KR101797276B1 - Multiple mutated Salmonella Typhimurium and vaccine composition for prevention of food poisoning - Google Patents

Abstract

The present invention relates to mutation of a plurality of genes contained in Salmonella typhimurium strains to prevent Salmonella infection in various animals. More specifically, the present invention relates to a method for preventing Salmonella infection in various animals by multiply mutating ssrA and ssrB regulatory genes, rpoS gene and hmpA gene , And to reduce or inhibit the persistent infectivity of Salmonella typhimurium in the host. Through the present invention, it is possible to contribute to the development of animal husbandry and pharmaceutical industry by providing a new vaccine which has less side effects than conventional vaccines and is safe and cost-competitive.

Description

[0001] The present invention relates to a multiple mutated Salmonella Typhimurium strain, and a vaccine composition for preventing food poisoning,

 The present invention relates to a vaccine composition for mutagenizing a plurality of genes contained in a Salmonella typhimurium strain and using the same to prevent food poisoning.

Salmonella is morphologically or physiologically similar to E. coli but has been classified as an independent genus by K. Kauffmann et al. For medical convenience. Salmonella has been isolated from enteritis, gastroenteritis, and various diseases since 1885, when Salmon and Smith first reported Salmonella choleraesuis to Salmonella choleraesuis in a pig that died of Don cholera. It has also been isolated from healthy animals such as cows, pigs, goats, dogs, cats, and other environmental sources. More than 2,500 serotypes have been reported to date in Salmonella spp., And there have been reports of serotypes that are host specific for animals (eg S. Typhi in humans, S. Dublin in cattle, S. choleraesuis in pigs, of S. Pullorum, S. gallinarum) and may build host specificity is not species (divided into S. Typhimurim, S. Enteriditis, S. Newprot, etc.), of serotypes causing food poisoning in people over the latter's livestock .

Salmonella is one of the most reported pathogens in Korea with Shigella causing dysentery. It is a very dangerous bacterium that can be transmitted to human body through distribution of aquaculture animals contaminated with Salmonella. Salmonella is a gram negative bacillus that does not form spores and is found as parasites in various animals.

Salmonella infection occurs in several forms, but it is the leading cause of food poisoning and enteritis is the most common symptom. In the past, the cause of food poisoning in Korea was mainly caused by Shigella . Recently, the incidence of food poisoning by Salmonella has been gradually increasing. In 2000, more than 2,500 cases of foodborne illnesses due to Salmonella were found to be significantly higher than other foodborne pathogens such as Staphylococcus aureus (about 1,000 cases) and Vibrio (about 200 cases) Of the total.

On the other hand, S. enteritidis accounted for 42% of salmonella serotypes isolated from people in Seoul from 1996 to 2005, accounting for almost half of the food poisoning caused by Salmonella, according to the serotype of Salmonella food poisoning , Followed by S. Typhimurium (see Table 1).

<Distribution of Salmonella serotypes isolated from food poisoning patients in Seoul area from 1996 to 2005> Serotype No, of Isolates Total
(%) 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 S. Enteritidis 12 10 51 135 58 32 60 10 7 41 416
(42.0) S. Typhimurium 7 7 18 42 10 3 8 12 One 7 115
(11.6) S. Typhi 10 15 73 51 19 50 10 4 14 10 256
(25.9) Other Salmonella 6 8 18 57 18 9 58 7 7 14 202
(20.4) Total 35 40 160 285 105 94 136 33 29 72 989

In addition, S. enteritidis is the highest and S. Typhimurium is the next most common species of salmonella serotype found in persons surveyed by the CDC.

On the other hand, the detection rate of salmonella serotype in livestock products varies depending on the species of the species. In Korea, the systematic distribution of serotype of Salmonella serotype has not yet been reported. In the Netherlands, S. Typhi, the cause of typhoid fever, was the most isolated in humans, but S. typhimurium or S. enteritidis has been most frequently isolated from the 1980s (Table 2). In addition, the pig can be separated most commonly S. Typhimurium, cattle in high host specificity and S. Typhimurium and S. Dublin separation Most S. Enteritidis is relatively low detection rate. In case of chicken, S. Enteritidis is the most isolated and S. typhimurium is the sixth. Interestingly, the detection rate of S. enteritidis in humans is higher than that of salmonella serotypes, but the highest detection rate is in chickens and S. Typhimurium is the most abundant in cattle and pigs, These results seem to be similar across countries.

 <Salmonella serotype most isolated in the Netherlands from 1984 to 2001> Source Serotype Data for isolates from indicated period 1996-2001 1990-1995 1984-1989 % (no.) Rank % (no.) Rank % (no.) Rank Human Typhimurium 32.0 (4, 470) 2 33.1 (5,666) 2 57.2 (16,049) One Enteritidis 43.6 (6,097) One 33.8 (6,642) One 5.4 (1,526) 2 Pig Typhimurium 66.4 (2,384) One 75.7 (2,378) One 66.0 (2,197) One Enteritis - > 10 - > 10 - > 10 Chicken Typhimurium 5.3 (336) 6 14.3 (2,669) 3 26.1 (5, 170) One Enteritidis 20.3 (1,290) One 15.0 (2,802) 2 5.5 (1,088) 6 Cattle Typhimurium 32.9 (702) 2 31.9 (1,670) 2 53.1 (1,706) One Enteritidis - > 10 - > 10 - > 10

Since 1988, the World Health Organization (WHO) has recommended that an effective live vaccine be inoculated into target animals to prevent the food poisoning of salmonella from animal products. In particular, S. Typhimurum is the most frequent and important Salmonella serotypes that cause food poisoning in humans due to the propagation of S. enteritidis and livestock products.

In order to ensure livestock safety, vaccine use is an indispensable factor in the prevention of salmonella in industrial animals rather than antibiotic treatment. In general, the vaccine can be divided into inactivated vaccine and live vaccine. However, since Salmonella is generally protected by cell mediated immunity, live vaccine vaccine is being actively studied all over the world. Inactivated vaccine, Salmonella can be prevented from penetrating into organs and is used as a reinforcement vaccine for high immunity induction after virulence. Therefore, S. Typhimurium is a preventive vaccine that must be developed in pigs, chickens, and cows that are used as livestock foods to reduce human food poisoning. It is a highly marketable vaccine product that can be used regardless of species, And the need for development for the promotion of public health is urgently needed.

1. Datsenko, K. A., and Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A97,6640-6645.

Therefore, an object of the present invention is to provide a novel strain of Salmonella typhimurium which has been mutated to a large number of Salmonella typhimurium genes.

It is another object of the present invention to provide a vaccine composition for preventing food poisoning, which comprises a novel Salmonella typhimurium strain in which a gene of Salmonella typhimurium is mutated to a large extent and a pharmaceutically acceptable carrier.

Another object of the present invention is to provide a safe antimicrobial product to consumers by providing the Salmonella typhimurium strain and the food poisoning prevention vaccine composition.

In order to achieve the object of the present invention as described above, the present invention has been the ssrA gene of SEQ ID NO: 1, ssrB gene of SEQ ID NO: 2, rpoS gene of SEQ ID NO: 3, hmpA gene of SEQ ID NO: any one or more of four mutant Salmonella To provide a typhimurium strain.

In one embodiment of the present invention, the mutation of SEQ ID NO: 1 is characterized by being SEQ ID NO:

In one embodiment of the present invention, the mutation of SEQ ID NO: 2 is SEQ ID NO: 6.

In one embodiment of the present invention, the strain is characterized by a deficient or reduced viability in phagocytes of the host.

In one embodiment of the present invention, the mutation of the sequence restriction 3 is SEQ ID NO: 7.

In one embodiment of the present invention, the strain is characterized in that the active oxygen resistance secreted in the host phagocytes is deficient or decreased.

In one embodiment of the present invention, the mutation of SEQ ID NO: 4 is SEQ ID NO: 8.

In one embodiment of the present invention, the mutant of SEQ ID NO: 1 is SEQ ID NO: 5, the mutation of SEQ ID NO: 2 is SEQ ID NO: 6, the mutation of SEQ ID NO: 3 is SEQ ID NO: 7, The mutation of SEQ ID NO: 4 is characterized by SEQ ID NO: 8 (Accession No .: KCTC 12325BP).

In one embodiment of the present invention, the strain is characterized by a deficient or reduced persistent infectivity in the host.

In one embodiment of the present invention, the strain is attenuated.

The present invention also provides a food poisoning prevention vaccine composition comprising the Salmonella typhimurium strain and a pharmaceutically acceptable carrier.

The present invention provides a mutant mutant strain in which a number of specific genes of Salmonella typhimurium, which cause enormous economic damage in the livestock industry including the poultry industry, are mutated to be used as a vaccine excellent in safety and excellent in safety due to its low side effect As a result, it can be expected to replace import vaccine in domestic defense industry which relied on conventional imported vaccine, and to pioneer overseas export market.

FIG. 1 is a graph showing real-time RT-PCR measurement of mRNA expression changes of sseJ, ssaB, and sseA belonging to SPI-2 by mutating ssrA and ssrB genes.
FIG. 2 is a graph showing H ₂ O ₂ -induced reactive oxygen species susceptibility when the rpoS gene is mutated.
FIG. 3 is a graph showing GSNO-induced nitric oxide susceptibility when the hmpA gene is mutated.
FIG. 4 is a graph comparing colonization numbers of strains at the time of intraperitoneal inoculation with salmonella typhimurium and wild-type strains mutating ssrA and ssrB genes, rpoS gene, hmpA gene, and the spleen.
FIG. 5 is a graph comparing the number of colonies of strains at the time of oral administration and in the spleen of Salmonella typhimurium and wild type strains mutating ssrA and ssrB genes, rpoS gene and hmpA gene.
FIG. 6 is a graph showing the results of a defense rate test on live vaccine candidate strains in mice.
FIG. 7 is a graph of survival rate test results for live vaccine candidate strains in mice. FIG.
FIG. 8 is a graph showing the results of antibody detection on live-bacillus candidate vaccine strains in the female mice with the susceptibility test.

The present invention relates to a vaccine composition for mutagenizing ssrA gene, ssrB gene, rpoS gene and hmpA gene in a Salmonella typhimurium strain and using the same to prevent food poisoning.

The inventors of the present invention conducted a study on the pathogenicity of Salmonella vaccine strains for the development of animal vaccine strains and applied the control process of pathogenicity related genes to control the acute infection process of new host animals. . The present invention relates to a vaccine for the prevention and treatment of infectious diseases in a host animal using an integrated control process of the mutant strains, And to provide new vaccine strains through studies on the immune process. In other words, Salmonella is a key factor in survival and proliferation and systemic infection in the host cell among the mechanism of adaptation, survival and penetration in the stepwise immune system of the host animal, thereby eliminating the survival ability and survival ability of the phagocyte, SsrA gene, ssrB gene, rpoS gene and hmpA gene in order to produce a strain.

In order to maintain the ability to present antigenicity when the Salmonella typhimurium is infected to the host, the present inventors have found that spi1 is normally expressed and inhibits the expression of spi2 essential for survival in host phagocytes Gene mutation type.

spi2 is a gene essential for Salmonella to be toxic , ssaV, ssaJ, ssaL, ssaM, ssaO. ssaP, ssaQ, ssaR, ssaS, ssaT, ssaU, ssaH genes. The present inventors intend to inhibit the expression of the genes by inducing mutations in the regulatory region that regulate the mutation rather than the mutation of the individual genes for the mutation of spi2 . Therefore, the present inventors produced a mutation in which a part of the ssrA and ssrB genes in the regulatory region of the genes were deleted.

In addition, the present inventors have attempted to lose the function of the RpoS sigma factor, which is essential for active oxygen resistance in the host's phagocytic cells when infected with host cells. Salmonella is frequently exposed to various kinds of energy resources and various kinds of stresses available during the lifecycle, and in order to survive in such a changing living environment, it is necessary to balance the demand for nutrient intake with stress tolerance. This is accomplished by a controlled modulation of the RpoS sigma factor-dependent stress response. When the RpoS concentration in the cell decreases, the ability to fight nutritional competition and stress is also significantly reduced. Therefore, the present inventors produced the rpoS gene mutation in order to lose the ability to survive in response to stress caused by infection with host cells.

On the other hand, HmpA is Flavohemoglobin, a nitric oxide detoxifying enzyme that is essential for Salmonella to persistently infect host animals. We also mutated the hmpA gene to produce Salmonella strains with reduced persistence of infectivity.

Mutation confirmation of ssrA and ssrB regulatory genes was confirmed by real-time RT-PCR of the mRNA expression changes of sseJ, ssaB and sseA genes belonging to spi-2 gene. As can be seen from Fig. 1, the mRNA level of the genes belonging to spi-2 in the mutant mutants in which the ssrA and ssrB regulatory genes are regulated alone, or the ssrA and ssrB regulatory genes, rpoS gene and hmpA gene are all mutated It can be confirmed that it is significantly reduced.

The rpoS gene mutation confirmation was confirmed by comparing the growth curves of each strain in the medium supplemented with H ₂ O ₂ . Compared with the wild type strain , it was confirmed that the rpoS mutant alone, the ssrA and ssrB regulatory genes, the rpoS gene and the hmpA gene were markedly inhibited by the addition of H ₂ O ₂ in the triple mutant strain, and the rpoS mutation It was found that the susceptibility of reactive oxygen species was significantly increased in the species (Fig. 2).

Finally, the hmpA gene mutation confirmation was confirmed by comparing the growth curves of each strain in the GSNO supplemented medium. Compared with the wild-type strain, hMPA- only mutant or ssrA and ssrB regulatory genes, rpoS and hmpA genes were completely inhibited by GSNO treatment in multiple mutants, suggesting a significant increase in nitric oxide susceptibility in hmpA mutants 3).

After confirming the inactivation of each gene by multiple mutations in vitro , the present inventors tried to confirm in vivo inhibition of persistent infectivity due to the loss of gene function of the multiple mutant strain. If the persistent infectivity of multiple mutant strains is reduced or inhibited, this is because Salmonella can be used as a useful vaccine in an infectious host.

Therefore, the present inventors administered the mutant strain and the wild type strain to each mouse by intraperitoneal injection or oral administration method. As a result, it was confirmed that the number of colonies of the mutant strain was significantly reduced in the peritoneal inoculation time, but no significant difference was found in the spleen (FIG. 4). However, at the oral administration, the number of colonies of multiple mutant strains was significantly reduced in liver and spleen compared with wild type, and mutant strains could not be detected at all on day 12 (FIG. 5).

The inventors inoculated the mutant strains orally, intraperitoneally and intramuscularly to measure the protective effect on the mice against the ST mutants. As a result, all the groups were statistically significant, and in particular, the inoculation group in the peritoneal cavity showed the lowest bacterial count in the liver and spleen, thereby confirming the highest defense rate (see FIG. 6).

In order to measure the survival rate in the mouse against the ST mutant, the present inventors immunized the mouse with the highly pathogenic wild-type strain ST21 3 weeks after the vaccination and observed whether the mouse was dead for 15 days. As a result, the mice inoculated with wild-type ST21 were killed, but survival rate of ST △ 3 of the live vaccine candidate in this study was 100% in the intraperitoneal inoculation and 66.7% in the oral vaccination 7). Thereafter, in order to confirm the antibody vaccine candidate for the live vaccine candidate, the antibody was measured by orbital blood collection every week from the mouse. As a result, it was confirmed that the antibody antibody exhibited high antibody level and high defense force even after attacking (see FIG. 8).

Therefore, the inventors of the present invention have demonstrated that a mutant Salmonella typhimurium strain having multiple mutations is useful as a vaccine as a strain lacking persistent infectivity.

In the present invention, the mutant Salmonella typhimurium strain and a pharmaceutically acceptable carrier can be used as a vaccine composition for preventing food poisoning.

The host animal in which the vaccine composition of the present invention can cause an immune response may include poultry such as human, chicken, duck, pheasant, turkey, pig, goat, sheep, cattle, dog, cat and the like.

The vaccine of the present invention may be an attenuated live vaccine or a sadox vaccine, a subunit vaccine, a synthetic vaccine or a genetic engineering vaccine, but a live vaccine that induces an effective immune response desirable.

The term " live vaccine " as used herein means a vaccine comprising the active ingredient of a live bacterium. The term "attenuation" refers to artificially weakening the toxicity of living pathogens, mutating the genes involved in essential metabolism of pathogens, inducing immune system stimulating the immune system without causing disease in the body do. The attenuation of the bacteria can be achieved by ultraviolet (UV) irradiation, chemical treatment, or in vitro high-throughput subculture. Inactivation can also be accomplished by making a clear genetic change, for example by insertion of a particular deletion of the gene sequence known to provide toxicity or a sequence into the genome of the strain.

The term " Sadox vaccine "is also referred to as inactivated vaccine or killed vaccine, and is a vaccine containing dead bacteria.

The term "subunit vaccine" is a vaccine prepared by extracting only an antigen component capable of causing an immune function among the constituents of a germ. The vaccine can minimize side effects by inducing immune formation only at an antigenic site necessary for the defense of germ.

A "genetic engineering vaccine" may be a modification or removal of a specific gene that causes the pathogenicity of the bacteria.

In addition, the vaccine of the present invention may be mixed with inactivated cells or antigens used for the preparation of other vaccines used for preventing diseases caused by bacteria other than Salmonella occurring in host animals, Can be used as a mixed or complex vaccine that can prevent diseases together. The term "combined vaccine " refers to a vaccine in which different antiviral drugs are used together.

The vaccine composition of the present invention may also comprise naked nucleic acid compositions. In one embodiment of the invention, the nucleic acid may comprise a nucleotide sequence encoding the mutant RfaH protein of the invention. Methods of nucleic acid vaccination can be carried out by methods known in the art. For example, in U.S. Patent Nos. 6,063,385 and 6,472,375. The nucleic acid may be in the form of a plasmid or gene expression cassette. In one embodiment, the nucleic acid is provided surrounded by liposomes administered to the animal.

In addition, the vaccine composition of the present invention may further comprise at least one member selected from the group consisting of a solvent, an adjuvant, and an excipient. Examples of the solvent include physiological saline or distilled water. Examples of the immunity enhancer include Freund's incomplete or complete adjuvant, aluminum hydroxide gel, vegetable and mineral oil, etc. Examples of excipients include aluminum phosphate, aluminum hydroxide Side or aluminum potassium sulfate, but are not limited thereto and may further comprise materials used in the manufacture of vaccines well known to those skilled in the art.

The vaccine composition of the present invention may be prepared in oral or parenteral formulations, preferably in the form of parenteral injectable solutions and may be formulated in intradermal, intramuscular, intraperitoneal, intravenous, intranasal, or eidural routes &Lt; / RTI &gt;

The term "prophylactic" in the present invention means any action that inhibits or slows the onset of Salmonella infection by administration of the composition. The term "treatment" in the present invention means any action that improves or alleviates symptoms due to Salmonella infection by administration of the composition.

The composition of the present invention is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and the effective dose level will depend on the species and severity of the subject, age, sex, The activity of the compound, the sensitivity to the drug, the time of administration, the route of administration, the rate of release, the duration of the treatment, factors including co-administered drugs, and other factors well known in the medical arts. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And can be administered singly or multiply. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without adverse effect, and can be easily determined by those skilled in the art.

Advantages and features of the present invention and methods of achieving them will become apparent with reference to the embodiments described in detail below. Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are for illustrating the present invention specifically, and the scope of the present invention is not limited to these examples.

Hereinafter, the present invention will be described in more detail by way of examples.

&Lt; Example 1 >

Salmonella  Typhimurium Multiple Mutant Ltd. Manufacture

The present inventors prepared a mutant strain in which the ssrA and ssrB regulatory genes, the rpoS gene and the hmpA gene, respectively, were mutated, and then produced mutant mutants in which all these genes were deficient. The present inventors modified the recombinant technology using lamda-Red recombinase as a method for producing a gene mutation in a wild-type strain (see Prior Art 1).

1-1. ssrA And  ssrB Regulatory gene , rpoS gene , hmpA gene Single mutant strain manufacture

The present inventors carried out PCR using pKD3 or pKD4 as a template, using the primers shown in Table 3 below. The template plasmids pKD3 and pKD4 contain the antifungal Chloramphenicol and kanamycin resistance cassette genes, respectively, and the FRP (Flp recombiase target) gene sequence recognized by Flp recombiase on both outer sides. Primers P1 and P2 were used to recognize genes located just outside both gene sequences to obtain PCR products containing the antibiotic resistance cassette and the FRT gene sequence. Primers were constructed by attaching some sequences of target genes to mutate P1 and P2 sequences, and P1 and P2 were used for each gene name (eg, rpoS-P1, rpoS-P2). When these primers are used for PCR using pKD3 or pKD4 as a template, a DNA having a partial sequence of 5'-target gene-P1-FRT-antibiotic cassette-FRT-P2-target gene sequence (other side of gene) -3 ' The product was obtained. When transformed into salmonella cells overexpressing Lamda-Red recombinase, homologous recombination with the gene of a PCR product homologous to the target gene in the chromosome is promoted. As a result, the target gene is deleted and the P1-FRT- The antibiotic cassette-FRT-P2 is inserted and is mutable. After this, the pCP20 plasmid producing Flp recombiase was transformed into the mutant and the antibiotic cassette with the Flp recombiase located between the FRT gene sequences was removed.

It was used as ssrB-P1-P2 primers ssrA and ssrB adjustment that mutation party, in the case of the rpoS gene was used as the rpoS-P1 and-P2 primers rpoS, for hmpA gene was used hmp-hmp-P1 and P2 primers. The PCR was carried out by post elongation at 94 ° C for 10 min, at 94 ° C for 1 min, at 50 ° C for 0.5 min, at 72 ° C for 1 min, at 35 cycles and at 72 ° C for 10 min.

After producing the mutant strains, the PCR products were obtained using the ssrA-Fw / ssrB-Rv, rpoS-Fw / rpoS-Rv and hmp-Fw / hmp-Rv primers on the chromosome of wild type and mutant strain ST98 I checked whether the mutant strain was made properly.

1-2. ssrA And  ssrB Regulatory gene , rpoS gene , hmpA Genetically multiple mutant strain manufacture

by removing using the FLP recombinase (pCP20) a kanamycin cassette in the ssrA and ssrB gene regulation mutants it was finally complete the ssrA and ssrB gene regulation mutants (strain FB324). FB328 was prepared by introducing rpoS mutant strain (rpoS :: cm) into the FB324 strain and the chloramphenicol cassette was removed using FLP recombinase to complete ssrA and ssrB regulatory genes and rpoS gene mutant strains (FB 329 Strain). The FB 329 Note hmpA gene mutation in strain (hmpA :: Cm) to a transduction manufactures FB 330, FLP recombinase using the chloramphenicol cassette by removing the control ssrA and ssrB gene, rpoS gene, gene hmpA multiple mutants FB331 .

<List of strains and plasmids> Strain Genotype FB280 ST98 FB289 ST98 rpoE :: cm FB324 ST98 SSRAB :: km FB327 ST98 ssrAB FB328 ST98 ssrABrpoS :: cm FB329 ST98 ssrABrpoS FB330 ST98 ssrABrpoShmpA :: cm FB331 ST98 ssrABrpoShmpA IB1335 rpoS :: cm IB1337 SSRAB :: km IB1019 hmpA :: cm  Plasmids pKD3 cat cassette pKD4 blood cassette pKD46 Lambda Red recombinase pCP20 FLP recombinase

<List of primer> Primer Sequence (5'-3 ') rpoS-P1 tttcgcgcagacggcgcaggccttcaacctgaatctgacggtgtaggctggagctgcttc rpoS -P2 tgatttaaatgaagacgcggaatttgatgagaacggagtacatatgaatatcctccttag rpoS -Fw cagtgtcagcattgtctgta rpoS -Rev cagctctacaagcttgcatt ssrA -P2 atattgtactaagcaatcaacggtttgaagaagctgaacgcatatgaatatcctccttag ssrB -P1 acctcattcttcgggcacagttaagtaactctgtcactttgtgtaggctggagctgcttc ssrA -Fw caggcgattctatcattcgg ssrB -Rev ggattttgtcgacgatgagca hmp-P1 gcttgacgcacaaaccatcgctacagtaaaggccaccattgtgtaggctggagctgcttc hmp-P2 tggggtgcatctggctgcgccggcaggtgacttctttatgcatatgaatatcctccttag hmp- Fw cataacgtaaagcagagaag hmp -Rev gctcgttagggcatgcttttat rPoD- RT-Fw gtgaaatgggcactgttgaactg rpoD -RT-Rev ttccagcagataggtaatggcttc sseJ -RT-Fw Ctttaccacccaccatgcag sseJ -RT-Rev tgggcttgggatgtgattta ssaB -RT-Fw ggatatcagggccgaaggta ssaB -RT-Rev aaatgcaagttaaagccaggtg sseA -RT-Fw gaggggaatgatgataaagaaa sseA -RT-Rev ggggcttgagcattaagtt

A new strain of salmonella typhimurium, which has been mutagenized with the ssrA and ssrB regulatory genes, rpoS gene and hmpA gene prepared as described above, was deposited on November 28, 2012 at the microorganism resource center (KCTC), an internationally recognized depository institution, On December 5, 2012, KCTC12325BP was granted.

&Lt; Example 2 >

ssrA And  ssrB Regulatory gene , rpoS gene , hmpA Decrease in SPI-2 gene expression in gene mutant mutants

There are five types of SPI ( Salmonella pathogenicity island) in salmonella , SPI-1 and SPI-2 are known to be particularly important for the pathogenicity of Salmonella. SPI-1 is associated with invasion of host epithelial cells or inflammatory response, and SPI-2 is known to contribute to survival and proliferation after invasion.

The present inventors have found that SPI-1 expression is essential for invasion of animal epithelial cells. However, SPI-2 expression is required to make a mutant in which the expression of SPI-2, which survives in host phagocytes and causes systemic infection, Lt; RTI ID = 0.0 &gt; ssrA &lt; / RTI &gt; and ssrB regulatory genes that regulate transcription of the mutant strain. After that, mRNA expression levels of sseJ, ssaB, and sseA genes belonging to SPI-2 were measured by real-time RT-PCR.

As a result, as can be seen in 1 sseJ, ssaB, mRNA expression of sseA is compared to the wild-type ssrA and ssrB regulatory genes alone mutants and ssrA and ssrB regulatory genes, rpoS gene, hmpA gene significantly decreased in both the multiple mutants .

&Lt; Example 3 >

ssrA And  ssrB Regulatory gene , rpoS gene , hmpA Changes in reactive oxygen species susceptibility in gene mutant mutants

Sigma factor is a protein that regulates transcription in bacteria. My sigma factor there is activated in response to changes in environmental conditions, and RpoS (Sigma-38) protein, which rpoS the encoding is known to function as control to play a central role in normal stress response, especially phagocytic cells of in the Salmonella host Is known to be an essential element for the resistance of the active oxygen released from the body.

The present inventors have for the gene mutation master rpoS single mutants and the ssrA and ssrB regulatory genes, rpoS gene, hmpA gene ROS H ₂ O ₂ in a multiple mutant that encodes a sigma factor RpoS governing the antioxidant defense mechanism before the Salmonella To determine the susceptibility, 1 mM of H ₂ O ₂ was added and the growth curve of Salmonella was observed over time.

As a result, also as can be seen from 2, rpoS single mutants and ssrA and ssrB control when genes, rpoS gene, hmpA gene multiple mutations note the addition of H ₂ O ₂ was that growth is to determine the inhibited, the rpoS The loss of RpoS protein function due to the mutation was experimentally confirmed.

<Example 4>

ssrA And  ssrB Regulatory gene , rpoS gene , hmpA Changes in Nitric Oxide Sensitivity in Gene Mutant Mutants

HmpA is a flavohemoglobin found in bacteria. HmpA plays an important role in the RNS defense system, and it is reported that when hmpA is defective, it does not perform the detoxification action of nitric oxide.

Thus, the inventors have produced hmpA gene deletion mutants that are secreted in the host's phagocytic cells to decrypt nitric oxide that controls the persistent infection of Salmonella as in Example 1 above. The growth curves of salmonella strains were observed over time by adding 2 mM of GSNO, a nitric oxide donor, to determine whether the susceptibility to nitric oxide actually changes in the hmpA mutant strain.

As a result, it was confirmed hmpA a single mutants and the ssrA and ssrB gene regulation, rpoS gene, the gene is inhibited hmpA multiple mutants grow when GSNO added only As can be seen in FIG. That is, the present inventors confirmed that the function of HmpA is lost by the mutation of hmpA through the above results.

&Lt; Example 5 >

For mouse vaccination ssrA And  ssrB Regulatory gene , rpoS gene , hmpA Gene multiple mutant strain and wild type strain culture

The present inventors prepared a mouse experiment to confirm the function of the multiple mutation-resistant Salmonella vaccine prepared above. First, the present inventors cultured multiple mutant strains and wild type strains for mouse inoculation. The mutant strains of ssrA and ssrB regulatory genes, rpoS gene and hmpA gene mutants were cultured by adding CM (chloramphnicol) to the LB liquid medium. Wild type strains LB liquid medium. After culturing at 37 ° C for 18 hours, 100 μl of the culture was inoculated again into the LB (CM-supplemented) liquid medium or LB liquid medium, and further cultured for 12 hours, followed by centrifugation at 13000 rpm for 20 minutes. Centrifuged pellet was washed twice with PBS, it was dispensed in 10 ³ / 100ul.

&Lt; Example 6 >

ssrA And  ssrB Regulatory gene , rpoS gene , hmpA Mouse inoculation of gene mutant mutant strain and wild type strain

The present inventors tried to test the persistent infectivity by inoculating the mouse with the prepared multiple mutant and wild type strains. Thus, the present inventors used C57BL / 6 mice and isolated 5 cows in each group. Each cage was fed with sterilized feed and water. The growth conditions were 22 ° C, 40-70% humidity, 12-hour day and night cycle. The strain prepared in Example 5 was orally administered to a 7-week-old female mouse at a dose of 1.0 × 10 ³ CFU / g per mouse or 2.6 × 10 ⁷ CFU / g at 3, 6, 9 and 12 days after inoculation It was euthanized by cervical dislocation.

Then, the liver and spleen were removed from the euthanized mouse, each was placed in a beaded tube, and the weight was measured. Then, 1 ml of BPW was added and the tissue was repeated three times at 30 Hz for 3 minutes using a tissue crusher (QUIAGEN, USA) . 100 μl of the pulverized tissue oil was inoculated on XLT agar medium or Salmonella Shigella agar medium and cultured at 37 ° C. for 24 hours, and the number of bacterial colonies was measured. The Salmonella Shigella agar medium is a differentially selective medium, which can be distinguished from other microorganisms by color.

As a result, the number of colonies in the liver during the intraperitoneal inoculation showed significant differences in the mutant strains and wild strains by each autopsy day. In other words, it was confirmed that the number of colonies decreased by more than 99% in mutant strains as compared with wild type strains. On the other hand, in the spleen, the mutant strains showed a decreased number of colonies than wild-type strains on all autopsy days, but no statistically significant difference was found (Fig. 4).

On the other hand, the number of colonies at the time of oral administration showed a significant difference only in the wild type and the mutant strain at 3 days, but it was statistically significant at the 3 days and 9 days 12 days in the spleen (Fig. 5).

&Lt; Example 7 >

ssrA And  ssrB Regulatory gene , rpoS gene , hmpA Measuring the ability of the mutant gene to protect the mutant in mice

The present inventors tried to test the protective ability after inoculating the prepared triple mutant strain into a mouse. Thus, we used C57BL / 6 mice and isolated 15 cows in each group. Each cage was fed with sterilized feed and water. The growth conditions were 22 ° C, 40-70% humidity, 12-hour day and night cycle. The triple mutant strain prepared in Example 5 was orally administered at a dose of 1.0 × 10 ³ CFU / g per mouse to a 7-week-old female mouse or 2.6 × 10 ⁷ CFU / g (vaccinated group). After 21 days from the inoculation, the wild type strain was inoculated with 1.0 × 10 ⁵ CFU / g per mouse and inoculated with 1.0 × 10 ⁷ CFU / g, and the blood was collected 7 days later and the antibody value was examined using ELISA .

After the mice were euthanized by cervical dislocations, the liver and spleen were removed, placed in bead tubes, weighed, and 1 ml of BPW was added. Using a tissue crusher (QUIAGEN, USA) The tissue was pulverized repeatedly. 100 μl of the pulverized tissue oil was inoculated on XLT agar medium or Salmonella-Shigella agar medium and cultured at 37 ° C. for 24 hours, and the number of bacterial colonies was measured. The Salmonella-Shigella agar medium is a differentially selective medium, which can be distinguished from other microorganisms by color. In addition, fecal shading samples were collected every week until the mice were euthanized after inoculating the mice with the strains prepared in Example 5, and the number of bacterial colonies was measured in the above manner.

As a result, colonization number of aggressive inoculation strains was significantly different between triple mutant and wild type strains at the time of intraperitoneal and oral administration. In other words, it was confirmed that the number of colonies was reduced by more than 90% in mutant strains compared to the wild type vaccine. In addition, it was confirmed that the triplet mutant strain also showed a statistically significant decrease in the number of colonies (more than 90% decrease) in the spleen compared to the wild type strain.

On the other hand, the number of colonies in the stool sample during the intraperitoneal and oral administrations showed a significant difference (more than 90% reduction) in the wild type and triple mutant strains from 2 weeks later, and the immune response of the blood sample was also statistically significant (90% Or more).

&Lt; Example 8 >

Defense Rate Test for Lactobacillus Vaccine Candidates in Mice

The present inventors used 7-week-old BALB / c female mice as an experimental animal for IVF test for the live vaccine candidates in the mice, and were raised in IVC Rack (MVCS; Threeshine, Korea). For the ethical use of experimental animals, the 3R principle was observed and an animal experiment was conducted under the regulation of the Animal Experiment Ethics Committee of Kangwon National University (Permission No. KW-130924-1). In the case of the defense rate test, 3 weeks after the vaccination, 10 ⁸ CFU / ml of ST21 was inoculated with a mouse mouth, and the organ weight was measured on the 12th day, and the number of the attack bacteria detected from liver and spleen was measured. The isolated liver and spleen were diluted with PBS, and the tissue was disrupted with TissueLyser (QIAGEN, USA). The number of colonies was measured in Salmonella-Shigella (SS) agar (BD, USA). A commercial vaccine (Salenvac T; MERCK, USA) was used as a positive control. In order to measure the protective effect of ST mutants, mutants were inoculated in the oral, intraperitoneal (IP), and intramuscular (IM) titers in an appropriate amount and phosphate-buffered saline (PBS) See Table 5).

&Lt; List of vaccines and strains used in the control of survival rate and survival rate for live vaccine candidate strains in mice & Vaccine Route Dose (CFU) Volume (μl) Mouse numbers Protection Survival ST △ 3 Oral 109 100 6 6 ST △ 3 IP 104 100 6 6 PBS IP 100 6 6 Salenvac-T IM 109 200 6 6

After 2 weeks of inoculation, all mice were killed and then the liver and spleen were extracted and the number of colonies of the attacked strains was measured. As a result, compared with the control group (1.3 × 10 ⁷ CFU / g), all groups were statistically significant Respectively. This shows that the vaccine of the candidate vaccine is excellent. In addition, the vaccine candidate strains showed significantly lower values than commercial vaccines. In comparison with the control (1.5 × 10 ⁶ CFU / g), the vaccine group showed a low number of colonies in the spleen. Especially, abdominal endocervical incidence was significantly lower. The lowest abundance was observed in the abdominal endotracheal tube (3.1 × 10 ⁴ CFU / g) and spleen (1.7 × 10 ⁴ CFU / g), showing the highest rate of defense (see FIG. 6).

&Lt; Example 9 >

Survival rate test for live vaccine candidate strains in mice

The present inventors used 7-week-old BALB / c female mice as an experimental animal for the survival rate and defense rate test for the live vaccine candidate strains in the mice, and bred in IVC Rack (MVCS; Threeshine, Korea). For the ethical use of experimental animals, the 3R principle was observed and an animal experiment was conducted under the regulation of the Animal Experiment Ethics Committee of Kangwon National University (Permission No. KW-130924-1). In the case of the survival rate test, mice were orally observed for 15 days after inoculation with 10 ¹⁰ CFU / ml of the highly pathogenic wild-type Salmonella Typhimurium (ST21: ATCC14028) three weeks after the vaccination with mouse oral.

After 3 weeks of vaccination, all mice of the control group were inoculated with wild type strain ST21 (10 ⁸ CFU / ml, 10 ¹⁰ CFU / ml of survival rate) , And one mouse died from the fifth day, and all mice died from the 11th day. The mice inoculated with the intramuscular group were all killed until day 10 except one. In contrast, the survivor vaccine candidate ST △ 3 used in this study showed a 100% survival rate after inoculation with intraperitoneal vaccine, although the activity was poor after the attack, % (See Fig. 7).

&Lt; Example 10 >

Antibody test for live vaccine candidate strains in mice with armor rate

Blood was collected from all mice before or after vaccination (0 weeks) and 1, 2, 3, and 5 weeks by orbital blood collection. ELISA was performed to identify changes in blood antibody. Each well was coated with 50 μl / well of antigen (Salmonella Typhimurium 21 OMP, 10 μg / ml) and the plate (Nunc, Wiesbaden, Germany) was stored at -4 ° C for 16 hours. The plate was then washed three times with PBST (0.5% Tween 20 + PBS) and then blocked with 3% BSA (Merck, Darmsdadt, W. Germany) for 3 hours at 37 ° C. After washing again with PBST, 100 μl of 200-fold diluted serum was added to PBS containing 0.5% BSA as a primary antibody, and cultured at 37 ° C for 2 hours. IgG, IgG1, IgG2a and IgA diluted 200 times and 2000 times with the secondary antibody were added and cultured at 37 ° C for 1 hour. After adding 100 μl of TMB (SurModics, Eden Prairie, USA) and allowing to react in the dark for 3 minutes, the reaction was stopped with 2N H ₂ SO ₄ and the absorbance was measured with an ELISA reader.

The serum levels of IgG, IgA, IgG1, and IgG2a were measured weekly in mice. The IgG antibody titers were significantly higher than those of the control group for 2 weeks to 5 weeks after vaccination. Antibodies were most abundant in abdominal endotracheal intramuscular and intramuscular insomnia, followed by oral insomnia. In the case of IgA, antibody titers did not seem to increase or increase slightly after vaccination, but all of the vaccine groups showed significantly higher antibody formation after the inoculation than the control group. As expected, the rate of IgA formation was higher in the oral insomnia group than in the intraperitoneal insemination group. In the case of IgG1, the commercial vaccine group was found to have a high antibody formation rate from the second week of vaccination. Antibody formation in the abdominal endotracheal group was lower after vaccination than in the intramuscular endothelium group, but antibody formation was similar at 5 weeks after the attack. In IgG2a, the antibody formation rate of abdominal endothelium showed a significant increase after vaccination. In the 3rd week of vaccination, antibody was higher than positive control, It was confirmed that even after attacking, high antibody value was exhibited and high defense force was exhibited (see FIG. 8).

Through the above results, the inventors of the present invention have confirmed that the triple mutant strain of the present invention can be used as a vaccine against wild type strains.

Statistical analysis

One-way ANOVA was used for statistical analysis to see the significant difference between the experimental groups. p <0.05 was considered to be significant, and Dunnett's multiple comparison test was performed to compare the differences between the groups.

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

Korea Biotechnology Research Institute KCTC12325BP 20121128

<110> KNU-Industry Cooperation Foundation          Industry-Academic Cooperation Foundation, Chosun University <120> Multiple mutated Salmonella typhimurium and vaccine composition          for prevention of food poisoning <130> PN1209-467 <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 2763 <212> DNA <213> salmonella typhimurium <400> 1 ttaagtaatg gtgtagtttt tgaagatcat acgtattttc tggcgtaagt cggttagttc 60 ctccagcgcg atgattttcc ccatttttac gcgattctca atgtctatga catagcatac 120 caattcagtc tgccctattt gacctaaaca gccttttaat gtgtgaatta actgatcgat 180 tttttctcca gccgatacgg cattttcaat atcagccagc aagaggtcca gtgattggaa 240 aatcttgcta ttaatgacca tatcatctgt cgccagtagc gctgagcagc gactcggatc 300 ctgctcctgt agctctatat ttcgtaaaag ttggtattct gcggcaatac tgatgtagcg 360 agctaaggta gccaatgtca ctggttttgt aatgtaatga tgaatcccat tttttttaca 420 acgatgaata tcttctgtcg ctacgctagc ggatagtgcc acaaacatgc agtcaggatc 480 taaattattc ggctcatcat gccataatcg tacacattca ataccatcta tttctggcat 540 tctaatgtca atcagtacta aatcgaatcg ctgctgttgt gataaagtca gagcctcgtt 600 actactggcg gcaatagtga cgtgttggcc caggctgaca agcattttgc cgatgatatc 660 ccgattaata tcggcatcat caaccaaaag aatctgcaac tgccagggtg gtaacaaatt 720 atttattact ggcatatttg gtgtacacaa tattaactgt tgcgccaggt cgtagagttt 780 tccggagaaa tacaaaagct ctgcgttgag aagcgcattt tgctggtggg gtggttcacc 840 gcgtattccc cagcaagcca gttgccgatg caggcagaac ggcgctgaca gcgtcccttt 900 aattggttga ggcggctggt attcttgtaa gggtaatact agcgagacac aggttccaac 960 cccggggaca ctttttagtg tcagattacc gcccatcatt ttagccaggc ttgacgcaat 1020 agtcagtcca attcctgtac cttgcgaatt tgtgtctgct tgataaaaag cagtaaagat 1080 ttgagactgc tgctgtattt caatcccttt accgctatcg ctaaccagaa atattaattg 1140 ttcctcatga cgcttgaccg tcagacgtat ccctccggtt tcggtaaatt ttaccgcgtt 1200 cccgagtaaa ttaaccaaaa tttgccgtaa acggatactg tcggtatgaa aatagagagg 1260 gacatgttga ccgacaaaag tacgtaatga cagttttttg ctttgcgctg gcccctggat 1320 ggtttgcatt gcctggtcca gtaacggcag taacgctgtt tcttccatat gtaatgtgaa 1380 atgaccagac tcgatgcgtg aaaaatccag cagattatta ataatagcta acaaagacag 1440 tgtacaattt ctggcggtat cagctaatcc ttgttgctct atgtttaaag gggtggtttg 1500 taataattca attgcaccga gtacgccatt catcggagta cgtaactcat gacttattac 1560 cgtaagatga atgcttttac gtttgttagc tcgctcagcg cgtttttttg cttcatttag 1620 cgcctgggtg cgctctgcga ctttgttttc cagattgtcg tattggactt gtagagtatc 1680 aagcagttgg ttaaaagcac cggcaatact atctaattca tccagtcgtt gtgctggtaa 1740 acgtgtgctc agcggtgcag ttgcggtttt attaatgaca tcgacaaaac gccataacgg 1800 tttggccagt gagcgatgta gtaaccagca aaaagccgac gtcatcaaca ccaatgctgt 1860 taatgtaaag gggatttgtt gaaggataat ttttaagatg cgattatgta gattaccgta 1920 tgggtacagc gtaaccagac tccatccggg gccatgcaag gttgtgcgta atatcagaaa 1980 tccgggaatt tgctgccatc catcatgcag cgttacattt tctaactgtg tacgtatttt 2040 ttgcgggatg tatgaaaacg gcaataagtg gttgttttga tccagccata ctcgaatact 2100 atcatctaat ggcaggtggc tcttagtaat gagatcggga agtttaaccg tcacctcaaa 2160 aaatacgcct tgctgatcgg caaccgcaac ggaagcgtgc catcctttgc cgtttatgta 2220 ttctggttca ctccagtaaa acccggcatg ggttgggtat aaaggaaagc tttttcgcgt 2280 taaaggctgt agagttgaat aatctgaagg gttatcagta gataataacg aaatctcatt 2340 tttatgatta agaataaaac tatcgcgacg aaagctattt tcatcgatat cagaggactg 2400 cagaaagaga cggtgcttct ctccgtttag cgtcggcgtg caatttgaag gaccgacaga 2460 tagatgccgg ctcacctcag ggaaaatatc gttatgatga atctcagtcg ctaatgagca 2520 ttgatacatt aaatttttag cgtcacgttc agcttcttca aaccgttgat tgcttagtac 2580 aatattcatc tcggatagaa cggataaatc ctctattata tgctgccgtt tctgaaccat 2640 tgatatataa gctgcggtaa gcacagatag cagccaaata attattgttg ttaataaaaa 2700 taaaaaagtt agcctgatta ctaaagatgt ttgcagcgta ttcttgagat tgagcaaatt 2760 cat 2763 <210> 2 <211> 639 <212> DNA <213> salmonella typhimurium <400> 2 ttaatactct attaacctca ttcttcgggc acagttaagt aactctgtca ctttatgaac 60 ctgtagcttt ctcatcatat tcatccggtg tgtttcgacg gtttttatac tgatatgtag 120 cttttcgctg atcccatgat tggtataccc ctcgtcaata agtttaagaa cctgacgctc 180 gcgcaaagta agcagttgat gattggtcgt gtcagcgttt aattcagcca ggatagcttc 240 ccgattcaac gttgggtcaa tgtaacgctt gtttactgct actgtttgca atgccgctaa 300 cagaacttgc tgactactgc tttttaaaac atagccatta gcacctgcgg ctaaagtttt 360 aatggtcata tactcttgtt ggtatgctgt gtaaaccaga atattcattg ctggccaacg 420 ctgatgtaat tgaggaatga tatccaggcc attgatgcca ggtagactaa gatcaaggat 480 aagtatgtca ggctcgtatg cacaacaggc attataaacc tcaagaccat ttttaacatg 540 ctctacaatt ttaaaatgag gccagggtaa taaggcattc ataatgccgt taatgatgat 600 ttcatgatcg tctactaata agatcttata ttctttcat 639 <210> 3 <211> 993 <212> DNA <213> salmonella typhimurium <400> 3 ttactcgcgg aacagcgctt cgatattcag cccctgcgtc tgcagaattt cgcgcagacg 60 gcgcaggcct tcaacctgaa tctgacgaac acgttcacgc gtaagaccga tttcacggcc 120 tacatcttcc agtgtcgcag cttcatatcc cagcagaccg aaacggcgcg ccagcacttc 180 acgctgtttg gcgttcagtt cgaacaacca tttgacgatg ctctgtttca tatcgtcatc 240 ttgcgtggtg tcttccggac cgttctcttt ttcatcggcc aggatgtcca gcaacgcttt 300 ttcggaatca ccgcccagcg gggtgtctac cgaggtaatg cgctcgttga gacgaagcat 360 acggctgacg tcatcaaccg gtttatccag ttgctctgca atttcttccg cactcggttc 420 gtggtccagt ttatgcgaca actcacgtgc ggtgcgcagg tatacgttca gctctttaac 480 aatgtgaatc ggcaagcgaa tcgtacgggt ttggttcatg atcgcccgtt cgattgtctg 540 gcgaatccac caggttgcgt atgttgagaa gcggaacccg cgttccgggt caaacttctc 600 gactgcacgg ataagcccca ggttgccctc ttcaatcagg tccagcaacg ccagtccacg 660 attgccataa cggcgggcaa tttttaccac cagacgcagg ttactctcaa tcatgcgacg 720 gcgagaagcg acatctccac gcagtgcgcg acgcgcaaaa tagacttctt cttcggctgt 780 taacagtggt gaatacccaa tctcaccaag gtaaagctga gtcgcgtcca acacacgctg 840 tgtggcccct tgcgataaca gctcttcttc agccaggtcg ttatcactgg gttcctcttc 900 actcaaggct ttttcgtcaa aagcctctac tccgttctca tcaaattccg cgtcttcatt 960 taaatcatga actttcagcg tattctgact caa 993 <210> 4 <211> 1191 <212> DNA <213> salmonella typhimurium <400> 4 atgcttgacg cacaaaccat cgctacagta aaggccacca ttcccctgct ggttgaaaca 60 ggaccgaaac tgaccgccca cttctacgac cgtatgttta cgcataaccc ggagctcaaa 120 gaaatcttca atatgagcaa ccagcgtaac ggcgatcagc gtgaagccct gtttaatgct 180 atcgcggcct acgccagcaa tatcgaaaat ttaccggcgt tgctgccggc ggtagaaaaa 240 atcgcgcaga agcacaccag cttccagatt aagccggagc agtacaacat cgtcgggaca 300 catctgctgg cgacgctgga cgaaatgttc aacccgggcc aggaagtgct ggacgcgtgg 360 ggcaaagcct atggcgtact ggctaacgtc tttattcatc gggaagccga gatttatcac 420 gagaacgcca gcaaagacgg cggctgggaa ggcacgcgcc ccttccgcat cgttgcgaaa 480 accccgcgta gcgcactgat caccagcttt gagtttgaac cagtcgacgg cggtacggtg 540 gcggaatacc gtcccgggca gtatctgggc gtctggctga agccggaagg ttttgcgcat 600 caggagatcc gccaatattc actgacccgt aaacccgatg gcaaagggta ccgtattgcc 660 gtgaagcgtg aagacggcgg ccaggtatca aactggttac accatcacgc cagcgtaggc 720 gatggggtgc atctggctgc gccggcaggt gacttcttta tgaatgtcgc cgctgatacc 780 cccgtttcgc tgatttccgc tggcgtcggc cagacgccga tgttagcgat gctcgatacg 840 ctggcgaaag aacagcatac cgcgcaggtg aactggttcc acgcggcgga gaacggcgac 900 gtccatgcgt ttgccgacga agtgagcgag ctgggccgta cactgccgcg tttcactgcc 960 catacctggt accgcgagcc gactgagtcc gatcgcgccc aacgcctctt cgacagcgaa 1020 gggctgatgg atttaagcaa actggaagcc gcgatcagcg atccagcaat gcagttctat 1080 ctttgcggcc cggtaggctt tatgcagttt gccgcaaaac aactggtttc acttggcgtg 1140 aataacgaaa acattcatta cgaatgcttc ggcccgcata aagtgctgta a 1191 <210> 5 <211> 283 <212> DNA <213> Artificial Sequence <220> <223> mutated ssrA gene from salmonella typhimurium <400> 5 gaagttccta tactttctag agaataggaa cttcggaata ggaactaagg aggatattca 60 tatggcgttc agcttcttca aaccgttgat tgcttagtac aatattcatc tcggatagaa 120 cggataaatc ctctattata tgctgccgtt tctgaaccat tgatatataa gctgcggtaa 180 gcacagatag cagccaaata attattgttg ttaataaaaa taaaaaagtt agcctgatta 240 ctaaagatgt ttgcagcgta ttcttgagat tgagcaaatt cat 283 <210> 6 <211> 139 <212> DNA <213> Artificial Sequence <220> <223> mutated ssrB gene from salmonella typhimurium <400> 6 ttaatactct attaacctca ttcttcgggc acagttaagt aactctgtca ctttgtgtag 60 gctggagctg cttcgaagtt cctatacttt ctagagaata ggaacttcgg aataggaact 120 aaggaggata ttcatatgg 139 <210> 7 <211> 238 <212> DNA <213> Artificial Sequence <220> <223> mutated rpoS gene from salmonella typhimurium <400> 7 ttactcgcgg aacagcgctt cgatattcag cccctgcgtc tgcagaattt cgcgcagacg 60 gcgcaggcct tcaacctgaa tctgacggtg taggctggag ctgcttcgaa gttcctatac 120 tttctagaga ataggaactt cggaatagga actaaggagg atattcatat ggtactccgt 180 tctcatcaaa ttccgcgtct tcatttaaat catgaacttt cagcgtattc tgactcaa 238 <210> 8 <211> 596 <212> DNA <213> Artificial Sequence <220> <223> mutated hmpA gene from salmonella typhimurium <400> 8 atgcttgacg cacaaaccat cgctacagta aaggccacca ttgtgtaggc tggagctgct 60 tcgaagttcc tatactttct agagaatagg aacttcggaa taggaactaa ggaggatatt 120 catatggtgg ggtgcatctg gctgcgccgg caggtgactt ctttatgaat gtcgccgctg 180 atacccccgt ttcgctgatt tccgctggcg tcggccagac gccgatgtta gcgatgctcg 240 atacgctggc gaaagaacag cataccgcgc aggtgaactg gttccacgcg gcggagaacg 300 gcgacgtcca tgcgtttgcc gacgaagtga gcgagctggg ccgtacactg ccgcgtttca 360 ctgcccatac ctggtaccgc gagccgactg agtccgatcg cgcccaacgc ctcttcgaca 420 gcgaagggct gatggattta agcaaactgg aagccgcgat cagcgatcca gcaatgcagt 480 tctatctttg cggcccggta ggctttatgc agtttgccgc aaaacaactg gtttcacttg 540 gcgtgaataa cgaaaacatt cattacgaat gcttcggccc gcataaagtg ctgtaa 596

Claims (11)

The ssrA gene of SEQ ID NO: 1 is mutated to SEQ ID NO: 5, the ssrB gene of SEQ ID NO: 2 is mutated to SEQ ID NO: 6, the rpoS gene of SEQ ID NO: 3 is mutated to SEQ ID NO: 7 and the hmpA gene of SEQ ID NO: Salmonella typhimurium strain mutated at number 8 (Accession number: KCTC 12325BP). delete delete The method according to claim 1,
Wherein the strain is deficient or decreased in viability in the host phagocyte. delete The method according to claim 1,
Wherein said strain is deficient or reduced in active oxygen resistance secreted in phagocytes of a host. delete The method according to claim 1,
Wherein said strain is deficient or decreased in persistent infectivity in a host. delete The method according to claim 1,
The strain is Salmonella typhimurium strain characterized by being attenuated. A vaccine composition for preventive food poisoning comprising the Salmonella typhimurium strain according to claim 1 and a pharmaceutically acceptable carrier.

Images