart disease.
  • said cancer is selected from: pancreatic cancer, bladder cancer and prostate cancer .
  • the invention further relates to an ELISA kit for the detection of anti-BAG3 antibodies or anti- BAG3 antibodies bound to soluble BAG3 to form an immune complexes in a biological sample.
  • the ELISA kit according to the present invention comprises a BAG3 recombinant protein for capturing anti-BAG3 antibodies or BAG3- specific mouse monoclonal antibodies AC-1, AC-2, AC-3, AC- 4, AC-5, AC-rbla, AC-rblb, AC-rb2a, AC-rb2b, AC- rb3a, AC-rb3b, AC-rb4a and AC-rb4b, for capturing soluble BAG3 and antibodies able to recognize human immunoglobulins.
  • Such antibodies can be enzyme-linked antibodies able to recognize human immunoglobulins.
  • the invention also relates to a kit for the detection of BAG3-associated antibodies in a biological sample and is performed by ELISA with BAG3-specific mouse monoclonal antibodies AC-1, AC-2, AC-3, AC-4, AC-5, AC-rbla, AC-rblb, AC- rb2a, AC-rb2b, AC-rb3a, AC-rb3b, AC-rb4 and AC- rb4b, for capturing soluble BAG3 and enzyme- linked antibodies for the detection able to recognize human immunoglobulins.
  • said biological sample is a serum, plasma, urine or saliva sample.
  • said serum, plasma, urine or saliva sample is from a mammalian, preferably a human.
  • the invention still further relates to a immunohistochemistry (IHC) kit for the detection of BAG3 protein in a biological sample, wherein said biological sample is preferably a tissue sample.
  • Tissue samples can be biopsies, frozen tissues, paraffin embedded tissues.
  • the IHC kit according to the present invention comprises BAG3- specific antibodies and reagents including probes needed for the staining.
  • Said BAG3- specific antibodies can be mouse monoclonal antibodies AC-1, AC-2 and AC-3 and/or enzyme-linked antibodies for the detection able to recognize mouse immunoglobulins.
  • the IHC kit advantageously allows to reveal BAG3 protein in 100% of pancreatic carcinoma tissue samples from patients that undergo pancreas resection and is expressed in most bladder carcinoma samples.
  • BAG3 protein can be revealed with the kit for BAG3 detection by IHC also in normal pancreas tissue in Langerhans islets while other normal tissues result negative (such for example normal urocystis). BAG3 positivity can be also observed in synovial fibroblasts and inflammatory infiltrates in rheumatoid arthritis tissue samples .
  • the BAG3 IHC kit allows the identification of the prognosis of PDAC patients. It was seen that the intensity of BAG3 expression identified by IHC, correlates with patients' survival. Therefore it can be used for both prognosis and for making a choice of therapy.
  • a still further aspect of the invention is a kit for the detection of BAG3 gene expression in a biological sample comprising a set of amplification primers.
  • amplification primers are suitable for the detection by quantitative real-time RT-PCR.
  • fw SEQ ID NO. 3: CCGGCTGGCCCTTCTTCGTG;
  • fw SEQ ID NO. 7: CCAGCCTCCCACGGACCTGA;
  • the RT-PCR kit for bag3 mRNA detection in a biological sample allows to correlate the levels of bag3 gene expression with patients' survival and can be used for prognosis and for choice of therapy.
  • said biological sample is a tissue sample.
  • a still further aspect of the invention is represented by anti-BAG3 monoclonal antibodies, their fragments, and peptides corresponding to specific aminoacidic sequences of BAG3 protein that are able to block macrophage activation and can therefore be used for therapy of inflammatory, oncologic or other diseases involving macrophage activation. See in particular Figure 3 and Table I.
  • This invention relates to the use of BAG3- specific mouse monoclonal antibodies AC-1, AC-2 and AC-3 or same modified as F(ab), F(ab')2, F(ab) or humanized; or peptides comprising sequences as follows:
  • PEP4 NPSSMTDTPGNPAAP (SEQ ID NO. 14)
  • Cardiomyocytes are known to release protective factors in mounting a response against stressful agents. Since stress- induced proteins, such as Hsp70, Hp27, Hsp90 and others, although exerting an intracellular activity, can also be secreted in response to stress, BAG3 release by cardiomyocytes was analyzed in stressful conditions. For this purpose, we analyzed the effect of serum deprivation- induced stress in cultured human primary cardiomyocytes or the rat cardiomyocyte cell line H9c2. As shown in Figure 1, we could detect BAG3 protein in the supernatants of cardiomyocytes exposed to serum deprivation for 16 h ( Figure 1A) .
  • the human BAG 3 protein has the amino acid sequence according to SEQ ID NO: 15.
  • J774 cells were incubated with 14 nM FITC-BAG3 protein and with 625 nM of BAG3 peptides (peptide 1, peptide 2, peptide 3, peptide 4 or scrambled peptide) or with 420 nM of
  • F(ab')2 fragments from anti-BAG3 monoclonal and polyclonal antibodies mouse monoclonal AC1, AC2 and rabbit polyclonal TOS2).
  • IgG were used as a negative control.
  • BAG3-treated macrophages Furthermore, BAG3 induced the release of nitrite and interleukin
  • BAG3-specific mouse monoclonal antibodies AC-1, AC-2 and AC-3 and/or others or same modified as F(ab), F(ab')2, F(ab) or humanized; or peptides comprising sequences PEP 1 to 4 and/or others are molecules able to bind and/or block soluble BAG3 effects to be used for therapy of inflammatory, oncologic or other diseases involving macrophage activation.
  • BAG3 expression in PDAC by immunohistochemistry was developed an immunohistochemistry (IHC) kit, including our anti-BAG3 monoclonal antibodies and able to detect BAG3 protein by immunohistochemistry (IHC).
  • IHC immunohistochemistry
  • This kit revealed BAG3 expression in all the 346 (100%) PDAC biopsies that we analyzed.
  • BAG3 staining revealed a moderate positivity of Langerhans islets, while normal pancreatic ducts and pancreatic acinar cells had no BAG3 expression. This was true in both normal pancreas and non-neoplastic pancreatic tissue adjacent to the tumor mass. BAG3 staining was observed predominantly in the cytoplasm of tumor cells.
  • the intensity of staining of BAG3 was variable as was the number of positive cancer cells. Furthermore, Langerhans insulae were positive and constituted a good internal control of IHC ( Figure 4A) . Therefore our kit allows the detection of BAG3 protein in PDAC by IHC. Furthermore, it allows detecting BAG3 protein by IHC also in other tumour or normal tissues
  • the survival analysis was performed in a cohort of 66 patients of which all the lesions examined were with resection margins free from tumor cells (R0) and only the 3.7% showed the presence of metastases to distant organs (Table II) .
  • the first-line chemotherapy for treatment of pancreatic cancer is gemcitabine.
  • BAG3 protein in response to therapy, we analyzed the effect of BAG3 down- modulation in human PDAC cells.
  • Silencing of BAG3 enhanced cell apoptosis in response to the drug ( Figure 8) .
  • bag3 primers that detect BAG3 expression by quantitative real-time RT-PCR.
  • RT-PCR kit containing specific primers for bag3 mRNA detection and quantification.
  • Control sera were obtained from healthy subjects and we measure BAG3 antibody titers in about five control subjects compared to each PDAC case. Furthermore, control sera came from subjects age matched with the respective PDAC case. This control sera matching was used for each time point.
  • BAG3 antibodies concentrations were detected in a specific ELISA assay.
  • BAG3 antibodies were significantly higher in cases at least 3-4 years pre-diagnosis in respect to control subjects.
  • BAG3 antibodies were significantly higher in cases at least 3-4 years pre-diagnosis in respect to control subjects.
  • HCMa Human Cardiac Myocytes-adult ) were purchased from Sciencell Research Laboratories (San Diego, CA) and grown in Cardiac Myocyte Medium (CMM, FBS 5%, Cardiac Myocyte Growth Supplement 1%, penicillin/ streptomycin solution 1%) (Sciencell Research Laboratories, San Diego, CA) . All experiments were performed on low- passage cell cultures.
  • Embryonic rat cardiomyoblasts (line H9c2) was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and grown in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10 % fetal bovine serum (FBS), 100 U/mL penicillin and 100 g/mL streptomycin.
  • DMEM Dulbecco's Modified Eagle's Medium
  • FBS fetal bovine serum
  • J774A.1 murine monocyte macrophage cell line (ATCC, Manassas, VA, USA), was grown in DMEM supplemented with 10% fetal bovine serum (FBS), 25 mM HEPES, 2 mM glutamine, 100 u/mL penicillin and 100 g/mL streptomycin.
  • pancreatic cancer cell lines (MIA PaCa-2, AsPC-1, PSN1, Capan-1 and PANC-1) were received from the American Type Culture Collection (ATCC; Manassas, VA) cell bank.
  • MIA PaCa-2 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) and supplemented with 10% FBS and 2.5% horse serum.
  • AsPC-1 and PSN1 cells were grown in RPMI-1640 Medium supplemented with 10% FBS.
  • Capan-1 were cultured in RPMI-1640 containing 20% FBS while PANC-1 were cultured in DMEM supplemented with 10% FBS.
  • Dissociation of BAG3 antibodies in human sera Sera were diluted 1:40 with dissociation buffer (PBS with 1.5% BSA and 0.2 M glycine-acetate pH 2.5) to a 500 ⁇ final volume and incubated for 20 min at room temperature.
  • the sera were then pipetted into the sample reservoir of Microcon centrifugal filter device, YM-100 (100,000 MW cut-off; Millipore, Billerica, MA, USA) and centrifuged at 14,100 rpm for 20 min at room temperature.
  • the sample reservoir was then separated from the flow through, placed inverted into a second tube and centrifuged at 5, 000 rpm for 3 min at room temperature.
  • the collected solution containing the antibody dissociated was adjusted to pH 7.0 with 1 M Tris buffer, pH 9.0.
  • the retentate volume was reconstituted to the initial volume (500 ⁇ ) with dilution buffer ( PBS with 1.5% BSA and 0.1% Tween-20) .14
  • the dissociated antibodies were diluted 1:200 in TBST containing 5% bovine serum albumin overnight at 4°C.
  • Cells were harvested and lysed in a buffer containing 20 mM HEPES (pH 7.5), 150 mM NaCl, 0.1% Triton (TNN buffer) supplemented with a protease inhibitors cocktail (1 mM phenylmethylsulfonyl fluoride, 1 mg/ml pepstatin A, 2 mg/ml aprotinin) by 3 cycles of freezing and thawing. Soluble proteins were collected after a centrifugation at 10, 000 g for 15 min and their amount was determined by Bradford assay (Bio-Rad, Hercules, CA) . 25 g of total protein and serum samples (1:2 in PBS-T 0.05%) were run on 8% or 10% SDS-PAGE gels and electrophoretically transferred to nitrocellulose membrane.
  • Nitrocellulose blots were blocked with 10% nonfat dry milk in TBST buffer (20 mM Tris-HCl pH 7.4, 500 mM NaCl, and 0.1% Tween 20) and incubated with primary antibodies in TBST containing 5% bovine serum albumin or 5% non-fat dry milk, overnight at 4°C. Immunoreactivity was detected by sequential incubation with horseradish peroxidase-conjugated secondary antibodies purchased from Pierce (Rockford, IL) and ECL detection reagents purchased from Amersham Life Sciences Inc. (Arlington Heights, IL, USA) .
  • Protein bands were excised and gel pieces were subsequently washed with MilliQ Water and Acetonitrile and the proteins were digested in situ as described in Shevchenko protocol. Briefly, gel slices were reduced in 1,4- dithiothreitol (10 mM) and alkylated with iodoacetamide (50 mM) , then washed and rehydrated in trypsin solution (12 ng/ L) on ice for lh. After the addition of 30 ammonium bicarbonate
  • Serum-free medium of H9c2 was cleared of cells and large debris by serial centrifugation at 4°C
  • F(ab')2 fragments from anti-BAG3 monoclonal and polyclonal antibodies (mouse monoclonal AC1, AC2 and rabbit polyclonal TOS2) or F(ab')2 fragments from mouse IgG or F(ab')2 fragments from rabbit IgG in PBS containing 2% FBS+ 0.1 % NaN3 for 30 min on ice.
  • IL6 was measured in supernatant of J774 A.l cells (5xl0 4 / in 96-well microplates) treated with LPS (10 ng/ml) or with rBAG3 (14 nM) or BSA (14 nM) for 10 or 20 hours in absence or presence of polymyxin B sulfate (5 g/ml) . After treatment 50 L of cell culture medium were collected and analyzed in triplicate with a mouse IL6 Kit
  • rBAG3-FITC and BSA-FITC proteins were added in HCMa and J774 Al culture media with 0.1 % NaN 3 for 1 h.
  • Coverslips were washed in lx PBS and fixed in 3.7% formaldehyde in lx PBS for 30 min at room temperature, and then incubated for 5 min with lx PBS 0.1M glycine. Following incubation with a 1:100 dilution of anti-P-integrin monoclonal antibody at 4 °C, coverslips were washed three times with lx PBS.
  • Images were acquired in sequential scan mode by using the same acquisitions parameters (laser intensities, gain photomultipliers , pinhole aperture, objective 63X, zoom 2) when comparing experimental and control material.
  • brightness and contrast of images were adjusted by taking care to leave a light cellular fluorescence background for visual appreciation of the lowest fluorescence intensity features and to help comparison among the different experimental groups.
  • Final figures were assembled using Adobe Photoshop 7 and Adobe Illustrator 10. Leica Q9 Confocal Software and ImageJ were used for data analysis.
  • NUNC Maxisorp 96 well ELISA plates were coated with recombinant BAG3 protein l g/ml (50 l/well) in PBS, pH 7 and incubated overnight at 4°C. Plates were washed 2 times with washing buffer (PBS + 0.05% Tween-20), and then blocked (150 ⁇ /well) for one hour at room temperature with 0.5% fish gelatin in PBS. Following blocking, the plates were washed 2 times with washing buffer and sera were diluted 1:70 with 0.5% fish gelatin in washing buffer and then applied (50 ⁇ /well) in triplicate and incubated at room temperature for two hour. The plates were then washed 6 times with washing buffer.
  • washing buffer PBS + 0.05% Tween-20
  • Anti-human IgG (H+L) antibody (Sigma Aldrich) was diluted 1:20,000 with 0.5% fish gelatin in washing buffer, added at 50 ⁇ /well and incubated at 4°C for 30 minutes. After incubation, the plates were washed 6 times, developed with TMB (50 ⁇ /well) (eBioscience ) , the reaction stopped with 4.5 M sulfuric acid (25 ⁇ /well) and the plates were analyzed spectrophotometrically at 450 nm.
  • N0 2 ⁇ assay Nitrite content (N02 ⁇ ) a stable metabolite of NO released by cells in the culture supernatant, was measured in J774 A.l cells (5x104/ in 96-well microplates) treated with LPS (10 ng/ml) or with rBAG3 (7, 14 and 28 nM) or BSA (28 nM) for 24 hours in absence or presence of polymyxin B sulfate (Sigma-Aldrich, St. Louis, MO, USA) 5 g/ml. N02 ⁇ amounts were measured by Griess reaction.
  • NUNC Maxisorp 96 well ELISA plates were coated with anti-BAG3 monoclonal antibody AC-1, AC-2 or AC-3 in PBS, pH 7 and incubated overnight at 4°C. Plates were washed 2 times with washing buffer (PBS + 0.05% Tween-20), and then blocked (150 ⁇ /well) for one hour at room temperature with 0.5% fish gelatin in PBS. Following blocking, the plates were washed 2 times with washing buffer and sera were diluted 1:70 with 0.5% fish gelatin in washing buffer and then applied (50 ⁇ /well) in triplicate and incubated at room temperature for two hour. The plates were then washed 6 times with washing buffer.
  • washing buffer PBS + 0.05% Tween-20
  • Anti-human IgG (H+L) antibody (Sigma Aldrich) was diluted 1:20,000 with 0.5% fish gelatin in washing buffer, added at 50 ⁇ /well and incubated at 4°C for 30 minutes. After incubation, the plates were washed 6 times, developed with TMB (50 ⁇ /well) (eBioscience ) , the reaction stopped with 4.5 M sulfuric acid (25 ⁇ /well) and the plates were analyzed spectrophotometrically at 450 nm.
  • Immunohistochemistry protocol included: deparaffination in xylene, re-hydration through descending concentrations of alcohol up to pure water, non-enzymatic antigen retrieval in citrate buffer, pH 6.0, for 30 minutes at 95°C, and endogenous peroxidase quenching with H202 in methanol for 20 minutes. After rinsing with PBS, the samples were blocked with 5% normal horse serum in 0.1% PBS/BSA. To detect BAG3, samples were incubated for 1 hour at room temperature with BAG3 monoclonal antibody AC-1, AC-2 or AC-3 at the concentration of 3 microg/ml. After washing thoroughly with PBS, sections were incubated with a biotinylated secondary anti- mouse IgG for 20 minutes, then rinsed, incubated with avidin-biotin-complexes peroxidase
  • RNA concentration and purity were validated by NanoDrop Spectrophotometer (Thermo Fisher, Waltham, MA, USA).
  • RNA was reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit according to the manufacturer's instructions (Applied Biosystems, Applera, Foster City, CA, USA) .
  • Quantitative real-time PCR assay was used to assess the differential expression of BAG3 in tumor tissue samples.
  • Primers for the human bag3 gene were synthesized by Primm srl (Milano, Italy) (forward primer: (SEQ ID NO: 16) CCT GTT AGC TGT GGT TG; reverse primer: (SEQ ID NO: 17) AAC ATA CAG ATA TTC CTA TGG C) .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
PCT/EP2013/061976 2012-06-19 2013-06-11 Bag3 as biochemical serum and tissue marker Ceased WO2013189778A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
KR1020157001313A KR102150903B1 (ko) 2012-06-19 2013-06-11 혈청 및 조직 생화학 마커로서 bag3
BR112014031958A BR112014031958A2 (pt) 2012-06-19 2013-06-11 bag3 como marcador de tecido e soro bioquímico
JP2015517672A JP6654432B2 (ja) 2012-06-19 2013-06-11 生化学的血清マーカーおよび組織マーカーとしてのbag3
PL13728180T PL2861618T3 (pl) 2012-06-19 2013-06-11 BAG3 jako surowiczy i tkankowy marker biochemiczny
CA2876922A CA2876922C (en) 2012-06-19 2013-06-11 Bag3 as biochemical serum and tissue marker
EP13728180.4A EP2861618B1 (en) 2012-06-19 2013-06-11 Bag3 as biochemical serum and tissue marker
AU2013279604A AU2013279604B2 (en) 2012-06-19 2013-06-11 BAG3 as biochemical serum and tissue marker
CN201380032138.3A CN104507965B (zh) 2012-06-19 2013-06-11 作为血清和组织生化标志物的bag3
ES13728180T ES2795981T3 (es) 2012-06-19 2013-06-11 BAG3 como marcador bioquímico de suero y tejidos
IN10561DEN2014 IN2014DN10561A (https=) 2012-06-19 2014-12-11
US14/572,654 US10359433B2 (en) 2012-06-19 2014-12-16 BAG3 as biochemical serum and tissue marker

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP12172531.1 2012-06-19
EP12172531.1A EP2676966A1 (en) 2012-06-19 2012-06-19 BAG3 as biochemical serum and tissue marker

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/572,654 Continuation US10359433B2 (en) 2012-06-19 2014-12-16 BAG3 as biochemical serum and tissue marker

Publications (1)

Publication Number Publication Date
WO2013189778A1 true WO2013189778A1 (en) 2013-12-27

Family

ID=48607259

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/EP2013/061976 Ceased WO2013189778A1 (en) 2012-06-19 2013-06-11 Bag3 as biochemical serum and tissue marker
PCT/EP2013/061971 Ceased WO2013189775A1 (en) 2012-06-19 2013-06-11 Bag3 as biochemical serum and tissue marker

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/EP2013/061971 Ceased WO2013189775A1 (en) 2012-06-19 2013-06-11 Bag3 as biochemical serum and tissue marker

Country Status (12)

Country Link
US (2) US20150132764A1 (https=)
EP (3) EP2676966A1 (https=)
JP (2) JP2015521475A (https=)
KR (2) KR20150036102A (https=)
CN (2) CN104619861A (https=)
AU (2) AU2013279604B2 (https=)
BR (2) BR112014031958A2 (https=)
CA (2) CA2876872A1 (https=)
ES (1) ES2795981T3 (https=)
IN (2) IN2014DN10561A (https=)
PL (1) PL2861618T3 (https=)
WO (2) WO2013189778A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021140173A1 (en) 2020-01-10 2021-07-15 Biouniversa S.R.L. Methods and uses for treating fibrotic solid tumors with bags inhibitors
WO2026074330A1 (en) 2024-10-01 2026-04-09 Fibrosys S.R.L. Antibodies and diagnostic methods for detecting bag3 protein in clinical samples

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ITMI20130403A1 (it) 2013-03-18 2014-09-19 Biouniversa Srl Anticorpi anti-bag3 per uso terapeutico
CN105021825B (zh) * 2015-07-09 2016-08-17 陈勇 一种检测胰腺癌相关多肽dap44的elisa试剂盒
CN105769900A (zh) * 2016-03-22 2016-07-20 山西大学 Bag3基因在制备抗膀胱癌药物中的应用
IT201600069391A1 (it) * 2016-07-04 2016-10-04 Univ Degli Studi Di Salerno Uso della proteina bag3 e suoi frammenti peptidici per il controllo dell’omeostasi vascolare
US11940450B2 (en) 2021-03-16 2024-03-26 University Of Connecticut Biomarker panel for non-invasive diagnosis of congenital renal dysfunction
CN113862361B (zh) * 2021-10-25 2023-08-15 中山大学孙逸仙纪念医院 一种诊断和治疗膀胱癌的分子标志物hsf1及其用途

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1323733A1 (en) * 2001-12-28 2003-07-02 Arturo Leone BAG3 nucleotide and protein sequences to be used in research, diagnostics and therapy for cell death-involving diseases
WO2011067377A1 (en) * 2009-12-04 2011-06-09 Biouniversa S.R.L. Biochemical serum marker
WO2012049664A2 (en) * 2010-10-15 2012-04-19 Sense Proteomic Limited Auto-antigen biomarkers for lupus

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5652223A (en) * 1994-03-14 1997-07-29 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services DNA encoding CAI resistance proteins and uses thereof
AU5789500A (en) * 1999-07-09 2001-01-30 Burnham Institute, The A method for determining the prognosis of cancer patients by measuring levels ofbag expression
US20030073623A1 (en) * 2001-07-30 2003-04-17 Drmanac Radoje T. Novel nucleic acid sequences obtained from various cDNA libraries
US7718387B2 (en) * 2001-09-20 2010-05-18 Board Of Regents, The University Of Texas System Measuring circulating therapeutic antibody, antigen and antigen/antibody complexes using ELISA assays
US20090047689A1 (en) * 2007-06-20 2009-02-19 John Kolman Autoantigen biomarkers for early diagnosis of lung adenocarcinoma
WO2011044927A1 (en) * 2009-10-12 2011-04-21 INSERM (Institut National de la Santé et de la Recherche Médicale) A method for the diagnosis or prognosis of an advanced heart failure

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1323733A1 (en) * 2001-12-28 2003-07-02 Arturo Leone BAG3 nucleotide and protein sequences to be used in research, diagnostics and therapy for cell death-involving diseases
WO2011067377A1 (en) * 2009-12-04 2011-06-09 Biouniversa S.R.L. Biochemical serum marker
WO2012049664A2 (en) * 2010-10-15 2012-04-19 Sense Proteomic Limited Auto-antigen biomarkers for lupus

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
M. FESTA ET AL.: "BAG3 protein is overexpressed in human glioblastoma and is a potential target for therapy.", THE AMERICAN JOURNAL OF PATHOLOGY, vol. 178, no. 6, 10 May 2011 (2011-05-10), USA, pages 2504 - 2512, XP002685427 *
MARCO M; TURCO MC; ROSATI A: "BAG3 protein is induced during cardiomyoblast differentiation and modulates myogenin expression", CELL CYCLE, vol. 10, 2011, pages 850 - 852
MENON ET AL., BMJ, vol. 337, 2008, pages A2079
ROSATI A; GRAZIANO V; DE LAURENZI V; PASCALE M; TURCO MC, CELL DEATH DIS, vol. 2, 2011, pages E141

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021140173A1 (en) 2020-01-10 2021-07-15 Biouniversa S.R.L. Methods and uses for treating fibrotic solid tumors with bags inhibitors
WO2026074330A1 (en) 2024-10-01 2026-04-09 Fibrosys S.R.L. Antibodies and diagnostic methods for detecting bag3 protein in clinical samples

Also Published As

Publication number Publication date
CA2876922A1 (en) 2013-12-27
KR102150903B1 (ko) 2020-09-03
IN2014DN10562A (https=) 2015-08-28
JP6654432B2 (ja) 2020-02-26
CA2876872A1 (en) 2013-12-27
PL2861618T3 (pl) 2020-09-21
CN104619861A (zh) 2015-05-13
KR20150036111A (ko) 2015-04-07
CN104507965A (zh) 2015-04-08
ES2795981T3 (es) 2020-11-25
AU2013279604A1 (en) 2014-12-18
AU2013279604B2 (en) 2018-03-29
JP2015529633A (ja) 2015-10-08
EP2676966A1 (en) 2013-12-25
AU2013279601A1 (en) 2015-01-15
WO2013189775A1 (en) 2013-12-27
KR20150036102A (ko) 2015-04-07
EP2861618B1 (en) 2020-03-11
CN104507965B (zh) 2019-04-26
IN2014DN10561A (https=) 2015-08-28
EP2861754A1 (en) 2015-04-22
JP2015521475A (ja) 2015-07-30
BR112014031957A2 (pt) 2017-08-01
EP2861618A1 (en) 2015-04-22
CA2876922C (en) 2022-09-20
US10359433B2 (en) 2019-07-23
US20150147767A1 (en) 2015-05-28
US20150132764A1 (en) 2015-05-14
BR112014031958A2 (pt) 2017-08-01

Similar Documents

Publication Publication Date Title
US10359433B2 (en) BAG3 as biochemical serum and tissue marker
ES2415375T3 (es) Un procedimiento para diagnosticar placas ateroescleróticas midiendo CD36
CN101389958B (zh) 使用轴突导向因子netrin-1的活性筛选抗癌化合物的方法
CN106461681B (zh) 用于诊断血管疾病的生物标志物及其用途
JP5946937B2 (ja) 線維性疾患および癌における治療選択肢としてのccr6を介するccl18シグナル伝達の遮断
JP7073528B2 (ja) 同種移植片レシピエントを分類するためのバイオマーカー
Gong et al. LIM kinase 2 activates cardiac fibroblasts and exacerbates postinfarction left ventricular remodeling via crosstalk between the canonical and non-canonical Wnt pathways
Huang et al. Cardiomyocyte-derived Galectin-9 induces macrophage M2 polarization via the TIM3 pathway to attenuate myocardial remodeling post-myocardial infarction
JP2018532100A (ja) 接触系活性化の評価のためのプロテアーゼ阻害剤を含む真空採血管
CN117491634A (zh) LDHA+EVs作为生物标志物在脑胶质瘤术后复发风险预测、检测与评估中的应用
AU2012271293B2 (en) Biomarkers for epithelial cancer diagnosis and treatment
EP2526423B1 (en) Methods & devices for diagnosing cardiac disorders
Jeong et al. GCC2 is a New Biomarker for Diagnosis of Early Non-Small Cell Lung Cancer and A Potential Target to Reverse Epithelial to Mesenchymal Transition
Petrsoric Do Urine Vesicles Offer a Fingerprint of Chronic Kidney Disease Progression?
Carreras-Planella Study of urine extracellular vesicles-derived protein biomarkers for the non-invasive monitoring of kidney-transplanted patients
JP2013545992A (ja) バイオマーカー、バイオマーカーの使用及びバイオマーカーを同定する方法
US20140335090A1 (en) Therapeutic agent for cancer, and method for determining prognosis of cancer
HK1250779B (zh) 用於预测慢性肾病发生风险的方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13728180

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2013728180

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2876922

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2013279604

Country of ref document: AU

Date of ref document: 20130611

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2015517672

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20157001313

Country of ref document: KR

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112014031958

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112014031958

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20141219