CN101629149A - Marker-free gene-deletion attenuated mutant strain derived from Edwardsiella tarda wild strain, related preparation and application thereof - Google Patents
Marker-free gene-deletion attenuated mutant strain derived from Edwardsiella tarda wild strain, related preparation and application thereof Download PDFInfo
- Publication number
- CN101629149A CN101629149A CN200910052707A CN200910052707A CN101629149A CN 101629149 A CN101629149 A CN 101629149A CN 200910052707 A CN200910052707 A CN 200910052707A CN 200910052707 A CN200910052707 A CN 200910052707A CN 101629149 A CN101629149 A CN 101629149A
- Authority
- CN
- China
- Prior art keywords
- strain
- marker
- blunt tarda
- free
- tarda
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Farming Of Fish And Shellfish (AREA)
Abstract
The invention relates to a marker-free gene-deletion attenuated mutant strain derived from an Edwardsiella tarda wild strain, constituting an attenuated live vaccine of the Edwardsiella tarda strain, wherein, chorismate synthase genes aroC of the Edwardsiella tarda strain are deleted; the Edwardsiella tarda strain is particularly an Edwardsiella tarda strain EIB202; and endogenous plasmids of the Edwardsiella tarda strain are further deleted. The invention further provides a preparation for the marker-free gene-deletion attenuated mutant strain derived from the Edwardsiella tarda wild strain, and the related application in preventing mariculture Edwardsiellosis. The marker-free gene-deletion attenuated mutant strain derived from the Edwardsiella tarda wild strain or the related preparation eliminates the potential security risk to the environment and products in most conventional attenuated live vaccines and constitutes a safe, effective and economic vaccine orienting to the mariculture Edwardsiellosis.
Description
Technical field
The present invention relates to the attenuation mutant technical field, particularly fish specifically is meant marker-free disappearance attenuation mutant, related preparations and the application of the wild strain of a kind of blunt tarda with bacillary attenuated live vaccine technical field.
Background technology
In view of the continuous growth of world population and the exhaustion day by day of natural fishing resources, water industry had obtained fast in modern age as a kind of conventional industries, effectively development, and in society, economy and people's life, appear out its critical role suddenly.According to statistics, China's fishery products total amount in 2002 account for global ultimate production 71% and the gross output value 49.8%, rank first in the world.According to the FAO statistics, the aquatic products product population of China in 2004 reaches 4,750 ten thousand tons.Yet, because the finiteness of water and soil resources increases output from the raising cultured area and is difficult to sustainable development.Therefore, mass-producing, intensification, high-density development mode become the development main flow of China's fish farming industry gradually.Yet along with the continuous stable development of fishery cultivating, various disease problems become increasingly conspicuous, and cultured output and growth are caused have a strong impact on.In China, sudden, the explosive disease of seawater cage culture that grew up in recent years and industrialized culture fish frequently takes place.At present, the average death loss rate of the sea farming of China is more than 30%, and annual financial loss reaches 16,000,000,000 yuan, and the disease problem has become the important factor that the restriction mariculture industry develops in a healthy way.
At the generation of various diseases, be that the chemotherapy of representative had once been brought into play active effect to the control and the control of disease with the microbiotic.But the environmental pollution that this disease measure of control cause, a large amount of appearance of anti-medicine cause of disease, the negative impacts such as drug residue of fishery products are on the rise.In European Union, the U.S. and Canada, disabled gradually in culture fishery based on the chemicals of microbiotic.Wherein, according to the regulation of European Union's food safety white paper, European Union member countries ban use of the aquaculture product of antibiotic medicine to enter trading market.Japan also begins to limit the control of using multiple antibiotic medicine to be used for cultured fishes and shrimps disease.
As aquaculture big country in the world, the sea farming product export volume of China has only accounted for cultures about 6% of total amount, the aquatic product quality safety problem that main restraining factors are exactly China is outstanding, and medicine and nuisance be residual to exceed standard seriously, becomes the major obstacle of expanding export.Export of Chinese Aquatic Products was subjected to European Union, Japan and other countries and geographic restriction because of quality security problem in recent years.Simultaneously, sudden strong because disease is serious, for evading the disease risk, the producer generally gathers in the crops ahead of time, causes product specification less than normal, has also influenced outlet rate and export price.In order to strengthen the competitiveness in the international market of culture fishery, enlarge the foreign exchange earning of aquaculture, country has proposed and has begun to promote to set up nuisanceless cultural technique standard, and one of them the key technical indexes bans use of antibiotic medicine exactly, to guarantee the food quality safety of aquaculture product.
Be the serious day by day development trend of cultured fishes disease of containing that various environmental factorss and cultivation density surge etc. cause, advance the Sustainable development of mariculture industry, the World Food Programme is in conjunction with developed country's fishery successful experience of developing (OrmondeP.Fisheries resources:trends in production, utilization and trade.In:Nomura I (ed.) .The State ofWorld Fishery and Agriculture2002.Rome:FAO Information Division, 2002, p3～p45), (System management approaches, SMA) aquaculture model prevents the generation of various diseases to advocate " system management approach ".Main contents in this measure are exactly that to advocate with vaccine inoculation be the various immune protection The Application of Technology of representative.The employing of these measures will significantly reduce the use of chemicals, both avoid the pollution to environment, increase the consumption safety of fishery products again.As the cost-effective disease control strategy and the means that meet environmental friendliness, the strategy of sustainable development, vaccination is just becoming the main forward position and the Application Areas of countries in the world research and development in modern aquaculture standard.
But pointed strong, the disease-resistant cycle of vaccine is grown lifetime immunity, effect is remarkable and control characteristics initiatively.With pathogenic bacteria cell deactivation body is that the inactivated vaccine (Kill vaccine) of base form is that the aquiculture disease control provides effective means; but inactivated vaccine generally has the technology applied defect of administration inconvenience (drug administration by injection just has immune protective efficiency preferably); very inconvenience for the fish farming industry of the thousands of quantity of needs immunity, the administration cost often can not be born by culture fishery.And, for disease serious fry and juvenile fish being taken place then can't implement drug administration by injection, simultaneously, to many disease inactivated vaccines poor effect or invalid often.Everything has brought obstruction all for aquiculture disease immune protection broad application.
The industry characteristics of culture fishery require the necessary economy of disease control technology, application implementation conveniently.Therefore, the exploitation of vaccine product is except that the technical requirements that height is tired, and immune cost must be cheap, can not exceed the ability to bear of aquaculture.Attenuated live vaccine because of have convenient drug administration (can soak administration), immunizing potency height (can reduce dosage), with low cost, can develop the new technology advantage of wide spectrum vaccine (live bacterial vaccines often has intersecting protective), become current vaccine research of used for aquiculture in the world and hot of research and development and field, forward position.
Edwardsiella is the common pathogenic agent of a class that causes fresh water, marine fish bacteriosis, specifically be divided into blunt tarda (Edwardsiella tarda), catfish tarda (Edwardsiella ictaluri) and guarantor section tarda (Edwardsiella hoshinae).Be referred to as tarda disease (Edwardsiellosis) by its fish hueppe's disease that causes.It is wide that this disease is propagated area, do not have obviously seasonality, infection rate and mortality ratio height, and the kind of harm is many, and carp is arranged, tilapia, common eel, grey mullet, salmon, trout, the fingerling that great majority such as flounder flounder have higher economic worth.In addition, blunt tarda also infects shellfish, reptiles, batrachians, birds, mammals.Merit attention, blunt tarda still is a kind of important infecting both domestic animals and human cause of disease bacterium, and it is the member of unique mankind of infection in the Edwardsiella.At present, the more serious pathogenic agent of the sick disease of China's cultured fishes tarda is mainly blunt tarda, and the grave danger that exists pathogenic agent to shift to human body is arranged.United States Patent (USP) has and utilizes Rifampin screening to obtain report (the Evans J J of the natural attenuation mutant of wild strain as attenuated live vaccine, Klesius, P H and Shoemaker C A 2006Modified live Edwardsiella tardavaccine for aquatic animals; United States Patent 7067122).Still there is not effective prophylactico-therapeutic measures of this disease at present in China.
The attenuated live vaccine of gene recombination constructing technology exploitations such as use transposon contains antibiotics resistance mark and exogenous genetic fragment, may propagate in use in other pathogenic agent, has geneogenous latency environment harm risk.Virulence easily reply and uncontrollable environmental dissemination risk be this kind vaccine use institute must attention and solution.Given this, such attenuated vaccine is comprised that the various countries biological products safety inspection administration of China examines rules and regards as the biological products with higher environmental safety risk and be difficult to enter the commercial development process.
The unmarked disappearance of gene attenuated vaccine constructing technology is the new in the world at present living vaccine development field that rises, and is the field, international forward position and one of main developing direction of vaccine development, and the vaccine man that is developed has reliable product and environmental safety.And the attenuated strain that makes up has the potential value of expressing heterologous antigen with exploitation multiple-effect valency vaccine (particularly at virus disease), also becomes the international forward position and the hot fields of vaccine development.
Separate in the sick fish body of the tarda disease that the wild strain EIB202 of the blunt tarda that the present invention relates to breaks out in culturing the fishing ground from marine site, China East Sea and obtain, be a kind of supervirulent blunt tarda bacterial strain (Edwardsiella tardaEIB202, Xiao Jingfan etc., " Isolation and identification of fish pathogen Edwardsiella tarda frommariculture in China ", " Aquaculture Research " Vol.40,2009).This wild strain karyomit(e) contains chorismic acid synthetase gene aroC in the die aromatischen Aminosaeuren pathways metabolism, and this genetically deficient mutant strain shows as die aromatischen Aminosaeuren auxotroph and characterizes.By this bacterial strain genome sequencing is found that this bacterium has the plasmid of a 43.7kb, be responsible for the synthetic of the incomplete four type excretory systems of a cover.
Summary of the invention
The objective of the invention is to have overcome above-mentioned shortcoming of the prior art, marker-free disappearance attenuation mutant, related preparations and the application of the wild strain of a kind of blunt tarda are provided, this attenuation mutant or related preparations have been eliminated ubiquitous latency environment of traditional attenuated live vaccine and product safety risk, are a kind of safe, effective, the economic vaccines at the tarda disease of cultured fishes.
To achieve these goals, in a first aspect of the present invention, the marker-free disappearance attenuation mutant of the wild strain of a kind of blunt tarda is provided, be characterized in, it is the attenuated live vaccine of blunt tarda strain, has wherein lacked the chorismic acid synthetase gene aroC of described blunt tarda strain.Therefore, attenuation mutant does not carry any antibiotics resistance mark and other mark, does not have any allogenic gene fragment, because disappearance chorismic acid synthetase gene aroC shows as die aromatischen Aminosaeuren auxotrophy feature.
Preferably, described blunt tarda strain is blunt tarda strain EIB202.
More preferably, the preserving number of described blunt tarda strain EIB202 is: CCTCC-M 208068.
Preferably, described attenuated live vaccine has also lacked the endogenous plasmid of described blunt tarda strain.Promptly lacked the self-contained endogenous plasmid pET of described blunt tarda strain.
In the present invention, the substratum that attenuated vaccine strain is cultivated can be selected the LB substratum for use, peptone wherein can be a casein peptone, Tryptones or soy peptone, add NaCl to 0.5%, add following amino acid (20mg/L) phenylalanine, tyrosine, tryptophane, para-amino benzoic acid, P-hydroxybenzoic acid simultaneously.Specific embodiments of the invention have been selected Tryptones for use.
In a second aspect of the present invention, the preparation of the marker-free disappearance attenuation mutant of the wild strain of a kind of blunt tarda also is provided, be characterized in, comprise the marker-free disappearance attenuation mutant of the above-mentioned wild strain of blunt tarda and acceptable part on pharmacology.
Preferably, the somatic cells concentration of described marker-free disappearance attenuation mutant is 10
6～10
9CFU/ml.
Preferably, described part is a stroke-physiological saline solution.Its prescription can be: NaCl 9g/L, pH are 7.2.
In a third aspect of the present invention, also provide the application of preparation in the blunt tarda disease of control cultured fishes of the marker-free disappearance attenuation mutant of the marker-free disappearance attenuation mutant of the above-mentioned wild strain of blunt tarda or the above-mentioned wild strain of blunt tarda.
Preferably, described marker-free disappearance attenuation mutant or described preparation are by the injection system administration, and wherein somatic cells concentration is 10
4～10
6CFU/ml.
Beneficial effect of the present invention is:
1, the marker-free of the wild strain of blunt tarda of the present invention disappearance attenuation mutant has lacked chorismic acid synthetase gene aroC, has tangible hypotoxicity with respect to its wild strain EIB202, can protect fish to avoid the infringement of the blunt tarda of the sick pathogenic strain of tarda effectively, immune effect is remarkable, has the prevention effect of tarda disease in the extraordinary aquaculture;
2, the marker-free of the wild strain of blunt tarda of the present invention disappearance attenuation mutant does not carry any antibiotics resistance mark and other mark, environment is not existed the potentially dangerous of propagating antibiotics resistance; There is not any allogenic gene fragment, plasmid and virulence associated gene large fragment deletion, virulence can not be replied, and greatly eliminates the possibility to a large amount of toxicity pathogenic agent of environmental dissemination, and environment on possessing skills and Product Safety have actual business development using value;
3, the genetic background of the sudden change of the marker-free of the wild strain of blunt tarda of the present invention disappearance attenuation mutant is clear, attenuation mechanism is clear and definite, be easy to distinguish vaccine strain and wild strain, be convenient to environment is monitored, improve the environmental safety and the controllability of vaccine;
4, the marker-free of the wild strain of blunt tarda of the present invention disappearance attenuation mutant provides real development and application prospect for the commercialization process of marker-free disappearance attenuated live vaccine.
Description of drawings
Fig. 1 is that the present invention adopts the amplification of Overlap PCR method to obtain the schema of aroC genetically deficient fragment F1F2.
Fig. 2 is that the present invention utilizes method aroC genetically deficient fragment F1F2 shown in Figure 1 to make up suicide plasmid pDMK and screening obtains aroC deletion mycopremna schema.
Fig. 3 is that the present invention utilizes suicide plasmid pDMK to make up the schema that screening obtains endogenous plasmid elimination bacterial strain.
Embodiment
In order more to be expressly understood technology contents of the present invention, describe in detail especially exemplified by following examples.
The structure of embodiment 1 marker-free disappearance attenuation mutant
(1) structure of aroC genetically deficient bacterial strain
1) pcr amplification obtains required gene fragment
As shown in Figure 1, be masterplate with the genome of blunt tarda EIB202 (deposit number CCTCC-M 208068, the preservation place is the Chinese typical culture collection center of Wuhan University, preservation date is on May 1st, 2008), utilize following amplimer:
P1(GAAGATCTATCCCGTTTGTCTGGCTGGAGTTCG)，
P2(CGTCACGGTGCTTCCGCACCCGATCATCCT)，
P3(ATCGGGTGCGGAAGCACCGTGACGAGATCA)，
P4(ACATGCATGCCAGCCACAACCACATGCGTTTACGC)，
At first respectively with P1 and P2, P3 and the required F1 of fragment up and down of P4 amplification acquisition Overlap PCR, F2.After reclaiming each fragment, utilize the Overlap round pcr to adopt P1 and P4 to obtain aroC deletion fragment F1F2.
2) reclaim each fragment
Reclaim the target gene fragment from the object that will study, adopt the glue of TIANGEN company to reclaim test kit.After agarose gel electrophoresis finished, the purpose band was downcut in EB dyeing rapidly on long-wave ultra violet lamp, the Eppendorf that packs into pipe also takes by weighing weight, adds the sol solutions PN of 3 times of volumes, and 50 ℃ of water-baths were placed 10 minutes, constantly leniently spin upside down centrifuge tube therebetween, fully dissolve to guarantee blob of viscose; The solution that obtains is added in the adsorption column centrifugal (12, the centrifugal 30sec of 000rpm), outwell the waste liquid in the collection tube, adsorption column is reentered in the collection tube; In adsorption column, add 700 μ l rinsing liquid PW, 12, the centrifugal 30sec of 000rpm outwells waste liquid, uses 500 μ l rinsing liquid PW12 again, and the centrifugal 30sec of 000rpm outwells waste liquid.Centrifugal adsorption column is put back in the collection tube, 12, the centrifugal 2min of 000rpm goes out rinsing liquid as far as possible, again adsorption column is placed room temperature or 50 ℃ of incubator numbers minute, after drying up hill and dale, put it to one neatly in the centrifuge tube, be no less than the elution buffer EB buffer of 30 μ l to the unsettled dropping in adsorption film mid-way, room temperature is placed 2min, 12, the centrifugal 1min of 000rpm collects and contains the segmental dna solution of purpose, and electrophoresis detection reclaims DNA concentration.
3) make up suicide instrument plasmid
After the BglII site of pDMK carrier multiple clone site and SphI site cut, with purpose fragment F1F2 with cut after plasmid be connected for 16 ℃ with the T4DNA ligase enzyme and spend the night.CaCl
2Conversion method transforms SM10, obtains plasmid vector pDMKaroC.
4) engage
With the SM10 that carries the pDMKaroC plasmid by volume 4 to 1 ratio mix centrifugally with wild strain EIB202, remove supernatant liquor, with the resuspended precipitation of the fresh LB substratum of 10 microlitres.Be laid on the fresh semi-solid LB substratum the water-based filter membrane after 0.22 micron sterilization is smooth, take out whole bacteria suspension points and place water-based film central authorities.Cultivate after 24 hours for 37 degrees centigrade, with the MgCl of 0.2M
2Under the bacterium colony wash-out on the water-based film, coat kantlex, the dual resistant panel of polymyxin.
5) forward screening aroC gene disruption clone
As shown in Figure 2, suicide plasmid pDMKaroC is inserted on the genome in the aroC gene.Utilize kantlex, the screening of the dual resistant panel of polymyxin, and be the clone that the pcr amplification of primer can obtain the aroC gene disruption with P1/P4.
6) screening aroC genetically deficient bacterial strain
As shown in Figure 2, on 20% sucrose LB semisolid medium flat board, utilize pDMK to go up the SacB gene and can oppositely screen the bacterial strain that obtains to take place the homologous recombination second time.With primer P1, P4 can obtain the deletion mutantion bacterial strain, called after HQ01 by the PCR checking.
(2) aroC genetically deficient and plasmid are eliminated the structure of bacterial strain
As shown in Figure 3, utilize primer P5 (GGAAGATCTTCTTTACCAAGCACAT), P6 (CAGAAGGGATATGTT) amplification obtains corresponding gene fragment F1.And according to described in (one), connection is implemented on the pDMK, obtains plasmid pDMKplas.
2) utilize the homology exchange principle, plasmid pDMKplas by the method that SM10 engages, is inserted on the F1 fragment corresponding among the endogenous plasmid pET among the bacterial strain Δ aroC of above-mentioned acquisition.Utilize the SacB selection markers, screening obtains the bacterial strain of SacB feminine gender on the sucrose LB of 20% (v/v) flat board, and by the PCR checking, the plasmid extraction checking determines that it is plasmid and eliminates bacterial strain Δ aroC Δ plas, called after HQ02.
(3) attenuated live vaccine preparation
Substratum and physiological saline are formed:
1) LB slant medium: Tryptones (Difco) 10g/L, yeast extract (Merck) 5g/L, NaCl 5g/L, agar 18g/L, pH7.5;
2) seed culture medium: Tryptones (Difco) 10g/L, yeast extract (Merck) 5g/L, NaCl 5g/L, phenylalanine 20mg/L, tyrosine 20mg/L, tryptophane 20mg/L, P-hydroxybenzoic acid 20mg/L, para-amino benzoic acid 20mg/L, pH7.5;
3) fermention medium: Tryptones (Dofco) 10g/L, yeast extract (Merck) 5g/L, NaCl 5g/L, phenylalanine 20mg/L, tyrosine 20mg/L, tryptophane 20mg/L, P-hydroxybenzoic acid 20mg/L, para-amino benzoic acid 20mg/L, pH6.8;
4) physiological saline: NaCl 9g/L, pH7.2 sterilized 20 minutes for 121 ℃.
Vaccine production: get a transfering loop and be stored in attenuated vaccine strain seed on the LB slant medium, be inoculated in the 500ml that 100ml liquid LB seed culture medium is housed and shake bottle, at 30 ℃ of following shaking culture (200 rev/mins of rotating speeds).After 12 hours, get the eugonic bacterium liquid of 5ml (about O.D=4.0) and be inoculated in the fresh fermention medium of 100ml, cultivated 12 hours for 30 ℃.With stroke-physiological saline solution washing 3 times, centrifugal results thalline (2000 * g, 15 minutes, 15 ℃), stroke-physiological saline solution is diluted to finite concentration suspension (10
6-10
9CFU/ml), be preserved in 15 ℃ standby.
Embodiment 2: (Danio rerio) is the Lethal Dose 50 LD of experimental animal with zebra fish
50Measure:
Test places SPF (Specific Pathogen Free) laboratory to adapt to earlier with fish and cultured for 1 week, to pick out undesired individuality.Before infection experiment, put the SPF test in a suitable place to breed in infection experiment chamber (Challenge Lab) 0.5L infection experiment tank with fish again, continue to feed for 1 week, every groove is put 10 (the long 2.5-3cm of average body, body weight 0.2g) in a suitable place to breed.Experimental tank uses aseptic Chen Shui to replace 1/2 volume breed water every day, and 22 ℃ of water temperatures fluctuate 2 ℃ up and down.
To test and use the fish random packet, every group of 2 tank parallel tests.In infection experiment, every group of test fish is with certain gradient dosage (10
2-10
7The CFU/ tail) wild strain of blunt tarda and attenuated vaccine strain are injected into pedestrian worker by tail muscles and infect.Write down in 10 days, the dead mantissa of every group of each infective dose following every day, and calculate cumulative mortality, measure LD
50Value is got the mean value (seeing Table 1) of three groups of tests.
Table 1 blunt tarda strain EIB202 and attenuated strain are to the LD of zebra fish
50
| Infection strain | ??LD 50 | Remarks |
| ??EIB202 | ??3.2×10 2CFU/ml | Reaching half in 3 days causes death |
| ??HQ01 | ??4×10 5CFU/ml | Experimental concentration (10 2-10 5CFU/ml) all not reaching half causes death |
| ??HQ02 | ??5×10 5CFU/ml | Experimental concentration (10 2-10 5CFU/ml) all not reaching half causes death |
Annotate: above data are 2 groups of independent parallel test mean values.
The above results shows that all attenuated strains have tangible attenuation effect with respect to the wild strain of blunt tarda, and is nontoxic substantially to zebra fish in institute's experimental concentration scope.
Embodiment 3: the drug administration by injection immunoprotection test that with the zebra fish is experimental animal
The test zebra fish is divided into 4 groups, every group of 3 parallel tanks, 10 tails/groove at random.The attenuated live vaccine of preparation is adopted the muscle injection mode immunity.Injecting immune dosage is 10
5CFU/g, intramuscular injection test zebra fish.Control group injection stroke-physiological saline solution.(intramuscular injection infects 10 with the wild strain viable bacteria of blunt tarda after 4 weeks of immunity each to be organized immune zebra fish
6The CFU/ tail) carries out the artificial challenge and attack poison.Observation statistics control group and immune death toll are calculated every group immune protective rate (seeing Table 2) in 15 days.
Wherein, calculate immune protective rate by following formula: immune protective rate %=(control group mortality ratio-immune group mortality ratio %)/control group mortality ratio * 100%.
The blunt tarda attenuated live vaccine of table 2 injecting immune zebra fish is attacked the immunoprotection test of poison after 4 weeks
| Group | Immunizing dose | Test mantissa | Dead mantissa | Cumulative mortality (%) | Immune protective rate (%) |
| ??HQ01 | ??10 5The CFU/ tail | ??30 | ??6 | ??20 | ??78.6 |
| ??HQ02 | ??10 5The CFU/ tail | ??30 | ??4 | ??13.3 | ??85.7 |
| The physiological saline contrast | ??10 5The CFU/ tail | ??30 | ??28 | ??93.3 | ??/ |
| Physiological saline and do not have the contrast of attacking | ??/ | ??30 | ??0 | ??0 | ??/ |
From above-mentioned data as can be seen; two strain attenuated vaccines have the good wild virus strain infection of blunt tarda prevention effect; the immune protective rate of injecting immune after 4 weeks is higher than 75%; and do not have vaccinated fish kills rate up to 93.3%, illustrate that vaccine of the present invention has immune protective effect preferably.
The marker-free disappearance attenuation mutant disappearance chorismic acid synthetase gene aroC of the wild strain of blunt tarda of the present invention, further lack endogenous plasmid, the bacterial strain of this plasmid disappearance has improved the consistency of environment, increased the environmental safety of attenuated vaccine strain simultaneously, the die aromatischen Aminosaeuren that disappearance said gene fragment can hinder the wild strain of blunt tarda synthesizes, synthetic and the four type excretory systems of folic acid synthetic, thereby cause the wild strain of blunt tarda attenuation and its colonization ability in physical environment and fish body host greatly, realize the attenuation purpose.
To sum up, the marker-free disappearance attenuation mutant or the related preparations of the wild strain of blunt tarda of the present invention have been eliminated ubiquitous latency environment of traditional attenuated live vaccine and product safety risk, are a kind of safe, effective, the economic vaccines at the tarda disease of cultured fishes.
In this specification sheets, the present invention is described with reference to its certain embodiments.But, still can make various modifications and conversion obviously and not deviate from the spirit and scope of the present invention.Therefore, specification sheets and accompanying drawing are regarded in an illustrative, rather than a restrictive.
Claims (9)
1. the marker-free of the wild strain of blunt tarda disappearance attenuation mutant is characterized in that it is the attenuated live vaccine of blunt tarda strain, has wherein lacked the chorismic acid synthetase gene aroC of described blunt tarda strain.
2. the marker-free disappearance attenuation mutant of the wild strain of blunt tarda according to claim 1 is characterized in that described blunt tarda strain is blunt tarda strain EIB202.
3. the marker-free disappearance attenuation mutant of the wild strain of blunt tarda according to claim 2 is characterized in that the preserving number of described blunt tarda strain EIB202 is: CCTCC-M 208068.
4. the marker-free disappearance attenuation mutant of the wild strain of blunt tarda according to claim 1 is characterized in that described attenuated live vaccine has also lacked the endogenous plasmid of described blunt tarda strain.
5. the marker-free of the wild strain of blunt tarda lacks the preparation of attenuation mutant, it is characterized in that, comprise that the marker-free according to the wild strain of the arbitrary described blunt tarda of claim 1～4 lacks attenuation mutant and acceptable part on pharmacology.
6. the preparation of the marker-free disappearance attenuation mutant of the wild strain of blunt tarda according to claim 5 is characterized in that the somatic cells concentration of described marker-free disappearance attenuation mutant is 10
6～10
9CFU/ml.
7. the preparation of the marker-free disappearance attenuation mutant of the wild strain of blunt tarda according to claim 5 is characterized in that described part is a stroke-physiological saline solution.
8. lack the application of preparation in the blunt tarda disease of control cultured fishes of the marker-free disappearance attenuation mutant of attenuation mutant or the wild strain of blunt tarda according to claim 5 according to the marker-free of the wild strain of the arbitrary described blunt tarda of claim 1～4.
9. application according to claim 8 is characterized in that, described marker-free disappearance attenuation mutant or described preparation are by the injection system administration, and wherein somatic cells concentration is 10
4～10
6CFU/ml.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100527076A CN101629149B (en) | 2009-06-09 | 2009-06-09 | Marker-free gene-deletion attenuated mutant strain derived from Edwardsiella tarda wild strain, related preparation and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100527076A CN101629149B (en) | 2009-06-09 | 2009-06-09 | Marker-free gene-deletion attenuated mutant strain derived from Edwardsiella tarda wild strain, related preparation and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101629149A true CN101629149A (en) | 2010-01-20 |
| CN101629149B CN101629149B (en) | 2011-08-03 |
Family
ID=41574429
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100527076A Active CN101629149B (en) | 2009-06-09 | 2009-06-09 | Marker-free gene-deletion attenuated mutant strain derived from Edwardsiella tarda wild strain, related preparation and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101629149B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101974472A (en) * | 2010-11-11 | 2011-02-16 | 华东理工大学 | Marker-free gene deletion attenuated mutant strain of Edwardsiella tarda wild strain as well as relevant preparations and application thereof |
| CN102154348A (en) * | 2010-12-22 | 2011-08-17 | 华东理工大学 | Vibrio anguillarum and edwardsiella tarda-resistant multi-valence live vaccine, correlative expression vector and application |
| CN102296044A (en) * | 2010-09-21 | 2011-12-28 | 华东理工大学 | Unmarked gene-deleted and attenuated mutant strain of vibrio alginolyticus wild strain, and preparation and use thereof |
| CN103146627A (en) * | 2013-02-28 | 2013-06-12 | 华东理工大学 | Nonreactive multi-valence Edwardsiella tarda carrier live vaccine, and preparation method and application thereof |
| WO2013185337A1 (en) * | 2012-06-15 | 2013-12-19 | 华东理工大学 | Edwardsiella tarda mutant strain and application thereof |
| CN104474539A (en) * | 2014-11-17 | 2015-04-01 | 中国人民解放军第三军医大学 | YncD-aroC double genes knocked-out salmonella paratyphi A attenuated vaccine |
| CN111484960A (en) * | 2019-01-28 | 2020-08-04 | 华东理工大学 | Novel Edwardsiella attenuated target spot and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101342367B (en) * | 2007-07-11 | 2012-08-22 | 中国科学院海洋研究所 | Edwardsiella tarda attenuated live vaccine |
-
2009
- 2009-06-09 CN CN2009100527076A patent/CN101629149B/en active Active
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296044A (en) * | 2010-09-21 | 2011-12-28 | 华东理工大学 | Unmarked gene-deleted and attenuated mutant strain of vibrio alginolyticus wild strain, and preparation and use thereof |
| CN102296044B (en) * | 2010-09-21 | 2013-10-09 | 华东理工大学 | Unmarked gene-deleted and attenuated mutant strain of vibrio alginolyticus wild strain, and preparation and use thereof |
| CN101974472A (en) * | 2010-11-11 | 2011-02-16 | 华东理工大学 | Marker-free gene deletion attenuated mutant strain of Edwardsiella tarda wild strain as well as relevant preparations and application thereof |
| CN101974472B (en) * | 2010-11-11 | 2013-03-27 | 华东理工大学 | Marker-free gene deletion attenuated mutant strain of Edwardsiella tarda wild strain as well as relevant preparations and application thereof |
| CN102154348A (en) * | 2010-12-22 | 2011-08-17 | 华东理工大学 | Vibrio anguillarum and edwardsiella tarda-resistant multi-valence live vaccine, correlative expression vector and application |
| WO2013185337A1 (en) * | 2012-06-15 | 2013-12-19 | 华东理工大学 | Edwardsiella tarda mutant strain and application thereof |
| CN104919036A (en) * | 2012-06-15 | 2015-09-16 | 华东理工大学 | Edwardsiella tarda mutant strain and application thereof |
| CN103146627A (en) * | 2013-02-28 | 2013-06-12 | 华东理工大学 | Nonreactive multi-valence Edwardsiella tarda carrier live vaccine, and preparation method and application thereof |
| CN104474539A (en) * | 2014-11-17 | 2015-04-01 | 中国人民解放军第三军医大学 | YncD-aroC double genes knocked-out salmonella paratyphi A attenuated vaccine |
| CN111484960A (en) * | 2019-01-28 | 2020-08-04 | 华东理工大学 | Novel Edwardsiella attenuated target spot and application thereof |
| CN111484960B (en) * | 2019-01-28 | 2023-05-05 | 华东理工大学 | Novel Edwardsiella attenuated target and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101629149B (en) | 2011-08-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101629149B (en) | Marker-free gene-deletion attenuated mutant strain derived from Edwardsiella tarda wild strain, related preparation and application thereof | |
| US7794730B2 (en) | Polyvalent attenuated live vaccine for preventing and curing vibriosis of cultivated fish | |
| CN103255089B (en) | The strong malicious slow Edwardsiella vaccine strain of one strain and application thereof | |
| Huang et al. | Selective breeding and preliminary commercial performance of Penaeus vannamei for resistance to white spot syndrome virus (WSSV) | |
| CN101342367B (en) | Edwardsiella tarda attenuated live vaccine | |
| CN104560851B (en) | The preparation method and application of aeromonas salmonicida live vaccine preparation and freeze dried vaccine product | |
| CN102296044B (en) | Unmarked gene-deleted and attenuated mutant strain of vibrio alginolyticus wild strain, and preparation and use thereof | |
| CN101974472B (en) | Marker-free gene deletion attenuated mutant strain of Edwardsiella tarda wild strain as well as relevant preparations and application thereof | |
| CN103014051B (en) | Multiple-potency live vaccine for fish and application thereof | |
| CN103275890A (en) | Vibrio anguillarum (listonella anguillarum) virulent strain and application thereof | |
| CN102206257B (en) | Edwardsiella tarda immunogenic protective antigen, and related expression vector, vaccine and application | |
| CN106047783B (en) | Kill sweetfish pseudomonad ExoU gene knockout mutant strain and its application | |
| CN104087559A (en) | Infectious bursal disease virus, inactivated vaccine for infectious bursal disease virus and preparation method of vaccine | |
| CN103667145B (en) | Edwardsiella tarda genetic engineering low virulent strain and its application | |
| CN103509732B (en) | Edwardsiella tarda natural low virulent strain and application thereof | |
| CN101659958B (en) | Multi-titer live vaccine as well as preparation method and application thereof | |
| CN104919036B (en) | Edwardsiella tarda mutant strain and its application | |
| CN100384985C (en) | Attenuated eel vibrio strain and its application | |
| CN102017911B (en) | Energy-saving and emission-reducing scophthalmus maximus seedling culture method | |
| CN104488823B (en) | A kind of haemophilus parasuis infects the construction method of piglet model | |
| CN104784684B (en) | A kind of fish gill-rot diseases cause of disease Yue Shi Flavobacteriums attenuated live vaccine and construction method | |
| CN101705198B (en) | Edwardsiella tarda attenuated strain and application thereof | |
| Giorgetti | Disease problems in farmed penaeids in Italy | |
| CN103361293A (en) | Pathogenic strain for Scophthalmus maximus and application thereof | |
| CN102154348B (en) | Vibrio anguillarum and edwardsiella tarda-resistant multi-valence live vaccine, correlative expression vector and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |