WO2010084350A1

WO2010084350A1 - Mutant pathogenic bacterial and live attenuated vaccine compositions

Info

Publication number: WO2010084350A1
Application number: PCT/GB2010/050086
Authority: WO
Inventors: Arthur Thompson; Steven D. Bowden
Original assignee: Plant Bioscience Limited
Priority date: 2009-01-21
Filing date: 2010-01-21
Publication date: 2010-07-29
Also published as: GB0900974D0

Abstract

The invention relates to a mutant pathogenic bacterium, preferably a mutant intracellular pathogenic bacterium, that is incapable of expressing one or more metabolic genes; preferably the mutant pathogenic bacterium is attenuated. A mutant pathogenic bacterium of the invention may be incapable of expressing two or more metabolic genes, which encode proteins involved in the same or in different metabolic pathways, such as glycolysis and sugar transport. The invention also relates to vaccines comprising a live attenuated mutant pathogenic bacterium of the invention, methods for their production and their use for the protection of humans or animals against infection with a pathogenic bacterium or against the pathogenic effects of infection.

Description

Mutant Pathogenic Bacteria and Live Attenuated Vaccine Compositions

Field of the Invention

The present invention relates to mutant pathogenic bacteria, particularly mutant intracellular pathogenic bacteria, useful in the preparation of attenuated pathogenic bacteria, to attenuated pathogenic bacteria, to such bacteria carrying a heterologous gene, to vaccines comprising live attenuated pathogenic bacteria, optionally carrying a heterologous gene, useful for the prevention of microbial pathogenesis, and to methods for the preparation of such vaccines and bacteria.

Background to the Invention

The mammalian cell provides a uniquely stable environment for the replication and survival of intracellular bacteria. The host cell provides constant temperature and pH regulation, a ready supply of nutrients for growth, and protection against antimicrobial agents. Intracellular bacteria can be divided into strict and facultative bacteria (1). Strict intracellular bacteria cannot be cultivated in broth medium and can replicate only in vivo or in tissue-cultured cells in vitro. Strict intracellular bacterial pathogens include Chlamydia (responsible for genital and ophthalmic infections in humans), Coxiella (the etiological agent of Q fever), Ehrlichia (headache, fever and chills in humans) and the Rikettsias. In contrast, facultative intracellular bacteria are able to replicate in broth medium as well as within mammalian cells. Certain facultative intracellular pathogens are able to enter and multiply in phagocytic cells such as neutrophils or macrophages. The intracellular environment of a phagocyte may protect the bacteria during the early stages of infection or until they develop a full complement of virulence factors. The intracellular environment also guards the bacteria against the activities of extracellular bactericides, antibodies, drugs, etc. Facultative intracellular parasites that are able to replicate in phagocytic cells include Yersinia, Legionella pneumophila, Salmonella, Mycobacterium tuberculosis and Mycobacerium leprae, the agents of tuberculosis and leprosy respectively. Other facultative intracellular pathogens are able to replicate in nonphagocytic cells and include Bartonella, associated with several human diseases, Brucella, Franciscella tularensis, Listeria, Salmonella and Tropheryma whippelii (associated with Whipple's disease).

Examples of bacterial intracellular pathogens (1) and the diseases that they cause are:

Organism Disease

Mycobacterium tuberculosis Tuberculosis

Mycobacterium leprae Leprosy

Listeria monocytogenes Listeriosis

Salmonella typhi Typhoid Fever

Shigella dysenteriae Bacillary dysentery

Yersinia pestis Plague

Brucella species Brucellosis

Legionella pneumophila Pneumonia

Rickettsiae Typhus; Rocky Mountain Spotted Fever

Chlamydia Chlamydia; Trachoma

Burkholderia mallei Glanders

Burkholderia pseudomallei Melioidosis

Although there is a long history of success in developing vaccines against extracellular bacterial pathogens, the development of vaccines against intracellular bacterial pathogens has proven to be more challenging (2). Intracellular bacteria have developed an array of weaponry that enables them to evade host cell immune mechanisms. These include slow growth phenotypes in phagocytic cells, and the ability to shield themselves from host cell defence mechanisms. The invasion and growth of intracellular pathogens in host cells also involves many virulence factors acting in concert. Therefore, unlike extracellular pathogens, it is unusual to identify a single gene product such as a toxin, which provides an overriding role in the pathogenesis of the disease and may provide a target for antimicrobials. Furthermore, antigens that play roles in the pathogenesis of disease caused by intracellular pathogens are likely to have limited visibility to the immune system and are generally not good targets for antibody mediated protection. Although antibodies have been developed that provide protection against some intracellular pathogens, the level of protection that they offer is relatively low. For example, antibodies can protect against low but not high virulence strains of F. tularensis (3), or can provide protection against low challenge doses of B. pseudomallei administered by the intraperitoneal route, but not administered by the aerosol route of infection (4,5).

The need to devise effective vaccines against intracellular bacteria has been driven by the emergence of multi-antibiotic resistant strains over the past 20 - 30 years, which pose a serious future threat for human and animal welfare. Furthermore, certain intracellular bacterial pathogens may act as candidates for biowarfare agents. For example, Brucella suis, Brucella melitensis, Brucella abortus, Francisella tularensis, Burkholderia mallei and Burkholdeήa pseudomallei are strains that may form a basis for the development of putative biowarfare agents.

Salmonella is a facultative intracellular pathogen that causes gastroenteritis and fatal systemic disease in mammals including humans, cattle and pigs. Typhoidal Salmonella serovars, such as Salmonella enterica serovars Typhi and Paratyphi cause an estimated 20 million cases of salmonellosis and 200,000 human deaths worldwide per annum (6). Salmonella infections occur as a result of ingestion of contaminated food and water. An important source of Salmonella infections in humans arises from contaminated poultry, pig, and cattle products. A randomised UK National Survey carried out in 2004 for faecal carriage of Salmonella in slaughter pigs, cattle and sheep identified S. Typhimurium in 11.1 % of caecal samples and 2.1 % of carcass swabs of 2509 pigs (7). Other studies have shown a high prevalence of S. Typhimurium in cull cattle, especially after transport. In one survey a pre-transport prevalence of 1 % increased to 21 % at the abattoir (8). A further study found 21.3% of 5087 caecal and colonic samples from cull dairy cows in the USA contained Salmonella (9).

Because salmonellosis has such global effects on human health, development of reliable vaccines is critical (for review see (10)). Many vaccines using Salmonella mutants have failed due to either over- or underattenuation of the vaccine strain (11 ,12). In systemic infections, Salmonella penetrates the small intestinal barrier by invading gut epithelial cells. From there Salmonella can gain access to the mesenteric lymph nodes where the bacteria are engulfed by phagocytic cells such as macrophages. Once inside macrophages, Salmonella is compartmentalised into an intracellular phagosome, which is modified to become the "Salmonella containing vacuole" (SCV). The SCV acts as a shield that prevents lysosomal fusion and exposure to host cell antimicrobial agents (13,14). Salmonella also resides within an SCV during invasion of epithelial cells (15). The Salmonella must acquire nutrients for replication in epithelial cells and macrophages.

It has previously been suggested that due to metabolic redundancy, the scope for antimicrobials based on the exploitation of metabolism-related genes was limited (16).

Statement of Invention

The invention provides a mutant pathogenic bacterium, preferably a mutant intracellular pathogenic bacterium, that is incapable of expressing one or more metabolic genes.

Such a mutation can be a deletion, an insertion, a substitution or a combination thereof, provided that the mutation leads to the failure to express a functional protein (functional silencing). Preferably the mutation is a deletion. Preferably the metabolic gene or genes are deleted, however other mutations, for example partial deletion of the gene or mutation in sequences that regulate expression of the metabolic gene or genes may be used to achieve functional silencing.

Preferably the mutant pathogenic bacterium is attenuated as a result of functional silencing of one or more metabolic genes. However, the invention also relates to mutant pathogenic bacteria that are incapable of expressing one or more metabolic genes, but are not attenuated, such mutants can be subjected to further mutation in metabolic or other virulence genes to provide a multiple mutant attenuated form of the pathogenic bacteria. Surprisingly, it has been found that mutation in one or multiple genes that involve proteins implicated in metabolism enables the development of novel antimicrobial live attenuated vaccine strains.

A mutant pathogenic bacterium of the invention, which may or may not be attenuated, can be incapable of expressing two or more metabolic genes. The two or more metabolic genes can encode proteins that are involved in the same metabolic pathway, or in different metabolic pathways. The metabolic gene or genes may be involved in glycolysis and/or sugar transport. A metabolic gene or genes involved in glycolysis can encode a phosphofructokinase, examples of such genes are pfkA and pfkB. Metabolic genes involved in sugar transport include those of sugar phosphotransferase systems, such as one or more metabolic genes that encode components of a glucose, mannose and/or galactose transport system, for example ptstil, err, glk, ptsG, manXYZ, mglABC and galP.

Until the present invention, metabolic pathways such as glycolysis and sugar transport were not identified as necessary for virulence. The present inventors are the first to recognise that metabolic genes involved in glycolysis and/or sugar transport are required for infection and thus that mutation in genes involved in these processes may provide attenuated strains of intracellular pathogenic bacteria useful as vaccines. Multiple signature tagged mutagenesis (STM) screens would not have identified glycolysis and sugar transport as being required for infection (17,18).

The inventors have investigated substrates and metabolic pathways required by S. Typhimurium for the infection of cultured murine macrophages and human epithelial cells and for the systemic infection of mice. S. Typhimurium causes a self-limited gastroenteritis in humans and results in a systemic typhoid-like disease in mice. Infected mice are frequently used as an experimental model for human typhoid diseases (19). A problem in the development of Salmonella vaccines is the variety of typhoidal and non-typhoidal salmonelloses caused by various serovars and strains. Since the central metabolic pathways of sugar transport and glycolysis are likely to be found in all Salmonella serovars, introduction of mutations into metabolic gene or genes of any disease causing strain of Salmonella may provide potential candidate strains for development as live attenuated vaccines.

In particular embodiments, the invention relates to mutant pathogenic bacteria, preferably mutant intracellular pathogenic bacteria, incapable of expressing:

(a) pfkA and/or pfkB;

(b) ptsHI, err, and/or glk;

(c) pfkA, pfkB, ptsHI, err, and glk;

(d) pfkA, pfkB, ptsHI, and err;

(e) pfkA, pfkB and glk,

(f) pfkA, pfkB and ptsHI

(g) pfkA, pfkB, ptsHI and glk (h) ptsHI;

(i) ptsHI, err

0) ptsHI, glk

(k) glk, ptsG and manXYZ.

(I) pfkA, pfkB, glk, ptsG and/or manXYZ

(m) mglABC and/or galP

(n) mglABC, galP, ptsHI

(o) mglABC, galP, ptsHI and err

(p) mglABC, galP, ptsHI

(q) mglABC, galP, ptsG and manXYZ

(r) pfkA, pfkB, ptsHI, err, mglABC and galP

(s) pfkA, pfkB, ptsHI, mglABC and galP; or,

(t) pfkA, pfkB, mglABC and gal.

Preferred attenuated strains include mutant pathogenic bacteria, preferably mutant intracellular pathogenic bacteria, incapable of expressing: (a) pfkA and pfkB; (b) ptsHI, err, and/or glk;

(c) pfkA, pfkB, ptsHI, err, and glk;

(d) p/ikA, pfkB, ptsHI, and err; (Θ) pfkA, pfkB and glk,

(f) pfkA, pfkB and ptsHI

(g) ptsHI;

(h) ptsHI, err;

(i) ptsHI, glk; or,

(f) glk, ptsG and manXYZ.

(k) ptsHI, mglABC and galP

(I) ptsHI, err, mglABC and galP

(m) pfkA, pfkB, mglABC and gal P

(n) pfkA, pfkB, ptsHI, err, mglABC and galP

(o) pfkA, pfkB, ptsHI, mglABC and gal.

Particularly preferred attenuated strains are glycolysis mutant strains in which phosphofructokinase is functionally silenced, such as ApfkAB strains in which phosphofructokinase genes pfkA and pfkB are functionally silenced; sugar transport mutant strains in which sugar transport genes are functionally silenced, such as glucose transport mutant strains AptsHlcrrAglk in which ptsHI, err, and glk are functionally silenced; or glucose transport mutant strains ΔptsHI in which ptsHI is functionally silenced. Also preferred are strains in which both glycolysis and sugar transport genes are functionally silenced, for example mutant strains in which ApfkAB is combined with the AptsHlcrr and AgIk mutations, or in which ApfkAB is combined with AptsHI; to minimise the risk of reversion of an attenuated strain to virulence it may be advantageous for two independent metabolic pathways to be rendered inoperable, e.g. both glycolysis (e.g., ApfkAB) and sugar transport (e.g., AptsHI, or AptsHlcrrΔglk). Thus, in a preferred embodiment, the attenuated strain is selected from AptsHI, AptsHlcrr, AptsGAmanXYZAglk, AptsHlcrrAglk or ApfkAB.

In S. Typhimurium, phosphofructokinase is encoded by two genes pfkA and pfkB; both the pfkA and pfkB genes must be mutated, preferably deleted, in order to functionally silence phosphofructokinase and thereby effect attenuation in virulence of S. Typhimurium in the infection models described herein. The S. Typhimurium ΔpfkAB mutant was observed to be avirulent in infected mice. The fur of infected mice was found to be slightly ruffled, suggesting that the strain provokes an immunogenic response protective against future infections by S. Typhimurium. This indicates that S. Typhimurium ApfkAB mutant is a promising candidate for a successful live attenuated vaccine for animals and humans.

The inability of the S. Typhimurium AptsHlcrrAglk mutant to replicate in RAW 264.7 macrophages and HeLa epithelial cells and impairment of survival in RAW macrophages indicates potential use of this strain as a live attenuated vaccine.

In a further aspect, a mutant pathogenic bacterium of the invention, which is attenuated is also incapable of expressing one or more other virulence genes, such as aroA, aroC, aroD, crp, cya, htrA, nirB, rpoS, ssaV, surA, Salmonella pathogenicity island 2 (SPI2) or combinations thereof.

The attenuated metabolic mutant bacteria of the invention provide a highly immunogenic live oral vaccine, suitable as a carrier of a gene or genes that express protective antigens cloned from other pathogens (20-22). A pathogenic bacterium of the invention may carry a heterologous gene or genes. Given the number of different immunisations that can be administered to humans, pets and farm animals, combined administration of several immunogens is desirable. A live attenuated pathogenic bacterium of the invention can be used as a recombinant carrier for a heterologous gene or genes, encoding antigens selected from other pathogenic microorganisms or viruses. Administration of such a recombinant carrier has the advantage that protective immunity can be induced against two or more diseases at the same time. The live attenuated mutant pathogenic bacteria according to the present invention provide suitable carriers for heterologous genes.

The construction of recombinant carriers can be performed using standard molecular biology techniques. Therefore, the invention also relates to mutant pathogenic bacteria of the invention, into which a heterologous gene has been inserted (herein termed "recombinant bacteria" or "recombinant carriers"). A heterologous gene can be obtained from pathogenic bacteria; suitable bacterial heterologous genes include a gene encoding a bacterial toxin, such as an Actinobacillus pleuropneumoniae toxin, Clostridium toxin, outer membrane protein and the like. A heterologous gene can, be derived from pathogenic herpesviruses (e.g., the genes encoding the structural proteins of herpesviruses), retroviruses (e.g., the gp160 envelope protein), adenoviruses and the like. Another possibility is insertion of a heterologous a gene encoding a protein involved in triggering the immune system, such as an interleukin or an interferon, or another gene involved in immune regulation.

A pathogenic bacterium of the invention can be a bacterial intracellular pathogen, such as a virulent strain of Salmonella, Bartonella, Burkholderia, Brucella, Chlamydia, Coxiella, Ehrlichia, Francisella, Legionella, Listeria, Mycobacterium, Nocardia, Rickettsia, Shigella, Tropheryma or Yersinia. Preferably the pathogenic bacterium is a typhoidal Salmonella serovar, such as a Salmonella enterica Typhi or Paratyphi. The Salmonella enterica Typhi can be a Salmonella Typhimurium.

The invention further provides a live attenuated vaccine for protection against infection with a pathogenic bacterium or the pathogenic effects thereof, comprising a live attenuated mutant pathogenic bacterium of the invention and a pharmaceutically acceptable carrier.

In addition to an immunogenically effective amount of the live attenuated mutant pathogenic bacteria of the invention, a vaccine according to the present invention also contains a pharmaceutically acceptable carrier, such as a vaccine-compatible pharmaceutically acceptable (i.e., sterile and non-toxic) liquid, semisolid, or solid diluent. Liquid diluents include water, but may, for example also comprise culture fluid in which the bacteria were cultured. Another suitable liquid carrier is a solution of physiological salt concentration. Any carrier known in the art may be used. Exemplary carriers include, but are not limited to, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl- and propylhydroxybenzoate, talc, alginates, starches, lactose, sucrose, dextrose, sorbitol, mannitol, gum acacia, calcium phosphate, mineral oil, cocoa butter, and oil of theobroma. Pharmaceutically acceptable carriers useful in the present invention may comprise stabilisers such as SPGA, carbohydrates (e.g. sorbitol, mannitol, starch, sucrose, glucose, dextrin), proteins for example albumin or casein, protein-containing agents such as bovine serum or skimmed milk and buffers (e.g., phosphate buffer). When such stabilisers are present in the vaccine, the vaccine can be freeze-dried. Thus, a live attenuated vaccine of the invention can be provided in freeze-dried form.

The vaccine compositions can be packaged in forms convenient for delivery. The compositions can be enclosed within a capsule, caplet, sachet, cachet, gelatin, paper, or other container. These delivery forms are preferred when compatible with entry of the immunogenic composition into the recipient organism and, particularly, when the immunogenic composition is being delivered in unit dose form. The dosage units can be packaged, e.g., in tablets, capsules, suppositories or cachets. The vaccine compositions may be introduced into the subject to be immunized by any conventional method including, e.g., by intravenous, intradermal, intramuscular, intramammary, intraperitoneal, or subcutaneous injection; by oral, transdermal, sublingual, intranasal, anal, or vaginal, delivery. In a preferred embodiment, the vaccine is delivered intraperitoneal.

The useful dosage to be administered will vary depending on the age, weight and animal vaccinated, the mode of administration and the type of pathogen against which immunisation is sought. The treatment may consist of a single dose or a plurality of doses over a period of time.

The vaccine may comprise any dose of bacteria, sufficient to evoke an immune response. Suitably the dose can be 10⁹ bacteria or less.

A live attenuated vaccine of the invention may comprise an adjuvant. Optionally, one or more compounds having adjuvant activity may be included in the vaccine. Adjuvants are non-specific stimulators of the immune system. They enhance the immune response of the host to the vaccine. Examples of adjuvants known in the art are Freund's Complete and Incomplete adjuvant, vitamin E, non-ionic block polymers, muramyldipeptides, ISCOMs (immune stimulating complexes), saponins, mineral oil, vegetable oil, and Carbopol. Adjuvants, especially suitable for mucosal application are, for example, E. coli heat-labile toxin (LT) or Cholera toxin (CT). Other suitable adjuvants are for example aluminium hydroxide, aluminium phosphate or aluminium oxide, oil-emulsions (e.g., of Bayol F^® or Marcol 52^®, saponins or vitamin-E solubilisate).

For administration to animals or humans, the vaccine according to the present invention can be given orally, intranasally, intradermal^, subcutaneously, by aerosol or intramuscularly. For application to poultry, wing web and eye-drop administration are appropriate routes. Preferably the live attenuated vaccine is formulated for oral administration.

The invention yet further provides for the use of a live attenuated pathogenic bacterium of the invention for the manufacture of a vaccine for the protection of humans or animals against infection with a pathogenic bacterium or against the pathogenic effects of infection.

Additionally, there is provided a method for the preparation of a vaccine, comprising admixing a live attenuated pathogenic bacterium according to the invention with a pharmaceutically acceptable carrier.

Also, the invention provides a method for immunizing a human or animal against infection with a pathogenic bacterium, comprising administering to the human or animal a vaccine of the invention.

Furthermore, the invention relates to a method of confirming that a bacterial strain is a mutant, potentially attenuated, pathogenic bacterial strain by virtue of not expressing one or more metabolic genes, which comprises confirming that one or more metabolic genes are functionally silenced. Additionally, the invention relates to a method of confirming that a bacterial strain is a mutant attenuated pathogenic bacterial strain by virtue of not expressing one, two or more metabolic genes. Such methods may comprise identifying a mutation in the metabolic gene or genes, and/or a mutation in sequences that regulate expression of the metabolic gene or genes. The mutation identified can be a deletion, an insertion, a substitution or a combination thereof, provided that the mutation leads to the failure to express a functional protein (functional silencing). Preferably the mutation identified is a deletion. Preferably the mutation identified is deletion of the entire coding sequence of the metabolic gene or genes; however, the mutation identified can be, for example, a partial deletion of the gene or a mutation in sequences that regulate expression of the metabolic gene or genes provided that the mutation results in functional silencing. Methods for identifying such mutations include sequencing, restriction enzyme digestion, PCR or other hybridisation- based methods such as in situ hybridisation, northern or southern blotting, and the like. Analysis of proteins expressed may be performed to confirm functional silencing of the metabolic gene or genes; protein analysis methods may involve detection of absence of expression of protein from the metabolic gene or genes, or detection of expression of a non-functional mutant form of the protein. Analysis of proteins expressed may comprise use of a ligand or ligands specific for the protein encoded by the metabolic gene(s) to identify absence of functional protein, or to identify presence of a mutated, non-functional form of protein encoded by the metabolic gene(s). Methods that employ specific ligands include immunological methods based on use of specific antibodies, such as ELISA, immunostaining and western blotting methods. Analysis of protein may involve testing to determine if protein encoded by the metabolic gene(s) is active.

List of Figures

Fig. 1. Intracellular replication rate assays of S. Typhimurium 4/74 wild type (WT) and ΔpfkAB strains in RAW 264.7 macrophages. The data are the statistical mean from three biological replicate experiments.

Fig. 2. Intracellular replication rate assays of S. Typhimurium 4/74 wild type (WT) and ApfkAB strains in HeLa epithelial cells. The data are the statistical mean from three biological replicate experiments. Fig. 3. Salmonella cfu's from BALB/c mouse livers and spleens (n=5) after 72 hours infection.

Fig. 4. Intracellular replication rate assays of S. Typhimurium 4/74 wild type (WT) and AptsHlcrrΔglk strains in RAW macrophages. The data are the statistical mean from three biological replicate experiments.

Fig. β. Intracellular replication rate assays of S. Typhimurium 4/74 wild type (WT) and AptsHlcrrΔglk strains in cultured human HeLa epithelial cells. The data are the statistical mean from three biological replicate experiments.

Examples

Example 1 : Mutant construction and testing

Mutants were constructed according to published procedures (23). Briefly, 60 base pair (bp) oligonucleotides were designed that contain flanking DNA sequences of the target genes to be deleted (Table 1). The oligonucleotides were used to amplify, by polymerase chain reaction (PCR), a cassette containing the kanamycin or the chloramphenicol resistance gene carried by plasmids pKD4 and pKD3 respectively (Table 2; (23)). The resulting PCR product was then transformed by electroporation into Salmonella Typhimurium 4/74 (24) carrying plasmid pKD46 (Table 2). Plasmid pKD46 encodes a recombinase enzyme that facilitates homologous recombination of the target gene with the kanamycin or the chloramphenicol resistance cassette resulting in complete replacement of the deleted gene.

The kanamycin/chloramphenicol resistance region of the deleted gene was transferred by P22 transduction into S. Typhimurium wild type strain 4/74 (25) to avoid unwanted genetic recombination events that may have occurred during the original transformation. The transductants were screened on green agar plates to obtain lysogen free colonies (26). The kanamycin or chloramphenicol resistance gene was then removed via a further recombination event by transforming the cells with the FLP-recombinase expression plasmid, pCP20 (27). The FLP- recombinase removed the kanamycin or chloramphenicol resistance gene and the strains were cured of the pCP20 plasmid by growing the strain at 42⁰C. The resultant strains, JH3478, JH3479 and JH3521 (Table 2) carry complete deletions of the specified genes and are free of genes conferring antibiotic resistance (23), For construction of multiple gene deletions, the above process was repeated on the original mutant strain (Table 2).

Confirmation of gene deletion.

The complete absence of the deleted gene(s) was confirmed by DNA sequencing across the deleted regions of the chromosome (data not shown).

Primer Name Primer DNA sequence pfkaredf CAATAGATTTCATTTTGCATTCCAAAGTTCAG

AGGTAGTCGTGTAGGCTGGAGCTGCTTC pfkaredr AGGCCTGATAAGCGTAGCGCCATCAGGCGCGC

AAAAACAACATATGAATATCCTCCTTAG pfkbredf ATTAAGTGCCAGACTGAAATCAGCCTAA

CAGGAGGTAACGGTGTAGGCTGGAGCTGCTTC pfkbredr AACCGATTTTCCGTTATCCCCCTCGGCGA

GGGGGAAACGACATATGAATATCCTCCTTAG ptshredf TTAGTTCCACAACACTAAACCTATAAGTT

GGGGAAATACAGTGTAGGCTGGAGCTGCTTC crrredr AAATGGCGCCCAAAGGCGCCATTCTTCAC

TGCGGCAAGAACATATGAATATCCTCCTTAG glkredf TGACAAAGACTTATTTTGACTTTAGCGGA

GCAGTAGAAGAGTGTAGGCTGGAGCTGCTTC glkredr CTTTTGTAGGCCGGATAAGGCGTTTATGCCA

CCATCTGGCCATATGAATATCCTCCTTAG ptslrevlnti GCAGTTCCTGTTTGTAGATTTCAATCTC

TTTGCGCAGCGCCATATGAATATCCTCCTTAG crrredf TCCACGAGATGCGGCCCAATTTACTGCTTAGGA

GAAGATCGTGTAGGCTGGAGCTGCTTC ptsgredf GAACGTAGAAAAGCACAAATACTCAGGA

GCACTCTCAATTGTGTAGGCTGGAGCTGCTTC ptsgredr GCCGAATGGCTGCCTTAATTCTCCCCAACATCA

TTACTGCCATATGAATATCCTCCTTAG manxredf TGTCAAGTTGATGTGTTGACAATAATAAAG GAGGTAGCAAGTGTAGGCTGGAGCTGCTTC manzredr AAAAAACGGGGCCGTTTGGCCCCGGTAGT GTACAACAGCCCATATGAATATCCTCCTTAG

Table 1. Primers used to construct S. Typhimurium gene deletion mutants (23)

S. Typhimurium strains Relevant genotype Reference

4/74 Wild type strain (24)

SL1344 rpsL^' hisG^' (25)

JH3386 4/74 ApfkA::Kn This study

JH3460 4/74 ApfkBv. Cm This study

JH3486 4/74 ApfkAv.Kn, ApfkBv.Cm This study

JH3536 4/74 AptsHlcrr:. Cm This study

JH3494 4/74 Δg Ik:: Kn This study

JH3540 4/74 AptsHlcrr.Cm, Δg//c::Kn This study

JH3502 4/74 Acrr. Kn This study

JH3537 4/74 ΔpteH/::Cm This study

JH3504 4/74 AptsG: :Cm This study

JH3501 4/74 AmanXYZ:: Cm This study

JH3541 4/74 AmanXYZ This study

AT1011 4/74 ΔpfeG::Cm, AmanXYZ This study

AT1012 4/74 AptsG/.Cm, AglkrKn This study

AT1013 4/74 AmanXYZ, Aglk::Kn This study

AT1014 4/74 ΔpfsG::Cm, AmanXYZ, Δg//c::Kn This study

Table 2, Strains and plasmids used.

Macrophage infection assays.

Infection assays in murine macrophages were performed according to (28). Briefly, murine macrophages (RAW264.7; obtained from American Type Culture Collection, Rockville, MD) were grown in MEM medium (Sigma) supplemented with 10% fetal bovine serum (FBS; Sigma), L-glutamine (2 mM final concentration; Sigma) and 1x non-essential amino acids (Sigma) as described (28). For infections, 1x10⁵ macrophage cells were seeded into each well of a 12-well cell culture plate and infected with complement-opsonized S. Typhimurium 4/74 and mutant strains at a multiplicity of infection (MOI) of 1 :1 (bacteria:cells) (28). To minimize SPM expression, bacteria were grown overnight on Luria broth plates at 37⁰C and suspended in phosphate buffered saline (PBS) before opsonization.

To increase the uptake of Salmonella, plates were centrifuged at 100Og for 5 min, and this was defined as time 0 hours (h). After 1 h of phagocytosis, extracellular bacteria were killed using 100 μg ml^"1 gentamicin (Sigma). The media was replaced after 1 h with medium containing 10 μg ml^"1 gentamicin. Incubations were continued for 2 h and 18 h. To estimate the amount of intracellular bacteria at each time point, cells were lysed using 1 % Triton X-100, and samples were taken for viable counts (28).

HeLa cell infection assays.

Infection assays in human HeLa epithelial cells (obtained from American Type Culture Collection, Rockville, MD) were performed according to (29). Briefly, HeLa cells were grown in DMEM medium (Sigma) supplemented with 10% fetal bovine serum (Sigma), 2mM L-glutamine (Sigma) and 2OmM HEPES buffer (Sigma). Approximately, 1x10⁵ HeLa cells were seeded into each well of a 6-well cell culture plates and infected with S. Typhimurium 4/74 and mutant strains at an MOI of 10:1. Prior to infection the S. Typhimurium strains had been grown to an OD600 of 1.2 to allow expression of the SPI-1 Type 3 secretion system. To increase the uptake of Salmonella, plates were centrifuged at 1000 g for 5 min, and this was defined as time 0 h. After 1 h of infection, extracellular bacteria were killed with 30 μg ml^"1 gentamicin. The media was replaced after 1 h with medium containing 5 μg ml^"1 gentamicin. Incubations were continued for 2 h and 6 h. To estimate the amount of intracellular bacteria at each time point, cells were lysed using 0.1 % SDS, and samples were taken for viable counts (28). Mouse infection assays.

Mouse infection experiments were performed as described (30) with some modifications. Liquid cultures of 4/74 and the S. Typhimurium ΔpfkAB strain, JH3486, were grown statically in 50ml of Luria Broth (LB; (31) at 37⁰C overnight in 50ml Falcon tubes (Corning Inc.) (32). The following day bacteria were resuspended at a final cell density of 1x10⁴ colony forming units (cfu) ml^"1 in sterile Phosphate Buffered Saline (PBS). Five female BALB/c mice (Charles River U.K. Ltd.) were infected with 200μl of bacterial suspension via the intraperitoneal (IP) cavity at a final dose of 2x10³ Salmonella cfu (30). The infection was permitted to proceed for 72 hours at which time point the mice were sacrificed by cervical dislocation and the spleens and livers surgically removed (30). Following homogenization of the organs in a stomacher (Seward Tekmar), serial dilutions of the suspensions in PBS were spread onto LB agar plates and bacterial colonies enumerated after overnight incubation at 37°C (32).

Phosphofructokinase is required for intracellular replication and survival of S. Typhimurium in cultured RAW macrophages.

Glycolysis is the sequence of catabolic reactions that converts sugars into pyruvate with the concomitant synthesis of ATP and NADH. It is the foundation of both aerobic and anaerobic respiration and is found in nearly all organisms (33). The enzyme phosphofructokinase irreversibly converts β-D-fructose 6-phosphate into β-D-fructose1 , 6-bisphosphate and is encoded by two genes in most bacteria (pfkA and pfkB) (34). An S. Typhimurium mutant strain in which the pfkAB genes were completely deleted was constructed according to procedures described above. The marker antibiotic resistance genes (kanamycin and chloramphenicol) were completely removed from the chromosome of the S. Typhimurium ApfkAB strain. The growth of the marker-free S. Typhimurium ApfkAB strain was inhibited by kanamycin and chloramphenicol.

The 322-fold decrease in the number of cfu's from recovered intracellular S. Typhimurium wild type and S. Typhimurium ApfkAB bacteria after 18h infection showed that the latter strain was unable to replicate within RAW 264.7 macrophages (Fig 1A, Table 3A). Furthermore, the 34-fold decrease in the cfu's of recovered intracellular S. Typhimurium ApfkAB bacteria after 18h compared to 2h infection showed that the S. Typhimurium ApfkAB strain was unable to survive within RAW 264.7 macrophages (Fig 1 , Table 3A). Infection assays have also shown that intracellular replication of the S. Typhimurium ApfkA and ApfkB single mutants is not attenuated compared to the wild type strain in RAW 264.7 macrophages (data not shown). This demonstrates that deletion of both pfkA and pfkB genes are required for functional silencing of phosphofructokinase for attenuation.

2 hours S. D. 18 hours S.D.

4/74 24.3 3.4 200.4 16.4

ApfkAB 21.2 3.0 0.6 0.2

4/74 24.8 1.6 57.8 1.6

AptsHlcrrΔglk 25.6 3.6 19.0 1.8

B

2 hours S.D. 6 hours S.D.

4/74 120.0 13.7 641.6 129.6

ApfkAB 86.4 6.5 143.6 27.7

4/74 120.0 13.7 641.6 129.6

AptsHlcrrΔglk 38.5 8.6 51.0 11.2

Table 3. Intracellular replication rate and survival assays for S. Typhimurium 4/74 (wild type), ApfkAB and AptsHlcrrglk strains in (A) cultured RAW 264.7 macrophages and (B) HeLa epithelial cells expressed as percentages of original inoculum. S.D. is standard deviation from three biological replicate experiments.

Phosphofructokinase is required for intracellular replication of S. Typhimurium in cultured HeLa epithelial cells.

The intracellular replication rates of the S. Typhimurium 4/74 wild type and ApfkAB mutant strains were determined in cultured human HeLa epithelial cells. A comparison of the intracellular replication rate of S. Typhimurium ApfkAB bacteria between 2 and 6 hours showed that the mutant strain replicated less than 2-fold in HeLa cells (Fig. 2, Table 3B).

Phosphofructokinase is avirulent in the mouse typhoid infection model.

BALB/c mice were infected (IP) with the S. Typhimurium ΔpfkAB mutant and the wild type strain. Salmonella were recovered and enumerated from the spleen and liver of mice after 72 hours infection. The results demonstrated that the S. Typhimurium ApfkAB mutant was severely attenuated by approximately 10² fold compared to the wild type strain in the spleen and liver of infected mice. (Fig. 3, Table 4). Mice infected with the S. Typhimurium wild type strain showed severe symptoms of systemic disease after 72 hours. The fur of mice infected with the S. Typhimurium ApfkAB strain was slightly ruffled after 72 hours.

Strain cfu's per spleen (SD) cfu's per liver (SD)

4/74 1853333 (1205047) 1051333 (685875)

ApfkAB 32828 (21395) 14912 (6923)

Table 4. Mean S. typhimurium wild type and S. typhimurium ApfkAB cfu's recovered from BALB/c mice liver and spleens 72 h post- infection (n=5).

Sugar transport is required for intracellular replication of S. Typhimurium in RAW 264.7 macrophages.

An S. Typhimurium mutant strain containing complete deletions of the ptsHI, err and glk genes was constructed according to the procedures described above. The ptsHI and err genes encode components of a phosphotransferase (PTS) system, which detects, transports, and phosphorylates several sugars and sugar derivatives into the bacterial cell (35). The glk gene encodes glucose kinase, which specifically phosphorylates intracellular glucose (36). In vitro growth experiments on M9 minimal salts media showed that, as expected, the S. Typhimurium AptsHlcrrΔglk mutant was unable to utilize glucose for growth (37). Infection assays of the S. Typhimurium wild type and AptsHlcrrΔglk strains were performed in RAW 264.7 macrophage. The data are the statistical mean from three biological replicate experiments (Fig. 4). A comparison of the intracellular replication rate of S. Typhimurium AptsHlcrrΔglk bacteria at 2 and 18 hours showed that the strain was unable to replicate in RAW 264.7 macrophages and may be impaired for survival (Fig. 4, Table 3A).

Sugar transport is required for intracellular replication of S. Typhimurium in HeLa epithelial cells.

The intracellular replication rates of the S. Typhimurium 4/74 wild type and

AptsHlcrrΔglk strains were compared in cultured HeLa cells. The S. Typhimurium

AptsHlcrrΔglk strain was unable to replicate in HeLa epithelial cells (Fig. 5, Table

3B).

The intracellular phenotype of the S. Typhimurium ApfkAB mutant demonstrated that phosphofructokinase and glycolysis are required for intracellular replication and survival of S. Typhimurium in RAW macrophages.

The S. Typhimurium ApfkAB mutant was unable to replicate within human HeLa epithelial cells suggesting phosphofructokinase and glycolysis are necessary for growth within this cell type.

The severe attenuation of the AptsHlcrrΔglk mutant compared to the wild type strain suggests glucose is the major sugar required for intracellular replication and survival of S. Typhimurium in RAW 264.7 macrophages and HeLa epithelial cells.

The S. Typhimurium pfkAB mutant is severely attenuated during intraperitoneal infection of BALB/c mice demonstrating that phosphofructokinase and glycolysis are required for Salmonella survival and replication within mice.

Example 2: Oral live vaccine strain verification Experiment 1 : Attenuation of potential vaccine strains

Female BALB/c mice (6 to 8 weeks old) and housed under specific-pathogen-free conditions are used for all experiments. For each animal experiment, a single bacterial dose of 1 x 10⁹ to 2 x 10⁹ bacteria in LB broth is administered by gavage to mice (n=5; day 0). Control mice are given an equal volume of sterile LB broth. The mice are infected with 0.2 ml of stationary phase bacteria grown aerobically overnight at 37⁰C in Luria Bertani (LB) broth and then concentrated in fresh LB broth to approximately 5 x 10⁹ to 10 x 10⁹ per ml. The Salmonella strains used to infect the mice are: wild type strain (S. Typhimurium 4/74) and 5 potential vaccine strains: S. Typhimurium ApfkAB, AptsHlcrrAglk, AptsHlcrr, AptsHI, AptsGAmanXYZAglk. Attenuation of the metabolic mutant strains were determined by evaluation of the mice according to humane procedures based on Home Office Licensing for Animal Experimentation. Between 4 and 7 days after inoculation the majority of animals inoculated with a virulent Salmonella strain will develop mild to moderate symptoms of systemic infection consisting of reduced activity, anorexia, hunched posture and ruffled fur. Each of these symptoms should appear with various degrees of development from the 4th day onward and therefore will be scored from 1 to 3 for "slightly developed" to "highly developed" at each checking point. Animals with three or more of these symptoms scored as highly developed will constitute the end point of the experiment and animals will be humanely killed. Any dyspnoeic animals will be killed at first sight. The results from this experiment are shown in Table 5. According to the above scoring procedure, after 4 days, mice infected with the wild-type strain displayed all the symptoms of a severe systemic typhoid infection and were humanely killed. The S. Typhimurium AptsGAmanXYZAglk strain displayed attenuated upon infection and mice were killed after 9 days (Table 5). The S. Typhimurium ApfkAB, AptsHlcrrAglk, AptsHlcrr, AptsHI strains were avirulent upon infection and continued to survive past 3 weeks post infection (Table 5).

Conclusion: The S. Typhimurium ApfkAB, AptsHlcrrAglk, AptsHlcrr, AptsHI, AptsGAmanXYZAglk strains are all attenuated or avirulent for infection of BALB/c mice and therefore verified as candidates for potential vaccine strains.

Table 5. Percentage survival of BALB/c mice infected with S. Typhimurium metabolic mutant strains.

Experiment 2: Clearance of potential vaccine strains

To determine whether complete sterility has been achieved, Experiment 1 is repeated and bacterial cfu's enumerated from spleen, liver, mesenteric lymph nodes and Peyer's patches every 14 days for a total of 50 days as described in Experiment 1. A positive outcome with respect to strain validation as potential vaccines would be no cfu's are recovered from the organs of mice infected with attenuated metabolism mutant strain(s), a positive control aroA strain, or LB control (sterility).

Experiment 3: Elicitation of an immune response by potential vaccine strains

Experiment 2 is repeated after 30 days infection using potential vaccine strain(s), S. Typhimurium ΔaroA strain and an LB control. Faecal and blood samples are collected after day 30. Faecal samples are weighed, and 1.0 ml of PBS plus 0.1 % sodium azide is added per 100mg of faeces. The faecal pellets are dispersed by microtip sonication for 10 to 20 second bursts at 50% duty. The faecal suspensions are subsequently pelleted in a microfuge for 5 min, and the supernatants transferred to a fresh tube and held frozen until assays are performed. Blood samples are collected from the tail vein and incubated overnight at 4⁰C followed by microcentrifugation for 1 min before the serum collection. The titre of anti-Salmonella lipopolysaccharide (LPS) in faecal supernatant and blood serum samples is determined by end-point ELISA. Briefly, 96-well commercially available immunoplates are coated overnight at 4⁰C with 0.01 mg/ml Salmonella LPS. Following blocking with 4% skim milk powder in PBS for 1 h at 37⁰C, serial dilutions of mouse sera in PBST (0.05% Tween20 in PBS) containing 0.4% skim milk powder are added to the wells and the plates incubated for 2h at 37⁰C. Bound antibody is detected by the addition of an anti-mouse Ig Horseradish peroxidase conjugate diluted 1/1000 in PBST containing 0.4% skim milk powder and incubated for 2 h at 37⁰C. Reactions are developed using immunopure o- phenylenediamine with H₂O₂ as the substrate. Absorbance is read at 492 nm in a plate reader. The serum antibody titre is designated as the reciprocal of the dilution of specific antibody that gives an OD₄₉₂ value of five times the background value.

Experiment 4: Virulent challenge

BALB/c mice are pre-infected for 30 days with the potential vaccine strain(s) and the S. Typhimurium AaroA strain and LB control at doses of 1-2 x 10⁹ bacteria according to experiment 1. The pre-infected mice are then challenged at day 30 via oral infection according to Experiment 1 with 1x10⁸ cfu of a S. Typhimurium wild type strain (4/74) to assess the protection conferred by the vaccine compared to control BALB/c mice. Mice successfully immunised following infection with the metabolism mutant strain(s) and aroA strains show no symptoms of typhoid fever according to the accepted scoring system. Optionally cfu's in above organs are enumerated and ELISA assays are performed to detect the presence of antibodies against Salmonella LPS (see Experiment 3 for methodology).

References

1. Cossart, P., Pizarro-Cerda, J., Lecut, M. (2005) Cellular Microbiology, ASM Press. 2. Titball, R.W. (2008) Vaccines against intracellular bacterial pathogens. Drug discovery today, 13, 596-600.

3. Fulop, M., Mastroeni, P., Green, M. and Titball, R.W. (2001) Role of antibody to lipopolysaccharide in protection against low- and high-virulence strains of Francisella tularensis. Vaccine, 19, 4465-4472.

4. Jones, S. M., Ellis, J. F., Russell, P., Griffin, K.F. and Oyston, P. C. (2002) Passive protection against Burkholderia pseudomallei infection in mice by monoclonal antibodies against capsular polysaccharide, lipopolysaccharide or proteins. Journal of medical microbiology, 51 , 1055-1062.

5. Nelson, M., Prior, J. L., Lever, M.S., Jones, H. E., Atkins, T.P. and Titball, R.W. (2004) Evaluation of lipopolysaccharide and capsular polysaccharide as subunit vaccines against experimental melioidosis. Journal of medical microbiology, 53, 1177-1182.

6. Crump, JA, Luby, SP. and Mintz, E. D. (2004) The global burden of typhoid fever. Bulletin of the World Health Organization, 82, 346-353.

7. Davies, R.H., Dalziel, R., Gibbens, J. C₁ Wilesmith, J.W., Ryan, J. M., Evans, S.J., Byrne, C₁ Paiba, GA, Pascoe, S.J. and Teale, CJ. (2004) National survey for Salmonella in pigs, cattle and sheep at slaughter in Great Britain (1999-2000). Journal of applied microbiology, 96, 750-760.

8. Beach, J. C₁ Murano, E.A. and Acuff, G. R. (2002) Prevalence of Salmonella and Campylobacter in beef cattle from transport to slaughter. Journal of food protection, 65, 1687-1693.

9. Troutt, H. F., Galland, J. C, Osburn, B.I., Brewer, R. L., Braun, R.K., Schmitz, J.A., Sears, P., Childers, A.B., Richey, E., Mather, E. et al. (2001) Prevalence of Salmonella spp in cull (market) dairy cows at slaughter. Journal of the American Veterinary Medical Association, 219, 1212-1215.

10. Guzman, C.A., Borsutzky, S., Griot-Wenk, M., Metcalfe, I. C₁ Pearman, J., Collioud, A., Favre, D. and Dietrich, G. (2006) Vaccines against typhoid fever. Vaccine, 24, 3804-3811.

11. Levine, M. M., Galen, J., Barry, E., Noriega, F., Chatfield, S., Sztein, M., Dougan, G. and Tacket, C. (1996) Attenuated Salmonella as live oral vaccines against typhoid fever and as live vectors. Journal of biotechnology, 44, 193-196. 12. Ward, S.J., Douce, G., Figueiredo, D., Dougan, G. and Wren, B.W. (1999) lmmunogenicity of a Salmonella typhimurium aroA aroD vaccine expressing a nontoxic domain of Clostridium difficile toxin A. Infection and immunity, 67, 2145-2152.

13. Abrahams, G. L. and Hensel, M. (2006) Manipulating cellular transport and immune responses: dynamic interactions between intracellular Salmonella enterica and its host cells. Cellular microbiology, 8, 728-737.

14. Haraga, A., Ohlson, M. B. and Miller, S.I. (2008) Salmonellae interplay with host cells. Nature reviews, 6, 53-66.

15. Brumell, J. H., Steele-Mortimer, O. and Finlay, B. B. (1999) Bacterial invasion: Force feeding by Salmonella. CurrBiol, 9, R277-280.

16. Becker, D., Selbach, M., Rollenhagen, C₁ Ballmaier, M., Meyer, T. F., Mann, M. and Bumann, D. (2006) Robust Salmonella metabolism limits possibilities for new antimicrobials. Nature, 440, 303-307.

17. Lehoux, D. E., Sanschagrin, F., Kukavica-lbrulj, I., Potvin, E. and Levesque, R. C. (2004) Identification of novel pathogenicity genes by PCR signature- tagged mutagenesis and related technologies. Methods in molecular biology (Clifton, N.J, 266, 289-304.

18. Morgan, E., Campbell, J. D., Rowe, S. C₁ Bispham, J., Stevens, M. P., Bowen, A.J., Barrow, P.A., Maskell, D.J. and Wallis, T.S. (2004) Identification of host-specific colonization factors of Salmonella enterica serovar Typhimurium. Molecular microbiology, 54, 994-1010.

19. Tsolis, R.M., Kingsley, R.A., Townsend, S. M., Ficht, T.A., Adams, L.G. and Baumler, AJ. (1999) Of mice, calves, and men. Comparison of the mouse typhoid model with other Salmonella infections. Advances in experimental medicine and biology, 473, 261-274.

20. Aggarwal, A., Kumar, S., Jaffe, R., Hone, D., Gross, M. and Sadoff, J. (1990) Oral Salmonella: malaria circumsporozoite recombinants induce specific CD8+ cytotoxic T cells. The Journal of experimental medicine, 172, 1083-1090.

21. Formal, S. B., Baron, L.S., Kopecko, DJ. , Washington, O., Powell, C. and Life, CA. (1981) Construction of a potential bivalent vaccine strain: introduction of Shigella sonnei form I antigen genes into the galE Salmonella typhi Ty21a typhoid vaccine strain. Infection and immunity, 34, 746-750.

22. Wu, J.Y., Newton, S., Judd, A., Stacker, B. and Robinson, W.S. (1989) Expression of immunogenic epitopes of hepatitis B surface antigen with hybrid flagellin proteins by a vaccine strain of Salmonella. Proceedings of the National Academy of Sciences of the United States of America, 8β, 4726-4730.

23. Datsenko, K.A. and Wanner, B. L. (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America, 97, 6640-6645.

24. Wray, C. and Sojka, WJ. (1978) Experimental Salmonella typhimurium infection in calves. Research in veterinary science, 25, 139-143.

25. Hoiseth, S. K. and Stacker, B.A. (1981) Aromatic-dependent Salmonella typhimurium are non-virulent and effective as live vaccines. Nature, 291 , 238-239.

26. Smith, H. O. and Levine, M. (1967) A phage P22 gene controlling integration of prophage. Virology, 31 , 207-216.

27. Cherepanov, P.P. and Wackernagel, W. (1995) Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene, 158, 9-14.

28. Eriksson, S., Bjorkman, J., Borg, S., Syk, A., Pettersson, S., Andersson, D.I. and Rhen, M. (2000) Salmonella typhimurium mutants that downregulate phagocyte nitric oxide production. Cellular microbiology, 2, 239-250.

29. Hautefort, I., Thompson, A., Eriksson-Ygberg, S., Parker, M. L., Lucchini, S., Danino, V., Bongaerts, R.J., Ahmad, N., Rhen, M. and Hinton, J. C. (2008) During infection of epithelial cells Salmonella enterica serovar Typhimurium undergoes a time-dependent transcriptional adaptation that results in simultaneous expression of three type 3 secretion systems. Cellular microbiology, 10, 958-984.

30. Oswald, I. P., Lantier, F., Moutier, R., Bertrand, M. F. and Skamene, E. (1992) Intraperitoneal infection with Salmonella abortusovis is partially controlled by a gene closely linked with the lty gene. Clinical and experimental immunology, 87, 373-378.

31. Bertani, G. (1951) Studies on lysogenesis. I. The mode of phage liberation by Iysogenic Escherichia coli. Journal of bacteriology, 62, 293-300.

32. Baumler, A.J., Tsolis, R.M., Valentine, P.J., Ficht, TA and Heffron, F. (1997) Synergistic effect of mutations in invA and IpfC on the ability of Salmonella typhimurium to cause murine typhoid. Infection and immunity, 65, 2254-2259.

33. Fraenkel, D. G. (1996) Glycolysis. 2 ed. ASM Press, Washington DC.

34. Riley, M. (1993) Functions of the gene products of Escherichia coli. Microbiological reviews, 57, 862-952.

35. Postma, P.W., Lengeler, J.W. and Jacobson, G. R. (1993) Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiological reviews, 57, 543-594.

36. Meyer, D., Schneider-Fresenius, C, Horlacher, R., Peist, R. and Boos, W. (1997) Molecular characterization of glucokinase from Escherichia coli K- 12. Journal of bacteriology, 179, 1298-1306.

37. Mackey, B. M. and Derrick, CM. (1982) A comparison of solid and liquid media for measuring the sensitivity of heat-injured Salmonella typhimurium to selenite and tetrathionate media, and the time needed to recover resistance. The Journal of applied bacteriology, 53, 233-242.

Sequence listing

<110> Plant Bioscience Limited

<120> Mutant Pathogenic Bacteria and Live Attenuated Vaccine

Compositions <130> pc780117WO <150> GB0900974.7 <151 > 2009-01-21 <160> 14

<170> Patentln version 3.3 <210> 1 <211> 60 <212> DNA <213> Artificial <220>

<223> Primer sequence pfkaredf <400> 1 caatagattt cattttgcat tccaaagttc agaggtagtc gtgtaggctg gagctgcttc 60 <210> 2 <211 > 60 <212> DNA <213> Artificial <220>

<223> primer sequence pfkaredr <400> 2 aggcctgata agcgtagcgc catcaggcgc gcaaaaacaa catatgaata tcctccttag 60 <210> 3 <211> 60 <212> DNA <213> Artificial <220>

<223> primer sequence pfkbredf <400> 3 attaagtgcc agactgaaat cagcctaaca ggaggtaacg gtgtaggctg gagctgcttc 60 <210> 4 <211 > 60 <212> DNA <213> Artificial <220>

<223> primer sequence pfkbredr <400> 4 aaccgatttt ccgttatccc cctcggcgag ggggaaacga catatgaata tcctccttag 60 <210> 5 <211 > 60 <212> DNA <213> Artificial <220>

<223> primer sequence ptshredf <400> 5 ttagttccac aacactaaac ctataagttg gggaaataca gtgtaggctg gagctgcttc 60 <210> 6 <211 > 60 <212> DNA <213> Artificial <220>

<223> primer sequence crrredr <400> 6 aaatggcgcc caaaggcgcc attcttcact gcggcaagaa catatgaata tcctccttag 60 <210> 7 <211 > 60 <212> DNA <213> Artificial <220>

<223> primer sequence glkredf <400> 7 tgacaaagac ttattttgac tttagcggag cagtagaaga gtgtaggctg gagctgcttc 60 <210> 8 <211 > 60 <212> DNA <213> Artificial <220>

<223> primer sequence glkredr <400> 8 cttttgtagg ccggataagg cgtttatgcc accatctggc catatgaata tcctccttag 60 <210> 9 <211 > 60 <212> DNA <213> Artificial <220>

<223> primer sequence ptslrevlnti <400> 9 gcagttcctg tttgtagatt tcaatctctt tgcgcagcgc catatgaata tcctccttag 60 <210> 10 <211 > 60 <212> DNA <213> Artificial <220>

<223> primer sequence crrredf <400> 10 tccacgagat gcggcccaat ttactgctta ggagaagatc gtgtaggctg gagctgcttc 60 <210> 11 <211 > 60 <212> DNA <213> Artificial <220>

<223> primer sequence ptsgredf <400> 11 gaacgtagaa aagcacaaat actcaggagc actctcaatt gtgtaggctg gagctgcttc 60 <210> 12 <211 > 60 <212> DNA <213> Artificial <220>

<223> primer sequence ptsgredr <400> 12 gccgaatggc tgccttaatt ctccccaaca tcattactgc catatgaata tcctccttag 60 <210> 13 <211 > 60 <212> DNA <213> Artificial <220>

<223> primer sequence manxredf <400> 13 tgtcaagttg atgtgttgac aataataaag gaggtagcaa gtgtaggctg gagctgcttc 60 <210> 14 <211 > 60 <212> DNA <213> Artificial <220>

<223> primer sequence manzredr <400> 14 aaaaaacggg gccgtttggc cccggtagtg tacaacagcc catatgaata tcctccttag 60

Claims

CLAIMS:

1. A mutant pathogenic bacterium that is incapable of expressing one or more metabolic genes.

2. A mutant pathogenic bacterium according to claim 1 , characterised in that the pathogenic bacterium is an intracellular pathogenic bacterium.

3. A mutant pathogenic bacterium according to claim 1 or 2, characterised in that it is attenuated.

4. A mutant pathogenic bacterium according to any of claims 1 to 3, characterised in that the bacterium is incapable of expressing two or more metabolic genes.

5. A mutant pathogenic bacterium according to claim 4, characterised in that the two or more genes encode proteins involved in the same or in different metabolic pathways.

6. A mutant pathogenic bacterium according to any of claims 1 to 5, characterised in that the metabolic gene or genes are involved in glycolysis and/or sugar transport.

7. A mutant pathogenic bacterium according to any of claims 1 to 6, characterised in that the metabolic gene or genes encode a phosphofructokinase.

8. A mutant pathogenic bacterium according to any of claims 1 to 7, characterised in that the metabolic genes are pfkA and pfkB.

9. A mutant pathogenic bacterium according to any of claims 1 to 8, characterised in that the bacterium is incapable of expressing one or more metabolic genes that encode components of a sugar phosphotransferase system.

10. A mutant pathogenic bacterium according to claim 9, characterised in that the one or more metabolic genes encode components of a glucose, mannose and/or galactose transport system.

11. A mutant pathogenic bacterium according to claim 10, characterised in that the one or more metabolic genes that encode components of a glucose, mannose and/or galactose transport system are selected from ptsHI, err, glk, ptsG, manXYZ, mglABC and galP.

12. A mutant pathogenic bacterium according to any of claims 1 to 11 , characterised in that it is incapable of expressing:

(a) pfkk and/or pfkB;

(b) ptsHI, err, and/or glk;

(c) pfkk, pfkB, ptsHI, err, and glk;

(d) pfkk, pfkB, ptsHI, and err;

(e) pfkk, pfkB and glk,

(f) pfkk, pfkB and ptsHI

(g) pfkA, pfkB, ptsHI and glk (h) ptsHI;

(I) ptsHI, err φ ptsHI, glk

(k) glk, ptsG and manXYZ.

(I) pfkA, pfkB, glk, ptsG and/or manXYZ

(m) mglABC and/or galP

(n) mglABC, galP, ptsHI

(o) mglABC, galP, ptsHI and err

(p) mglABC, galP, ptsHI

(q) mglABC, galP, ptsG and manXYZ

(r) pfkA, pfkB, ptsHI, err, mglABC and galP

(s) pfkA, pfkB, ptsHI, mglABC and galP; or,

(t) pfkA, pfkB, mglABC and galP.

13. A mutant pathogenic bacterium according to any of claims 1 to 12 wherein the bacterial strain is selected from AptsHI, AptsHlcrr, AptsGAmanXYZAglk, AptsHlcrrAglk or ApfkAB.

14. A mutant pathogenic bacterium according to any of claims 1 to 13, which is attenuated and which is incapable of expressing one or more other virulence gene or genes, such as aroA and/or rpoS.

15. A mutant pathogenic bacterium according to any of claims 1 to 14, characterised in that the bacterium carries a heterologous gene.

16. A mutant pathogenic bacterium according to any of claims 1 to 15, characterised in that the pathogenic bacterium is a Salmonella, Bartonella, Brucella, Burkholderia, Chlamydia, Coxiella, Ehrlichia, Francisella, Legionella, Listeria, Mycobacter, Nocardia, Rickettsia, Shigella or Tropheryma

17. A mutant pathogenic bacterium according to any of claims 1 to 16, characterised in that the pathogenic bacterium is a typhoidal Salmonella serovar.

18. A mutant pathogenic bacterium according to claim 16, characterised in that the typhoidal Salmonella serovar is a Salmonella enterica Typhi or Paratyphi.

19. A mutant pathogenic bacterium according to claim 18, characterised in that the Salmonella enterica Typhi is a Samonella Typhimurium.

20. A live attenuated vaccine for protection against infection with a pathogenic bacterium or the pathogenic effects thereof, comprising a live attenuated mutant pathogenic bacterium according to any one of claims 3 to 19 and a pharmaceutically acceptable carrier.

21. A live attenuated vaccine according to claim 20, characterised in that it is formulated for oral administration.

22. A live attenuated vaccine according to claim 20 or 21 , characterised in that it is in freeze-dried form.

23. A live attenuated vaccine according to any of claims 20 to 22, characterised in that it comprises an adjuvant.

24. Use of a live attenuated mutant pathogenic bacterium according to any one of claims 3 to 19 for the manufacture of a vaccine for the protection of humans or animals against infection with a pathogenic bacterium or against the pathogenic effects of infection.

25. A method for the preparation of a vaccine according to any one of claims 20 to 22, comprising admixing a live attenuated mutant pathogenic bacterium according to any one of claims 3 to 18 with a pharmaceutically acceptable carrier.

26. A method for immunizing a human or animal against infection with a pathogenic bacterium, comprising administering to the human or animal a vaccine according to any of claims 20 to 22.