WO2013185337A1

WO2013185337A1 - Edwardsiella tarda mutant strain and application thereof

Info

Publication number: WO2013185337A1
Application number: PCT/CN2012/076961
Authority: WO
Inventors: 王启要; 刘琴; 张元兴; 王亚敏; 吴海珍; 肖婧凡
Original assignee: 华东理工大学
Priority date: 2012-06-15
Filing date: 2012-06-15
Publication date: 2013-12-19
Also published as: CN104919036A; CN104919036B

Abstract

Provided are an Edwardsiella tarda mutant strain and application thereof, and particularly a mutant strain having a biological barrier and an attenuated mutant strain having a biological barrier.

Description

Duchendella mutant strain and its application

The present invention relates to fish vaccines and marine life safety precautions. More specifically, the present invention relates to a retarded Edwards with a biological barrier

Torifa) mutant strain and its application. Background technique

In order to achieve sustainable development of marine aquaculture, to curb the growing trend of aquaculture fish diseases caused by various environmental factors and breeding density, the World Food Organization has combined the successful experience of fisheries development in developed countries (Ormonde P. Fisheries resources: Trends in production, utilization and trade. In: Nomura I (ed.). The State of World Fishery and Agriculture 2002. Rome: FAO Information Division, 2002, p3~p45), advocates "system management approaches" The SMA) farming model prevents the occurrence of various diseases. One of the main elements of this measure is the promotion of the application of various immunological control technologies represented by vaccination. The adoption of these measures will greatly reduce the use of chemical drugs, avoiding environmental pollution and increasing the safety of aquatic products. As a cost-effective disease control strategy and tool that is environmentally friendly and sustainable, vaccination is becoming a major frontier and application area for research and development in the world in modern aquaculture practices.

At present, vaccination has become the main means of preventing and controlling aquaculture diseases and outbreaks worldwide due to its safety, reliability and durability. The vaccine is characterized by strong targeting, long disease resistance cycle, immunization, significant effect and active prevention. Inactivated vaccines based on pathogen inactivated cells provide an effective means for aquaculture disease control, but inactivated vaccines generally have inconvenient administration (injection administration has better immune protection; The technical application defects are extremely inconvenient for the need to immunize thousands of fish farming industries, and the cost of administration is often not borne by the aquaculture industry. Moreover, injections can not be administered to fry and juveniles with serious diseases, and inactivated vaccines for many diseases are often ineffective or ineffective. All of this has hampered the widespread use of aquaculture disease immuno-control techniques.

The industrial characteristics of aquaculture require disease prevention and control technology to be economical and easy to implement. Therefore, in addition to high-cost technical requirements, the development of vaccine products must be inexpensive and must not exceed the tolerance of the aquaculture industry. Reduced (weak) live vaccines are easy to administer (soakable;) and have high immunopotency (can be The new technology advantages of reducing the dose of administration, low cost, and development of broad-spectrum vaccines (the live vaccines are often cross-protective;) have become the hotspots and frontiers in the research and development of vaccines for aquaculture in the world.

Edwards is a common class of pathogens causing bacterial diseases in farmed fish. It is classified as retarded (depressed;) Edwards C&c warc3⁄4/e//a torcfa;), E. sinensis/cto/ Wr/) and P. falciparum (; hoshinae). The hemorrhagic sepsis caused by fish is called Edwards disease (edwardsiellosis). The disease spreads widely, has no obvious seasonality, high infection rate and mortality, and is harmful. There are many species, such as squid, tilapia, squid, squid, squid, squid, squid, etc. Most of the fish with high economic value. In addition, Edwards are also infected with shellfish, reptiles, amphibians. Birds, mammals. It is worth noting that Edwards is an important zoonotic pathogen, which is the only member of the genus Edwards that infects humans. Currently, the disease of cultured fish in China is Edwards disease. The more serious pathogen is mainly Edwards deficient. The US patent has a natural attenuated mutant of wild strains screened by rifampicin as a live attenuated vaccine. Road (Evans J J, Klesius, P H and Shoemaker C A. Modified live Edwardsiella tarda vaccine for aquatic animals, 2006, United States Patent 7067122). There is no effective control measures of the disease in our country.

Currently, the factors identified for the virulence of E. sinensis include hemolysin, chitinase, iron carrier, catalase, cell adhesion factor, type III secretion system (0 SS) and type 6 secretion system (T6SS). (Edwardsiella tarda -Virulence mechanisms of an emerging

Gastroenteritis pathogen, Microbes and Infection, 2012, 14:26-34.). Furthermore, the attachment to the host cell surface has an important contribution to the infection of E. sinensis, and its adhesion is mediated by pili, manifested as mannose-insensitive or sensitive blood cell agglutination. The recently completed genome-wide sequencing of E. sinensis EIB202 provides a genetic level of research for the identification of virulence factors (Genome sequence of the versatile fish pathogen Edwardsiella tarda provides insights into its adaptation to broad host ranges and intracellular niches. PLoS ONE 2009, 4(10): e7646). In the EIB202 genome annotation, the Twin-arginine translocation (Tat) has been shown to play an important role in the secretion of 33 putative Tat system substrates and their co-transporters. The role of the Tat system of the genus Edwards in its physiological adaptability and virulence remains to be identified.

There are currently no vaccines developed against Edwards in the world, only the related reports on inactivated Edwards and subunit vaccines (Development of an effective E. tarda vaccine for cultured turbot (Scophthalmus maximus), Fish & Shellfish Immunology. 2008, 25:208-212). And related research reveals the esrB mutant as a target for Edward The potential application value of a live attenuated Edwardsiella tarda vaccine, CN200710015285.6; Construction and characterization of a live, attenuated esrB mutant oi Edwardsiella tarda and its potential as a vaccine against the haemorrhagic septicaemia in turbot, Scophthamus maximus (L.), Fish &

Shellfish Immunology, 2007, 23:521-530). In addition, the study also found that the degraded Edwards strains ATCC 15947 and E22, and a rifampicin-resistant mutant TX5RM can be used as a live attenuated vaccine candidate, which can be administered to the gums by oral, soaking or injection. Provides effective immunity protection (Analysis of the vaccine potential of a natural avirulent Edwardsiella tarda isolate. Vaccine, 2010, 28: 2716-2721; The efficacy of five avirulent Edwardsiella tarda strains in a live vaccine against Edwardsiellosis in Japanese flounder,

Paralichthys olivaceus. Fish & Shellfish Immunology, 2010, 29: 687-693; Isolation and analysis of the vaccine potential of an attenuated Edwardsiella tarda strain. Vaccine, 2010, 28: 6344-6350). U.S. Pat. No. 6,019,981 shows a currently commercialized vaccine against labeled Edwards ictaluri against enteric septicemia in channel catfish. U. S. Pat. No. 6,019,981, 2000. However, these vaccines have the potential for virulence back mutations, and none of the above vaccines take into account environmental and biosafety.

We have previously constructed two live attenuated vaccines based on the strategy of marker-free gene deletion mutations based on the wild-type strain of Edwards, and the marker-free gene deletion attenuated mutant strain of the wild strain of Edwards Preparation and application thereof, CN 201010541646.2, 2010; a marker-free gene deletion attenuated mutant strain of A. sinensis wild strain, related preparation and application thereof, ZL 200910052707.6, 2009), all of which lack aromatic amino acid synthase AroC. In subsequent studies it was found that their attenuating effects were too significant to be cleared quickly in the host and did not produce longer-term protection.

In live attenuated vaccines and other genetically modified organisms,

In the development and application of GMO technology, in order to prevent microorganisms from escaping into the natural environment, it is necessary to develop a biological containment. Molin et al. (Molin SR, Andersson PK, Gerdes KAS, Klemm P.. Biological containment, 1995, US Pat. 5,670,370; Molin SR, Andersson PK, Gerdes KAS, Klemm P.. Biological containment, 1995, US Pat. 5,702,916 The use of the controllable replicon gene ParB to provide a biological barrier. In addition, other types of toxin-antitoxin systems, such as lytic protein E, can also be used in the construction of biological barriers (Guan et al. 201 1, Iron-regulated lysis of recombinant Escherichia coli in host releases). Protective antigen and confers biological containment, Infect Immun, 201 1, 79: 2608-2618). The above-mentioned biological restriction system adopts a complicated regulation loop, which makes the specificity and efficiency of the suicide component difficult to control, and at the same time increases the mutation rate of the suicide loop. Based on aromatic amino acid synthase (such as AroA, AroC, AroD), pyrimidine synthase (ThyA;), purine synthase (PurA and PurE), aspartate-b-semialdehyde synthase (Asd) and other mutations The biological barrier of the resulting auxotrophic mutant produces a significant effect on basal metabolism.

Therefore, the development of a biological barrier that is safe and effective, has a low rate of reversion, and has little effect on the basal metabolism of the strain itself has become an urgent problem to be solved. Summary of the invention

The present invention provides a mutant strain having a biological barrier and a low reversion mutation rate, which is constructed by using a wild-type strain of E. faecalis as a starting strain and utilizing a marker-free gene deletion mutation strategy. The mutant has a marine biological barrier mechanism, that is, it can exist stably in a low-salt environment (such as in a fish body), and is unstable and dead in a high-salt environment (such as a seawater environment), and is easily removed by the seawater environment. It can prevent the escape of live attenuated vaccine strains in natural seawater environment and improve the environmental and biosafety of live attenuated vaccine strains. In the embodiment of the present invention, the wild strain E.202 of E. faecalis is used, and the strain is isolated from the diseased fish of Edwards disease which is outbreaked in the fishery farm in the Yellow Sea of China, and is a highly toxic strain of E. faecalis strain C&c Warc3⁄4/e〃a tarda EIB202, Xiao Yufan et al., "Isolation and identification of fish pathogen Edwardsiella tarda from mariculture in China", "Aquaculture Research" Vol.40, 2009), and deposited in China on May 1, 2008 Typical Culture Collection (CCTCC) with accession number CCTCC-M 208068.

Specifically: The present invention includes the following:

A mutant strain of Edwards, characterized in that its tatABCD gene is inactivated and thus does not express a TatABCD protein.

In one embodiment, the toD gene of the E. sinensis mutant is deleted. In one embodiment, the E. faecalis mutant is E. faecalis EIBAV1 1092701 with accession number CCTCC M 201 1338.

In one embodiment, the E. faecalis mutant further lacks the E. faecalis endogenous plasmid pEIB202.

In one embodiment, the E. faecalis mutant is further characterized by inactivation of its eseBCD and escA genes and thus does not express EseBCD and EscA proteins, and does not contain the endogenous plasmid pEIB202 of the wild strain of E. faecalis. In one embodiment, the eseBCD and escA genes of the E. faecalis mutant are deleted.

In one embodiment, the E. faecalis mutant is E. faecalis EIBAV11092801 with accession number CCTCC M 2011339.

An immunological composition comprising the mutant strain of E. sinensis of the present invention as an immunogenic component. In one embodiment, the concentration of the E. faecalis mutant in the immunological composition is

The use of the E. sinensis mutant of the present invention for the manufacture of a medicament against fish Edwards disease.

A method for controlling fish Edwards disease using the mutant E. faecalis mutant of the present invention.

Advantages of the invention include, but are not limited to:

1. An unlabeled mutant strain of E. sinensis with a biological barrier is provided, which improves the biosafety of the attenuated strain constructed on the basis of the system and prevents its escape in the seawater environment.

2. The attenuated strain of the degraded Edwards strain of the invention has a significantly reduced virulence compared to the wild strain, and at the same time provides effective immune protection, and can effectively protect the fish from the retarded Edwards disease caused by the Edwardian strain. Invasion, significant immune effect, very good retardation of Edwards disease for the immunized fish body;

3. The attenuated strain of E. sinensis of the present invention does not carry any antibiotic resistance marker, endogenous plasmid PEIB202 and other markers, and has no potential risk of transmitting antibiotic resistance to the environment; no exogenous gene fragment, virulence Large fragments of related genes are deleted, virulence is not recoverable, and it is easy to be removed due to the high salinity of seawater in seawater environment, which greatly eliminates the possibility of transmitting a large number of toxic pathogens to the environment, with technical environment and product biosafety. , has practical commercial development application value;

4. The attenuated strain of E. sinensis of the present invention has a clear genetic background, and is easy to distinguish between a vaccine strain and a wild strain, and is convenient for monitoring the environment and improving the environmental biosafety and controllability of the vaccine;

Figure 1: Schematic representation of the preparation of the tatABCD deletion fragment F1F2 by the Overlap PCR technique in the examples. Figure 2: Schematic representation of two homologous recombination constructs to ^CZ) gene deletion mutants in the examples. Figure 3: In the examples, the cat gene (chloramphenicol resistance gene;) and the suicide plasmid were used to screen the no endogenous plasmid protocol.

Figure 4A-C: Growth status of E. faecalis wild strain EIB202 and tatABCD deletion strain EIBAV11092701 at different salt concentrations. Figure 5A-C: Detection of culturable conditions of E. faecalis wild strain EIB202 and tatABCD deletion strain EIBAV1 1092701 at different temperatures (A. 28 ° C; B. 16 ° C; C. 10 ° C) and different salt concentrations. detailed description

One of the embodiments of the present invention provides a mutant strain of Edwards with a tatABCD gene which is inactivated and thus does not express a TatABCD protein. The experiment of the present invention proves that when the Tat system of Deinococcus dysenella is deficient, for example, when the TatABCD protein is deleted, it becomes sensitive to salinity, and specifically shows growth inhibition with an increase in salt concentration, thereby forming the marine environment of the present invention. Biological barrier. The marine environmental biological barrier of the present invention is characterized in that the mutant strain or the vaccine based on the mutant strain normally grows and reproduces under low salinity conditions in fish, but in the high salinity environment of seawater, growth inhibition, rapid decay and extinction This avoids biosafety risks such as genetic escape. The present invention exemplifies, in the examples, a gene deletion method for inactivating the toD gene, i.e., a mutant strain of E. faecalis having a to^CZ) gene deletion mutation. However, it is known to those skilled in the art that other gene inactivation techniques, such as mutagenesis, antisense nucleic acid, and RNA interference techniques, can be used to cause a toL CZ) gene deletion or a Tat system defect, thereby achieving the same as shown in the examples of the present application. Or quite the effect. As one of the examples, the present invention provides a mutant strain of E. faecalis containing a deletion mutation of the tatABCD gene, named EIBAV1 1092701, deposited at the China Center for Type Culture Collection (CCTCC) on September 29, 2011. Deposit number CCTCC M 201 1338. In one embodiment, the depressive E. faecalis tatABCD gene deletion mutant of the present invention does not contain the endogenous plasmid pEIB202.

Another embodiment of the present invention provides attenuated mutant strain of Edwards, which has an inactivation of the tatABCD gene and thus does not express a TatABCD protein, and the eseBCD and escA genes are inactivated and thus do not express EseBCD and EscA proteins, and are not dull. Endogenous plasmid pEIB202 of the wild strain of Edwards. The experiment of the present invention proves that the defect of TTSS system of Edwards erythropolis, such as the deletion of EseBCD and EscA protein, and the endogenous plasmid pEIB202 of the wild strain of E. sinensis, the virulence is significantly reduced, but has significant immunoprotective effect. Therefore, it is a suitable attenuated vaccine strain raw material. The present invention exemplifies, in the examples, the inactivation of the e D and escA genes by gene deletion, that is, the mutant strain of E. faecalis having D and gene deletion mutations. However, those skilled in the art know that other gene inactivation techniques, such as mutagenesis, antisense nucleic acid and RNA interference techniques, etc., can also be used to cause EseBCD and EscA protein deletion or TTSS system defects, thereby achieving the embodiment shown in the present application. The same or equivalent effect. As one of the examples, the present invention provides a wild type strain containing the tatABCD, eseBCD and gene deletion mutations and which does not contain the Edwards The attenuated E. faecalis strain of the source plasmid PEIB202, named EIBAV11092801, was deposited with the China Center for Type Culture Collection (CCTCC) on September 29, 2011, under the accession number CCTCC M 2011339.

The mutant strain of the present invention can be cultured in accordance with the conventional culture method of Edward Edwards. For example, the medium may be selected from LB medium, and the peptone may be casein, tryptone or soy protein, and may be supplemented with NaCl to 0.5%. One of the embodiments of the present invention selects tryptone.

Another embodiment of the present invention provides an immunological composition comprising the mutant strain of Edwards of the present invention as an immunogenic component, preferably an attenuated mutant of the present invention. The immunological compositions of the present invention may also comprise a variety of suitable carriers and immunological adjuvants. The carrier is for example water and physiological saline. One of the examples of the present invention uses physiological saline having a concentration of 0.9% (9 g/L) of NaCl as a carrier. The pH of the immunological composition is preferably physiological pH, especially the physiological pH of the target fish, such as pH 6-8, pH 7-7.2.

One of the forms of the immunological composition of the present invention is a ready-to-use composition, wherein the concentration of the attenuating mutant of the present invention as an immunogenic component can be determined experimentally by conventional techniques, or can be experimentally determined with reference to practical experience in the art. For example, in the immunological composition of the present invention, the concentration of the attenuated mutant strain of Edwards deficient is 10 ³ -10 ⁹ CFU/ml, or 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ or 10 ⁹ CFU/ml, or an interval composed of any two of the above, for example, 10 ³ - 10 ⁸ CFU/ml. In one of the soaking liquid compositions, the concentration of the attenuated mutant was on the order of 10 ⁶ - 10 ⁸ CFU/ml.

Another embodiment of the present invention provides a method for controlling fish Edward's disease by using the attenuated mutant strain of E. sinensis of the present invention to immunize fish. The attenuated mutant strain of the present invention can be used as a vaccine, and its configuration and a suitable immunological composition can also be used. Conventional immunization practices in the aquaculture industry are applicable to the present invention, such as injection and soaking. A suitable use concentration is 10 ³ - 10 ⁹ CFU/ml, or 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ or 10 ⁹ CFU/ml, or any interval formed by any two of the above, For example, 10 ³ -10 ⁸ CFU/mL For example, when immunizing with an injection, the dose of the attenuating mutant is on the order of 10 ³ CFU/g (body weight), for example, 5 χ 10 ³ CFU/g. For another example, in the case of immersion immunization, the concentration of the attenuating mutant is in the order of 10 ⁶ - 10 ⁸ CFU/mL. In one of the examples, the soaking time of the attenuated mutant of the present invention is 15 to 120 minutes.

Another embodiment of the present invention is the use of the mutant strain of Edwards of the present invention, particularly an attenuated mutant strain, for the manufacture of a medicament against fish Edward's disease, such as a fish vaccine against Edwards. In order to more clearly understand the technical content of the present invention, the following embodiments are specifically described. Example 1 Construction of attenuated mutant strain without marker gene deletion

(1) Construction of tatABCD gene deletion strain

1) PCR amplification to obtain the desired gene fragment

As shown in Figure 1, the wild strain of E. faecalis EIB202 (Accession No. CCTCC-M)

208068, deposited at the China University of Culture Collection, Wuhan University, dated May 1, 2008;) The genome is a template, using the following amplification primers:

P I : GGAAGATCTCGTCT AC AGC AC AGC ATGGA , SEQ ID NO: 1 P2 : GCTTC AGCC AATCCGAACCC AGAGT ACGC A , SEQ ID NO: 2

P3: GGGTTCGGATTGGCTGAAGC AGGTGACTGA, SEQ ID NO: 3 P4: ACATGCATGCATCGCTGCTGTACGCCTCTT, SEQ ID NO: 4 tatABCD-deV: CCTGTTC AAT ACCGC ACGGCGTTTT, SEQ ID NO: 5 tatABCD-deR: TGCGGCCATCCATCATATCGCTCGG, SEQ ID NO: 6 First, PI and P2, respectively , P3 and P4 amplification obtained the upstream and downstream fragments F l, F2 required for Overlap PCR. Use TIANGEN's Glue Recovery Kit to recycle the target fragments as directed.

The tatABCD deletion fragment F 1F2 obtained from the templates F 1 and F2, primers P I and P4 by Overlap PCR. The target fragment was recovered using TIANGEN's Glue Recovery Kit.

2) Construction of a suicide tool plasmid

After the Bglll site of the pDMK vector multiple cloning site and the Sphl site were cleaved, the target fragment F 1F2 and the ligated plasmid were ligated overnight at 16 ° C with T4 DNA ligase. The CaCl ₂ transformation method was used to transform Escherichia coli SMlO ^ r, and a positive clone transformed with the plasmid vector pDMKAtatABCD was screened on chloramphenicol and kanamycin plates.

3) Bonding

The SM10 Xpir carrying the pDMKAtatABCD plasmid was mixed with wild strain EIB202 at a ratio of 4:1 by volume centrifugation, the supernatant was removed, and the pellet was resuspended in 10 μl of fresh LB medium. The 0.22 micron sterilized hydrophilic filter was placed on fresh semi-solid LB medium, and all the bacterial suspensions were taken out and placed in the center of the hydrophilic filter. After incubation at 37 ° C for 24 hours, the colonies on the hydrophilic filter were eluted with 0.2 M of MgCl ₂ and applied to a kanamycin, polymyxin double-resistant plate.

4) Two rounds of screening to obtain clones of toL D gene deletion mutants

As shown in Figure 2, the suicide plasmid pDMKAtatABCD was inserted into the genome according to the principle of homologous recombination. On the toL CZ) gene cluster. The kanamycin, polymyxin double-resistant plate was screened, and the PCR amplification of P 1/P4 was used to identify the tatABCD gene inserted into the clone in which the F 1 F2 fragment lacking tatABCD was inactivated. Next, the strain in which the second homologous recombination occurred was reverse-screened on a 10% (; w/v) sucrose LB semi-solid medium plate using the SacB protein encoded on pDMK. The mutant strain was obtained by PCR with the primer tatABCD-deF/R. One of the clones was named EIBAV1 1092701 and deposited with the China Center for Type Culture Collection (CCTCC) on September 29, 2011, with the accession number CCTCC M 201 1338. .

(II) Construction of tatABCD gene deletion and plasmid elimination strain

1) As shown in Figure 3, using the primer catA-P l (GGAAGATCTTCTTTACCAAGCACAT,

SEQ ID NO: Ί), catA-P2 (ACATGCATGCGCTCAGGTTAAATTAAAGGG, SEQ ID NO: 8), the plasmid pEIB202 in the wild Escherichia coli strain EIB202 was used as a template to obtain the corresponding gene fragment CAT (encoding chloramphenicol resistance) Sex gene fragment). The construct was ligated to pDMK according to the method described in (a) to obtain plasmid pDMKCATIII.

2) The plasmid pDMKCATIII was transferred from SM10 Xpir to the EIBAV1 1092701 receptor strain obtained above by the method of conjugation described in (a). According to the principle of homologous exchange, the plasmid pDMKCATIII was inserted into the corresponding fragment of the endogenous plasmid pEIB202 in strain EIBAV1 1092701, cultured at 41 ° C for 24 hours, and then re-inoculated into a medium without antibiotics, and repeated three times. The SacB-negative strain was screened on a 10% (w/v) sucrose LB plate using the SacB selection marker, and the CJ-P1 (CGGCAGCTTCAATAACCA, SEQ ID NO: 9) was used.

C6-P2 (GGAACTCCGTAACGTCGAA, SEQ ID NO: 10) was subjected to PCR verification, and plasmid extraction was confirmed to be a plasmid-eliminating strain atABCD Aplas.

(III) Construction of attenuated vaccine strain EIBAV11092801

A mutant strain directed at the eseBCD and escA genes was constructed based on the AtABCD Aplas, using the following amplification primers:

P5 : GGAAGATCTCGCCTTTCACACGTTACAGCAAGAG, SEQ ID NO:

1 1,

P6: GCTGGGC ATCCGATT AGCC ACCTGCTGGGA, SEQ ID NO: 12, P7: C AGGTGGCT AATCGGATGCCC AGC AAAAGA , SEQ ID NO: 13

P8 : ACATGCATGCCCTGCGACTGACGCGACATGTCATT , SEQ ID NO: 14.

TTSS-deF: CCTGTTCAATACCGCACGGCGTTTT, SEQ ID NO: 15, TTSS-deR: TGCGGCC ATCC ATC AT ATCGCTCGG, SEQ ID NO: 16. First, the upstream and downstream fragments F3 and F4 required for Overlap PCR were amplified by P5 and P6, P7 and P8, respectively. After recovering each fragment, the TTSS deletion fragment F3F4 was obtained by using the Overlap PCR technique and the primers P5 and P8. The construct was constructed on pDMK as described in (;1;) to obtain plasmid pDMKATTSS.

The SM KUp/r carrying the pDMKATTSS plasmid was mixed and centrifuged at a ratio of 4:1 by volume to the Ato CD Aplas, and the kanamycin and polymyxin were used as described in (;1). Resistant plate screening, and PCR amplification with P5/P8 as primers, identified clones in which the TTSS gene was inactivated by insertion of F3F4. Subsequently, a strain in which a second homologous recombination occurred was obtained by reverse-screening on a 10% sucrose LB semi-solid medium plate using SacB encoding pDMK. The deletion mutant strain obtained by PCR was verified by the primer TTSS-deF/TTSS-deR, and one of the clones was named EIBAV1 1092801. It was deposited with the China Type Culture Collection (CCTCC) on September 29, 201, with the accession number CCTCC M 201 1339.

(iv) ifli BO) ⁺ replenishment strain construction

Based on the AtatABCD mutant, the primers toL 5CD-comF (CCGGAATTCGCTGGGTGCCGCCGGATACCAATG, SEQ ID NO: 17) and the primer toL 5CD-comR (ACGCGTCGACTCGCGGAACGGACCGTAGTAGCAAG, SEQ ID NO: 18) were used to E. tarda EIB202 (CCTCC M 208068) genome. A gene sequence containing the toL D gene promoter region and its complete open reading frame was amplified for the template, and the target fragment was subsequently subjected to sequencing analysis. This fragment was double digested with the complement plasmid pMMBK by Ecom and Sc l and ligated with T4 DNA ligase at 16 ° C overnight, CaCl ₂ conversion method was transformed /zer/c/w'a coli SM 10 Xpir, in chloramphenicol Positive clones transformed with the plasmid vector pMMBKtatABCD (the plasmid containing the tatABCD fragment) were screened on kanamycin plates. The plasmid pMMBKtatABCD was ligated from SM10 Xpir into the atABCD Aplas receptor strain obtained above by the method described in the binding (I). Screening with kanamycin, polymyxin double-resistance plate, and PCR amplification with pMMB206-F (CCCCAGGCTTTACACTT, SEQ ID NO: 19) and pMMB206-R (GCTTCTGCGTTCTGATTT, SEQ ID NO: 20) The obtained replenishing strain was named as the tatABCD+ clone. Example 2 Preparation of live attenuated vaccine

(1) Preparation of medium and physiological saline:

1) LB slant medium: tryptone (Difco) 10 g / L, yeast extract (Merck) 5 g / L, NaCl 5 g / L, agar 18 g / L, pH 7.5 _;

2) Seed medium: Tryptone (Difco) 10 g / L, yeast extract (Merck) 5 g / L, NaCl 5 g / L, pH 7.5;

3) Fermentation medium: Tryptone (Difco) 10 g / L, yeast extract (Merck) 5 g / L, NaCl 5 g / L, pH 6.8;

4) Saline: NaC19 g/L, pH 7.2, sterilized at 121 °C for 20 minutes.

(ii) Preparation of vaccine compositions:

An attenuated vaccine strain EIBAV11092801 seed stored on LB slant medium was inoculated into a 500 ml shake flask containing 100 ml of liquid LB seed medium, and shake cultured at 28 ° C (200 rpm) ). After 12 hours, 5 ml of vigorously growing bacterial solution (OD _{6 (K)} = 4.0 or so) was inoculated into 100 ml of fresh fermentation medium and cultured at 28 ° C for 12 hours. After washing 3 times with sterile physiological saline, the cells were collected by centrifugation (2000×g, 15 minutes, 15° C.), and diluted to a certain concentration (10 ^{2 to} 10 ⁹ CFU/ml) in sterile physiological saline to prepare a solution. The attenuated strain EIBAV11092801 was used as an immunological composition of a live vaccine and stored at 15 ° C for use. Example 3: Stress and virulence testing of Edwards strain EIBV11092701

(1) EIBAV11092701 osmotic stress test

The LB medium cultured overnight (AIB202), tatABCD gene deletion mutant EIB AV 11092701 (AtatABCD) and replenished strain (to^ CZ) was diluted to OD _{6 (K)} = 1.0, and then inoculated at 1%. Inoculation was carried out in LB medium containing different NaCl concentrations (1.5%, 3.0% and 3.5%, percentages in g/100 ml), and the osmotic stress of EIBAV11092701 was detected by measuring the growth of each strain at different time points. Ability (Figure 4).

The results showed that there was no difference in the growth characteristics of the degraded E. faecalis wild strain and the EIBAV11092701 strain under low salt (1.5% NaCl), but at high salt concentrations (3.0% and 3.5% NaCl), although the retarded Edwardella wild The concentration of the strain in the stable phase decreased compared with the low salt, but there was no growth delay; while the growth of EIBAV11092701 showed significant delay, the growth rate and the final concentration of the bacteria decreased significantly, and The extent to which growth is inhibited increases as the NaCl concentration increases. It can be seen that the Tat system is suitable for the growth of Edwards in the high salt environment. Have an important role.

(II) Growth maintenance of EIBAV11092701 at different salt concentrations

The above results show that EIBAV1 1092701 has a significant decrease in the bacterial concentration of the E. sinensis wild-type strain at high salt concentration. In order to clarify whether the growth inhibition was caused by non-cultivable factors such as lysis of the bacteria at a high salt concentration, the number of culturable cells of the wild strain and the mutant strain at different salt concentrations was further examined. The overnight cultured wild strain (EIB202) and the mutant strain EIBAV1 1092701 (AtatABCD) were inoculated separately into 50 ml of artificial seawater containing different salt concentrations (2.5%, 3%, 3.5%, 4% NaCl), and the culture temperature was At 28 ° C, samples were taken at regular intervals, and after a certain concentration gradient dilution, 100 μ ΐ samples were applied to LB solid medium, and cultured at 30 ° C for 48 hours, and colony counts were performed (Fig. 5A;). When the number of colonies on the plate is less than 1, it is considered uncultivable.

The results showed that under the condition of 28 °C culture temperature, EIBAV1 1092701 strain showed growth loss in the range of salt concentration detected, and the number of cultivatable colonies was significantly lower than that of wild plants, and the rate of decline was significantly faster. In addition, the EIBAV1 1092701 strain was maintained for a period of 3-5 days relative to the wild strain at the salt concentration tested. It can be seen that the Tat system plays an important role in the growth of Edwards in the high salt environment.

(iii) Growth maintenance of EIBAV11092701 at different temperatures and salinities

Since the seawater environment not only has a certain range of fluctuations in salt concentration in different seasons, but also the temperature of the water body changes, so the growth of the retarded Edwards strain in the above salt concentration range and culture under different temperature conditions is further detected. situation. The growth status of wild and Tat mutants was examined at 16 ° C and 10 ° C, respectively (Fig. 5B and C).

The results showed that the restriction of salinity growth of wild strain and EIBAV1 1092701 at the detection temperatures of 16 ° C and 10 ° C was basically the same as that at 28 ° C. However, EIBAV1 1092701 is more likely to be more restricted in growth than wild strains. For example, at 10 °C, the mutant strain EIBAV1 1092701 was maintained for a 4-1-4 day shorter period than the wild-type EIB202 in the salt concentration range (2.5%, 3%, 3.5%, 4% NaCl).

These results indicate that the Tat system plays an important role in high salt stress and can utilize Tat-deficient strains in a low-salt environment (such as fish); it can exist stably in a high-salt environment (in a seawater environment); The salinity limiting characteristic constructs a live attenuated vaccine for the biological barrier of the marine environment, thereby increasing the environmental biosafety of the live attenuated vaccine. (iv) Efficacy testing of EIBAV11092701

The pathogenicity of EIBAV11092701 strain was further investigated with healthy turbot, and the detection index was LD ₅₍₎ . The test fish was placed in a clean water tank for 1 week to remove abnormal individuals. Before the infection test, the health test fish were cultured in a 10 L infection test tank, and the feeding was continued for 1 week, and 10 fish per tank (average body length 11 to 12 cm, body weight 30 g;). The test tank replaces 2/3 of the volume of culture water with sterile seawater every day. The water temperature is 16 ° C and the temperature fluctuates by 2 ° C. The overnight culture of each strain was collected by centrifugation at 12000 g, and then washed three times with physiological saline to remove the residual medium, and the cells were resuspended with physiological saline while adjusting the density gradient to 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ and 10 ⁹ CFU/ml, and calculate the number of bacteria in the bacterial liquid by means of plate counting. The experimental animals were divided into groups. Each group consisted of 3 parallel tanks with 10 tails per tank. The experimental fish were anesthetized with MS-222 solution (80 mg/L) and artificially infected by back muscle injection. Each group was 10 ¹ . 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ and 10 ⁸ CFU/tail injection animals. In the control group, the same dose of physiological saline was injected in the same manner. After the injection was completed, the infected animals were normally reared, and the infection of the fish within 15 days was observed. The number of deaths of the experimental animals per day was recorded. After the experiment, the experimental fish was killed with an excess of MS-222 solution (200 mg/L). . The semi-lethal dose (LD _5Q ) of each strain was calculated by the Reed-Muench method and converted to CFU/g body weight according to the body weight of the experimental animals (see Table 1). Its calculation formula is as follows:

LD ₅₀ = 10 ^{[ m} - ^{l (∑} - ^{0 5)]}

among them:

Xm: logarithm of the maximum dose

i : the difference between the two pairs of doses

P: The mortality rate of each group of animals, expressed as a decimal (; if the mortality rate is 80%, it should be written as 0.8)

∑P: Total mortality of each group of animals Table 1. LD _{50 of the} degraded dose of E. faecalis wild strain and mutant EIBAV11092701 to turbot

The results showed that EIBAV11092701 was less virulence than the degraded E. faecalis strain EIB202 when it was used as an animal model of turbot, and it was suitable as a starting strain for constructing an attenuated vaccine. Example 4: Evaluation of pathogenicity and immune protection rate of attenuated E. faecalis strain EIBAV11092801 (1) Toxicity test of injection of medicinal turbot with turbot as test animal The virulence of EIBAV11092801 strain was investigated, and the detection index was LD ₅₍₎ . The test fish was placed in a clean water tank for 1 week to remove abnormal individuals. Before the infection test, the health test fish were cultured in a 10 L infection test tank, and the feeding was continued for 1 week, and 10 fish per tank (average body length 11 to 12 cm, body weight 30 g). The test tank replaces 2/3 volume of culture water with sterile seawater every day. The water temperature is 16 °C and the temperature fluctuates by 2 °C. The overnight culture of each strain was collected by centrifugation at 12000 g, and then washed three times with physiological saline to remove the residual medium, and the cells were resuspended with physiological saline while adjusting the density gradient to 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ and 10 ¹⁰ CFU/ml, and calculate the number of bacteria in the bacterial solution by means of plate counting. The experimental animals were grouped into 3 parallel tanks, each with 10 tails, and artificial infection was performed by intramuscular injection of the back muscles, each group according to 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 Animals were injected at ⁸ and 10 ⁹ CFU/tail. In the control group, the same dose of physiological saline was injected in the same manner. After the injection was completed, the infected animals were normally reared, the infection of the fish was observed within 15 days, the number of deaths of the experimental animals per day was recorded, and the semi-lethal dose (LD ₅ o) of each strain was calculated by the Reed-Muench method according to the experimental animals. Body weight was converted to CFU/g body weight (see Table 2). Table 2. LD _{50 of the} lethal dose of E. faecalis wild strain and attenuated strain EIBAV11092801 against turbot

The results showed that the virulence of EIBAV11092801 was significantly lower than that of the wild strain EIB202, and the number of deaths caused by the detected dose range was less than 50%, and the attenuation effect was very obvious.

(II) Injecting immunoprotective test with turbot as test animal The healthy turbot was immunized intraperitoneally with a dose of 5 x l0 ³ CFU/g. The turbot used in the experiment was randomly divided into 3 groups, 3 in each group. Sink, 44 tails/slot. The prepared live attenuated vaccine was immunized by intraperitoneal injection. The immunization period was one month, and the health status of the experimental animals was observed every day, as shown in Table 3. One month after the immunization, EIB202 was challenged with an intramuscular injection of the immunized animals at a dose of 1 χ 10 ² CFU/g for 3 weeks, and the cumulative mortality was counted and the relative immunoprotective power was calculated (Table 3).

Among them, the immune protection rate was calculated according to the following formula: Relative immune protection rate (RPS) % = (control group mortality - immunization group mortality %) / control group mortality χ ΐοο%. Table 3. Evaluation of immunoprotection rate of attenuated E. faecalis strain EIBAV11092801

From the results in Table 3, it can be seen that the attenuated strain of EIBAV11092801 has good immunoprotective ability, and the relative immune protection rate RPS is above 80%, which can effectively resist the infection of the wild strain of Edwards.

(3) The immune protection efficiency of the EIBAV11092801 attenuated strain was further investigated by the immersion administration immunoassay of turbot as the test animal. The test turbot was randomly divided into 4 groups of 3 parallel tanks and 40 tails/tank. Immersion immunization is to dilute the prepared vaccine stock solution into 10 ⁶ CFU/ml or 10 ⁸ CFU/ml with sterile seawater, put it into the sterile empty water tank for soaking to 10 L, and then soak the treatment of each group of test turbot. The soaking time is controlled between 15 and 120 minutes. The control group did not do any treatment. After 4 weeks of immunization, each group of immunized turbot was challenged with artificial infection of live strain of E. faecalis wild strain (intramuscular injection of lx lO ² CFU/g). The number of deaths in the statistical control group and the immunized group was observed within 3 weeks, and the immune protection rate of each group was calculated (see Table 4). Table 4. Immunoprotective evaluation of immersion immunity of E. sinensis attenuated strain EIBAV11092801 After soaking concentration

Immunization cumulative mortality

Strain (CFU/ml) Death tail RPS%

(%)

Time

10 ⁸

EIBAV11092801 120 40 33.33 65.5

15 min

10 ⁶

EIBAV11092801 120 48 40.0 58.6

15 min

Saline group 120 116 96.7 1 blank control group 120 0 0 1 It can be seen from the above data that the attenuated vaccine has a good anti-stasis effect against Edwardian infection, and the immune protection rate after 4 weeks of immunization is higher than 50%, while the unvaccinated turbot mortality rate is close to 100%. . The soaking dose is a very stable administration safety in the range of 10 ⁶ -10 ⁸ CFU/ml. Compared with the effect of injection administration, the immersion immunity showed a substantially consistent good immune effect, indicating that the vaccine of the present invention can conveniently obtain a high immune protection rate by immersion administration. Example 5: Maintenance of attenuated E. faecalis strain EIBAV11092801 at different salt concentrations

In order to detect the number of culturable cells of EIBAV11092801 at different salt concentrations, an overnight culture of attenuated E. sinensis strain 18 ¥11092801 was inoculated to 50 1111 fresh artificial containing different salt concentrations (2.5%, 3.5% and 4% NaCl). Cultured in sea water. A 100 μΐ sample was then applied to the LB plate medium and incubated at 30 ° C for 48 hours. When the number of colonies growing on the plate was less than one, it was considered to be non-cultivable. The results showed that EIBAV11092801 colonies were not detected in seawater environment (2.5% or more salt concentration) after 8-9 days. In summary, the live attenuated vaccine strain of the present invention has a very good immunoprotective effect against Edwards in the cultured fish model, and eliminates the potential environmental and product safety risks prevalent in traditional live attenuated vaccines. A safe, effective, and economical vaccine. The embodiments of the present invention have been exemplarily explained above by way of examples. It will be apparent that various modifications and changes can be made thereto in accordance with the spirit and scope of the invention. Accordingly, the specification and drawings are to be regarded as

1 The following instructions are mentioned here with the instructions in this application.

Preserved microorganisms or other biological materials related:

1-1 Page 6-7

1-2 Line number: 16-19:1-3

1-3 Deposits

1-3-1 Depository Name CCTCC China Type Culture Collection

1-3-2 Depository Address Wuhan University, Wuhan, Hubei Province, China. Zip code: 430072, Hubei

1-3-3 Date of Deposit September 29, 2011 (29.09.2011)

1-3-4 Deposit No. CCTCC M 2011338 ; 2011339

1-5 This note is for all designated countries in the following designated countries.

Filled in by the receiving office

0-4 This form was received with the international application:

(Yes or no)

0-4-1 Authorized official Filled in by the International Bureau

0-5 The International Bureau received the date of this form:

0-5-1 authorized official

Claims

A mutant strain of E. faecalis characterized in that the tatABCD gene is inactivated and thus does not express a TatABCD protein.

2. The mutant of E. sinensis according to claim 1, wherein the toL D gene is deleted.

3. The mutant of E. faecalis according to claim 1, which is Escherichia coli EIBAV1 1092701 with accession number CCTCC M 201 1338.

The mutant of E. sinensis according to any one of claims 1 to 3, wherein the E. faecalis endogenous plasmid pEIB202 is deleted.

5. The E. sinensis mutant according to claim 1, which is characterized in that the ese D and esc genes are inactivated and thus do not express EseBCD and EscA proteins, and do not contain an endogenous plasmid of the E. faecalis wild strain. pEIB202.

6. The mutant of E. faecalis according to claim 5, wherein the eseBCD and esc^ genes are deleted.

7. The E. faecalis mutant according to claim 6, which is Escherichia coli EIBAV1 1092801 with accession number CCTCC M 201 1339.

An immunological composition comprising the mutant of Escherichia coli according to any one of claims 1 to 7 as an immunogenic component.

9. The immunological composition according to claim 8, wherein the concentration of the E. sinensis mutant is 10 ³ - 10 ⁹ CFU/mL

A method for controlling fish Edward's disease, comprising administering the fish of claim 1 to 7 or the immune composition according to any one of claims 8 to 9 A step of.