CN104560851B - The preparation method and application of aeromonas salmonicida live vaccine preparation and freeze dried vaccine product - Google Patents
The preparation method and application of aeromonas salmonicida live vaccine preparation and freeze dried vaccine product Download PDFInfo
- Publication number
- CN104560851B CN104560851B CN201410837255.3A CN201410837255A CN104560851B CN 104560851 B CN104560851 B CN 104560851B CN 201410837255 A CN201410837255 A CN 201410837255A CN 104560851 B CN104560851 B CN 104560851B
- Authority
- CN
- China
- Prior art keywords
- aeromonas salmonicida
- vaccine
- preparation
- strain
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The preparation method and application of aeromonas salmonicida live vaccine preparation and freeze dried vaccine product belongs to fishing with bacillary gene-deletion attenuated live vac-cine technology field.It includes the Unmarked gene-deleted Attenuating mutations bacterial strain HTAsf-5307 of one plant of wild strain of aeromonas salmonicida, and prepared by the bacterial strain aeromonas salmonicida live vaccine, preparation method and application.The Partial Fragment of aromatic amino acid synthesis related gene of the aeromonas salmonicida attenuated live vaccine provided by the invention because having lacked aeromonas salmonicida strain; the Partial Fragment of encoding gene related to the secretion of three type of part; there is apparent hypotoxicity and Product Safety relative to its wild strain; meanwhile immune fish can be effectively protected and caused a disease the infringement of strain from aeromonas salmonicida.The live vaccine immune effect is significant, can prevent and treat the disease of aeromonas salmonicida initiation well in practical applications.
Description
Technical field
The present invention relates to the preparation method and application of a kind of aeromonas salmonicida live vaccine preparation and freeze dried vaccine product, tools
Body is related to preparation and application based on a kind of aeromonas salmonicida Unmarked gene-deleted attenuation mutant, which mainly uses
In the immune protection of the fish scabies disease caused by aeromonas salmonicida, belongs to aquiculture animal disease and prevention and control field is immunized,
Fishing is particularly belonged to bacillary gene-deletion attenuated live vac-cine technology field.
Background technique
Aeromonas salmonicida (Aeromonas salmonicida) belong to aeromonas section (Aeromonadaceae) gas list
Born of the same parents Pseudomonas (Aeromonas), it is a kind of Gram-negative brevibacterium, optimum growth temperature is 18 ~ 22 DEG C.By aeromonas salmonicida
Caused furunculosis (Furuneulosis) is great disease (the Janda J.M. of salmon fishes aquacultureet al., 2010,
Clin Microbiol Rev, 23:35-73.), seriously affected in world wide with Atlantic salmon (Salmo salar)For
The sound development of the salmon fish farming industry of representative is one of risk the most great in marine fish culture industry, and world animal is defended
Raw tissue (World Organisation for Animal Health,OIE) it is classified as emphasis epidemic disease catalogue.Except this bacterium
Other most Salmons, e.g., Pacific Ocean salmon (Pacific salmon), maple leaf salmon, rainbow trout (Rainbow can also be infected
Trout), silverside (Coho salmon) etc. and non-Salmons, such as goldfish (Goldfish), carp (Common carp), Nian
(Catfish) and turbot (Turbot) etc., to culture fishery cause serious economic loss (Bergh, 2008,
Fish Diseases. Science Publishers, pp.239-277.).
In view of aeromonas salmonicida significant damage caused by culture fishery, people were supported at the past nearly 40 years with salmon
It grows in the culture fishery sustainable development that industry is representative, constantly explores the efficient prevention and treatment plan for being directed to aeromonas salmonicida disease
Slightly.Using antibiotic as the chemotherapy of core once along in world wide using marine fish culture as the culture fishery of representative
Development course played positive contribution for disease control and reduction disease loss.But anti-medicine caused by this disease prevention and control strategy
Cause of disease is quickly spread, and the negative effect of Safety of Aquatic Products problem (medicament residue) and environmental pollution is on the rise.Antibiotic it is big
Amount uses and abuses brought negative effect and produces to the health of world wide culture fishery and sustainable development
It is serious to restrict.
And the preventative control and prevention of disease measure based on fish immunity system be then it is a kind of it is very effective meet it is environmental-friendly
Disease prevention and control strategy.Vaccine is as a kind of preventative means, due to it can make host muchly support antiviral infection
It is introduced into culture fishery.In terms of the research and development course and current development trend of fish vaccine, vaccines for fish can substantially be divided into four kinds
Type: the 1) inactivated vaccine based on the full cell of pathogen；2) attenuated live vaccine based on full cell；3) anti-to have
Subunit vaccine based on former active subcellular component；4) the DNA epidemic disease based on the encoding gene of antigen active ingredient
Seedling.Currently, the fish bacteria vaccine being commercialized in the world be essentially inactivated vaccine (Bj rn E. B.,et al., 2013,
Fish Shellfish Immunol, 35:1759-1768).
Compared with inactivated vaccine, subunit vaccine and DNA vaccination, since pathogen attenuated live has complete immunogene
Component has stronger cellular immunity potential compared with inactivated pathogenic bacteria, can induce and generate more effective immune response；Meanwhile
Its infectivity still maintained can make attenuated live immune by oral and immersion approach, be existed with the attenuated live vaccine that this is developed
It is economically more competitive.Due to attenuated live vaccine have both efficiently, convenient drug administration, the economic comprehensive advantages such as cheap, this is for needing
The business application potentiality with reality are immunized for the culture fishery of thousands of quantity.
According to the difference of attenuation principle, attenuated live vaccine can be there are many different type.It is wherein not of the same race using belonging to
Microorganism as attenuated strain, passage attenuated strain, cause of disease Natural Avirulent Strain, change in vitro culture passage environment attenuated strain or
The attenuated strain of the gene recombination technologies such as transposons exploitation, mostly tool is there are two congenital fatal defect: 1) carry resistance marker and
Exogenous genetic fragment has potential hazard to environment；2) easy back mutation restores virulence.Virulence is easily replied and uncontrollable environment passes
Broadcasting risk is that the application of these vaccines must be paid attention to and solve.In consideration of it, such attenuated vaccine is by each including China
Biological products safety inspection management organization, state examination & approval regulation regards as the biological products with higher Environmental Risk, thus difficult
To enter commercial development process.
In order to eliminate the Environmental security potential hazard of genetic vaccine product, the development of Unmarked gene-deleted mutating technology
For construct in the world in recent years gene-deletion attenuated live vaccine advanced development technique (GolovliovI.,et al., 2003,
FEMS MicrobiolLett, 222:273-280).The attenuated live vaccine and previous traditional technology route of technology building construct
Attenuated live vaccine compared to having the advantages that the attenuated live vaccine 1) developed does not carry resistance marker and foreign gene piece
It is disconnected；2) it is lost using large stretch of breakthrough in gene orientation frame, mutation and virulence can not reply；3) genetic background of mutation building understands,
It is attenuated clear mechanism.These all provide more sound assurance for the Environmental security control of unmarked attenuated live vaccine.Due to
With generally acknowledged product and environmental safety, the unmarked missing attenuated vaccine of gene has become at present the live vaccine of prevalence in the world
Constructing technology is one of international Disciplinary Frontiers and the main direction of development of vaccine development.
It is its key problem in technology place that gene-deletion attenuated live vaccine, which makes up the gene delection in strategy, is mainly adopted at present
Target gene is lacked with two kinds of strategy and suggestions: 1) virulence factor correlative coding gene known to selection missing pathogen；2) selection relates to
And pathogen is in host default value and relevant known metabolic pathway key function gene of surviving.
Auxotroph (Auxotrophy) bacterium be one kind require supplementation with one or more of growth factors could survive and
The auxotrophic mutant of proliferation, and certain trophic factors are limited available in vertebrate animal tissues.Meanwhile modern molecular biology
The development of technology and the understanding that deepens continuously of fish pathogens pathogenic mechanism is made it was recognized that many in host survival and
Functional gene necessary to being proliferated.These all provide potential purpose for the building of attenuated vaccine and lack target gene.With fragrance
Metabolite biosynthesis defect be target spot (such asaroA,aroCWitharoD Mutant strain) attenuation mutant be configured to fish
Possible technique route (Wang in exploitationet al., 2013; Lienet al, 2014).AroGenoid mutating technology road
One basic assumption of line is namely based on two kinds of aromatic compound p-aminobenzoic acid and 2,3- dihydroxy-benzoic acid in host
Be inside it is limited available, this auxotroph has been used in the exploitation of the mankind and terricole attenuated vaccine, such as cholera, broken
Cold, leishmaniasis and typhoid fever (Stocker B.A., 1988, Vaccine, 6:141-145; Ward S.J.,et al.,
1999, InfectImmun, 67:2145-152, Malcova M.,et al., 2009, FEMS Microbiol Lett,
291 (1): 44-49).Foreign countries, which have been reported that, kills salmon gas by transposons insertion inactivation technique or Unmarked gene-deleted techno-absence
MonadaroAGene successfully constructs aeromonas salmonicida (killing salmon subspecies)) attenuated live vaccine (Vanghunet al.,
1993; Marsden et al, 1996).There has been no missing aeromonas salmonicidasaroCThe report of (coding branch acid enzyme)
Road.
Chorismic acid synthetase (Chorismate synthase) is shikimic acid metabolic pathway of synthesizing (Shikimate in bacterium
Pathway synzyme), catalysis 5- enol form shikimic acid -3- phosphoric acid synthesize chorismic acid, relate generally to the biology of ArAA
Synthesis (Pitchandi P.,et al, 2013, BMC Pharmacol Toxicol, 14:29), function coding genearoCFunctional disturbance will lead to organism show as to ArAA Phenylalanine, Tyrosine and
The auxotroph of Tryptophan.aroCGene and auxotroph Escherichia coli (Escherichia coli), point
Branch bacillus (Mycobacteria), the white dead leaf germ of rice (Xanthomonas oryzae), salmonella (Salmonella)
And had made intensive studies in higher plant (Betancor L.,et al., 2005, Vet Microbiol, 107(1-
2):81-9; Song H., et al., 2009, Methods Mol Biol, 465:279-95; Song E.S., et al., 2012, Microbiol Res, 167(6):326-31; Maeda H., et al., 2012, Annu Rev
Plant Biol, 63:73-105).
Some researches show that on pathogen chromosomearoCThe deletion mutation of gene will lead to F-strain and show as fragrant ammonia
Base acid auxotrophic phenotype, cannot be effectively synthesized DNA and albumen synthesis needed for folic acid and important virulence factor siderophore before
Body substance 2,3- dihydroxy-benzoic acid etc., to lose virulence and greatly weaken its struggle for existence power in the environment, Wu Fa
The interior proliferation survival of host (Chen Q.,et al, 1994, JBacteriol, 176:4226-4234).
Type III excretory system be a kind of important virulence factor in gram negative pathogenic bacterium (Corneliset al.,
1998; Galan& Collmer, 1999;Nhieu& Sansonetti, 1999).Burr et al., which is identified, kills salmon gas unit cell
The type III excretory system (Burr et al., 2002,2003) of bacterium.In aeromonas salmonicida, the volume of type III excretory system
Code gene is mainly present in endogenous plasmid (pAsa5) in the form of pathogenicity island.In pAsa5 loss or type III excretory system
Membrane structure protein coding geneascVMissing cause aeromonas salmonicida virulence reduction (Burr et al., 2002;
Stuber et al., 2003).AopN is the modulin of aeromonas salmonicida type III excretory system, with molecular chaperones Acr1
(TyeA), SycN and YscB form multiprotein complex, to the secretion process carry out negative regulation (Schubot et al.,
2004).AscN provides energy (Blaylock et al., 2004) as ATPase, for type III excretory system.aopN、acr1
AndascNMissing will lead to type III excretory system disorder.But using these III type excretory system encoding genes as missing target base
Because building aeromonas salmonicida attenuated live vaccine has no any document report.
Summary of the invention
It is an object of the present invention to overcome the shortcomings of the prior art and provide a kind of wild strains of aeromonas salmonicida
Unmarked gene-deleted attenuated live vaccine and its preparation and application, the attenuated vaccine strain eliminate traditional live vaccine and generally deposit
Potential product and Environmental Risk, be for cultured fishes disease caused by aeromonas salmonicida it is a kind of safely, have
Effect, economic new generation vaccine.
According to technical solution provided by the invention, the Unmarked gene-deleted attenuation of one plant of wild strain of aeromonas salmonicida
Mutant strain HTAsf-5307, classification naming areAeromonas salmonicida, it has been preserved in China typical culture collection
Center, the deposit date is on October 29th, 2014, deposit numbers are as follows: CCTCC M 2014527.Its main feature is that having lacked described
The aromatic amino acid synthesis related gene of aeromonas salmonicida strainaroCSegment, the strains expressed go out aromatic amino acid battalion
Support defect characteristic.
The Unmarked gene-deleted Attenuating mutations bacterial strain of the wild strain of aeromonas salmonicida, has lacked and has killed salmon gas list
The aromatic amino acid of the wild strain of born of the same parents bacterium synthesizes genearoCPartial Fragment, as shown in SEQ ID NO.1；It is secreted with III type
System coding geneaopN、acr1AndascNPartial Fragment, as shown in SEQ ID NO.2.
The aeromonas salmonicida live vaccine of the bacterial strain preparation, including vaccine fermentation culture and vaccine fermentation culture
The freeze dried vaccine obtained after freeze-dried.Before the freeze dried vaccine freeze-drying, i.e., the viable bacteria content in vaccine fermentation culture is not less than
Hundred million/milliliter of 45-80 also contains NaCl 9g/L, pH 6.5-8.0.
Aeromonas salmonicida live vaccine preparation is obtained by the freeze dried vaccine and after pharmacologically acceptable ligand compounding,
Its cell concentration is 104~108CFU/mL.The pharmacologically acceptable ligand is sterile saline；Sterile physiological salt
Water formula are as follows: NaCl 9g/L, pH 6.5-8.0.
The preparation method of the aeromonas salmonicida live vaccine, it is characterized in that step are as follows:
The preparation of vaccine fermentation culture: it is stored in attenuation mutant on TSA culture medium with oese picking, is inoculated in dress
There is shaken cultivation in the shaking flask of liquid LB or TSB seed culture medium；Growth factor is added in LB the or TSB culture medium, it is described
Growth factor is phenylalanine, tyrosine and tryptophan, and additive amount is 5-40mg/L；Then eugonic bacterium solution is taken to connect again
Kind continues to cultivate in fresh fermentation medium；It is washed with sterile phosphate buffer, is centrifuged, finally uses sterile phosphate buffer
Liquid is resuspended to arrive vaccine fermentation culture；Fermented and cultured cultivation temperature is 20 ~ 22 C；
The preparation of freeze dried vaccine: preparation obtained by vaccine fermentation culture is taken to be lyophilized in freeze dryer；It is prepared in freeze-drying
In the process, it is added with growth factor；The growth factor includes trehalose, skimmed milk power and glycine betaine；Their additive amount is
The trehalose of 1-5g, the skimmed milk power and 0.1-2mM glycine betaine of 1-10g are added in every 100mL live vaccine, after mixing well, are put
Enter and be lyophilized in the freeze dryer of sterilization treatment, moisture is down to 4% or less up to freeze dried vaccine.
The application of the aeromonas salmonicida live vaccine is applied to prevention fish and suffers from and being caused by aeromonas salmonicida
Atlantic salmon furunculosis；Aeromonas salmonicida live vaccine preparation is obtained after wherein freeze dried vaccine is compounded with ligand；Kill salmon gas list
Born of the same parents' bacterium live vaccine preparation or vaccine fermentation culture pass through intraperitoneal injection and immersion way administration；
Injection system administration: cell concentration 1*106~1*108CFU/mL, injection dosage 0.1mL/ tail, intraperitoneal injection；Leaching
Bubble mode is administered: cell concentration 1*104~1*107CFU/mL, soaking time are 15 ~ 30min, 15 ~ 18 C of soaking temperature.
The fish include the Salmons such as Atlantic salmon, Pacific Ocean salmon, rainbow trout and non-Salmons: zebra fish, big water chestnut
Flounder etc..
Beneficial effects of the present invention:
(1) fragrance of the aeromonas salmonicida attenuated live vaccine provided by the invention because having lacked aeromonas salmonicida strain
The Partial Fragment of the Partial Fragment of race's Amino acid synthesis related gene encoding gene related to the secretion of three type of part, relative to it
Wild strain has apparent hypotoxicity and Product Safety, meanwhile, immune fish can be effectively protected from aeromonas salmonicida
The infringement of pathogenic strain.Experiment shows that the live vaccine immune effect is significant hereinafter, can prevent and treat well kill salmon in practical applications
The disease that Aeromonas causes.
(2) Unmarked gene-deleted attenuation mutant used in aeromonas salmonicida live vaccine provided by the invention is not taken
Band any antibiotic label and other exogenous markers and genetic fragment, therefore there is no the potential dangers for propagating antibiotic resistance；
Using deletion mutant (especially polygene deletion) means, virulence associated gene large fragment deletion is theoretically thought not
A possibility that can replying, substantially eliminating toxicity pathogen a large amount of to environmental dissemination, has technical safety and product
On safety.
(3) the heredity back of the Unmarked gene-deleted attenuated vaccine strain of the wild strain of aeromonas salmonicida provided by the invention
Scape understands, is attenuated clear mechanism, and easily distinguishable vaccine strain and wild strain improve the environment of vaccine convenient for being monitored to environment
Safety and controllability.
(4) aeromonas salmonicida live vaccine of the invention can be prepared into freeze dried vaccine product, have actual business development to answer
With value.
Biological material specimens preservation: the Unmarked gene-deleted Attenuating mutations bacterial strain of one plant of wild strain of aeromonas salmonicida
HTAsf-5307, classification naming areAeromonas salmonicida, it has been preserved in China typical culture collection center, ground
Location: Wuhan, China, Wuhan University, the deposit date is on October 29th, 2014, deposit numbers are as follows: CCTCC M 2014527.
Detailed description of the invention
Fig. 1 is the PCR detection knot of the wild strain of aeromonas salmonicida and attenuation mutant aromatic amino acid lack part
Fruit.
Fig. 2 is that the wild strain of aeromonas salmonicida and three type excretory system correlative coding genetic fragment of attenuation mutant lack
Lose the PCR testing result of part.
Fig. 3 is the immune protective effect curve graph after injecting immune zebra fish.
Fig. 4 is the immune protective effect curve graph after injecting immune Atlantic salmon.
Fig. 5 is the immune protective effect curve graph after immersion immunity zebra fish.
Specific embodiment
In order to be more clearly understood that technology contents of the invention, spy lifts following embodiment and is described in detail.
Experimental example 1: the verifying and preparation of vaccine strain
The present invention selects aeromonas salmonicida wild virulent strain, and (cultivation that scabies disease is suffered from China, Area in Yantai Region, Shandong is western greatly
One plant of strong pathogenic strain being separated at foreign salmon disease stoveAeromonas salmonicida SDy0701 sets out for vaccine construction
Strain, with its house-keeping genearoCEncoding gene in gene and T3SS excretory systemacr1、aopN、ascNTo lack target gene,
WhereinaroCThe missing of gene blocks aromatic amino acid and its folic acid synthesis,acr1、aopNFor the controlling element of excretory system,ascNThe assembling of III type excretory system is participated in for ATP phosphatase, their missing will lead to T3SS excretory system function and effect
The destruction of object.It is related to the double missings of large fragment of the crucial encoding gene of aeromonas salmonicida colonization ability and important virulence factor,
Since virulence back mutation bring environmental dissemination is dangerous when greatly reducing application, there is reliable and stable safety.Together
When, missing attenuated vaccine strain without any external source antibiotic-screening label and exogenous genetic fragment, easily distinguishable vaccine strain and
Wild-type strain improves the safety and controllability of vaccine convenient for being monitored to vaccine strain.Currently, in addition to the present invention, it is domestic
It has no outside and utilizes marker-free mutating technology missing genearoCSalmon gas unit cell is killed with the preparation of three type excretory system related genes
The document and patent report of bacterium attenuated vaccine.
(1) verifying of vaccine strain
By genetic engineering means, in aeromonas salmonicida wild strainAeromonas salmonicida SDy0701's
On the basis of obtain aeromonas salmonicida attenuation mutant, be named asAeromonas salmonicidaHTAsf-5307 is lacked
Three type excretory system phase of the Partial Fragment for killing the aromatic amino acid synthesis related gene of salmon gas unit cell wild strain and part is lost
The Partial Fragment for closing encoding gene can be distinguished vaccine strain and wild strain by PCR verifying.
Using the genome of aeromonas salmonicida SDy0701 and HTAsf-5307 as template, using being PCR with primer below:
P1(5 ' ACTCGAGATAAGCGAAGCG3 '),
P2(5 ' GGTGATCATCTCTATGGCTTC3 '),
P3(5 ' CCAACCATAGGGTCAGTTG3 '),
P4(5 ' GCCCCGTTCACCGATCAGC 3 '),
Wherein P1/P2 verifies aromatic amino acid synthesis related gene segment, and P3/P4 verifies three type excretory system correlations and compiles
Code genetic fragment.Tris-HCl(pH containing 10mmol/L 8.3 in PCR reaction system), 50mmol/L MgCl2, upstream and downstream primer
Each 100pmol, 200 μm of ol/L dNTPs, 50ng template DNAs, 2.5U archaeal dna polymerase.PCR response procedures are as follows: 94 DEG C of denaturation
5min；95 DEG C of 30s, 55 DEG C of 15s, 72 DEG C of 3min, 30 circulations；72 DEG C of extension 5min.PCR result is as shown in electrophoretogram, tool
Body is as follows.
In Fig. 1: M swimming lane is DL2000 DNA Marker；A swimming lane is aeromonas salmonicida wild strain aromatic amino acid
Synthesize genetic fragment, size 876bp；B swimming lane is that attenuation mutant aromatic amino acid synthesizes genetic fragment, and size is
507bp。
In Fig. 2: M swimming lane is λ/HindIII DNA Marker；A swimming lane is the secretion of three type of aeromonas salmonicida wild strain
System correlative coding genetic fragment, size 2080bp；B swimming lane is three type excretory system correlative coding gene piece of attenuation mutant
Section, size 509bp.
(2) prepared by attenuated live vaccine
Culture medium and physiological saline form:
(1) TSA culture medium: tryptone 17g/L, soya peptone 3g/L, glucose 2.5g/L, sodium chloride 5g/L, phosphoric acid hydrogen
Dipotassium 2.5g/L, agar 15g/L, pH 7.1~7.5；
(2) LB culture medium: tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L, pH 7.1~7.5；
(3) seed culture medium: tryptone 17g/L, soya peptone 3g/L, glucose 2.5g/L, sodium chloride 5g/L, phosphoric acid hydrogen
Dipotassium 2.5g/L, phenylalanine, tyrosine and tryptophan are 5mg/L-40mg/L, pH 7.1~7.5；
(4) fermentation medium: tryptone 17g/L, soya peptone 3g/L, glucose 2.5g/L, sodium chloride 5g/L, phosphoric acid hydrogen
Dipotassium 2.5g/L, phenylalanine, tyrosine and color ammonia are originally 5mg/L-40mg/L, pH 7.1~7.5；
(5) phosphate buffer: sodium chloride 8g/L, potassium chloride 0.2g/L, sodium dihydrogen phosphate 1.44g/L, potassium dihydrogen phosphate
0.24g/L, pH7.1~7.5；
(6) physiological saline: sodium chloride 9g/L, pH 6.5-8.0,121 DEG C sterilize 20 minutes.
A, vaccine preparation: it is stored in attenuation mutant on TSA culture medium with oese picking, is inoculated in equipped with 100mL liquid
In the 500mL shaking flask of body LB or TSB seed culture medium, shaken cultivation (200 revs/min of revolving speed), after 24 hours, is taken at 22 DEG C
The eugonic bacterium solution inoculation (OD=4.0 or so) of 3mL is inoculated in the fresh fermentation medium of 100mL, 22 DEG C of constant-temperature shaking cultures 24
Hour, it is washed 3 times with sterile phosphate buffer, thallus (2000 × g, 15 minutes, 15 DEG C) is harvested by centrifugation, uses sterile phosphate
Buffer is resuspended to a certain concentration.
B, prepared by vaccine freeze-drying: viable bacteria content is not less than 5,000,000,000/milliliter before prepared by freeze dried vaccine preparation, according to every 100 milli
Rise the skimmed milk power and volume 0.1-2mM beet of trehalose, 1-10g that 1-5g is added in live bacterial vaccines sterile saline re-suspension liquid
The ratio of alkali adds trehalose, skimmed milk power and glycine betaine into live bacterial vaccines as freeze drying protectant (sterilizing), mixes well
Afterwards, it is put into the freeze dryer of sterilization treatment, carries out freeze-drying preparation according to following freeze-drying parameter: being cooled to 4 DEG C in advance, maintain 0.5h,
Freeze 3h after being cooled to -45 DEG C, then heat to -15 DEG C, vacuumize and be continuously heating to 28 DEG C after maintaining 8 ~ 9h, maintains 6 ~ 8h
(residual moisture is down to 4% and becomes freeze-drying terminal hereinafter, can sentence).Vacuum gland aluminium is honored as a queen to be saved backup in -15 DEG C.
Freeze dried vaccine product in administration is carried out by following method: being first placed on the taking-up of freeze dried vaccine product
(15 DEG C ~ 20 DEG C) at room temperature carry out rehydration according to freeze-dried powder stoste volume with sterile saline, then dilute with sterile saline
It is interpreted into required strain density (injection or immersion way administration can be used at this time).
Experimental example 2: using zebra fish as the half lethal dose (LD of Experimental fish50) measurement.
The raising of Experimental fish: the test purchased from Shanghai International Automobile City Tourist Festival is first placed in SPF with fish with fish (zebra fish), test
The laboratory (Special Pathogen Free) adapts to cultivation 1 week, removes abnormal individual to choose.Before infection experiment, then will
SPF test puts the 10L infection experiment sink in infectious laboratory in a suitable place to breed with fish, continues to feed 1 week, and every slot puts 10 tails (average body in a suitable place to breed
Long 2-3cm).Experimental tank uses sterile water to replace 2/3 volume cultivation water daily, 28.5 DEG C of water temperature, fluctuates 2 DEG C up and down.
The evaluation of virulence: test is grouped at random with fish, every group of 3 sink parallel tests.
In infection experiment, every group of test fish strain of certain graded doses: the wild strain of aeromonas salmonicidaAeromonas salmonicida SDy0701(5 × 102~5×105CFU/ tail), test condition and the results are shown in Table 1.Subtract
Strain: Unmarked gene-deleted Attenuating mutations bacterial strain HTAsf-5307(5 × 10 of the wild strain of aeromonas salmonicida5~5×
108CFU/ tail) artificial challenge, test condition and the results are shown in Table 2 carried out by intraperitoneal injection.
Measurement result of the 1 aeromonas salmonicida strain of table to zebra fish median lethal dose
| Grouping | Dosage (CFU/ tail) | It tests number (tail) | Death toll | Survival number after 2 weeks | The death rate (%) |
| 1 | 5×105 | 30 | 30 | 0 | 100% |
| 2 | 5×104 | 30 | 19 | 11 | 63.3% |
| 3 | 5×103 | 30 | 15 | 15 | 50% |
| 4 | 5×102 | 30 | 8 | 22 | 26.7% |
| Control | Physiological saline | 30 | 0 | 30 | 0% |
Measurement result of the 2 aeromonas salmonicida attenuation mutant of table to zebra fish median lethal dose
| Grouping | Dosage (CFU/ tail) | It tests number (tail) | Death toll | Survival number after 2 weeks | The death rate (%) |
| 1 | 5×108 | 30 | 7 | 23 | 23.3% |
| 2 | 5×107 | 30 | 3 | 27 | 10% |
| 3 | 5×106 | 30 | 0 | 30 | 0% |
| 4 | 5×105 | 30 | 0 | 30 | 0% |
| Control | Physiological saline | 30 | 0 | 30 | 0% |
It records in 2 weeks, daily dead mantissa under every group of each infective dose, and calculates cumulative mortality, measure LD50Value
(concrete outcome is as shown in table 3).
The LD of 3 aeromonas salmonicida strain of table and attenuated strain HTAsf-5307 to zebra fish50。
| Infection strain | LD50 | Remarks |
| SDy0701 | 6.29×103CFU/ tail | Reach median lethal in 14 days |
| HTAsf-5307 | >5×108CFU/ tail | -- |
The above results show that on zebra fish model, aeromonas salmonicida attenuated strain has obvious relative to wild strain
Attenuation effect.
Experimental example 3: using zebra fish as the drug administration by injection Immunoprotection test of experimental animal.
The evaluation of immune efficacy: test zebra fish is grouped at random, every group of 3 parallel sinks, 10 tails/slot.By subtracting for preparation
Virus live vaccine is immune using intraperitoneal injection mode.Immune group injection dosage is 2 × 105 CFU/ tail.Control group injects same volume
Sterile saline.The zebra fish wild strain viable bacteria of aeromonas salmonicida (intraperitoneal injection 1 is immunized in each group after 4 weeks immune
×104 CFU/ tail) carry out artificial challenge attack poison.Observation statistics control group and immune group death toll in 15 days, statistical result is such as
Shown in Fig. 3.
Relative immunity protective rate is calculated using following formula:
Relative immunity protective rate (RPS) %=(the control group death rate-test group the death rate)/control group death rate × 100%.
It is computed, prepared aeromonas salmonicida attenuated live vaccine reaches 92% to the immune protective rate of zebra fish, thus
As it can be seen that the vaccine has good control efficiency to aeromonas salmonicida on zebra fish model, zebra fish can be effectively protected and supported
Imperial aeromonas salmonicida infects.
Experimental example 4: malicious half lethal dose (LD is attacked by the injection of experimental animal of Atlantic salmon50) measurement.
The raising of Experimental fish: the Experimental fish (Atlantic salmon) purchased from Shandong temporarily supports in 200L aquarium, is equipped with stream
Dynamic circulating water treatment and purification system, temperature of cultivation maintain 16 ± 2 DEG C, after temporarily supporting 1 week, reject unhealthy individual.Selective body is long
20L experimental tank, each 10 tail of sink are randomized to for the healthy Atlantic salmon of 12-15cm (weight 50g or so).
The evaluation of virulence: test is grouped at random with fish, every group of 3 sink parallel tests.
In infection experiment, every group of test certain graded doses (10 of fish4~108CFU/mL aeromonas salmonicida) is wild
Raw strainAeromonas salmonicida SDy0701, test condition and the results are shown in Table 4.Aeromonas salmonicida is wild
The Unmarked gene-deleted Attenuating mutations bacterial strain HTAsf-5307 of strain by intraperitoneal injection carry out artificial challenge, test condition and
The results are shown in Table 5.
Measurement result of the 4 aeromonas salmonicida strain of table to Atlantic salmon median lethal dose.
| Grouping | Dosage (CFU/ tail) | It tests number (tail) | Death toll | Survival number after 2 weeks | The death rate (%) |
| 1 | 1×108 | 30 | 30 | 0 | 100% |
| 2 | 1×107 | 30 | 30 | 0 | 100% |
| 3 | 1×106 | 30 | 27 | 3 | 90% |
| 4 | 1×105 | 30 | 21 | 9 | 70% |
| 5 | 1×104 | 30 | 12 | 18 | 40% |
| Control | Physiological saline | 30 | 0 | 30 | 0% |
Measurement result of the 5 aeromonas salmonicida attenuation mutant of table to Atlantic salmon median lethal dose.
| Grouping | Dosage (CFU/ tail) | It tests number (tail) | Death toll | Survival number after 2 weeks | The death rate (%) |
| 1 | 1×109 | 30 | 3 | 27 | 10% |
| 2 | 1×108 | 30 | 0 | 30 | 0% |
| 3 | 1×107 | 30 | 0 | 30 | 0% |
| 4 | 1×106 | 30 | 0 | 30 | 0% |
| 5 | 1×105 | 30 | 0 | 30 | 0% |
| Control | Physiological saline | 30 | 0 | 30 | 0% |
It records in 2 weeks, daily dead mantissa under every group of each infective dose, and calculates cumulative mortality, measure LD50Value
(see Table 6).
The LD of 6 aeromonas salmonicida strain HTAsf-5307 of table and attenuated strain to Atlantic salmon50。
| Infection strain | LD50 | Remarks |
| SDy0701 | 3.16×104CFU/ tail | Reach median lethal in 14 days |
| HTAsf-5307 | >1×109CFU/ tail | -- |
The above results show that in the case where poison is attacked in injection, attenuated strain has apparent relative to the wild strain of aeromonas salmonicida
It is attenuated effect.
Experimental example 5: using Atlantic salmon as the drug administration by injection Immunoprotection test of experimental animal.
Test Atlantic salmon is grouped at random, every group of 3 parallel sinks, 10 tails/slot.The attenuated live vaccine of preparation is used into abdomen
Chamber injection system is immune.Injecting immune dosage is 1 × 107Atlantic salmon is injected intraperitoneally in CFU/ tail.Control group injects same volume
Long-pending sterile saline.Atlantic salmon is immunized in each group after 6 weeks immune (to be infused in abdominal cavity with the wild strain viable bacteria of aeromonas salmonicida
Penetrate 1 × 105CFU/ tail) carry out artificial challenge attack poison.Observation statistics control group and immune group death toll, statistical result in 15 days
As shown in Figure 4.
Relative immunity protective rate is calculated using following formula:
Relative immunity protective rate (RPS) %=(the control group death rate-test group the death rate)/control group death rate × 100%.
It being computed, prepared aeromonas salmonicida attenuated live vaccine reaches 90% to the immune protective rate of Atlantic salmon, by
This can be effectively protected Atlantic salmon and resist and kill salmon gas list as it can be seen that the vaccine has good control efficiency to aeromonas salmonicida
Born of the same parents bacterium is infected.
Experimental example 6: Immunoprotection test is administered by the immersion of experimental animal of zebra fish.
Test zebra fish is grouped at random, every group of 3 parallel sinks, 10 tails/slot.By the attenuated live vaccine of preparation using immersion
Mode is immune.Immersion immunity is that the vaccinogen liquid that will be prepared is diluted to 2 × 10 with sterile saline7CFU/ml is put into leaching
For bubble with sterile empty sink to 10L, water temperature is 28.5 ± 2 DEG C, and each group is then tested zebra fish successively immersion treatment, soaking time
It is 15 minutes.Control group is without any processing.The zebra fish wild strain of aeromonas salmonicida is immunized in each group after 4 weeks immune to live
Bacterium (intramuscular injection 1 × 104CFU/ tail) carry out artificial challenge attack poison.Observation statistics control group and immune group are dead in 15 days
Number, statistical result are as shown in Figure 5.
Relative immunity protective rate is calculated using following formula:
Relative immunity protective rate (RPS) %=(the control group death rate-test group the death rate)/control group death rate × 100%
It is computed, prepared attenuated live vaccine has good aeromonas salmonicida wild strain preventing and curing infection effect, leaching
Immune protective rate after bubble is 4 weeks immune reaches 77.8%.It is compared with drug administration by injection effect, immersion immunity equally shows good
Immune effect illustrates that the present invention obtains the immune protective of efficient in which can be convenient by impregnating administration mode.
The Unmarked gene-deleted attenuation mutant missing of the wild strain of aeromonas salmonicida of the invention kills salmon gas unit cell
The Partial Fragment of the aromatic amino acid synzyme related gene segment of bacterium strain and three type excretory system correlative coding genes,
Missing said gene can hinder the aromatic amino acid of the wild strain of aeromonas salmonicida to synthesize, folic acid synthesis and the secretion of three types are
The assembling of system substantially reduces so as to cause the wild strain virulence of salmon gas unit cell is killed.
In conclusion the Unmarked gene-deleted attenuation mutant or correlation of the wild strain of aeromonas salmonicida of the invention
Preparation eliminates the generally existing environment of traditional attenuated live vaccine and product safety risk, is to be directed to be caused by aeromonas salmonicida
Cultured fishes disease a kind of vaccine safely, effectively, economic.
<160> SEQ ID NO.1
<210> 1
<211> 343
<212> DNA
<213>Partial Fragment of the aromatic amino acid synthesis gene aroC of the wild strain of aeromonas salmonicida has been lacked
<400> 1
GAGAATACCG ATCAGCGTTC CAAGGATTAC TCCGACATCA AGGACGTGTT TCGTCCGGGC 60
CATGCGGATT ACACCTACCA CCAGAAATAT GGTCAGCGGG ATTATAGGGG GGGCGGTCGC 120
TCCTCCGCCC GTGAAACTGC CATGCGGGTG GCGGCGGGTG CCATTGCCAA GAAGTACCTC 180
AAGCAGATGC ATGGCATCGA GATCACCGGC TTTCTCTCCC AGCTCGGCCC CATCAAGGCG 240
GAAGGCTTTG ACGCGGCGCA AATTGAGCAG AACCCCTTCT TCTTCCCCGA TGCGGGCAAG 300
CTGGAAGAGC TCGATCAGTA CATGCGCGAT CTGAAAAAAG AGG 343
<160> SEQ ID NO.2
<210> 1
<211> 1565
<212> DNA
<213>III type excretory system encoding gene aopN, acr1 and ascN of the wild strain of aeromonas salmonicida has been lacked
Partial Fragment
<400> 1
TTGATAGAGC AGCACCTGCT GGCGACAATC TGACAGCTCA AGAGCCACAC CGACCTGCTC 60
CACATCCCGC ACGCTGGCCC AGCGTTTCTC CACCAGGGCG ATCAGATCGC CCATCAGATC 120
AGAAGGCCCG TATACCATGG GCCGAACCCT CCTTCACCCG TTGCCACAGC TCGTCCACTT 180
GCGCCGAGAG AGTGTTGAGC AGCCGCAGCT TGTGCATGTC GCTCATCACC CGTTCCAGCT 240
TGACCGGGTC GAGCCAGCGC TGCTGGCTGT CGAGATCGGC GCTCAGGGCC TTCATCATGA 300
AACCGGTCAC CTTCTCCAGC GCTCCGTTGC CAAAGCGGCT GTGAATATCG CGCCAGGCGG 360
CAGAGAGGGC GCGGTAGTCC TGCACCGCAT CGCGATAGAG ATCCCGCAGA TCCTGCTCGG 420
CCCCCACGCC CGCTTTGGCC GCTTCAGCCG CGGGGCCGGT AATGCGCGCC CCCAGCACGA 480
TGGCACTGCC CTGCTCGTCC GCCAGCTTGG CCAGCGCCTG CTCGACCAGC GCCAGGGTGC 540
CCTGCATATC CGGTCGTCCG GATAGCGCCT TGCGCGCCTG ACAGAGCGCT TCGAACTGCT 600
CGCTCACCTC CCCCGAATAG CTCTCGAGGT AGGCTAGCAG CTGGGAGAGG TTGGCCAGCC 660
GACCGCTGCC GAGGTGGCTC ACCATCTCCT TGATCTTCTG CTGGCGCTCA AGCTCCGGCA 720
CCTTGTCGAG GTAGTCCCCC ACCAGCGCCT CGATCTCGCT GATGCGGGCA TGGCTGTCAC 780
TCAGCTTGCG CTTGGCGAGC GAAAGCTCAG CGCGCTCGGA AAAGACAAAG GTGAGCTCTT 840
CGGCGGCATC GGCCAGCGAC TGGGAGGCAC TGGCCAGCAC GACTCGCTCC CCCTGAAACT 900
GTCCTCCCTG CAGGGGAGTC TGACGGGATG CGACCTCTGC TCCGCGCAGC TCGGGCTGGG 960
CGGCAGAGGC ATAGGGGTTG CTCTGGATAA TGGCCATGGA AACTCCCGTG ACGAATGGAT 1020
TGACGAGGAT GGCATTATAA AAATCACCCT CGCCTCCCTA TGCCAAAATC GGCCGTGAAT 1080
TTTTAGCCCG CCCCCAACGG TTTTCTAAAA AGTCCCGACT CGCGCTGAAA TCCCCGTAGC 1140
CCCCCATCCC CTATAGTGGC CGCCAGTTTC AATGGCGCAG ATTGTTATGA CCCTCTCCCT 1200
CGACCACATC CCCGACCAGC TTCGTCACGC CATCGACGAG TGCCGCCTGA TCCAGATCCG 1260
TGGCCGGGTC ACCCAGGTGA CCGGCACCCT GCTCAAGGCG GTCGTCCCCG GGGTGCGGAT 1320
CGGCGAGCTC TGCCATCTGC GCAACCCGGA CAACACCCTC TCCCTGCAGG CAGAGGTGAT 1380
CGGCTTTGCC CAGCATCAAG CGCTGCTCAC CCCCCTTGGC GAAATGTTCG GCATCTCCTC 1440
CAACACCGAG GTGAGCCCGA CCGGTGCCAT GCATCAGGTC GGGGTCGGCG AACATCTGCT 1500
CGGCCAGGTG CTCGATGGCC TCGGCAACCC CTTTGGCGGC GGCCATCTGC CGGAGCCCGA 1560
GGCTT 1565
Claims (9)
1. the Unmarked gene-deleted Attenuating mutations bacterial strain HTAsf-5307 of one plant of wild strain of aeromonas salmonicida, classification life
It is entitledAeromonas salmonicida, it has been preserved in China typical culture collection center, the deposit date is in October, 2014
29 days, deposit number are as follows: CCTCC M 2014527.
2. the Unmarked gene-deleted Attenuating mutations bacterial strain of the wild strain of aeromonas salmonicida as described in claim 1, feature
It is: its aromatic amino acid synthesis gene for having lacked the wild strain of aeromonas salmonicidaaroCPartial Fragment, it is describedaroC
Partial Fragment it is specific as shown in SEQ ID NO.1；With III type excretory system encoding geneaopN、acr1AndascNPart piece
Section, it is describedaopN、acr1AndascNPartial Fragment it is specific as shown in SEQ ID NO.2.
3. the aeromonas salmonicida live vaccine of the preparation of bacterial strain described in claim 1, it is characterized in that: include vaccine fermentation culture,
The freeze dried vaccine obtained after freeze-dried with vaccine fermentation culture.
4. aeromonas salmonicida live vaccine as claimed in claim 3, it is characterized in that: that is, vaccine is sent out before freeze dried vaccine freeze-drying
Ferment culture solution is the phosphate buffer containing viable bacteria, and the content of viable bacteria is hundred million/milliliter of 45-80.
5. aeromonas salmonicida live vaccine preparation described in claim 3, it is characterized in that: by the freeze dried vaccine and pharmacologically may be used
Aeromonas salmonicida live vaccine preparation, cell concentration 10 are obtained after the ligand compounding of receiving4~108CFU/mL。
6. aeromonas salmonicida live vaccine preparation as claimed in claim 5, it is characterized in that: the pharmacologically acceptable ligand is
Sterile saline；Sterile saline formula are as follows: NaCl 9g/L, pH 6.5-8.0.
7. the preparation method of aeromonas salmonicida live vaccine described in claim 3, it is characterized in that step are as follows:
The preparation of vaccine fermentation culture: being stored in Attenuating mutations bacterial strain HTAsf-5307 on TSA culture medium with oese picking,
It is inoculated in shaken cultivation in the shaking flask equipped with liquid LB or TSB seed culture medium；In LB the or TSB culture medium be added growth because
Son, the growth factor are phenylalanine, tyrosine and tryptophan, and additive amount is 5-40mg/L；Then take growth vigorous again
Bacterium solution be inoculated in fresh fermentation medium and continue to cultivate；It is washed, is centrifuged, finally with sterile phosphorus with sterile phosphate buffer
Phthalate buffer is resuspended to arrive vaccine fermentation culture；Fermented and cultured cultivation temperature is 20 ~ 22 C；
The preparation of freeze dried vaccine: preparation obtained by vaccine fermentation culture is taken to be lyophilized in freeze dryer；In freeze-drying preparation process
In, it is added with freeze drying protectant；The freeze drying protectant includes trehalose, skimmed milk power and glycine betaine；Their additive amount is
The trehalose of 1-5g, the skimmed milk power and 0.1-2mM glycine betaine of 1-10g are added in every 100mL live vaccine, after mixing well, are put
Enter and be lyophilized in the freeze dryer of sterilization treatment, moisture is down to 4% or less up to freeze dried vaccine.
8. aeromonas salmonicida live vaccine preparation described in claim 5 is suffered from preparation prevention fish and being caused by aeromonas salmonicida
Atlantic salmon furunculosis on application in drug.
9. as claimed in claim 8 application, it is characterised in that: the fish specifically include Atlantic salmon, Pacific Ocean salmon, rainbow trout,
Zebra fish and turbot.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410837255.3A CN104560851B (en) | 2014-12-29 | 2014-12-29 | The preparation method and application of aeromonas salmonicida live vaccine preparation and freeze dried vaccine product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410837255.3A CN104560851B (en) | 2014-12-29 | 2014-12-29 | The preparation method and application of aeromonas salmonicida live vaccine preparation and freeze dried vaccine product |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104560851A CN104560851A (en) | 2015-04-29 |
| CN104560851B true CN104560851B (en) | 2019-03-26 |
Family
ID=53077931
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410837255.3A Active CN104560851B (en) | 2014-12-29 | 2014-12-29 | The preparation method and application of aeromonas salmonicida live vaccine preparation and freeze dried vaccine product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104560851B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110055194A (en) * | 2019-04-23 | 2019-07-26 | 山东省海洋生物研究院 | A kind of aeromonas salmonicida in cold water rainbow trout source |
| KR102199932B1 (en) | 2019-04-11 | 2021-01-11 | 강릉원주대학교산학협력단 | High-pathogenic Aeromonas salmonicida RTDH and vaccine composition using the same |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106075419B (en) * | 2016-06-14 | 2019-12-10 | 中国科学院海洋研究所 | Aeromonas salmonicida inactivated vaccine and application thereof |
| CN108434105B (en) * | 2017-02-16 | 2021-09-14 | 华东理工大学 | Preparation method and preparation of vaccine based on intracellular betaine accumulation |
| CN109999192A (en) * | 2019-04-23 | 2019-07-12 | 山东省海洋生物研究院 | A kind of aeromonas salmonicida inactivated vaccine prepared using Nano-Zinc |
| CN114164159B (en) * | 2021-06-21 | 2023-10-03 | 湖南师范大学 | Bivalent vaccine for preventing and treating salmonicida and Edwardsiella tarda infection of fish, and preparation method and application thereof |
| CN113234647B (en) * | 2021-07-13 | 2021-09-21 | 烟台市海洋经济研究院(烟台市渔业技术推广站、烟台市海洋捕捞增殖管理站) | Aeromonas salmonicida from turbot and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014052378A2 (en) * | 2012-09-26 | 2014-04-03 | Zoetis Canada Inc. | Subunit immersion vaccines for fish |
| CN103272228B (en) * | 2013-02-08 | 2016-05-18 | 江苏海健前沿生物科技有限公司 | Hemorrhagic Disease Sufferers of Crucian Carp multivalence carrier bacterin and application thereof |
-
2014
- 2014-12-29 CN CN201410837255.3A patent/CN104560851B/en active Active
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102199932B1 (en) | 2019-04-11 | 2021-01-11 | 강릉원주대학교산학협력단 | High-pathogenic Aeromonas salmonicida RTDH and vaccine composition using the same |
| CN110055194A (en) * | 2019-04-23 | 2019-07-26 | 山东省海洋生物研究院 | A kind of aeromonas salmonicida in cold water rainbow trout source |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104560851A (en) | 2015-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104560851B (en) | The preparation method and application of aeromonas salmonicida live vaccine preparation and freeze dried vaccine product | |
| CN103255089B (en) | The strong malicious slow Edwardsiella vaccine strain of one strain and application thereof | |
| CN108939062A (en) | A kind of aeromonas salmonicida vaccine and its application | |
| DK181323B1 (en) | Method and composition comprising probiotic bacteria for increasing weight of fish and isolated strains of psychrobacter and pseudomonas | |
| CN101629149B (en) | Marker-free gene-deletion attenuated mutant strain derived from Edwardsiella tarda wild strain, related preparation and application thereof | |
| CN106754594A (en) | A kind of Salmonella choleraesuls attenuated carrier bacterium and its construction method | |
| CN102140430B (en) | Mouse-typhus salmonella gene-deletion mutant strain without containing resistance marks, vaccine and application thereof | |
| CN113234647B (en) | Aeromonas salmonicida from turbot and application thereof | |
| CN102296044B (en) | Unmarked gene-deleted and attenuated mutant strain of vibrio alginolyticus wild strain, and preparation and use thereof | |
| CN113403241B (en) | Novel Edwardsiella attenuated vaccine strain, preparation method and application thereof | |
| CN1276076C (en) | No mark gene deletion deoxidated mutant strain of wild Manhu bacteria and its use | |
| CN103014051B (en) | Multiple-potency live vaccine for fish and application thereof | |
| CN103667145B (en) | Edwardsiella tarda genetic engineering low virulent strain and its application | |
| CN101974472B (en) | Marker-free gene deletion attenuated mutant strain of Edwardsiella tarda wild strain as well as relevant preparations and application thereof | |
| CN106190943A (en) | A kind of dual-gene disappearance Salmonella enteritidis, its construction method and the vaccine containing this dual-gene disappearance Salmonella enteritidis | |
| CN102676421B (en) | Bordetella bronchiseptica gene deletion strain, vaccine prepared from Bordetella bronchiseptica gene deletion strain and application | |
| CN106047783A (en) | Pseudomonas plecoglossicida ExoU gene knockout mutant strain and application thereof | |
| CN109010816A (en) | One kind killing the different vibrio vaccine of salmon and its application | |
| CN105886429B (en) | A kind of Aeromonas hydrophila attenuation bacterium of antibiotic-free label and application | |
| CN101659958B (en) | Multi-titer live vaccine as well as preparation method and application thereof | |
| CN104919036B (en) | Edwardsiella tarda mutant strain and its application | |
| KR20180105945A (en) | Novel Salmonella Typhimurium strain and vaccine composition comprising the same | |
| CN101962625A (en) | Salmonella choleraesuis gene deletion mutant without resistant marker and vaccine thereof | |
| CN101705198B (en) | Edwardsiella tarda attenuated strain and application thereof | |
| CN103509732B (en) | Edwardsiella tarda natural low virulent strain and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230324 Address after: 200237 No. 130, Meilong Road, Shanghai, Xuhui District Patentee after: Ma Yue Patentee after: Liu Xiaohong Address before: Floor 1, Building 7, Phase II, Biomedical Outsourcing Area, 88 Meiliang West Road, Binhu District, Wuxi City, Jiangsu Province, 214092 Patentee before: JIANGSU HAIJIAN CUTTING-EDGE BIOTECHNOLOGY Co.,Ltd. |
|
| TR01 | Transfer of patent right |