WO2013181404A2 - COMPOSITIONS AND METHODS FOR PEPTIDE EXPRESSION AND PURIFICATION USING A TYPE lll SECRETION SYSTEM - Google Patents

COMPOSITIONS AND METHODS FOR PEPTIDE EXPRESSION AND PURIFICATION USING A TYPE lll SECRETION SYSTEM Download PDF

Info

Publication number
WO2013181404A2
WO2013181404A2 PCT/US2013/043384 US2013043384W WO2013181404A2 WO 2013181404 A2 WO2013181404 A2 WO 2013181404A2 US 2013043384 W US2013043384 W US 2013043384W WO 2013181404 A2 WO2013181404 A2 WO 2013181404A2
Authority
WO
WIPO (PCT)
Prior art keywords
flgm
interest
secretion
peptide
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/043384
Other languages
English (en)
French (fr)
Other versions
WO2013181404A3 (en
Inventor
Kelly T. Hughes
Baldomero M. Olivera
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Utah Research Foundation Inc
Original Assignee
University of Utah Research Foundation Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to ES13798228T priority Critical patent/ES2861275T3/es
Priority to PL13798228T priority patent/PL2855676T3/pl
Priority to EP13798228.6A priority patent/EP2855676B1/en
Priority to DK13798228.6T priority patent/DK2855676T3/da
Priority to US14/404,919 priority patent/US9630997B2/en
Priority to HK15109866.5A priority patent/HK1209158B/en
Application filed by University of Utah Research Foundation Inc filed Critical University of Utah Research Foundation Inc
Priority to JP2015515191A priority patent/JP6496243B2/ja
Publication of WO2013181404A2 publication Critical patent/WO2013181404A2/en
Anticipated expiration legal-status Critical
Publication of WO2013181404A3 publication Critical patent/WO2013181404A3/en
Priority to US15/459,191 priority patent/US10800818B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245Escherichia (G)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/255Salmonella (G)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43513Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
    • C07K14/43518Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from spiders
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43513Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
    • C07K14/43522Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from scorpions
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/02Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/036Fusion polypeptide containing a localisation/targetting motif targeting to the medium outside of the cell, e.g. type III secretion
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/50Fusion polypeptide containing protease site

Definitions

  • the disclosed invention relates generally to the use of FlgM in a type III secretion system for expression of a peptide of interest
  • compositions and methods for overcoming the current obstacles of production and purification of cysteine-rich polypeptides are disclosed herein.
  • flagellar FlgM protein As a vector for the secretion of small, highly stable pharmacologically-active polypeptides that contain a high density of cysteine residues, which form disulfide crosslinks in the mature product.
  • a bacterial secretion system for the recombinant expression of ⁇ -conotoxin SIIIA in Salmonella typhimurium is provided.
  • bacterial strains that can be used to produce high yields of secreted protein for the purposes of protein purification via flagellar T3S.
  • compositions and methods for production and purification of polypeptides using a bacterial flagellar system Disclosed are compositions and methods for production and purification of polypeptides using a bacterial flagellar system.
  • constructs comprising a FlgM nucleic acid sequence, a cleavage site, and a nucleic acid sequence of interest.
  • the constructs can further comprise a nucleic acid sequence encoding a purification tag.
  • the purification tag can be poiy- histidine.
  • the FlgM nucleic acid sequence of the disc losed constructs can be wild type FlgM.
  • the cleavage site can be a Tobacco Etch Virus (TEV) protease cleavage site or an Enterokinase (ETK) cleavage site.
  • TSV Tobacco Etch Virus
  • ETK Enterokinase
  • the nucleic acid sequence of interest of the disclosed constructs can encode a cysteine-rich peptide.
  • the cysteine-rich peptide can be a neuroactive toxin, such as a conopeptide.
  • the conopeptide can be a ⁇ -conotoxin such as SIIIA.
  • the disclosed constructs can have the cleavage site between the FlgM nucleic acid sequence and the nucleic acid sequence of interest.
  • the order of the sequences in the constructs can be the FlgM nucleic acid sequence, the nucleic acid sequence encoding a purification tag, the cleavage site, and the nucleic acid sequence of interest.
  • the order of the sequences in the constructs can be the nucleic acid sequence encoding a purification tag, the FlgM nucleic acid sequence, the cleavage site, and the nucleic acid sequence of interest.
  • the order of the sequences in the constructs can also include the nucleic acid sequence encoding a purification tag being C-terminal to the nucleic acid sequence of interest.
  • the disclosed constructs can also comprise a ParaBAD promoter.
  • polypeptides comprising FlgM, a cleavage site, and a peptide of interest.
  • the polypeptides can further comprise a purification tag.
  • the purification tag can be poly-histidine.
  • the FlgM in the disclosed polypeptides can be wild type FlgM,
  • the cleavage site can be a TEV protease cleavage site or an ET cleavage site.
  • the peptide of interest in the disclosed polypeptides can be a cysteine-rich peptide.
  • the cysteine-rich peptide can be a neuroactive toxin such as a conopeptide.
  • the conopeptide can be a ⁇ -conotoxin such as SWA.
  • the disclosed polypeptides can have the cleavage site between the FlgM and the peptide of interest.
  • the order of the sequences in the polypeptides can be the FlgM is N-terminal to the purification tag, the purification tag is N-terrninal to the cleavage site, and the cleavage site is N-terminal to the peptide of interest.
  • the order of the sequences in the polypeptide can be the purification tag is N-terminal to FlgM, FlgM is N-terminal to the cleavage site, and the cleavage site is N-terminal to the peptide of interest.
  • the purification tag is C-terminal to the peptide of interest.
  • recombinant cell lines comprising any of the disclosed constructs.
  • the recombinant cell line can be derived from a wild type strain of
  • Salmonella enterica serovar Typhimuri m Salmonella enterica serovar Typhimuri m.
  • the genome of the disclosed recombinant cell lines can comprise an alteration to one or more flagellin or hook-associated protein genes.
  • the one or more flagellin genes can be selected from the group consisting offlgK,flgL, fliC,fljB, and fliD.
  • Die disclosed recombinant cell lines can comprise an alteration to one or more inhibitors of the flagellar FlhD4C2 master regulatory protein complex.
  • the inhibitors of the flagellar FlhD4C2 master regulatory protein complex can be selected from the group consisting of flmZ, srgD, hdfR, rhsR, ompR, clpX, clpP, IrhA, ydiV, dskA, ecnR, fliT, and rcsB.
  • the disclosed recombinant cell lines can comprise a mutation to increase transcription or translation of the i%A/ T3S-chaperone gene fliA.
  • Also disclosed are methods of producing a peptide of interest comprising eulturing a cell line comprising any of the disclosed polypeptides in culture media, wherein the polypeptide comprises the peptide of interest.
  • the methods can further include purifying the peptide of interest from the culture media.
  • the methods can use a cell line that comprises any of the disclosed constructs.
  • the purifying of the peptide of interest can comprise an affinity column such as ⁇ 3 ⁇ affinity column.
  • the disclosed methods can use a cell line that comprises a flagellar type III secretion (T3S) system of Salmonella enterica serovar Typhimurium to secrete the polypeptide comprising the peptide of interest.
  • T3S flagellar type III secretion
  • the disclosed methods can use a cell line that comprises an alteration to one or more fiagellin hook-associated protein genes.
  • the one or more flagellin or hook- associated protein genes can be selected from the group consisting offlgK ⁇ gL. fliC, fljB, and fliD.
  • the disclosed methods can use a cell line that comprises an alteration to one or more inhibitors of the flagellar FIHD4C2 master regulatory protein complex.
  • the inhibitors of the flagellar FlhD4C2 master regulatory protein complex can be selected from the group consisting oifimZ, srgD, kd/R, rbsR, ompR, clpX, clpP, IrhA, ydiV, dshi, ecnR, fliT, and rcsB,
  • the disclosed methods can use a ceil line that comprises a mutation to increase transcription or translation of the /3 ⁇ 4 T3S-chaperone gene fliA.
  • FIG. 1 shows engineering of a flagellar type ⁇ secretion system for the secretion of SOiA conotoxins.
  • a FlgM-S lA translational fusion is a secretion substrate of the bacterial T3SS. The fusion construct is secreted via the flage liar-specific T3SS through the flagellar channel into the culture medium through flagellar structures that are competent for FlgM secretion.
  • FlgM-SUlA is induced upon addition of arabinose and is independent of flagellar class I and II gene expression.
  • FlgM remains inside the cytosol and acts as an anti a28-factor preventing transcription of class III genes, e.g. genes encoding for the flagellin subunit FliC or the stator proteins MotAB.
  • the HBB structure is completed within 30 min, which coincides with a substrate specificity switch within the flagellar secretion apparatus (indicated by an orange asterisk in the figure) from early to late- substrate secretion. This results in secretion of FlgM and substrates needed during the final phase of flagella assembly.
  • OM outer membrane
  • PG peptidoglycan layer
  • IM inner membrane.
  • F/gA/-H6-TEV-SIIIA was expressed from the arabinose promoter and secretion was compared i afliAwt (lane 2), fliA* (HMD, lane3) and AfliCD (lane 4) background. Secretion of wildtype FlgM expressed from its native promoter is shown in lane 1 (TH437, labeled wt).
  • Figure 2 shows purification and electrophysiology of recombinant conotoxin SIIiA and secretion of toxins from various organisms via the flagellar T3SS.
  • A The supernatant of a strain expressing and secreting recombinant SIIIA fused to FlgM
  • TH 15707 fliA* HMD
  • AaraBAD1036::F/gAi ⁇ H6-TEV-SIIIA was filtered and bound to a NI2+-IDA column as described in Example 1.
  • the matrix was washed after binding (W1-W3) and FlgM-SUlA was eluted in three steps with imidazo!e-containing eiution buffer (E1-E3).
  • E1-E3 imidazo!e-containing eiution buffer
  • samples were TCA precipitated. Due to the increased FlgM-SUlA concentration in the elution fractions, only 1/lOth of the volume was used for TCA precipitation of eiution fractions 1 -3.
  • (C) i3 ⁇ 4 -H6-TEV was trans lationaliy fused to six different toxins from cone snails, and one toxin each from sea anemone, scorpion, spider, and snake, and FlgM ⁇ W6 was fused to (D) the Corynebacterium diphtheria (see also Table 3 for detailed list). Toxins were expressed in a Salmonella poSy-hook background. Secretion of diphtheria toxin fragment A from Salmonella strain TH 16229 was tested using three independent biological replicates (labeled 1-3).
  • FIG. 34 shows the effect of Salmonella poly-hook background on secretion.
  • A Immunostaining of the poly-hook background ⁇ 16778 used for secretion of FigM- H6-TEV-toxin fusions. Top left: Membrane stained with F -64. Top right: DNA stained with Hoechst. Bottom left: Flagellar hook-basal-body complexes (flgE::3xHA) labeled with anti-haemaggiutinin antibodies coupled to Alexa Fluor-488. Scale bar is 5 ⁇ ,
  • B Secreted proteins were precipitated using TCA and immunoblots with antibodies against FlgM and FliK are shown for cellular and supernatant fractions.
  • Protein bands of native FlgM (open triangle) and FlgM-SlUA fusions (filled triangle) are marked next to the blot.
  • Secretion levels were compared by measuring the densitometric intensity of the detected bands using ImageJ.
  • Secretion values relative to the secretion in a Para wildtype background (first lane) are displayed below the corresponding band.
  • FIG. 4 shows FlgM secretion under ParaBAD over-expression conditions.
  • Western blot analysis of supernatant fractions of strains over-expressing FlgM from the chromosomal araBAD promoter (ParaBAD- / ( g +). Overnight cultures were diluted 100-fold into LB medium, incubated at 37°C for 2 hours, followed by addition of arabinose to 0.2% to induce ParaBAD- /g . After 5 hours further incubation at 37°C, cells were separated from the supernatant by eentrifugation and TCA was added to the cell supernatant to precipitate secreted protein (see Example 2). For the secreted protein analysis, 100 OD units of sample were loaded into each lane.
  • Figure 5 shows the effect of flhDC operon expression on levels of secreted FlgM and cell motility.
  • Figure 7 shows the effect of flagellar late substrate deletion, growth phase, and fljBenx vh2 mutations on levels of secreted FlgM and ceil motility.
  • A Secreted levels of FlgM was determined in strains carrying different flagella late substrate genes (flgK, flgL.
  • B Relative FlgM secreted levels.
  • C Motility assay in various mutant backgrounds depicted with AaraBAD l l 56 :FlgM ⁇ in the absence and presence of added 0.2% arabinose.
  • FIG. 8 shows the effects of late flagella T3S chaperone deletion mutations on levels of secreted FlgM and cell motility.
  • B Relative FigM secreted levels.
  • FIG. 9 shows the effects of Spi-1 and Spi-2 mutations deletion mutations on levels of secreted FigM and cell motility
  • B Relative FigM secreted levels.
  • C Motility assay in various mutant backgrounds depicted with
  • Figure 10 shows the effects of cellular protease mutant alleles on levels of secreted FigM and ceil motility
  • Figure 1 1 shows the effects of NaCi and KCi ionic strengths on levels of secreted FigM and cell motility.
  • B Relative FigM secreted levels.
  • C Motility assay in various mutant backgrounds depicted with AaraBADl ⁇ 56::FlgM+ in the absence and presence of added 0.2% arabinose,
  • Figure 12 shows the effects of different combined mutations on levels of secreted FigM.
  • FIG. 13 shows the effects of different combined mutations on levels of secreted F/g,V/-6H-TEV-8-SVIE and F/gA/-6H-ETK-5-SVIE.
  • Figure 14 shows type HI secreted proteins.
  • Figure 15 shows the Salmonella SPIi injectisome system.
  • A All genes required for the structure and assembly of the SPII injectisome are clustered in the chromosome.
  • B SPII genes are under control of the flagellar master operon flhDC, which leads to the successive transcription of the FliZ, HilD and HilA regulators and HilA is required for injectisome gene transcription.
  • C Injectisome basal body (IBB) completion is followed by (D) needle and (E) translocon assembly.
  • Figure 16 shows flagellar and SPII injectisome structures. The structures show overall similarities in structure with strong homologies to basal and secretion-associated component proteins.
  • Ranges may be expressed herein as from “about” one particular value, and/or to "about” another particular value. When such a range is expressed, also specifically contemplated and considered disclosed is the range from the one particular value and/or to the other particular value unless the context specifically indicates otherwise. Similarly, when values are expressed as approximations, by use of the antecedent "about,” it will be understood that the particular value forms another, specifically contemplated embodiment that should be considered disclosed unless the context specifically indicates otherwise. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint unless the context specifically indicates otherwise.
  • vector refers to a nucleic acid sequence capable of transporting into a cell another nucleic acid to which the vector sequence has been linked.
  • expression vector includes any vector, (e.g., a piasmid, cosmid or phage chromosome) containing a gene construct in a form suitable for expression by a cell (e.g., linked to a transcriptional control element).
  • Plasmid and vector are used interchangeably, as a piasmid is a commonly used form of vector, Moreover, the invention is intended to include other vectors which serve equivalent functions.
  • sequence of interest or "nucleic acid sequence of interest” can mean a nucleic acid sequence (e.g., gene capable of encoding a cysteine-rich peptide), that is partly or entirely heterologous, i.e., foreign, to a cell into which it is introduced.
  • sequence of interest or "nucleic acid sequence of interest” can also mean a nucleic acid sequence, that is partly or entirely homologous to an endogenous gene of the cell into which it is introduced, but which is designed to be inserted into the genome of the cell in such a way as to alter the genome (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in "a knock-in i! ).
  • a sequence of interest can be cDNA, DNA, or mRNA.
  • a "peptide of interest” or “protein of interest” means a peptide or polypeptide sequence (e.g., a cysteine-rich peptide), that is expressed from a sequence of interest or nucleic acid sequence of interest,
  • operatively linked to refers to the functional relationship of a nucleic acid with another nucleic acid sequence.
  • Promoters, enhancers, transcriptional and translationai stop sites, and other signal sequences are examples of nucleic acid sequences operatively linked to other sequences.
  • operative linkage of DNA to a transcriptional control element can refer to the physical and functional relationship between the DNA and promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA,
  • transformation and “transfection” mean the introduction of a nucleic acid, e.g., an expression vector, into a recipient cell including introduction of a nucleic acid to the chromosomal DNA of said cell.
  • TCEs transcriptional control elements
  • TCEs are elements capable of driving expression of nucleic acid sequences operabiy linked to them.
  • the constructs disclosed herein comprise at least one TCE, TCEs cars optionally be constitutive or regulatabie.
  • the bacterial flagellum is a complex cellular machine that requires more than 30 gene products for its construction.
  • Salmonella enterica there are currently more than 60 genes involved in the biogenesis and function of its flagella. These genes are organized into a transcriptional hierarchy of 3 promoter classes.
  • theflhDC operon encoding the master regulator proteins FlhD and FlhC, which form a heteromultimeric, transcriptional activation complex.
  • the FlhD4C2 complex directs ⁇ 7(! RNA polymerase to transcribe from class 2 flagellar promoters.
  • HBB hook-basal body
  • T3S flagellar type III secretion
  • FHA flagellar class 3 promoters
  • the ⁇ 28 protein is a flage liar-specific transcription factor that directs RNA polymerase to transcribe from the flagellar class 3 promoters
  • C lass 3 genes include the structural genes of the flagellar filament and genes of the chemosensory signal transduction system that controls the direction of flagellar rotation according to changing concentrations of extracellular ligands.
  • FlgM binds ⁇ 28 and prevents flagellar class 3 promoter transcription.
  • a change in the flagellar T3S substrate specificity results in FigM secretion and initiation of a i8 -dependeni transcription from flagellar class 3 promoters.
  • the secretion signal requirements for T3S substrates remains poorly defined, but all substrates utilize an N-terminal peptide secretion signal that is disordered in structure and unlike type II secretion, is not cleaved during the secretion process- Substrate secretion is often facilitated by T3S chaperone-assisted delivery to the secretion apparatus.
  • the FlgM protein is 97 amino acids in length and its secretion is dependent on an N-tenrsinai secretion signal FlgM secretion is greatly enhanced by its secretion chaperone, ⁇ 28 , which binds to the C-terminal half of FlgM,
  • FlgM is a small T3S substrate and not part of the final flagellar structure, it can be used as a vehicle to direct secretion of proteins for purification purposes. Fusion of foreign peptides to the C-terminus of FlgM can be used to direct their secretion either into the periplasm or into the extracellular milieu.
  • the FlgM type III secretion system can be used to express and purify reeombined proteins.
  • Dislcosed are constructs and methods that use an expression system that exploits the flagellar secretion system of Salmonella enterica serovar Typhimurium (Salmonella typhimuriurrs) and bypasses the inclusion body problem of recombinant small peptide expression.
  • nucleic acid constructs comprising a FlgM nucleic acid sequence, a cleavage site, and a nucleic acid sequence of interest.
  • the constructs can further comprise a nucleic acid sequence encoding a purification tag.
  • the order of the FlgM nucleic acid sequence, the cleavage site, and the nucleic acid sequence of interest can vary. In some aspects, the order of the sequences can be from 5' to 3', the FlgM nucleic acid sequence, the nucleic acid sequence encoding a purification tag, the cleavage site, and the nucleic acid sequence of interest. In some aspects, the order of the sequences can be from 5' to 3', the nucleic acid sequence encoding a purification tag, the FlgM nucleic acid sequence, the cleavage site, and the nucleic acid sequence of interest.
  • the order of the sequences can be from 5' to 3', the F/g nucleic acid sequence, the cleavage site, the nucleic acid sequence encoding a purification tag, and the nucleic acid sequence of interest. In some aspects, the order of the sequences can be from 5' to 3', the FlgM nucleic acid sequence, the cleavage site, the nucleic acid sequence of interest, and the nucleic acid sequence encoding a purification tag. Thus, the nucleic acid sequence encoding a purification tag can be 5' or 3' to the nucleic acid sequence of interest,
  • the disclosed constructs comprise a FlgM nucleic acid sequence.
  • the FlgM nucleic acid sequence can be wild type FlgM.
  • the FlgM nucleic acid sequence can be a mutant sequence of FlgM.
  • the mutant sequence oiFlgM can have one or more nucleotide mutations compared to wild type FlgM.
  • the mutations do not change the encoded amino acid sequence.
  • the mutations in the mutant nucleic acid sequence of. FlgM does not affect the ability of the encoded FlgM peptide to act as a vector for the secretion of the peptide encoded by the nucleic acid sequence of interest.
  • the disclosed constructs can comprise a cleavage site between the FlgM nucleic acid sequence and the nucleic acid sequence of interest.
  • the cleavage site can be a Tobacco Etch Virus (TEV) protease cleavage site or an Enterokinase (ET ) cleavage site.
  • TSV Tobacco Etch Virus
  • ET Enterokinase
  • Other cleavage sites known to those of skill in the art can be used.
  • the cleavage site is between the FlgM nucleic acid sequence and the nucleic acid sequence of interest, the cleavage site does not always have to be contiguous with those sequences. In other words, a sequence encoding a purification tag can be directly before or after the cleavage site.
  • the cleavage site can be a protease cleavage site. Therefore, the nucleic acid sequence of the cleavage site can encode a protease cleavage site.
  • the cleavage site is not a nuclease cleavage site and thus the nucleic acid sequences present in the constructs are not cleaved.
  • the cleavage site allows for cleavage of the polypeptide encoded by the disclosed constructs. Cleavage of the polypeptide encoded by the disclosed constructs can release the peptide of interest (encoded by the nucleic acid of interest) from FlgM peptide (encoded by the FlgM nucleic acid sequence).
  • the disclosed constructs comprise a nucleic acid sequence of interest.
  • the nucleic acid sequence of interest can encode a peptide of interest to be expressed and purified using the FlgM system provided herein,
  • the nucleic acid sequence of interest encodes a eysteine-rich peptide or a disulfide-rich peptide
  • Recombinant expression of small disulfide-rich polypeptides results in generally low yields. Overexpression of these polypeptides can lead to the formation of intermolecuiar aggregates, and the recombinant polypeptides can be found in the inclusion bodies. Because recovering the polypeptides from the inclusion bodies can be difficult and time consuming, these disulfide-rich polypeptides are best purified using the FlgM expression system disclosed herein.
  • the nucleic acid sequence of interest encodes a cysteine-rich peptide or a disulfide-rich peptide, wherein the disulfide-rich or cysteine-rich polypeptides is a neuroactive toxin.
  • the neuroactive toxin can be any neuroactive toxin.
  • the neuroactive toxin can be a conoidean derived toxin (i.e. a toxin from a conoidean).
  • the neuroactive toxin can be a conopeptide.
  • the conopeptide can be a ⁇ -conotoxin. Exarrsples of ⁇ -conotoxins include but are not limited to SIIIA.
  • the disclosed constructs can further comprise a sequence encoding a purification tag.
  • purification tags include, but are not limited to poly- histidine, glutathione S-transferase (GST), Myc, HA, FLAG, and maltose binding protein (MBP).
  • GST glutathione S-transferase
  • MBP maltose binding protein
  • the disclosed constructs can also comprise transcriptional control elements (TCEs).
  • TCEs are elements capable of driving expression of nucleic acid sequences operably linked to therrs.
  • the constructs disclosed herein comprise at least one TCE.
  • TCEs can optionally be constitutive or regulatable.
  • disclosed herein are constructs comprising a ParaBAD promoter.
  • the ParaBAD promoter is an arabinose- inducible promoter. This allows for expression of the nucleic acid sequences downstream of the promoter to be turned on or off in the presence or absence of arabinose.
  • Regulatable TCEs can comprise a nucleic acid sequence capable of being bound to a binding domain of a fusion protein expressed from a regulator construct such that the transcription repression domain acts to repress transcription of a nucleic acid sequence contained within the regulatable TCE.
  • the construct comprising the regulatable TCE can further comprise the nucleic acid sequence capable of encoding a drug-controllable (such as a drug inducible) repressor fusion protein that comprises a DNA binding domain and a transcription repression domain.
  • a drug-controllable (such as a drug inducible) repressor fusion protein that comprises a DNA binding domain and a transcription repression domain.
  • the nucleic acid sequence capable of encoding a drug-control lab ie (such as a drug inducible) repressor fusion protein is on the same construct as the regulatabie TCE to which the repressor fusion protein binds.
  • Regulatabie TCEs can optionally comprise a regulator target sequence.
  • Regulator target sequences can comprise nucleic acid sequence capable of being bound to a bi nding domain of a fusion protein expressed from a regulator construct such that a transcription repression domain acts to repress transcription of a nucleic acid sequence contained within the regulatabie TCE
  • Regulator target sequences can comprise one or more tet operator sequences (tetO).
  • the regulator target sequences can be operabSy linked to other sequences, including, but not limited to, a TATA box or a GAL-4 encoding nucleic acid sequence.
  • a regulatabie TCE and a regulator sequence allow for inducible and reversible expression of the sequences operably linked to the regulatabie TCE.
  • the regulatabie TCE can provide a means for selectively inducing and reversing the expression of a sequence of interest.
  • Regulatabie TCEs can be regulatabie by, for example, tetracycline or doxycyeline. Furthermore, the TCEs can optionally comprise at least one tet operator sequence.
  • polypeptides encoded by the nucleic acid constructs disclosed above and elsewhere herein are polypeptides encoded by the nucleic acid constructs disclosed above and elsewhere herein.
  • polypeptides comprising FlgM, a cleavage site, and a peptide of interest.
  • the polypeptides can further comprise a purification tag.
  • the FlgM cm be N-terminal to the purification tag
  • the purification tag can be N-terminal to the cleavage site
  • the cleavage site can be N-terminal to the peptide of interest.
  • the purification tag can be N- terminal to FlgM
  • FlgM can be N-terminal to the cleavage site
  • the cleavage site can be N-termina! to the peptide of interest.
  • the purification tag can be C- terminai to the peptide of Interest.
  • the order of the polypeptide can be, for example, 1) Tag- /g -cleavage site-peptide of interest, 2) /g -Tag-cIeavage site-peptide of interest, 3) F/g -cleavage site-Tag-peptide of Interest, or 4) /g -cieavage site-peptide of interest-Tag,
  • the disclosed polypeptides comprise FlgM.
  • the FlgM can be wild type FlgM.
  • the FlgM can be a mutant FlgM.
  • the mutant FlgM can have one or more amino acid mutations compared to wild type FlgM.
  • the mutations in the mutant FlgM does not affect the ability of FlgM to act as a vector for the secretion of the peptide of interest.
  • the disclosed polypeptides can comprise a cleavage site between FlgM and the peptide of interest.
  • Tlie cleavage site can be a TEV protease cleavage site or an ETK cleavage site, Although the cleavage site is between the FlgM mid the peptide of interest, the cleavage site does not always have to be contiguous with FlgM and the peptide of interest, in other words, a purification tag can be directly before or after the cleavage site.
  • the cleavage site can be a protease cleavage site.
  • the cleavage site allows for cleavage of the polypeptide. Cleavage of the polypeptide can release the peptide of interest from the FlgM.
  • the disclosed polypeptides comprise a peptide of interest.
  • the peptide of interest can be a peptide to be expressed using the FlgM system provided herein.
  • the peptide of interest can be a cysteine-rich peptide or a disulfide-rich peptide.
  • the dis lfide-rich or cysteine-rich peptides can be a neuroactive toxin.
  • the neuroactive toxin can be any neuroactive toxin, in some aspects, the neuroactive toxin can be a conoidean derived toxin (i.e. a toxin from a conoidean). In some aspects, the neuroactive toxin can be a conopeptide.
  • the conopeptide can be a ⁇ - conotoxin. Examples of ⁇ -conotoxins include but are not limited to SlilA.
  • the peptide of interest can vary in size. In some aspects, the peptide of interest can be 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acids long. In some aspects, the peptide of interest can be 5, 10, 15, 20, 25, 30, or 35 amino acids long. The peptide of interest can vary in size. In some aspects, the peptide of interest can be 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 amino acids long. In some aspects, the peptide of interest can be 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 amino acids long. 4, Purification Tag
  • the disclosed polypeptides can further comprise a purification tag.
  • purification tags include, but are not limited to poiy-histidine, glutathione S- transferase (GST), Myc, HA, FLAG, and maltose binding protein (MBP).
  • the purification tag can be used to purify the polypeptide after it has been secreted into the culture media via the FlgM secretion system.
  • recombinant cell lines that comprise any of the disclosed constructs comprising a FlgM nucleic acid sequence, a cleavage site, and a nucleic acid sequence of interest.
  • the recombinant ceil lines can comprise one or more of the following sequences: FlgM nucleic acid sequence, a cleavage site, and a nucleic acid sequence of interest.
  • the recombinant cell lines can have a mutation of the construct comprising the FlgM nucleic acid sequence, a cleavage site, and a nucleic acid sequence of interest.
  • the recombinant cell lines can be derived from a wild type strain of
  • the recombinant cell line can be derived from a mutant strain of Salmonella enterica serovar Typhimurium,
  • the recombinant cell lines can be derived from other enteric bacterial species.
  • the recombinant ceil lines can be derived from E. Coli or Yersinia.
  • recombinant cell lines wherein the genome of the recombinant cell line comprises an alteration to one or more flagellin or hook-associated protein genes.
  • the one or more flagellin genes can be selected from the group consisting of flgK, flgl, fliC, fljB, mdfliD.
  • recombinant cell lines wherein the ceil line comprises an alteration to one or more inhibitors of the flagellar FlhD4C2 master regulatory protein complex.
  • the inhibitors of the flagellar FIHD4C2 master regulator)' protein complex can be selected from the group consisting of fimZ, srgD, hdfR, rbsR, ompR, clpX, clpP, IrhA, ydiV, dskA, ecnR, fliT, and rcsB.
  • FihD4C2 activates the transcription of class 11 promoters, including those of fliA, FlgM, and genes for hook basal body assembly. Inhibition of FlhD4C2 can result in a reduction in FlgM or the number of hook basal body structures. Therefore, the recombinant cell lines having an alteration to one or more inhibitors of the flagellar FlhD4C2 master regulatory protein complex can positively affect the secretion of disclosed polypeptides. [0099] The recombinant cell lines can comprise a mutation to increase transcription or translation of the /gA/T3S-ehaperone gene fliA.
  • FliA is considered a /gA/T3S- chaperone gene because fliA encodes for ⁇ 28 and ⁇ 28 binds to FlgM and protects FlgM from proteolysis in the cytoplasm of the ceil Therefore, a mutation that increases transcription or translation of the fliA gene can lead to more or better FlgM secretion.
  • FlgM is part of a polypeptide that also contains a peptide of interest.
  • the mutations in the fliA gene resulted in an H14N, HMD, T138I or E203D mutation in the encoded ⁇ 28 ,
  • combination strains can comprise any of the disclosed constructs having a FlgM nucleic acid sequence, a cleavage site, and a nucleic acid sequence of interest.
  • Disclosed are methods of producing a peptide of interest comprising culturing a cell line in culture media wherein the ceil line comprises any of the disclosed polypeptides that contain FlgM, a cleavage site, and the peptide of interest.
  • the methods can further include purifying the peptide of interest from the culture media.
  • the disclosed methods can include cell lines comprising any of the disclosed nucleic acid constructs that contain a FlgM nucleic acid sequence, a cleavage site, and a nucleic acid sequence of interest.
  • the nucleic acid sequence of interest encodes the peptide of interest being produced.
  • the step of purifying the peptide of interest can include an affinity column, in some aspects, the affinity column can be a ⁇ 28 affinity column.
  • the affinity column can be any column designed to purify' the peptide of interest or the polypeptide of interest that contains the peptide of interest by using an attraction between one of the peptides on the polypeptide and a molecule on the affinity column.
  • a ⁇ 28 affinity column can be used because ⁇ 28 binds to FlgM which is on the polypeptide which also contains the peptide of interest.
  • the affinity colum can also be based on the purification tag present in the polypeptide, in some aspects, the affinity column can have antibodies that bind to FlgM, the purification tag, or the peptide of interest.
  • the purification of the peptide of interest can include purification of the polypeptide that comprises FlgM, a cleavage site, and the peptide of interest.
  • the peptide of interest can be cleaved by using the cleavage site present between FlgM and the peptide of interest.
  • the peptide of interest can be cleaved before, after, or during purification.
  • using the disclosed cell lines that have a polypeptide that includes FlgM, a cleavage site and the peptide of interest allows for FlgM to direct the polypeptide and be secreted through a flagellar type III secretion system into the media that the cells are cultured in.
  • the peptide of interest can be cleaved away from the rest of the polypeptide by adding a protease specific to the cleavage site of the polypeptide.
  • the peptide of interest can then be purified from the culture media.
  • the peptide of interest can be purified along with the rest of the polypeptide that comprises the peptide of interest.
  • the polypeptide can be cleaved and the peptide of interest released.
  • the peptide of interest can be cleaved during purification.
  • the polypeptide can be bound to the affinity column during purification and while bound, the polypeptide can be cleaved releasing the peptide of interest from the remaining polypeptide.
  • the cell lines of the disclosed methods can be any of the disclosed recombinant cell lines, in some aspects, the cell lines can have a flagellar type ⁇ secretion (T3S) system of Salmonella enterica serovar Typhi urium to secrete the polypeptide comprising the peptide of interest. In some aspects, the cell lines can have an alteration to one or more flagellin genes or hook-associated protein genes.
  • the one or more flagellin or hook-associated protein genes cars be selected from the group consisting of flgK, flgL, fliC, fljB, and jHD.
  • the cell lines can have an alteration to one or more inhibitors of the flagellar FlhD4C2 master regulatory protein complex.
  • the inhibitors of the flagellar FIHD4C2 master regulatory protein complex can be selected from the group consisting otfimZ, srgD, hdfR, rbsR, ompR, clpX, dpP, IrhA, ydiV, dskA, ecnR, . I/T, and rcsB.
  • the cell lines can have a mutation to increase transcription or translation of the FlgM T3 S-chaperone gene #£4,
  • kits for producing a peptide of interest the kit comprising one of the disclosed recombinant cell lines.
  • the kits also can contain culture media.
  • kits can also include materials for purifying the peptide of interest.
  • the kits can include an affinity column for purifying the peptide of interest based on the purification tag present on the polypeptide.
  • the flagellar FlgM protein was utilized as a vector for the secretion of the small, highly stable pharmacologically-active polypeptides that contain a high density of cysteine residues, which form disulfide crosslinks in the mature product.
  • a bacterial secretion system was engineered for the recombinant expression of ⁇ -conotoxin SIILA in Salmonella typhimurium.
  • T3S flagellar type III secretion
  • Exemplary bacterial strains that can be used are listed in Table 1.
  • Cells were cultured in Luria-Bertani (LB) media and, when necessary, supplemented with ampicillin (100 ⁇ g ml) or tetracycline ( 15 ⁇ 3 ⁇ 41 ⁇ 21).
  • ampicillin 100 ⁇ g ml
  • tetracycline 15 ⁇ 3 ⁇ 41 ⁇ 21.
  • AaraBAD 1150 ;FlgM-H6-TEV-Shk
  • AaraBAD! 149 FlgM-H6-TEV-Chlorotoxin
  • AaraBAD 114 :FlgM-H6-TEV-G.sAfTx4
  • SIIIA was amplified in a de novo fill-in PCR-reaciion using a iong primer SIIIAJong_fw
  • GCGGCCGCAGCAGCGCGCATG SEQ ID NO: 3
  • a cleavage site for the TEV protease (ENLYFQG; SEQ ID NO:4) and a poly- histidine tag (H6 encoded by (CATCAQs; SEQ ID NO: 5) were inserted during amplification of 3g and SIIIA at various positions, resulting in three different construct (named construct 1-3),
  • construct 2 and construct 3 were designed accordingly (see Table 2 for primer sequences).
  • the flgM gene was amplified from genomic DNA ( ⁇ 2788) using forward primers l_HSl__ gA _fw and reverse primers
  • the PCR products of FlgM and SIIIA were purified and used in a subsequent fusion PCR as a template together with forward primers 1 J3Sl_ /g _fw and reverse primers l_HS4_SHlA_rv.
  • This method allows the fusion of two PCR products that share a homology of (in case of construct 1) 28 base pairs, resulting in one 3ong_ 3 ⁇ 4Af-SIOA fusion construct.
  • Table 2 Primer sequences for toxin construction.
  • AAAGGCAGCTCTCACCACCACC (SEQ ID NO: 10)
  • AITAACGGITACCTGCACAAG (SEQ ID NO: l l )
  • Vcl .i homology fw GCGATCCGCGTTG (SEQ ID NO:33)
  • AGTTCTTCTTCACC (SEQ ID NO:46)
  • SIIIA The expression of SIIIA in Salmonella resulted in a recombinant peptide that was lacking posttranslational modifications that are usually present under physiological conditions. Those include a neutral N-terminal pyroglutamate, C-terminal amidation and cleavage of a two-residue fragment -named SIIIApre. However, according to functional studies on the related ⁇ -conotoxin GHIA, the potency of SIIIA is determined by the lysine at position 1 1 and therefore not affected by any N- and C-terminal sequence variations.
  • Fragment A of the diphtheria toxin was amplified from plasmid pTH794 with primers ⁇ -FigMJw
  • DTA amplification included a poly-hisiidine-tag ( ⁇ ) with a GSS-linker before the His ⁇ tag and a SSGLVPR- inker between the His-tag and the first amino acid of DTA.
  • DTA was chromosomally inserted by ⁇ - ed-mediated recombination. The insertion was carried out in a AaraBAD.-.Flg&f background, DTA was targeted in front of the flgM stop codon resulting in a
  • a gravity-flow column Bio-Rad
  • 3 g Ni-IDA resin Protino Ni-IDA. Machery-Nagel
  • affinity tagged proteins were eluted under native conditions at pH 7.5 with a buffer containing 250 mM imidazole.
  • the supernatant samples were resuspended in 2x SDS sample buffer (100 mM Tris pH 6.8, 4% SDS, 10% glycerol, 2% ⁇ -mercaptoethanol, 25 mM EDTA, 0.04% bromophenol blue) and adjusted to 20 ODeoo units per ⁇ .
  • 2x SDS sample buffer 100 mM Tris pH 6.8, 4% SDS, 10% glycerol, 2% ⁇ -mercaptoethanol, 25 mM EDTA, 0.04% bromophenol blue
  • the cellular, pellet fraction was suspended in 2x SDS sample buffer, whose volume was adjusted to yield 20 ODsoo units per ⁇ .
  • SIIIA was cleaved off flagellar secretion substrates using AcTEV Protease (Invitrogen). 450 U of TEV protease was added to 15 mi of the elution fraction, which corresponds to the secreted proteins from a 750 ml culture. Cleavage was performed overnight at room temperature in elution buffer containing 1 mM dithiothreiiol (DTT) and 0.5 mM EDTA.
  • DTT dithiothreiiol
  • Recombinant SliiA was folded in 0.1 M Tris buffer, pH 7.5 using 1 mM oxidized glutathione (GSSG) and 0.1 mM EDTA. The folding reaction was allowed to proceed overnight at room temperature and was quenched by the addition of formic acid to a final concentration of 8%.
  • Cis Solid phase extraction columns (Supelclean LC-18, Supelco) were used to remove the oxidized peptide from the other components of the folding and cleavage reactions.
  • the isolated peptide was then dried and purified by HPLC on a Waters 600 ehromatograph, equipped with a dual-wavelength absorbance detector and a Vydac C ⁇ % analytical column.
  • the HPLC separation was run with a linear gradient from 4.5% to 33.5% (ag) acetonitriie (0.9% change per minute), maintaining 0.1% TFA throughout. This allowed purification of the correct folding product; mass was validated by matrix- assisted laser desorption ionization time-of-fiight (MALDI-TOF) mass spectrometry.
  • MALDI-TOF matrix- assisted laser desorption ionization time-of-fiight
  • oocytes expressing Nayl .2 were placed in a 30 ⁇ recording chamber perfused with ND96 and two-electrode voltage clamped. A holding potential of -80 mV was used, and activation of sodium channels was achieved by stepping the potential to -10 mV for 50 ms every 20 seconds. Exposure to toxin was performed in a static bath to conserve peptide, as follows. Prior to toxin application, the perfusion of the bath was halted, and control responses were recorded.
  • Peptide (3 id at 10-times the final concentration) was then applied to the bath, which was stirred for 5 seconds using a micropipette. Recordings of the onset of block by the peptide were obtained for about 20-min, after which the perfusion with ND96 was resumed to remove unbound peptide while the rate of recovery from block was monitored for about 20 minutes, The time course of the onset of block was fit to a single- exponential function to obtain the observed rate constant of block, k 0 S . The rate of recovery' from block during peptide washout was too slow to measure by curve fitting, so kofr was estimated from the level of recovery after 20 min of washing and assuming exponential decay of block. All recordings were obtained at room temperature.
  • Conotoxins are synthesized in the venom duct of marine cone snails and target ion channels, including voltage-gated sodium channels (V ' GSCs).
  • SIIIA is a ⁇ - eonotoxin from Conus strialus that inhibits tetrodotoxin (TTX)-resistant VGSCs in frog and TTX-sensitive VGSCs in rodents.
  • TTX tetrodotoxin
  • SOLA binds to site 1 of the a- subunit of VGSCs and thereby occludes the channel pore and blocks sodium
  • SiiiA Under physiological conditions two forms of SiiiA exist: a precursor form and a mature peptide, which has been modified by processing the C-terminai glycine- arginine residues to an amino group and changing the N-terminal glutamine residue to pyroglutamate.
  • two forms of SIIIA were recombinantly expressed, the precursor peptide and a peptide that most closely resembles the physiological mature form ( - terminal giutamate instead of pyroglutamate).
  • ⁇ -SIIIA effectively blocks neuronal sodium channels such as Na v 1.2 and 1.6, and the skeletal muscle subtype Na v 1.4.
  • SIIIA targets VGSCs and has potent analgesic activity in mice, it can be used for medical research and drug discover)'.
  • the fundamental advantage in developing a T3SS bacterial expression system is that after translation the polypeptides translocate through a narrow secretion channel in the flagellar structure and thereby bypass the problem of aggregation in inclusion bodies. Polypeptide secretion prevents intermoiecular aggregation in the cytoplasm, intramolecular disulfide bonds form as the polypeptide chain exits the reductive environment of the bacterial cytoplasm and enters an oxidizing extracellular environment.
  • SIIIA pretoxin ( ⁇ -SIIlApre” in Table 3 and henceforth referred to as "rSHIA") is a small 22 amino acid peptide which was fused to FlgM with an N-terminai TEV cleavage site in front of SIIIA.
  • FlgM three different constructs were designed with a poiy-h stidine tag at different positions. All constructs were chromosoma!iy expressed from the arabinose-inducible promoter O TO BAD- Figure I B shows the secretion profile of all three constructs.
  • Construct 3 F/g -H6-TEV-SIIIA
  • construct 2 /gi -TEV-SII!A-H6
  • the flagellum-specific transcription factor ⁇ 28 acts as a chaperone to facilitate FlgM secretion.
  • ⁇ 28 H41D also increases FlgM stability. This is the cause of the increased levels of FlgMSUlA in the JliA* background ( Figure 1C, lanes 2 and 3).
  • the effect of removing the late flagellar secretion substrates (and potential secretion competitors) FliC and FHD (AfliCD) was also tested.
  • the fliC and fliD genes are divergently transcribed.
  • the fliD gene is in an operon withj3 ⁇ 4T, which encodes the FliT inhibitor of all flagellar gene expression.
  • the AfliCD deletion results in removal of secretion competitors for FlgM in addition to increasing the number of flagellar basal structures.
  • the net effect was increased production and secretion of both FlgM and FlgM-SlllA from the cell ( Figure 1C, lanes 2 and 4),
  • F/gA -H6-TEV-SIIIA showed the highest level of secretion, this construct was used for further purification experiments.
  • the SIIIA fusion was expressed from an arabinose inducible promoter to allow synchronization of the high level of expression with completion of the flagellar secretion systems.
  • Secreted F/g -H6-TEV-SIIIA was separated from the bacterial cell culture by centrifugation and was obtained from the supernatant under native conditions by nickel-affinity chromatography.
  • Figure 2A F/g -H6-TEV-SIIIA efficiently bound to the Ni-IDA resins and was eluted with imidazole-contatning eiution buffer. After concentration of the eluted fraction, rSIIIA was cleaved from the F/g -H6-TEV secretion signal using TEV protease.
  • the formation of the native disulfide bonds is a process involved in generating biologically active SIIIA.
  • the optimal buffer conditions of the TEV protease can be 1 mM dithiothreitol (DTT),
  • DTT dithiothreitol
  • This redox agent provides reducing power for the TE V protease but at the same time can reduce S-S bonds in the peptide of interest.
  • rSIIIA was refolded prior to electrophysiological analysis. Refolding was carried out in a redox buffer of oxidized and reduced glutathione, allowing thiol-disulfide exchange reactions under conditions that are known to favor formation of the native disulfide bonds.
  • a non-motile poly- hook mutant was constructed that had the following characteristics: It lacked the flagellum-reiated SPI-1 (AprgH-hilA,) virulence system, as well as all class 3 flagellar genes (AflgKL, AfljB-T, AF!gMN, Aaer-mcpC, VmotA. motA-cheZ, AtncpA, A cpB, Aisr) that could diminish or interfere with flagellar type III secretion of the toxin fusion of interest.
  • the strain harbored a mutation in XhsflhD promoter (P*flhD) and was deleted for negative regulators of the flagellar master regulator FlhD4C2 ( ⁇ , AydiV, AecnR).
  • LrhA acts as a negative regulator of flhDC transcription by directly binding to the promoter region of the master regulator.
  • a major advantage of this system is the workflow. After induction with arabinose, the bacterial cells express recombinant polypeptides and subsequently secrete the toxin into the media. Contrary to the purification of neuropeptide by traditional methods, this makes it unnecessary to lyse cells in order to purify toxins. Instead, recombinant SOLA was selectively secreted via the flagellar T3SS and it accumulated in the culture supernatant. After several hours of production, ceils were removed by simple centrifugation and filtration. Other aspects of this system are type Hi secretion chaperones thai facilitate secretion or increase the stability of the secretion substrates.
  • Type ⁇ secretion substrates are usually secreted in an unfolded or partially folded state, which is often achieved by interaction of the chaperones with the secondary structure of the secreted protein. Since SIIIA was fused to FigM, a type 10 secretion substrate, it was protected from premature folding by interaction with FUA ( ⁇ 28 ), the cognate type III secretion chaperone of FigM. For the disclosed recombinant expression, full-length FigM was used, which increased secretion efficiency due to the presence of its FUA chaperone binding site,
  • the disclosed system provides an easy-to-use method for complicated toxin purification - a task that goes beyond yield and solubility of peptides, but also allows the peptides and proteins to be accessible in a correctly folded and active state.
  • flagellar secretion system of Salmonella enterica serovar Typhimurium (Salmonella typhimurium) that has been shown to export non-flagellar proteins if fused to flagellar secretion signals, e.g. hook protein FlgE or flagellin FliC.
  • the flagellar secretion system is a member of a family of bacterial type III secretion systems that selectively secrete proteins from the cytoplasm to the external medium.
  • the bacterial flageilum is composed of an external helical filament, extending many body lengths from the cell surface, attached to a rotary motor embedded within the cell wall and membranes.
  • a chemosensory system controls the clockwise and counterclockwise direction of flagellar rotation, which allows the bacterium to migrate towards attractants, such as nutrients, or away from repellents that are harmful to the bacterium,
  • flagellar secretion substrate secretion is primarily determined by an N-terminai peptide secretion signal that has a disordered structure. Many secretion substrates also require a specific secretion chaperone to facilitate secretion,
  • One flagellar secretion substrate, FlgM is a regulatory protein that couples flagellar assembly to gene expression, ⁇ 23 , a transcription factor specific for flagellar promoters, directs transcription of genes specifically needed after completion of the flagellar motor and thereby induces expression of the filament and chemosensory genes.
  • FlgM binds ⁇ 28 and prevents its association with RNA polymerase.
  • flagellar FlgM protein was utilized as a vector for the secretion of the small, highly stable pharmacologically-active polypeptides that contain a high density of cysteine residues, which form disulfide crosslinks in the mature product,
  • a bacterial secretion system was created for the recombinant expression of ⁇ -conotoxin SIIIA in Salmonella typhimurium.
  • T3S flagellar type ill secretion
  • All strains used in this study are derivatives of LT2, a wild-type strain Salmonella enlerica serovar Typhimurium, and are listed in Table 4. Ail strains were constructed during the course of this study. Strain construction utilized either P22- rnediated generalized transduction or ⁇ Red-mediated targeted mutagenesis. For strains with the flhDC operon expressed from its native promoter, flagellar gene expression was induced by 100-fold dilution from overnight stationary cultures into fresh LB medium ( 10 g Bacto tryptone, 5 g Bacto Yeast Extract and 5 g NaCl per liter).
  • flagellar gene expression was induced by addition of the tetracycline analog anhydro-tetracycline (1 ⁇ / ⁇ 1).
  • arabinose utilization operon araBAD was replaced with the FlgAf gene or FlgM gene fusions FlgM-6His- TEV-&SVIE or FlgM-6His-ETK-&SVIE (AaraBADv.FlgAf , AaraBAD: :F!gM-6His-TEV- ⁇ -SYTE or AaraBA D: :FlgM-6Hi-ETK- ⁇ -SVIEI, respectively).
  • .Arabinose was added to 0.2% final concentration two hours after the induction of the flhDC operon. After another 5 hours, the cultures were eentnfuged at 10,000 g for 30 min to pellet the cells. The supernatant was filtered with 0.2 ⁇ low protein binding filter (Acrodisk Syringe Filter, PALL Life Sciences) to remove remaining cells. Secreted proteins in the filtered supernatant were precipitated by addition of TCA (trichloroacetic acid) to 10% final concentration. The cell pellet was re-suspended in cold PBS
  • LB medium was prepared without NaCl and either NaCl or KCI were added to the desired concentrations.
  • TH18636 AoraBAD 1156 :FlgAf fliA 8088(H 14D, R91C, L207P)
  • AaraBADI 156 :Flght ArcsB::tetRA TH 18830
  • AaraBADI 156 FlgAf AflgN5626: :FKF A/HST5775: :FCF ⁇ 19106
  • AaraBADI 156 :FlgAf AfliS5728:; ⁇ RT
  • AaraBADI 164 :FlgM-6His-ETK ⁇ d ⁇ S ⁇ IE P//&DC7793 TH19120
  • Motility assays utilized soft agar tryptone plates (per liter: 1 Og Bacto tryptone, 5g NaCI, 3g Bacto agar), A bacteria! coiony was picked by toothpick and poked through the soft agar followed by incubation at 37°C for about 5 hours. If necessary either arabinose (0,2%) or anhydro-tetracycl ine (1 ⁇ ' ⁇ ! was added for
  • FlgM is secreted through a completed HBB into the external spent growth medium, it has been shown that fusion of foreign proteins to the C-terminus of FlgM cm be used for protein purification purposes without the need to lyse ceils prior to purification, Irs order to develop the flagellar T3S system for protein purification using FlgM as a secretion signal, the known aspects of FlgM production and secretion were characterized to maximize protein production using this system.
  • the FlgM gene is transcribed from a class 2 flagellar promoter in the flgA MY operon. This results in FlgM production during initial HBB assembly.
  • Class 2 produced FlgM binds ⁇ 2 * protein, the product of the fliA gene, which is also produced via class 2 transcription in one of two fliAZ transcripts.
  • a change in the secretion substrate specificity of the flagellar T3S system results in FlgM secretion and initiation of a 28 ⁇ dependent class 3 transcription.
  • FlgM and a iS continue to be produced from ⁇ -dependent FlgMN and fliAZ transcripts, respectively.
  • About 80% of steady-state FlgM transcription is from its class 3 promoter. Since FlgM is an anti- ⁇ 28 factor, its production via the class 3 promoter is under auto-inhibiiion.
  • FlgM gene transcription was removed from FlgM auto-inhibition by using a construct with the FlgM gene transcribed from the arabinose-inducible chromosomal araBAD promoter ( ⁇ ⁇ ⁇ ) ⁇ This was accomplished by a targeted deletion of the chromosomal araBAD operon followed by insertion of the FlgAf gene in its place. This resulted in the arabinose-dependent induction of FlgM production in strains where the arabinose inducer is not degraded due to deletion of the araBAD structural genes.
  • FlgM transcribed from VaraSAD was produced in the presence of arabinose and secreted at levels higher than FlgM produced and secreted from its native promoters ( Figure 4).
  • the flhDC operon is at the top of the flagellar transcriptional hierarchy.
  • the regulation of flhDC is complex and there are six known transcription initiation sites within the flhDC promoter region. Changes in the -10 sequences for the PI and P4 transcription initiation sites within the flhDC promoter region to the canonical TATAAT sequence (the ⁇ 7793 allele) resulted in the doubling of the number of HBB structures per cell and increased production and secretion of the flagellar hook protein. Other mutations resulting in increased hook protein secretion and increased HBB structures per cell resulted in reduced expression or removal of known inhibitors of flhDC operon transcriptional or post-transcriptional control.
  • flhDC regulators' mutations The effects of flhDC regulators' mutations on the secretion of FlgM transcribed from ParaSAD were tested.
  • the known transcriptional and post-transcriptional inhibitors of ' flhDC expression included in this example were EcnR, RscB, LrhA, FliT, DskA and YdiV.
  • EcnR is responsible for FlhDC-mediated auto-repression
  • the FlhD4C2 complex directs transcription of ecriR, which in turn results in repression of flhDC transcription in concert with the RcsB protein, RcsB, which regulates capsular pol sacharride synthesis and a number of genes in response to membrane and cell wail damage, is a repressor of flhDC transcription.
  • LrhA is also a regulator of flhDC that has been shown to bind within the flhDC promoter region to inhibit flhDC operon transcription.
  • FliT is transcribed from both class 2 and class 3 flagellar promoters.
  • FliT binds to the FlhD4C2 complex and prevents activation of flagellar class 2 transcription.
  • FliT is also the secretion chaperone for the flagellar filament capping protein FliD.
  • Secretion of FliD after HBB completion couples inhibition of further class 2 transcription by FlhD4C2 to HBB completion.
  • the DskA protein acts with ppGpp to inhibit flhOC's transcription.
  • DskA can also stimulate rpeS translation, which can inhibit flhDC transcription through an RpoS-mediated mechanism
  • YdiV is a post-transcriptional regulator that targets FlhD4C2 to the ClpXP protease for degradation in response to changes in nutrient growth conditions.
  • CsrA which is a positive regulator of flhDC mRNA stability'
  • the P j uc8089 allele was constructed by replacing the flhDC promoter control region with a tetR ⁇ ? ietA cassette from transposon Tn/0. This resulted in the placement of the flhDC operon under control of the ielA promoter, which can be induced by the addition of the tetracycline analog anhy dro-te tracyc line.
  • FlgM accumulated in the cytoplasm. Mutations defective in known transcriptional and post-iranscriptionai inhibitors of flhDC expression resulted in increased levels of secreted FlgM&s did the presence of PfihOc7793 promoter- ⁇ allele. Secreted levels of
  • FlgM in PflKDc7793, P ⁇ h nc80899 ⁇ tetR-P felA -flhDQ,fliT, rcsB and ecnR mutant strains were 4.5-, 4.5-, 3.8-, 4.7- and 4- fold higher than that of wild type, respectively.
  • Secreted levels of FlgM were less m diV, IrhA and dskA mutants strains at 2-, 1.5- and 2.7-foid compared to wild type, respectively ( Figure 5B), For each strain tested, the accumulated cellular levels of FlgM were inversely proportional to secreted FlgM levels.
  • FlgM is a soluble protein
  • Figure 5 A indicating that excess cellular FlgM went into inclusion bodies and the observed motility under FlgM inducing conditions indicated that the insoluble form of FlgM was not active.
  • the late secretion substrates include hook-filament junction proteins (Flg and FIgL), filament cap protein (FliD), the alternately expressed filament proteins (FliC or FijB) and the anti-o" factor FlgM.
  • Flg and FIgL hook-filament junction proteins
  • FliD filament cap protein
  • FliC or FijB alternately expressed filament proteins
  • FlgM anti-o" factor
  • Efficient secretion of each Sate secretion substrates requires the aid of a cognate T3S chaperone. These include FlgN (for FlgK and FigL), FLIT (for FliD), FUS (for FliC and FijB) and ⁇ 28 (for FlgM).
  • T3S chaperones fall into three classes: i) those that bind and protect substrates from proteolysis in the system prior to secretion, ii) those that facilitate substrate secretion and iii) those that both stabilize and facilitate secretion.
  • the a 2S protein falls into the latter category; it protects FlgM from proteolysis in the cytoplasm and facilities the secretion of FlgM presumably by helping to localize FlgM to the base of the flagellum.
  • a mutant of ⁇ 28 with two amino acid substitutions that render it defective in recognition of the - 10 and -35 promoter sequences retains its T3S chaperone activity for FlgM secretion. This indicated that the T3S chaperone function of ⁇ 28 was a separate process from its transcription activity.
  • the ⁇ 28 protein contains 3 of the 4 regions conserved in all a 70 ⁇ type housekeeping sigma factors: regions 2, 3 and 4, which are further divided into sub- regions 2.1 , 2.2, 2,3, 2.4, 3.1, 3.2, 4.1 and 4.2. Region 2.1, 3.1, 3.2 and 4.1 are involved in binding to the core RNA polymerase while regions 2.4 and 4.2 are required for recognition of the - 10 and -35 regions of promoter sequences, respectively.
  • FlgM was shown to interact with all three regions of a s in a FlgM:a 2?
  • the V33E and L199R allele resulted in FlgM secretion level that was 32% and 59% of wild type, respectively.
  • the H14D and H14N alleles exhibited secreted FlgM levels that were 2.1 and 1.5-fold of that seen for wild type.
  • the T138I and E203D alleles, that are defective in binding FlgM resulted in increased secreted FlgM levels 1.2 and 1.4-fold of wild type, respectively.
  • the promoter binding-defective double mutant of fliA (R9I C L207P) was also tested and compared to wild-type showed a 39% level of secreted FlgM,
  • the promoter binding-defective R 1C L207P was also tested and compared to wild-type showed a 39% level of secreted FlgM.
  • FliA level in the cell was consistent with the FlgM secreted level (Figure 6A).
  • the FlgM secreted level was related to FliA concentration within the cell. Therefore, other mutants were introduced, which would potentially increase the intracellular FliA concentration, to see whether they could affect FlgM secretion.
  • These mutants included a fliA start codon change from GTG to ATG that was combined with either H14N stabilization substitution or with a change of the fliA ribosome binding sequence (RBS) to a canonical sequence
  • FlgM levels from 2- to 4-fold that of wild type ( Figure 6A and 6B).
  • Deletion of the chromosomal FlgM gene in the fliA CRBS ATG double mutant, background resulted in a reduction of both of intracellular FliA and secreted FlgM.
  • the excess a produced in the fliA CRBS ATG double mutant background can involve chromosomal FlgM expression in addition to P ⁇ o-ex essed FlgM to contribute to ⁇ 28 stability, which improves FlgM secretion. This is consistent with the results showing that FlgM not only acts as a anti-sigma factor but also protects FliA from being degraded.
  • V33E, T1381, L199R and E203D are reported to have flagellar transcriptional activities in the presence of FlgM that are 8.0, 1, 45 and 7-fold higher than wild-type, respectively and their motility phenotypes on swim plates under FlgM inducing conditions correlate with these levels.
  • the H14N ATG and CRBS ATG double mutants showed decreased motility on swim plates, although they have higher cellular levels of ⁇ 7 28 than the wild type strain,
  • Salmonella ertierica alternately expresses one of two fiagellin subunit genes, fliC or fljB. Strains carrying the hin-5717 allele are locked in the FliC 0N
  • the fljB*"* vh2 is a historical relic that is also FliC 0N FljB 0FF , and resulted from replacement the hin-fljBA region from S. enterica strain LT2 with the same region from
  • FlgM levels by 1.9-fold and the additional removal of the fliC gene in this background further increased the secreted FlgM level 2.7-fold that of wild type even though FliC fiagellin is not produced in the hin-5718 background.
  • /J/C mRNA is produced, but not translated, in the hin-5718 background, showing that fliC mRNA has a negative effect on FlgM protein secretion.
  • Secreted levels of FlgM in the fljB enx vh2 background were 2.9-fold higher than in the wild type strain and further removal of the fliC gene in this background increased secreted FlgM levels to 4.3-fold of wild type.
  • the flhDC operon is the master operon of both the flagellar regulon and the genes of Spi 1.
  • the Spi 1 regulon encodes genes needed for the structure and assembly of the Spil injectisome T3S system.
  • the fliZ gene is transcribed in the flhiZ operon and FliZ activates transcription of hilD, whose product in turn activates Spi l transcription.
  • One HilD activated gene product, RtsB acts to repress flhDC transcription providing a feedback loop for the entire flage!lar-Spil regulon.
  • a common technique used to improve protein yield from the cytoplasm is by removing cellular proteases, in addition, proteases present in the outer membrane, such as OmpT can decrease protein yield by degradation after cell lysis.
  • the ClpA and ClpX proteins interact with different substrates for delivery to the ClpP serine protease for degradation.
  • DegP is a periplasms protease that exhibits broad substrate specificity. DegP is exclusively directed against unfolded, mis-localized, hybrid and recombinant proteins that are improperly folded from over-expression in the periplasm.
  • the NaCl concentration in LB medium is not optimal for FlgM secretion.
  • KG had a similar effect on secreted FlgM levels, 200 and 400 mM KCi produced the highest levels of secreted FlgM at 3,2- and 3.6- fold compared to the secreted FlgM level at 100 mM NaCl. This is due to effects on the solubility of FlgM in the cytoplasm. Increased ionic strength also had a positive effect on motility in soft agar although this was suppressed under FlgM induction conditions due to inhibition of ⁇ 2 *- dependent flagellar class 3 transcription (Figure .1 1C).
  • the ⁇ -SViE protein is a small peptide produced by a venomous marine cone snail and inhibits sodium channels in vertebrate neuromuscular systems.
  • This 31 amino acid peptide (DGCSSGGTFCGIHPGLCCSEFCFLWCITFID) is hydrophobic and contains 6 cysteine residues that form 3 pairs of intramolecular disulfide bonds.
  • the hydrophobic nature of the peptide and requirement for multiple disulfide bond formation to produce an active conformation of ⁇ -SVIE are an impediment to proper folding when this peptide is overexpressed in E. coli. Thus, production of ⁇ -SVIE in an active form via i3 ⁇ 4A/-mediated secretion was tested.
  • the ⁇ -SVIE sequence of the FlgM-8-SVlE fusion would exit the cell as it exits the ribosome: from N-terminus to C-terminus. This can facilitate proper folding and disulfide formation of ⁇ -SVIE into an active conformation.
  • C-terminal fusions of ⁇ -SVIE to hexa-His-tagged (6His) FlgM with either TEV or ETK protease cleavage sites engineered between the two proteins were expressed from the
  • the 6His facilitates purification using a Nt- agarose affinity column and the TEV and ETK cleavage sites are recognized by TEV protease and enterokinase, respectively, allowing the secreted ⁇ -SVIE to be separated from its FlgM secretion signal.
  • AH of the selected single mutants increased 7gA -6H-TEV ⁇ o-SVIE secretion (see Figure 13A and 1.3B).
  • the secreted levels of P ara &4_rexpressed fusion protein levels were enhanced in mutant backgrounds that produced enhanced secreted FlgM levels.
  • T3S type 01 secretion
  • T3S type 01 secretion
  • Many, but not all T3S substrates can utilize cognate T3S chaperones for their stability in the cytoplasm and'Or as secretion pilots for targeting the T3S substrate to the secretion apparatus in the cytoplasmic membrane.
  • Another feature of T3S systems is the ability to undergo a secretion-specificity switch from early to late secretion substrate specificity.
  • the FlgM protein is an integral part of the transition from hook completion to filament assembly.
  • FlgM is a late, filament-type flagellar secretion substrate and an anti- ⁇ 28 factor.
  • FlgM is a small, 97 amino acid protein.
  • the N-terminal half of FlgM includes the T3S signal while the C- terminal half includes the anti-cT 8 interaction domain, it has been shown that fusion of recombinant proteins to the C-terminus of FlgM would allow for their secretion and purification without a requirement to lyse cells prior to purification.
  • FlgM and /g ⁇ 5-SVIE fusion constructs were over-expressed from the chromosomal promoter by replacing the araBAD coding region with the FlgM or FlgM-b-SViE fusion coding regions. By removing araBAD it was ensured that arablnose inducer would not be consumed as a carbon source. This inducing system proved sufficient to produce FlgM in quantities In excess of what the cell could secrete ( Figure 5). The cells were then manipulated by introducing mutations that increase FlgM stability and secretion in order to increase production of secreted FlgM.
  • the ⁇ ⁇ ⁇ 8089 allele is a replacement of the flhDC promoter region with an inducible tetA promoter region, which removes the site of action of all known negative regulators of flhDC transcription.
  • the ? j i h oc8089 allele also places flhDC transcription under induction by tetracycline and its analogs. Without the inducer, the cells were not motile on swimming plate, indicating that flhDC was not transcribed.
  • FlgM was not secreted in the csrA null mutant strain, as CsrA can stabilize flhDC mRNA.
  • FlgMT3S chaperone ⁇ " 8 encoded by the fliA gene were explored. These included FlgM bypass alleles offliA that allow class 3 transcription in the presence of FlgM, the promoter binding-defective double-mutant R91C L207P, the ATG start codon mutant (from GTG), and a canonical ribosome binding sequence mutant (labeled CRBS).
  • the FlgM bypass alleles HMD, H14N, V33E, T138I, L199R and E203D all have similar affinities for RNAP with a measured K d for core RNAP of 2.0, 1.9, 0.7, 0.8, 1.2 and 1.4 s M, respectively compared to 0.9 for wild- type ⁇ 28 .
  • the relative affinities for FlgM of the H14D and H14N are the same as wild- type, while the V33E, T138L L199R and E203D alleles have 10-, 20-, 600- and 10-fold reduced affinities, respectively.
  • the V33E allele showed the lowest levels of secreted FigM while L199R had about half the secreted level of FigM as wild-type.
  • V33E ⁇ 28 allele shows that it is a limiting ⁇ 28 that is responsible for the reduced secreted FigM levels observed.
  • the reduced affinity of TI38I and V203E for FigM is not a limiting factor under FigM over-expressing conditions (from ⁇ ⁇ ⁇ ) ⁇
  • the R91C L207P promoter binding-defective double-mutation resulted in reduced ⁇ 28 cellular levels that corresponded to a reduced level of secreted FigM while the H14D and H14N alleles had the opposite effect.
  • the H14D and H14N alleles resulted in elevated cellular ⁇ " ⁇ levels and corresponded to increased levels of secreted FigM.
  • Another combined strain _ JM)7793 IrhA ecnRfli - TydiV hin-fljA flgKL FlgMN increased the secretion of F/g -6H-ETK-5-SViE over 100- fold compare to wild type strain.
  • the addition of 100 mM NaCl to LB medium can increase the secretion of /3 ⁇ 4Af-6H-ETK-8-SVIE in //M 7793 strain, ./7AD7793 FlgM strain, and/7£D7793 FlgMclpX strain.
  • Example 3 Large-Scale, Type ⁇ -DepeBdent Protein Production via Direct Secretion iato the Growth Medium.
  • FlgM as a secretion signal to facilitate secretion of previously difficult to produce proteins, such as conopeptides with numerous disulfide bonds and the A subunit of diphtheria toxin, which is not detectable in the cytoplasm due to its instabiiitv', demonstrates the utility of this system for protein production and purification of proteins that otherwise are not produced.
  • tetRA element can be the tetR and tetA genes from transposon ⁇ that code for a tetracycline efflux pump (TetA), which confers resistance to tetracycline, and the TetR repressor. This can be
  • One ologo has 40 bases of homology to the 5' side of the beginning of the araB gene followed by 18 bases that can amplify from the 5" -tetR end of tetRA.
  • the second has 40 bases of homology to the 3' side of the end of the araD gene followed by 18 bases that can amplify from the V-tetA end of tetRA.
  • PGR amplification of tetRA -containing DNA produces the tetKi element flanked by 40 bases of homology to the target.
  • RED results in recombination using the 40 bases of flanking homology resulting in deletion of the araBAD genes that are replaced by tetRA (AaraBADv.tetRA where ⁇ is genetic nomenclature for deletion and :: is genetic nomenclature for insertion).
  • tetRA AaraBADv.tetRA where ⁇ is genetic nomenclature for deletion and :: is genetic nomenclature for insertion.
  • the advantage of the tetRA element is that it can be selected for and against.
  • the presence of the tetRA element in the chromosome confers tetracycline resistance, but also confers sensitivity of fusaric acid.
  • FlgM coding sequence is PCR amplified with the same 40 bases of homology 5' to araB and 3' to araD in the presence of lambda
  • FlgM* gene is now transcribed from the arabinose-inducible araBAD promoter.
  • teiRA is placed downstream of FlgM * at araBAD resulting in
  • FlgM-X fusion that is expressed by addition of arabinose to the growth medium.
  • any fusion of any protein to FlgM under arabinose induction can be constructed with intervening protease cleavage sequences to facilitate final purification of a protein of interest.
  • Optimum secretion strains can be identified.
  • the AnTc-inducibie/7 )C operon (the flhD8089 allele) is of note because it is deleted for the binding sites of all known inhibitor proteins and dependent only on AnTc for expression.
  • the fihD8089 allele can be combined with the JlL4(? 2S ) H14N allele of the secretion chaperone of FlgM, which showed to greatest positive effect on FlgM secretion (Figure 6A). Further combination with a clpX protease mutant allele can increase secretion ( Figure 10A).
  • the ⁇ 28 protein is the product of the fliA gene and the type HI secretion chaperone for FlgM. Increased ⁇ 28 levels result in increased levels of secreted FlgM- fused protein substrate (Fig 6A).
  • the ⁇ 28 protein can also be used for a protein purification system.
  • the apparent Kj oi the FlgM-a ⁇ complex is 2xlO ' ' M. This remarkably high affinity means that purification of FlgM cm result in co-purification of ⁇ 2? and vice versa, FlgM fused to a chitin-binding domain (CBD) sandwiched by an intein self-cleavage site has been constructed.
  • CBD chitin-binding domain
  • Proteins that must remain in oxidative conditions to maintain an active conformation can have a protease cleavage sequence, such as enterokinase, which cleaves under oxidative conditions, in place of the intein.
  • a protease cleavage sequence such as enterokinase
  • the disclosed system and methods can also be developed into E. coli to obtain the protein secretion and production with the E. coli flagellar T3S system that was achieved in Salmonella.
  • This can be expanded to include other strains such as thermo- tolerant strains. Proteins from thermo tolerant strains are often used in crystallographic and NMR studies because of increased protein stabilities at high temperatures that facilitate structural analysis.
  • a SPI1 injectisome T3S system for protein production can be developed.
  • the SipA, SipB and SipC proteins are secreted at high levels by the SPI 1 injectisome T3S system ( Figure 14). These proteins can be tested to determine if they can be used to facilitate protein secretion in fusion constructs and develop a protein production system similar to the flagellar system.
  • Spil production is under the control of HilD and it has been determined that controlled expressio oihilD * from the arabinose-inducible Va aBAD promoter results in high levels of Spil mRNA production.
  • E. coli has essentially the identical flagellar T3S as Salmonella, making it straightforward to reconstruct the optimal secretion strain in E. coli.
  • E. coli Sacks the SPI1 system and thus the entire SP11 set of genes can be inserted into the E. coli chromosome.
  • the SPI1 genes are organized into a single "pathogenicity island" which can be amplified and inserted into the E. coli chromosome using the lambda RED technology.
  • the export apparatus and needle complex genes can be used, while the hilA+ gene will be inserted into the araBAD locus to allow for arabinose induction of SPI 1.
  • the SPI1 system can also be used to develop a membrane-protein purification system. Such as system can revolutionize membrane protein production and characterization.
  • the SPI 1 system works by inserting into the cytoplasmic membrane of host cells through its transiocon tip (see Figure 16). Modifying injectisome needle-length can be done in order to develop a minimal functional needle that is as short as possible yet still allows for normal transiocon formation and insertion into the membrane of host ceils. Minimizing the needle length through which a membrane protei must traverse can be beneficial. This can be coupled to translocation of secretion of membrane proteins using the SPI1 system into artificial membrane vesicles. References
  • YdiV a dual function protein that targets FlhDC for ClpXP-dependent degradation by promoting release of DNA -bound FlhDC complex.
  • T-POP array identifies EcnR and Pefi-SrgD as novel regulators of flagellar gene expression. J Bacterioi. 35. Yao, S., M.-M. Zhang, D. Yoshikami, L. Azam, B. M. G!ivera, G, Bulaj, and R. S. Norton. 2008. Structure, dynamics, and selectivity of the sodium channel blocker mu- conotoxin S111A. Biochemistry 47: 10940-10949.
  • the f!agellar-specifie transcription factor, sigma28 is the Type III secretion chaperone for the flageliar-specific anti-sigma28 factor FlgM, Genes Dev. 20:2315-2326.
  • H2 phase-2 flagellin
  • EAL domain protein YdiV acts as an ti-.FlhD4C2 factor responsible for nutritional control of the flagellar regulon in Salmonella enterica Serovar
  • T-POP array identifies EenR and PefT-SrgD as novel regulators of flagellar gene expression. J. Bacteriol. 191 : 1498- 1508.
  • FHT acts as an anti-FlhD2C2 factor in the transcriptional control of the flagellar regulon in Salmonella enterica serovar Typhimurium. J, Bacteriol. 188:6703-6708.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Insects & Arthropods (AREA)
  • Toxicology (AREA)
  • Microbiology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2013/043384 2012-05-30 2013-05-30 COMPOSITIONS AND METHODS FOR PEPTIDE EXPRESSION AND PURIFICATION USING A TYPE lll SECRETION SYSTEM Ceased WO2013181404A2 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
PL13798228T PL2855676T3 (pl) 2012-05-30 2013-05-30 Kompozycje i sposoby ekspresji i oczyszczania peptydów z wykorzystaniem systemu sekrecji typu iii
EP13798228.6A EP2855676B1 (en) 2012-05-30 2013-05-30 COMPOSITIONS AND METHODS FOR PEPTIDE EXPRESSION AND PURIFICATION USING A TYPE lll SECRETION SYSTEM
DK13798228.6T DK2855676T3 (da) 2012-05-30 2013-05-30 SAMMENSÆTNINGER OG FREMGANGSMÅDER TIL PEPTIDEKSPRESSION OG -OPRENSNING UNDER ANVENDELSE AF ET TYPE lll-SEKRETIONSSYSTEM
US14/404,919 US9630997B2 (en) 2012-05-30 2013-05-30 Compositions and methods for peptide expression and purification using a type III secretion system
HK15109866.5A HK1209158B (en) 2012-05-30 2013-05-30 COMPOSITIONS AND METHODS FOR PEPTIDE EXPRESSION AND PURIFICATION USING A TYPE lll SECRETION SYSTEM
ES13798228T ES2861275T3 (es) 2012-05-30 2013-05-30 Composiciones y métodos para la expresión y la purificación de péptidos usando un sistema de secreción de tipo III
JP2015515191A JP6496243B2 (ja) 2012-05-30 2013-05-30 Iii型分泌系を使用したペプチド発現および精製のための組成物および方法
US15/459,191 US10800818B2 (en) 2012-05-30 2017-03-15 Compositions and methods for peptide expression and purification using a type III secretion system

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261689284P 2012-05-30 2012-05-30
US61/689,284 2012-05-30

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/404,919 A-371-Of-International US9630997B2 (en) 2012-05-30 2013-05-30 Compositions and methods for peptide expression and purification using a type III secretion system
US15/459,191 Continuation US10800818B2 (en) 2012-05-30 2017-03-15 Compositions and methods for peptide expression and purification using a type III secretion system

Publications (2)

Publication Number Publication Date
WO2013181404A2 true WO2013181404A2 (en) 2013-12-05
WO2013181404A3 WO2013181404A3 (en) 2015-06-04

Family

ID=49674058

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/043384 Ceased WO2013181404A2 (en) 2012-05-30 2013-05-30 COMPOSITIONS AND METHODS FOR PEPTIDE EXPRESSION AND PURIFICATION USING A TYPE lll SECRETION SYSTEM

Country Status (7)

Country Link
US (2) US9630997B2 (https=)
EP (1) EP2855676B1 (https=)
JP (1) JP6496243B2 (https=)
DK (1) DK2855676T3 (https=)
ES (1) ES2861275T3 (https=)
PL (1) PL2855676T3 (https=)
WO (1) WO2013181404A2 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180072715A (ko) * 2015-10-02 2018-06-29 유니버시티 오브 유타 리서치 파운데이션 조절가능한 리보솜 번역 속도를 위한 조성물 및 사용 방법

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2861275T3 (es) * 2012-05-30 2021-10-06 Univ Utah Res Found Composiciones y métodos para la expresión y la purificación de péptidos usando un sistema de secreción de tipo III
US10849938B2 (en) 2017-09-13 2020-12-01 ZBiotics Company Gene expression system for probiotic microorganisms
CN108837152B (zh) * 2018-05-23 2021-06-22 浙江大学 鞭毛主调控基因flhDC或其表达产物作为靶点在抗菌药物开发中的应用
JP7609793B2 (ja) * 2019-03-04 2025-01-07 ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー バイオコンジュゲーションのために操作されたcd47の細胞外ドメイン
KR20240013955A (ko) * 2022-07-21 2024-01-31 충남대학교산학협력단 멜리틴 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주
KR102933213B1 (ko) * 2022-07-21 2026-03-03 충남대학교산학협력단 코난토킨-g의 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주
KR20240015029A (ko) * 2022-07-25 2024-02-02 충남대학교산학협력단 카탈레이스 분비를 위한 재조합 발현 벡터 및 이로형질전환된 대장균 균주
KR20240015035A (ko) * 2022-07-25 2024-02-02 충남대학교산학협력단 클로로톡신의 분비를 위한 재조합 발현 벡터 및 이로형질전환된 약독화 살모넬라 균주

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7659102B2 (en) * 2001-02-21 2010-02-09 Verenium Corporation Amylases, nucleic acids encoding them and methods for making and using them
US20040033608A1 (en) * 2001-10-10 2004-02-19 Purdue Research Foundation Plasmids, strains, and methods of use
WO2003033536A2 (en) * 2001-10-19 2003-04-24 Paradigm Therapeutics Limited G-protein coupled receptor
US20120027786A1 (en) * 2010-02-23 2012-02-02 Massachusetts Institute Of Technology Genetically programmable pathogen sense and destroy
ES2861275T3 (es) * 2012-05-30 2021-10-06 Univ Utah Res Found Composiciones y métodos para la expresión y la purificación de péptidos usando un sistema de secreción de tipo III

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP2855676A4 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180072715A (ko) * 2015-10-02 2018-06-29 유니버시티 오브 유타 리서치 파운데이션 조절가능한 리보솜 번역 속도를 위한 조성물 및 사용 방법
US11293028B2 (en) 2015-10-02 2022-04-05 University Of Utah Research Foundation Compositions for adjustable ribosome translation speed and methods of use
KR102809778B1 (ko) * 2015-10-02 2025-05-19 유니버시티 오브 유타 리서치 파운데이션 조절가능한 리보솜 번역 속도를 위한 조성물 및 사용 방법

Also Published As

Publication number Publication date
JP6496243B2 (ja) 2019-04-03
JP2015523066A (ja) 2015-08-13
WO2013181404A3 (en) 2015-06-04
EP2855676A4 (en) 2016-04-06
US20150225466A1 (en) 2015-08-13
PL2855676T3 (pl) 2021-07-05
ES2861275T3 (es) 2021-10-06
HK1209158A1 (en) 2016-03-24
EP2855676B1 (en) 2021-01-13
EP2855676A2 (en) 2015-04-08
US20180009851A1 (en) 2018-01-11
US10800818B2 (en) 2020-10-13
US9630997B2 (en) 2017-04-25
DK2855676T3 (da) 2021-04-12

Similar Documents

Publication Publication Date Title
US10800818B2 (en) Compositions and methods for peptide expression and purification using a type III secretion system
Kusumoto et al. Regulation of polar flagellar number by the flhF and flhG genes in Vibrio alginolyticus
Calvio et al. Swarming differentiation and swimming motility in Bacillus subtilis are controlled by swrA, a newly identified dicistronic operon
Ray et al. A high‐molecular‐weight outer membrane protein of Xanthomonas oryzae pv. oryzae exhibits similarity to non‐fimbrial adhesins of animal pathogenic bacteria and is required for optimum virulence
Peltier et al. Cyclic diGMP regulates production of sortase substrates of Clostridium difficile and their surface exposure through ZmpI protease-mediated cleavage
Milner et al. Ras GTPase-like protein MglA, a controller of bacterial social-motility in Myxobacteria, has evolved to control bacterial predation by Bdellovibrio
JP2016501550A (ja) Crm197に関する方法及び組成物
WO2011126811A2 (en) High level expression of recombinant toxin proteins
Zhao et al. Activities of virE1 and the VirE1 secretion chaperone in export of the multifunctional VirE2 effector via an Agrobacterium type IV secretion pathway
Luna Rico et al. Functional reconstitution of the type IVa pilus assembly system from enterohaemorrhagic Escherichia coli
JP2008509682A (ja) Yebfを利用するタンパク質の製造方法
Nakatogawa et al. SecM facilitates translocase function of SecA by localizing its biosynthesis
Gao et al. The signal peptide of Cry1Ia can improve the expression of eGFP or mCherry in Escherichia coli and Bacillus thuringiensis and enhance the host’s fluorescent intensity
Lux et al. Overproduced Salmonella typhimurium flagellar motor switch complexes
Berger et al. Small things matter: the 11.6-kDa TraB protein is crucial for antibiotic resistance transfer among enterococci
US20140154742A1 (en) Novel expression and secretion vector systems for heterologous protein production in escherichia coli
Wilson et al. Cloning of a functional Salmonella SPI-1 type III secretion system and development of a method to create mutations and epitope fusions in the cloned genes
KR100963302B1 (ko) 대장균 유래 ptsL 프로모터를 함유하는 재조합벡터 및이를 이용한 외래 단백질의 제조방법
KR102809778B1 (ko) 조절가능한 리보솜 번역 속도를 위한 조성물 및 사용 방법
BRPI0807661A2 (pt) Microorganismo modificado
HK1209158B (en) COMPOSITIONS AND METHODS FOR PEPTIDE EXPRESSION AND PURIFICATION USING A TYPE lll SECRETION SYSTEM
Little The Type IV pilus secretin BfpB: structural analysis and binding interactions
Troutman Designing, Cloning, and Evaluating Expression of a Visible Chromoprotein and Antimicrobial Peptides in Gram-Negative Bacteria
Desiderato Characterization and recombinant production of the bacteriocin garvicin Q
DeRosa The Role of Francisella tularensis pil Genes in Protein Secretion and Pilus Fiber Formation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13798228

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2015515191

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14404919

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2013798228

Country of ref document: EP