WO2013177397A1 - Multivalent meningococcal conjugates and methods for preparing cojugates - Google Patents
Multivalent meningococcal conjugates and methods for preparing cojugates Download PDFInfo
- Publication number
- WO2013177397A1 WO2013177397A1 PCT/US2013/042428 US2013042428W WO2013177397A1 WO 2013177397 A1 WO2013177397 A1 WO 2013177397A1 US 2013042428 W US2013042428 W US 2013042428W WO 2013177397 A1 WO2013177397 A1 WO 2013177397A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- polysaccharide
- fhbp
- immunogenic
- meningococcal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/095—Neisseria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
- A61K47/646—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the entire peptide or protein drug conjugate elicits an immune response, e.g. conjugate vaccines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
- A61K2039/572—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 cytotoxic response
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- This disclosure relates to conjugates, particularly immunogenic meningococcal conjugates, and methods of making such conjugates.
- Menveo® Novartis tetravalent conjugate vaccines for protection against meningococcal disease caused by groups A, C, W-135, and Y Neisseria meningitidis.
- Group B capsular PS a polysialic acid with an a2 ⁇ 8 glycosidic linkage, is similar to the PS structure expressed in certain human tissues (Finne et ah, Lancet 2:355-357, 1983), thus making it a poor immunogen.
- a need remains to develop additional meningococcal vaccines, particularly for group B and group X meningococcal serogroups.
- immunogenic conjugates including at least one polysaccharide or protein conjugated to a Neisseria surface protein, for example group B factor H binding protein (fHbp) or Neisserial surface protein A (NspA).
- fHbp group B factor H binding protein
- NspA Neisserial surface protein A
- meningococcal immunogenic conjugates which can elicit immune responses against meningococcal polysaccharides (PS) from groups A, C, W-135, and Y.
- the immunogenic conjugates can also elicit immune responses against fHbp or NspA.
- the disclosed conjugates also exhibit bactericidal activity against meningococcal A, C, W-135, Y, B, and X serogroups.
- the immunogenic conjugates are multivalent immunogenic conjugates.
- the methods include reacting at least one first moiety (such as a PS, protein, drug, or other compound) with a cyanylation agent at about 2°C to about 6°C, resulting in a cyanate-activated first moiety and contacting the cyanate-activated first moiety with a second moiety (such as a PS, protein, drug, or other compound) having at least one amino group or at least one hydrazide group (such as a hydrazide- activated second moiety) at about 2°C to about 6°C, resulting in a conjugate that includes at least one C-N bond formed between the at least one first moiety and the at least one second moiety.
- a first moiety such as a PS, protein, drug, or other compound
- a cyanylation agent at about 2°C to about 6°C
- the methods include reacting at least one
- polysaccharide with a cyanylation agent at about 2°C to about 6°C resulting in a cyanate-activated polysaccharide and contacting the cyanate-activated polysaccharide with at least one protein (such as fHbp or NspA), resulting in an immunogenic conjugate that includes at least one C-N bond formed between the at least one polysaccharide and the at least one protein.
- a cyanylation agent at about 2°C to about 6°C
- the methods also include reacting the at least one protein with hydrazine, carbohydrazide, hydrazine chloride, a dihydrazide, or a mixture thereof at about 2°C to about 6°C, producing a solution of at least one hydrazide-activated protein and contacting the at least one cyanate-activated
- polysaccharide with at least one protein at about 2°C to about 6°C such that the at least one cyanate-activated polysaccharide reacts with the at least one hydrazide-activated protein, resulting in an immunogenic conjugate that includes at least one C-N bond formed between the at least one polysaccharide and the at least one protein
- FIG. 1A-1B are a pair of digital images of purified recombinant meningococcal factor H binding protein variant 1 (fHbpl), variant 2 (fHbp2), and their fusion product (fHbp(l+2)).
- FIG. 1A is a digital image of SDS-PAGE analysis: fHbpl in lane 1; fHbp2 in lane 2; fHbp(l+2) in lane 3; and the molecular weight ladder in lane 4.
- FIG. IB is a digital image of a Western blot analysis using monoclonal antibodies Jar 5 (specific to fHbpl) and Jar 11 (specific to fHbp 2).
- fHbp(l+2) in lanes 1 and 4 was developed with monoclonal antibodies Jar 5 and Jar 11, respectively; fHbpl in lane 2 was developed with monoclonal antibody Jar 5; and fHbp2 in lane 3 was developed with monoclonal antibody Jar 11.
- FIG. 2 is a plot of size-exclusion HPLC profiles (monitored at 280 nm) of conjugate products of fHbp(l+2) and meningococcal serogroup C polysaccharide (MCPS) prepared under the original conjugation conditions (bottom trace; room temperature) or the modified conjugation conditions (top trace; 4°C).
- fHbp(l+2)MCPS conjugate indicates the PS-fHbp conjugate;
- fHbp(l+2) indicates the unconjugated fHbp protein.
- FIGS. 3 A and 3B are a set of HPLC profiles of conjugate products.
- FIG. 3 A is a set of
- FIG. 3B is a set of HPLC profiles of fHbp(l+2) and conjugate products of fHbp(l+2) and meningococcal serogroup A polysaccharide (MAPS), fHbp(l+2)MCPS, fHbp(l+2) and meningococcal serogroup W-135 polysaccharide (MWPS), and fHbp(l+2) and meningococcal serogroup Y polysaccharide (MYPS) monitored at 280 nm.
- the protein signals move from about
- nucleic acid and amino acid sequences listed herein or in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases and amino acids, as defined in 37 C.F.R. ⁇ 1.822. In at least some cases, only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
- SEQ ID NOs: 1 and 2 are exemplary NspA nucleic acid and amino acid sequences, respectively.
- SEQ ID NOs: 3 and 4 are exemplary fHbpl nucleic acid and amino acid sequences, respectively.
- SEQ ID NOs: 5 and 6 are exemplary fHbp2 nucleic acid and amino acid sequences, respectively.
- SEQ ID NOs: 7 and 8 are exemplary fHbpl-fHbp2 fusion nucleic acid and amino acid sequences, respectively.
- SEQ ID NOs: 9 and 10 are the nucleic acid sequences of forward and reverse fHbpl primers, respectively.
- SEQ ID NOs: 11 and 12 are the nucleic acid sequences of forward and reverse fHbp2 primers, respectively.
- SEQ ID NOs: 13 and 14 are the nucleic acid sequences of additional reverse fHbpl primers.
- SEQ ID NOs: 15 and 16 are the nucleic acid sequences of additional forward fHbp2 primers.
- conjugation methods which avoid the inconvenient and less controllable procedure of 2-2.5 minutes PS activation time. It was found that PS can be activated by CDAP at about 4°C for 1.5-3 hours and achieve better yield of conjugation with protein.
- CDAP and the resulting cyanate groups have longer half-life at lower temperatures (e.g., 4°C) than at room temperature.
- a similar phenomenon was observed for PS conjugating to hydrazide groups in hydrazide- activated protein at 4°C.
- the disclosed improved conjugation methods are not limited to production of conjugates of
- PS and proteins are improved methods that can be utilized for conjugation of any cyanate-activated moiety with any moiety including an amino group or any hydrazide- activated moiety, providing improved convenience and increased yield of the resulting conjugate.
- the disclosed methods can be used to produce chemical, biochemical, medical, pharmacological, diagnostic and/or therapeutic reagents.
- CDAP 1 -cyano-4-dimethylaminopyridinium tetrafluorob orate
- Adjuvant A substance or vehicle that non-specifically enhances the immune response to an antigen.
- Adjuvants can include a suspension of minerals (such as alum, aluminum hydroxide, or phosphate) on which antigen is adsorbed or water-in-oil emulsion in which antigen solution is emulsified in mineral oil (for example, Freund's incomplete adjuvant), sometimes with the inclusion of killed mycobacteria (Freund's complete adjuvant) to further enhance antigenicity.
- Immuno stimulatory oligonucleotides (such as those including a CpG motif) can also be used as adjuvants (for example, see U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371;
- Adjuvants also include biological molecules, such as costimulatory molecules.
- exemplary biological adjuvants include IL-2, RANTES, GM- CSF, TNF-a, IFN- ⁇ , G-CSF, LFA-3, CD72, B7-1, B7-2, OX-40L and 41 BBL.
- Antigen A compound, composition, or substance that may be specifically bound by the products of specific humoral or cellular immunity, such as an antibody molecule or T-cell receptor.
- Antigens can be any type of biologic molecule including, for example, simple intermediary metabolites, sugars (e.g., oligosaccharides), lipids, and hormones as well as macromolecules such as complex carbohydrates (e.g., polysaccharides), phospholipids, nucleic acids and proteins.
- Antigens include, but are not limited to, viral antigens, bacterial antigens, fungal antigens, protozoa and other parasitic antigens, tumor antigens, antigens involved in autoimmune disease, allergy and graft rejection, toxins, and other miscellaneous antigens.
- Carrier An immunogenic molecule to which a hapten or an antigen (such as a
- polysaccharide can be bound or conjugated.
- the molecule When bound or conjugated to a carrier, the molecule may become more immunogenic.
- Carriers are chosen to increase the immunogenicity of the bound or conjugated molecule and/or to elicit antibodies against the carrier which are diagnostically, analytically, and/or therapeutically beneficial.
- Covalent linking of a molecule to a carrier can confer enhanced immunogenicity and T-cell dependence (Pozsgay et al., PNAS 96:5194-97, 1999; Lee et al. , J. Immunol. 116: 1711-18, 1976; Dintzis et al., PNAS 73:3671-75, 1976).
- Useful carriers include polymeric carriers, which can be natural (for example, proteins from bacteria or viruses), semi-synthetic, or synthetic materials containing one or more functional groups to which a reactant moiety can be attached.
- bacterial products for use as carriers include bacterial toxins, such as B.
- anthracis protective antigen including fragments that contain at least one antigenic epitope and analogs or derivatives capable of eliciting an immune response
- lethal factor and lethal toxin include fragments that contain at least one antigenic epitope and analogs or derivatives capable of eliciting an immune response
- lethal factor and lethal toxin include lethal factor and lethal toxin, and other bacterial toxins and toxoids, such as tetanus toxin/toxoid, diphtheria toxin/toxoid, P.
- meningococcal factor H binding proteins or NspA proteins are also useful carrier proteins.
- Viral proteins, such as hepatitis B surface antigen and core antigen can also be used as carriers.
- Conjugate Coupling a first unit to a second unit. This includes, but is not limited to, covalently bonding one molecule to another molecule (for example, directly or via a linker molecule), noncovalently bonding one molecule to another ⁇ e.g. electrostatically bonding) (see, for example, U.S. Patent No. 6,921,496, which discloses methods for electrostatic
- conjugating includes covalent bond linkage of a polysaccharide to a protein.
- the covalent bond linkage can be direct or indirect, e.g., linked though a spacer molecule.
- Covalent bond An interatomic bond between two atoms, characterized by the sharing of one or more pairs of electrons by the atoms.
- the terms “covalently bound” or “covalently linked” refer to making two separate molecules into one contiguous molecule.
- Effective amount A quantity of a specified agent sufficient to achieve a desired effect in a subject being treated with that agent. For example, this may be the amount of an immunogenic conjugate (such as a meningococcal PS-fHbp conjugate) useful in increasing resistance to, preventing, ameliorating, and/or treating infection and disease caused by a bacterial infection in a subject.
- an immunogenic conjugate such as a meningococcal PS-fHbp conjugate
- a therapeutically effective amount of an agent may include an amount sufficient to increase resistance to, prevent, ameliorate, and/or treat infection and disease caused by infection in a subject without causing a substantial cytotoxic effect in the subject.
- the effective amount or therapeutically effective amount of an agent useful for increasing resistance to, preventing, ameliorating, and/or treating infection and disease caused by infection in a subject will be dependent on the subject being treated, the severity of the affliction, and the manner of administration of the composition.
- Factor H binding protein A meningococcal surface protein, also known as GNA1870 or LP2086 (Masignani et al, J. Exp. Med. 197:789-799, 2003; Fletcher et al, Inf.
- fHbp binds to factor H, which is a cofactor in the cleavage of C3b to iC3b, prevents association of factor B with C3b slowing formation of the alternative pathway C3 convertase, and irreversibly dissociates the C3 convertase once it is formed.
- fHbp subfamily A
- fHbpl subfamily B
- the fHbp proteins exhibit substantial sequence variation among N. meningitidis strains, but all bind to factor H.
- fHbp nucleic acid and protein sequences are publicly available.
- Exemplary fHbp nucleic acid sequences include GenBank Accession Nos. NC_003112 (1975218-1976180), AY330353, AY330354, AY330363, AY330361, AY330367, AY330370, AY330375, AY330398, AY330399, AY330400, AY330401, AY330406, AY330407, AY330408, AY330409, AY330411, JN580522, and the associated amino acid sequences, all of which are incorporated herein by reference as present in GenBank on May 24, 2012.
- One of skill in the art can identify additional fHbp nucleic acid and protein sequences.
- Immune response A response of a cell of the immune system, such as a B-cell, T-cell, macrophage or polymorphonucleocyte, to a stimulus.
- An immune response can include any cell of the body involved in a host defense response for example, an epithelial cell that secretes interferon or a cytokine.
- An immune response includes, but is not limited to, an innate immune response or inflammation.
- Immunogen A compound, composition, or substance which is capable, under appropriate conditions, of stimulating the production of antibodies or a T-cell response in a subject, including compositions that are injected or absorbed into a subject.
- Immunogenic conjugate or composition A composition useful for stimulating or eliciting a specific immune response (or immunogenic response) in a subject.
- the immunogenic response is protective or provides protective immunity, in that it enables the subject to better resist infection or disease progression from the organism against which the immunogenic composition is directed.
- a type of immunogenic composition is a vaccine.
- Immunogenic-distinct polysaccharide A polysaccharide that elicits an immune response that differs from the immune response elicited by another type of polysaccharide.
- Immunogenic - distinct polysaccharides may be two or more polysaccharides from different encapsulated bacteria.
- a pneumococcal polysaccharide is an immunogenic-distinct polysaccharide compared to a meningococcal polysaccharide.
- Immunogenic-distinct polysaccharides also are inclusive of two or more polysaccharides from different serogroups or serotypes. For example, a
- meningococcal polysaccharide of serogroup A is an immunogenic-distinct polysaccharide compared to a meningococcal polysaccharide of serogroup C.
- Inhibiting or treating a disease refers to inhibiting the full development of a disease or condition, for example, in a subject who is at risk for a disease such as meningococcal meningitis. Inhibition of a disease can span the spectrum from partial inhibition to substantially complete inhibition (prevention) of the disease. In some examples, the term
- inhibiting refers to reducing or delaying the onset or progression of a disease.
- Treatment refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop.
- the term “ameliorating,” with reference to a disease, pathological condition or symptom refers to any observable beneficial effect of the treatment.
- the beneficial effect can be evidenced, for example, by a delayed onset of clinical symptoms of the disease in a susceptible subject, a reduction in severity of some or all clinical symptoms of the disease, a slower progression of the disease, a reduction in the number of relapses of the disease, an improvement in the overall health or well-being of the subject, or by other parameters well known in the art that are specific to the particular disease.
- Multivalent immunogenic conjugate or multivalent conjugate vaccine A molecule or conjugate including more than one antigenic epitope.
- One type of a multivalent immunogenic conjugate includes a mixture of different molecules, each molecule comprising different immunogenic-distinct polysaccharides wherein each different immunogenic-distinct polysaccharide is conjugated to a separate protein carrier (which may be the same or different protein carriers).
- Another type of a multivalent immunogenic conjugate is a molecule in which a plurality of immunogenic-distinct polysaccharides are conjugated to a single protein molecule or single protein construct (which protein construct itself includes more than one different protein).
- a further type of multivalent immunogenic conjugate includes a mixture of the conjugates of the first type and the conjugates of the second type.
- An example of the first type of multivalent immunogenic conjugate may be depicted as a mixture of the different structures represented by:
- PS 1 is a carrier protein
- PS 2 is each immunogenic-distinct polysaccharides.
- An example of the second type of multivalent immunogenic conjugate may be depicted as a structure represented by:
- PS 1 is a carrier protein
- PS2 is a carrier protein
- PS 3 is each immunogenic-distinct
- the protein and polysaccharide in the above formulae can be singular or plural
- Neisseria meningitidis A bacterium which causes meningococcal meningitis in humans. There are at least thirteen serogroups of N. meningitis, including groups A, B, C, W-135, X, Y, D, 29E, H, I, K, L, and Z, which are classified based on the composition of their polysaccharide capsule. Of these, A, B, C, W-135, X, and Y account for the majority of meningococcal disease. Symptoms of meningococcal meningitis include stiff neck, high fever, light sensitivity, headaches, and vomiting. Even with early diagnosis and antibiotic treatment, 5-10% of infected individuals die.
- Meningococcal meningitis may also result in brain damage or hearing loss in 10-20% of those who survive the disease. Meningococcal disease may also progress to meningococcal septicemia, characterized by hemorrhagic rash and rapid circulatory collapse.
- N. meningitidis bacteria are spread through contact with respiratory or throat secretions of carriers (such as through coughing, sneezing, kissing, sharing food or utensils, and living in close proximity). Up to 10-20% of the population may carry the bacteria in the nasopharynx without symptoms at any given time and the carriage rate may be even higher during an epidemic.
- Neisserial surface protein A A meningococcal surface protein capable of binding to factor H (Lewis et ah, PloS Pathogens 6:el001027).
- NspA nucleic acid and protein sequences are publicly available.
- Exemplary NspA nucleic acid sequences include GenBank Accession Nos. NC_003112.2 (690298..690822, complement), NC_013016.1 (590409..590933, complement), NC_010120.1 (632166..632690, complement), and NC_008767.1 (635025..635549, complement) and their associated amino acid sequences, all of which are incorporated by reference as present in GenBank on May 24, 2012.
- One of skill in the art can identify additional NspA sequences.
- Subject Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals.
- Subjects include veterinary subjects, including livestock such as cows and sheep, rodents (such as mice and rats), and non-human primates.
- novel immunogenic conjugates which include a polysaccharide (such as one or more bacterial polysaccharides) or a protein (such as a bacterial surface protein or an immunogenic portion thereof) conjugated to a carrier protein, for example, a Neisseria surface protein, such as meningococcal fHbp or NspA.
- a carrier protein for example, a Neisseria surface protein, such as meningococcal fHbp or NspA.
- the disclosed conjugates are immunogenic in a subject (as demonstrated in the Examples, below).
- the disclosed immunogenic conjugates include one or more (such as 1, 2, 3, 4, or more) immunogenic-distinct polysaccharides conjugated to fHbp or NspA.
- the immunogenic conjugates include one or more meningococcal polysaccharides (such as one or more meningococcal serogroups A, C, W-135, Y, or X
- the immunogenic conjugates include one or more pneumococcal, group B streptococcal, Haemophilus influenzae type b, or
- Salmonella typhi polysaccharides conjugated to fHbp or NspA conjugated to fHbp or NspA.
- the disclosed immunogenic conjugates include one or more (such as 1, 2, 3, 4, or more) proteins or an immunogenic portion thereof conjugated to a carrier protein, such as fHbp or NspA.
- the immunogenic conjugates include one or more bacterial surface proteins conjugated to fHbp.
- the immunogenic conjugates include one or more bacterial surface proteins conjugated to NspA.
- the immunogenic conjugates are multivalent immunogenic
- a multivalent immunogenic conjugate includes a mixture of different molecules, each molecule including different immunogenic-distinct polysaccharides wherein each different immunogenic - distinct polysaccharide is conjugated to a separate protein carrier (each of which may be the same or different protein carriers).
- a separate protein carrier each of which may be the same or different protein carriers.
- conjugate may be depicted as a mixture of the different structures represented by:
- P 1 and P2 are carrier proteins (for example fHbp and NspA); and PS 1 , PS2 , and PS 3 are each immunogenic-distinct polysaccharides.
- a multivalent immunogenic conjugate includes molecules in which a plurality of immunogenic-distinct polysaccharides are conjugated to a single protein molecule or single protein construct (which protein construct itself includes more than one different protein).
- a non-limiting example of such a multivalent conjugate may be depicted as a structure represented by:
- P 1 and P2 are carrier proteins (such as fHbp and NspA); PS 1 , PS2 , and PS 3 are each immunogenic-distinct polysaccharides that are covalently attached to P 1 or P 2.
- a multivalent immunogenic conjugate includes a mixture of one or more of the conjugates described above.
- a multivalent immunogenic conjugate includes a mixture of conjugates of MAPS-fHbp, MCPS-fHbp, MWPS-fHbp, and MYPS-fHbp.
- a multivalent immunogenic conjugate can also include a mixture of one or more immunogenic conjugates of a polysaccharide conjugated to fHbp and one or more immunogenic conjugates of a polysaccharide conjugated to NspA.
- polysaccharide as used herein, is a broad term and is used in its ordinary sense, including, without limitation, saccharides comprising a plurality of repeating units, including, but not limited to polysaccharides having 50 or more repeat units, and oligosaccharides having 50 or less repeating units.
- polysaccharides typically have from about 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 repeating units to about 2,000 or more repeating units, and such as from about 100, 150, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900 or 1000 repeating units to about, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, or 1900 repeating units.
- Oligosaccharides typically have from about 6, 7, 8, 9, or 10 repeating units to about 15, 20, 25, 30, or 35 to about 40 or 45 repeating units.
- polysaccharides for use in the disclosed conjugates and methods include polysaccharides and oligosaccharides from encapsulated bacteria.
- the polysaccharides and oligosaccharides can be from any source, for example, they can be derived from naturally-occurring bacteria, genetically engineered bacteria, or can be produced synthetically.
- the polysaccharides and oligosaccharides can be subjected to one or more processing steps prior to activation, for example, purification, functionalization, depolymerization using mild oxidative conditions, deacetylation, and the like. Post processing steps can also be employed, if desired. Any suitable method known in the art for synthesizing, preparing, and/or purifying suitable polysaccharides and oligosaccharides can be employed.
- Polysaccharides and oligosaccharides for use in the disclosed conjugates and methods include pneumococcal polysaccharides of, for example, serogroups 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11 A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F; meningococcal
- polysaccharide polyribosylribitol phosphate group B streptococcal polysaccharides of serotypes III and V, and Salmonella typhi Vi polysaccharide.
- Other polysaccharides of pneumococcal and group B streptococcal serotypes, and meningococcal serogroups are also suitable for use herein, as are other T-independent polysaccharide and oligosaccharide antigens, for example, polysaccharides or oligosaccharides derived from group A streptococcus, Staphylococci, Enterococci, Klebsiella pneumoniae, E. coli, Pseudomonas aeruginosa, and Bacillus anthracis. While bacterial
- polysaccharides and oligosaccharides are particularly suitable, gram- negative bacterial
- lipopolysaccharides and lipooligosaccharides and their polysaccharide and oligosaccharide derivatives, and viral polysaccharides and oligosaccharides can also be employed.
- detoxified mutant meningococcal lipooligosaccharides can be used in the disclosed conjugates (see, e.g., Weynants et al, Inf. Immun. 77:2084-2093, 2009).
- Polysaccharides with side chain phosphorus and/or backbone phosphorus are suitable for use in the disclosed conjugates and methods.
- the conjugation reactions (such as those described in Section IV, below) are particularly well suited for use with polysaccharides having phosphorus in the backbone, although they are not limited to such polysaccharides.
- the disclosed immunogenic conjugates include a polysaccharide or at least a portion of (such as an immunogenic portion of) one or more (such as 1, 2, 3, 4, or more) proteins (such as one or more bacterial surface proteins) conjugated to a carrier protein.
- the carrier protein is a Neisseria surface protein.
- the carrier protein is fHbp.
- the immunogenic conjugate includes a meningococcal polysaccharide or protein conjugated to fHbp.
- the carrier protein is NspA.
- the immunogenic conjugate includes a meningococcal polysaccharide or protein conjugated to NspA.
- the immunogenic conjugate includes meningococcal outer membrane vesicles or meningococcal outer membrane protein mixture conjugated to fHbp or NspA.
- Nucleic acid and amino acid sequences of NspA are publicly available.
- an NspA protein is encoded by a nucleic acid sequence at least 70% (such as at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) identical to the nucleic acid sequence set forth as SEQ ID NO: 1.
- an NspA protein is at least 70% (such as at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) identical to the amino acid sequence set forth as SEQ ID NO: 2.
- Factor H binding protein is a meningococcal surface protein, also known as
- GNA1870 or LP2086 (Masignani et al, J. Exp. Med. 197:789-799, 2003; Fletcher et al, Inf.
- fHbp binds to factor H, which is a cofactor in the cleavage of C3b to iC3b, prevents association of factor B with C3b slowing formation of the alternative pathway C3 convertase, and irreversibly dissociates the C3 convertase once it is formed.
- fHbp subfamily A
- fHbpl subfamily B
- Nucleic acid and amino acid sequences of fHbpl are publicly available.
- an fHbpl protein is encoded by a nucleic acid sequence at least 70% (such as at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) identical to the nucleic acid sequence set forth as SEQ ID NO: 3.
- an fHbpl protein is at least 70% (such as at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) identical to the amino acid sequence set forth as SEQ ID NO: 4.
- Nucleic acid and amino acid sequences of fHbp2 are publicly available.
- an fHbp2 protein is encoded by a nucleic acid sequence at least 70% (such as at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) identical to the nucleic acid sequence set forth as SEQ ID NO: 5.
- an fHbp2 protein is at least 70% (such as at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) identical to the amino acid sequence set forth as SEQ ID NO: 6.
- the immunogenic conjugates include a fusion protein including at least a portion of each of fHbpl and fHbp2.
- an fHbpl-fHbp2 fusion protein is encoded by a nucleic acid encoding fHbpl (or a portion thereof), which is directly or indirectly (for example via a linker) linked to a nucleic acid encoding fHbp2 (or a portion thereof).
- an fHbpl-fHbp2 fusion protein is encoded by a nucleic acid sequence at least 70% (such as at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) identical to the nucleic acid sequence set forth as SEQ ID NO: 7.
- an fHbp-lfHbp2 fusion protein is at least 70% (such as at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100%) identical to the amino acid sequence set forth as SEQ ID NO: 8.
- the disclosed immunogenic conjugates can be prepared by methods including reductive amination conjugation or cyanylation conjugation.
- the methods for preparing the immunogenic conjugates are standard methods known to one of skill in the art.
- the methods are improved methods that provide, for example, increased convenience, improved ability to perform large scale reactions, and increased yield over standard methods.
- the improved methods can be utilized to prepare a conjugate between any cyanate-activated moiety (such as a PS, protein, drug, or other compound) and any moiety (such as a PS, protein, drug, or other compound) with at least one amino group or any hydrazide-activated moiety (such as a PS, protein, drug, or other compound).
- any cyanate-activated moiety such as a PS, protein, drug, or other compound
- any moiety such as a PS, protein, drug, or other compound
- any hydrazide-activated moiety such as a PS, protein, drug, or other compound
- methods of preparing the disclosed immunogenic conjugates include reductive amination reaction to conjugate a polysaccharide containing aldehyde groups to a protein (such as hydrazide modified protein).
- the disclosed methods include conjugating at least one aldehyde- activated meningococcal PS (such as MAPS, MCPS, MWPS, MYPS, or a combination of two or more thereof) to a hydrazide-activated fHbp.
- aldehyde- activated meningococcal PS such as MAPS, MCPS, MWPS, MYPS, or a combination of two or more thereof
- Any suitable functionalization reaction can be employed to activate the polysaccharide or oligosaccharide with aldehyde groups.
- Certain polysaccharides and oligosaccharides possess terminal aldehyde groups that can participate in the conjugation reaction. If the polysaccharide or oligosaccharide is activated with aldehyde groups, a preferred reaction involves reaction with an oxidizing agent, such as NaI0 4 . Oxidizing agents have the potential for fragmenting the
- Ketone groups are also capable of reacting with hydrazide, so activation of the polysaccharide or oligosaccharide with ketone groups can be employed in certain embodiments.
- polysaccharide is reacted with sodium periodate at about 2-6°C (for example, about 2°C, about 2.5°C, about 3°C, about 3.5°C, about 4°C, about 4.5°C, about 5°C, about 5.5°C, or about 6°C) for 6-24 hours (for example about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, or about 24 hours) or overnight.
- the activated polysaccharide can be purified, for example by diafiltration against water.
- a strongly buffered (e.g., at pH of from about 6.5 to about 8, with a high buffer concentration of from about 100 mM to about 200 mM) activated polysaccharide solution is employed in the conjugation reaction in the form of a strongly buffered solution.
- Any suitable buffer can be employed, such as a buffer such as N-(2-Hydroxyethyl) piperazine-N'-(2- ethanesulfonic acid) (HEPES) or phosphate buffered saline.
- the activated polysaccharide is buffer exchanged with 10 mM HEPES, pH 7.5.
- the methods include introducing at least one hydrazide group onto the protein (for example, a carrier protein, such as a fHbp or NspA) by reacting the protein with excess hydrazine, carbohydrazide, hydrazine chloride, or a dihydrazide (for example, succinyl dihydrazide or adipic acid dihydrazide (ADH)) catalyzed by a carbodiimide (such as l-[3- (dimethylamino)propyl]-3-ethylcarbodiimide hydrochloride (EDC), although any water-soluble carbodiimide can be used).
- a carrier protein such as a fHbp or NspA
- the protein is reacted with hydrazine or ADH in the presence of EDC at about pH 5.5-6.5 (such as pH about 5.5, about 5.6, about 5.7, about 5.8, about 5.9, about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, or about 6.5).
- the hydrazide- activated protein is maintained soluble at a pH of from about 10 to about 11.5, such as from about 10.1, 10.2, 10.3, or 10.4 to about 10.6, 10.7, 10.8, 10.9, 11.0, 11.1, 11.2, 11.3, or 11.4, for example about 10.5, with a buffer at a concentration of from about 3 or less to about 10 mM or more, such as from about 4 or 5 mM to about 6, 7, 8, or 9; mM, before conjugation.
- Suitable buffers include but are not limited to Na 2 C0 3 , 3-(cyclohexylamino)-l- propanesulfonic acid (CAPS), and (2-(N-cyclohexylamino)ethane sulfonic acid (CHES).
- the hydrazide-activated protein is buffer- exchanged to a solution of about pH 10.5 (such as 30 mM NaCl and 3 mM Na 2 C0 3 , pH 10.5).
- the hydrazide-activated protein is maintained soluble at neutral or approximately neutral pH (e.g., pH of about 7 to about 7.5) by activating the protein in the presence of at least one amino acid (such as lysine, arginine, histidine, glycine, serine, threonine, glutamic acid, cysteine, or a mixture of two or more thereof) (see, e.g., WO 07/109129, incorporated herein by reference).
- Amino acids may be included in the activation reaction at a concentration of about 1-500 mM, about 20-300 mM, or about 36- 144 mM.
- the hydrazide-based conjugation reaction can be carried to completion within one to three days at reactant concentrations of from about 1 to about 40 mg/mL, or about 1 to about 50 mg/mL, at PS/protein weight ratios of from about 1 :5 to about 5: 1, such as from about 1 :2 to about 2: 1, for example, about 1 : 1, although in certain embodiments higher or lower ratios can be utilized.
- the conjugation reaction is conducted at temperatures of from about 4°C to about 40°C, for example from about 4, 10, 15, or 20°C to about 25, 30, or 35°C, and at a pH of from about 6 to about 8.5, such as from about 6.1, 6.2, 6.3, 6.4, or 6.5 to about 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, or 8.4, with optimal conditions varying according to the polysaccharide.
- the reductive amination conjugation reaction of the disclosed methods proceeds without the aid of sodium cyanoborohydride because of the high efficiency of the hydrazide-aldehyde reaction.
- the reductive amination conjugation reaction of these methods avoids contamination of the resulting conjugate with cyanide, a by-product of sodium cyanoborohydride.
- the activated protein is provided in the form of a weakly buffered solution with a low buffer concentration of from about 3 mM to about 10 mM, which is added to a strongly buffered (at pH of from about 6.5 to about 7.5, with a high buffer concentration of from about 100 mM to about 200 mM) activated polysaccharide solution.
- a strongly buffered (at pH of from about 6.5 to about 7.5, with a high buffer concentration of from about 100 mM to about 200 mM) activated polysaccharide solution In particular examples, the pH of the activated protein solution is buffered to from about pH 10 to about pH 11.5, for example, about pH 10.5.
- the activated polysaccharide solution is strongly buffered to from about pH 6 to about pH8, such as from about pH 6.5 to about pH 7.5.
- the hydrazide- aldehyde reductive amination reaction proceeds at a fast rate, and the precipitating effect of a pH lower than 10.5 (for example, a pH as low as from about 8.5 to about 9.5) on activated protein is overcome by the molecular properties of the reacting activated polysaccharide.
- a pH lower than 10.5 for example, a pH as low as from about 8.5 to about 9.5
- the disclosed methods include reacting at least one aldehyde- activated protein with at least one hydrazide-activated polysaccharide to produce an immunogenic conjugate. Any suitable functionalization reaction can be employed to activate the protein with aldehyde groups.
- the protein is reacted with l-amino-2,3-propanediol (APDO) in the presence of EDC.
- APDO l-amino-2,3-propanediol
- Amino sugars such as glucosamine, galactosamine, and the like can be used in place of APDO.
- an oxidizing agent for example, NaI0 4
- immunogenic conjugates include a cyanylation conjugation reaction to conjugate a moiety containing at least one cyanate group to a moiety including at least one amino group or to at least one hydrazide-activated moiety.
- the methods include conjugating a
- the improved cyanylation conjugation methods disclosed herein include reacting at least one first moiety (such as a PS, protein, drug, or other compound) with a cyanylation agent at about 2°C to about 6°C, resulting in a cyanate-activated first moiety and contacting the cyanate-activated first moiety with a second moiety (such as a PS, protein, drug, or other compound) having at least one amino group or at least one hydrazide group (such as a hydrazide-activated second moiety) at about 2°C to about 6°C, resulting in a conjugate that includes at least one C-N bond formed between the at least one first moiety and the at least one second moiety.
- a first moiety such as a PS, protein, drug, or other compound
- a cyanylation agent at about 2°C to about 6°C
- the resulting conjugates are useful for a variety of purposes, including as immunogenic, diagnostic, and/or therapeutic compounds or reagents.
- One of skill in the art can select appropriate moieties for conjugation by the cyanylation conjugation methods provided herein, and the methods are not limited to production of the specific examples provided herein.
- the disclosed methods include reacting at least one polysaccharide with a cyanylation agent, resulting in at least one cyanate-activated polysaccharide.
- the at least one cyanate-activated polysaccharide is reacted with at least one protein, resulting in a conjugate that includes at least one C-N bond formed between at least one
- the methods also include reacting at least one protein with hydrazine, carbohydrazide, hydrazine chloride, a dihydrazide or a mixture thereof, resulting in at least one hydrazide-activated protein.
- Exemplary methods include those in International Patent Publication Nos. WO 2005/014037, WO
- the disclosed methods include conjugating at least one cyanate- activated meningococcal PS (such as MAPS, MCPS, MWPS, MYPS, or a combination of two or more thereof) to a fHbp protein (such as a native fHbp or a hydrazide-activated fHbp).
- the disclosed methods include conjugating at least one cyanate-activated meningococcal PS (such as MAPS, MCPS, MWPS, MYPS, or a combination of two or more thereof) to a NspA protein.
- any suitable functionalization reaction can be employed to activate the polysaccharide or oligosaccharide with cyanate groups.
- the polysaccharide or oligosaccharide is reacted with 1- cyano-4-dimethylammoniumpyridinium tetrafluoroborate (CDAP) in the presence of triethylamine.
- Additional cyanylation agents include cyanogen bromide, p-nitrophenyl cyanate (pNPC), l-cyano-4-pyrrolidiniopyridinium tetrafluoroborate (CPIP), and N-cyano-N,N,N-triethylammonium tetrafluoroborate (CTEA).
- At least one polysaccharide is reacted with a cyanylation agent (for example CDAP) at about 20°C-25°C (such as about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, or about 25°C) in the presence of triethylamine for about 1-5 minutes (such as about 1, about 1.5, about 2, about 2.5, about 3, about 3.5, about 4, about 4.5, or about 5 minutes).
- a cyanylation agent for example CDAP
- At least one polysaccharide is reacted with a cyanylation agent (such as CDAP) at about 2°C-6°C (such as about 2°C, about 2.5°C, about 3°C, about 3.5°C, about 4°C, about 4.5°C, about 5°C, about 5.5°C, or about 6°C, for example about 4°C) in the presence of triethylamine for about 1- 3 hours (for example about 1, about 1.5, about 2, about 2.5, or about 3 hours).
- a cyanylation agent such as CDAP
- Activation of polysaccharide with a cyanylation agent such as CDAP
- a longer reaction time makes the method more suitable for large scale preparation of immunogenic conjugates, for example for commercial vaccine production.
- the modified activation conditions provide increased yield following conjugation to a protein (such as a hydrazide- activated protein) than are achieved with the standard (room temperature) activation conditions.
- the yield of the immunogenic conjugate is about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5- fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold more, or higher when the activation reaction is carried out at 4°C than when it is carried out at room temperature.
- the amount of unconjugated protein in the reaction is reduced from about 30% when the reaction is carried out at room temperature, to less than about 5% when the reaction is carried out a 4°C, corresponding to about a 40% increase in conjugation yield
- the methods also include introducing at least one hydrazide group onto the protein (for example, a carrier protein, such as a fHbp) by reacting the protein with excess hydrazine, carbohydrazide, hydrazine chloride, or a dihydrazide (for example, succinyl dihydrazide or adipic acid dihydrazide (ADH)) catalyzed by a carbodiimide (such as l-[3- (dimethylamino)propyl]-3-ethylcarbodiimide hydrochloride (EDC), although any water-soluble carbodiimide can be used).
- a carrier protein such as a fHbp
- a dihydrazide for example, succinyl dihydrazide or adipic acid dihydrazide (ADH)
- ADH succinyl dihydrazide or adipic acid dihydrazide
- EDC l-[3-
- the protein is reacted with hydrazine or ADH in the presence of EDC at about pH 5.5-6.5 (such as pH about 5.5, about 5.6, about 5.7, about 5.8, about 5.9, about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, or about 6.5).
- the hydrazide- activated protein is maintained soluble at a pH of from about 10 to about 11.5, such as from about 10.1, 10.2, 10.3, or 10.4 to about 10.6, 10.7, 10.8, 10.9, 11.0, 11.1, 11.2, 11.3, or 11.4, for example about 10.5, with a buffer at a concentration of from about 3 or less to about 10 mM or more, such as from about 4 or 5 mM to about 6, 7, 8, or 9; mM, before conjugation.
- Suitable buffers include but are not limited to Na 2 C0 3 , 3-(cyclohexylamino)-l- propanesulfonicacid (CAPS), and (2-(N-cyclohexylamino)ethane sulfonic acid (CHES).
- the hydrazide-activated protein is buffer- exchanged to a solution of about pH 10.5 (such as 30 mM NaCl and 3 mM Na 2 C0 3 , pH 10.5).
- the hydrazide-activated protein is maintained soluble at neutral or approximately neutral pH (e.g., pH of about 7 to about 7.5) by activating the protein in the presence of at least one amino acid (such as lysine, arginine, histidine, glycine, serine, threonine, glutamic acid, cysteine, or a mixture of two or more thereof) (see, e.g., WO 07/109129).
- Amino acids may be included in the activation reaction at a concentration of about 1-500 mM, about 20-300 mM, or about 36- 144 mM.
- the cyanylation conjugation reaction is efficient and reversible, favoring the product formation.
- blocking agents are employed to remove residual cyanate groups.
- addition of a blocking agent to the reaction mixture drives the conjugation reaction backward and reduces the conjugation yield by 5-12%.
- blocking agents for example, ADH, hydrazine, glycine, or
- conjugation time can be prolonged.
- conjugation is conducted at a temperature of from about 0°C to about 6°C (for example, about 2°C, about 2.5°C, about 3°C, about 3.5°C, about 4°C, about 4.5°C, about 5°C, about 5.5°C, or about 6°C) for about 36 to about 48 hours, for example at about 4°C for about 36 hours, followed by about an additional 18 to 24 hours at a temperature of from about 20°C to about 25°C, for example at about 18 hours at about 20 to 24°C, such that the residual cyanate groups react with water and decompose.
- conjugation reaction Longer or shorter conjugation times and/or higher or lower conjugation temperatures can be employed, and different sequences of steps at various times and temperatures can be conducted, as desired. It is desirable, however, to conduct the conjugation reaction, at least initially, at low temperatures, for example from about 0°C to about 6°C, such as about 2°C to about 6°C (for example, about 2°C, about 2.5°C, about 3°C, about 3.5°C, about 4°C, about 4.5°C, about 5°C, about 5.5°C, or about 6°C), so as to reduce the degree of precipitation of the conjugate. In particular examples, the reaction is carried out at about 4°C.
- the disclosed methods utilize a plurality of immunogenic-distinct polysaccharides and/or a plurality of proteins to produce a multivalent immunogenic conjugate.
- a mixture of two or more (such as 2, 3, 4, 5, or more) immunogenic-distinct polysaccharides is conjugated to at least one protein (such as fHbp or NspA) using the methods described above.
- the plurality of immunogenic distinct polysaccharides includes two or more meningococcal polysaccharides (for example, two or more of meningococcal polysaccharides selected from serotypes A, B, C, W-135, and Y).
- the plurality of immunogenic distinct polysaccharides includes meningococcal serogroup A polysaccharide (MAPS), meningococcal serogroup C polysaccharide (MCPS), meningococcal serogroup W-135 polysaccharide (MWPS), and meningococcal serogroup Y polysaccharide (MYPS).
- the plurality of immunogenic-distinct polysaccharides includes polysaccharides from two or more different bacteria (such as two or more of meningococcal polysaccharides, pneumococcal polysaccharides, Haemophilus influenzae type b polysaccharide, Vi polysaccharide of Salmonella typhi, and group B Streptococcus polysaccharides).
- the plurality of immunogenic-distinct polysaccharides includes at least one meningococcal polysaccharide, at least one pneumococcal polysaccharide, and at least one Haemophilus influenzae type b polysaccharide.
- a mixture of more than one polysaccharide can be simultaneously activated by reaction with a single activating agent (or a mixture of activating agents) in single batch step.
- a mixture of MAPS, MCPS, MWPS, and MYPS can be reacted with an aldehyde-functionalizing agent in a single batch reaction.
- a mixture of MAPS, MCPS, MWPS, and MYPS can be reacted with cyanate-functionalizing agent in a single batch reaction.
- a mixture of at least one meningococcal polysaccharide such as at least one of meningococcal polysaccharides of serotypes A, B, C, W-135, and Y
- at least one pneumococcal polysaccharide such as at least one of pneumococcal polysaccharides of serogroups 1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11 A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F
- H at least one H.
- influenzae type b polysaccharide can be activated with an aldehyde-functionalizing agent of a cyanate-functionalizing agent.
- the mixture of activated polysaccharides is then conjugated to at least one protein (such as fHbp or NspA) in a single process.
- each individual polysaccharide can be activated by reaction with an activating agent in a separate process.
- the separately activated polysaccharides can then be mixed together prior to the conjugation step so the activated polysaccharides can be simultaneously conjugated in a single process.
- multivalent immunogenic conjugates are prepared by mixing individual immunogenic conjugates.
- a multivalent immunogenic conjugate can be prepared by mixing conjugates of MAPS-fHbp, MCPS-fHbp, MWPS-fHbp, and MYPS-fHbp.
- a multivalent immunogenic conjugate can also be prepared by mixing one or more immunogenic conjugates of a polysaccharide conjugated to fHbp and one or more immunogenic conjugates of a polysaccharide conjugated to NspA.
- the activation and conjugation reactions can be carried out according to the methods described above.
- the conjugates disclosed herein and/or prepared according to the methods disclosed herein are administered to a subject in an effective dose (for example, a therapeutically effective dose) in a suitable form to elicit an immune response in the subject.
- the disclosed immunogenic conjugates are capable of treating, inhibiting, or in some examples, even preventing infection or disease (for example Neisseria meningitidis infection) in a subject.
- a subject refers to animals, such as mammals.
- mammals include humans, primates, dogs, cats, sheep, cattle, goats, pigs, horses, mice, rats, rabbits, guinea pigs, and the like.
- the terms subject, patient, and host are used interchangeably.
- the particular dosage effective to elicit an immune response or to treat, inhibit, or ameliorate an infection depends upon the age, weight and medical condition of the subject to be treated, as well as on the method of administration.
- Immunization protocols for use with the disclosed conjugates provide compositions and methods for preventing or treating a disease, disorder and/or infection in a subject are known to one of skill ordinary in the art. Suitable doses and immunization protocols can be readily determined by those of ordinary skill in the art.
- compositions comprising the disclosed conjugates can offer various advantages over conventional vaccines, including enhanced immunogenicity of weakly
- immunogenic antigens potential reduction in the amount of antigen used, less frequent booster immunizations, improved efficacy, preferential stimulation of immunity, or potential targeting of immune responses.
- the disclosed immunogenic conjugates, conjugates made by the disclosed methods, and/or pharmaceutical compositions including the conjugates can be administered to a subject by a variety of routes, as discussed below, including but not limited to parenteral, intradermal, transmembranal, transdermal (including topical), intramuscular, intraperitoneal, intravenous, intra-arterial, intralesional, subcutaneous, oral, and intranasal ⁇ e.g., inhalation) routes of administration.
- Immunogenic conjugates can be administered by bolus injection or by continuous infusion, as well as by localized administration, for example at a site of disease or injury.
- the conjugate can be optionally administered in a pharmaceutically or physiologically acceptable carrier (vehicle).
- a pharmaceutically or physiologically acceptable carrier vehicle.
- One or more of the disclosed conjugates (such as 2, 3, 4, 5, 6, or more) can be formulated with adjuvants, diluents, excipients, carriers, and other pharmaceutically acceptable substances.
- pharmaceutically acceptable is used to refer to a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism.
- compositions are sterile and contain either a therapeutically or prophylactically effective amount of the conjugate in a unit of weight or volume suitable for administration to a subject.
- pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional.
- compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds or molecules The characteristics of the carrier depend on the route of administration.
- Physiologically and pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials which are well known in the art.
- compositions can also contain one or more adjuvants.
- adjuvants include, for example, aluminum adjuvants (such as aluminum hydroxide or aluminum phosphate), Freund's Adjuvant, BAY, 3(N,N,- dimethylaminoethane)-carbamyl cholesterol (DC-Choi), poly[di(sodium
- PCPP carboxylatephoneoxyphosphazene
- the dosage of immunogenic conjugate(s) to be administered to a subject and the regime of administration can be determined in accordance with standard techniques well known to those of ordinary skill in the pharmaceutical and veterinary arts, taking into consideration such factors as the intended use, particular antigen, the adjuvant (if present), the age, sex, weight, species, general condition, prior illness and/or treatments of the subject, and the route of administration.
- Preliminary doses can be determined according to animal tests, and the scaling of dosages for human administration is performed according to art-accepted practices such as standard dosing trials.
- the therapeutically effective dose can be estimated initially from serum antibody level testing. The dosage depends on the specific activity of the conjugate and can be readily determined by routine experimentation.
- a therapeutically effective amount of conjugate is administered to a subject.
- a therapeutically effective amount is the total amount of therapeutic agent (e.g., conjugate) or other active component that is sufficient to show a meaningful benefit to the subject, such as immune response, treatment, healing, inhibition, prevention, or amelioration of the relevant medical condition (disease, infection, or the like), or an increase in rate of treatment, healing, prevention or amelioration of such conditions.
- An effective amount can include the amount of an individual therapeutic agent (such as an individual immunogenic conjugate disclosed herein), a combination of therapeutic agents (such as two or more of the disclosed immunogenic conjugates), or a combination of one or more of the disclosed immunogenic conjugates and other agents.
- a combination can be administered to a subject simultaneously, substantially simultaneously, or serially.
- a subject is administered an amount of therapeutic agent or composition in an amount and for a time to treat, inhibit, or even prevent an infection, such as an infection with Neisseria meningitidis.
- the amount of conjugate that is an effective amount or a therapeutically effective amount is from about 1 ⁇ g/kg or less to about 100 ⁇ g/kg or more, such as from about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45 or 50 ⁇ g/kg to about 55, 60, 65, 70, 75, 80, 85, 90, or 95 ⁇ g/kg body weight.
- An effective amount can be less if the post-infection time elapsed is less, since there is less time for the pathogen to proliferate.
- An effective amount can also depend on the bacterial load at the time of diagnosis. Multiple injections administered over a period of days can be considered for therapeutic usage.
- the disclosed immunogenic conjugates can be administered as a single dose or in a series including one or more boosters.
- a subject can receive a single dose (for example, early in life), then be administered a booster dose up tol month, 2 months, 3 months, 6 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or more later.
- More than one booster dose can be administered if necessary, as determined by one of ordinary skill in the art.
- the booster dose generates antibodies from primed B-cells, for example, an anamnestic response.
- the immunogenic conjugate elicits a high primary functional antibody response in infants or children, and is capable of eliciting an anamnestic response following a booster administration, demonstrating that the protective immune response elicited by the conjugate vaccine is long-lived.
- the disclosed immunogenic conjugates can be formulated into liquid preparations for example, for oral, nasal, anal, rectal, buccal, vaginal, peroral, intragastric, mucosal, perlingual, alveolar, gingival, olfactory, or respiratory mucosa administration. Suitable forms for such administration include suspensions, syrups, and elixirs.
- the disclosed immunogenic conjugates can also be formulated for parenteral, subcutaneous, intradermal, intramuscular, intraperitoneal, or intravenous administration, injectable administration, sustained release from implants, or administration by eye drops. Suitable forms for such administration include sterile suspensions and emulsions.
- Such formulations can be in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, and the like.
- a suitable carrier diluent, or excipient
- the immunogenic conjugates can also be lyophilized.
- the immunogenic conjugates or formulations thereof can contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired.
- Such preparations can include complexing agents, metal ions, polymeric compounds such as polyacetic acid, polyglycolic acid, hydrogels, dextran, and the like, liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts or spheroblasts.
- Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like. The presence of such additional components can influence the physical state, solubility, stability, rate of in vivo release, and rate of in vivo clearance, and are thus chosen according to the intended application, such that the characteristics of the carrier are tailored to the selected route of administration.
- the immunogenic conjugates may be provided as liquid suspensions or as freeze-dried products.
- suitable liquid preparations include, for example, isotonic aqueous solutions,
- Transdermal preparations include lotions, gels, sprays, ointments or other suitable techniques. If nasal or respiratory (mucosal) administration is desired (e.g., aerosol inhalation or insufflation),
- compositions can be in a form and dispensed by a squeeze spray dispenser, pump dispenser or aerosol dispenser. Aerosols are usually under pressure by means of a hydrocarbon. Pump dispensers can dispense a metered dose or a dose having a particular particle size, as discussed below.
- formulations of the conjugate can typically contain a major amount of water (for example, purified water) in addition to the active ingredient.
- Minor amounts of other ingredients such as pH adjusters, emulsifiers, dispersing agents, buffering agents, preservatives, wetting agents, gelling agents, colors, and the like can also be present.
- compositions are isotonic with the blood or other body fluid of the subject.
- the isotonicity of the compositions can be attained using sodium tartrate, propylene glycol, or other inorganic or organic solutes.
- Sodium chloride is particularly preferred.
- Buffering agents can be employed, such as acetic acid and salts, citric acid and salts, boric acid and salts, and phosphoric acid and salts.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils.
- Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like.
- Viscosity of the compositions can be maintained at the selected level using a
- thickening agent is methylcellulose, because it is readily and economically available and is easy to work with.
- suitable thickening agents include, for example, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer, and the like.
- concentration of the thickener can depend upon the agent selected and is used in an amount that can achieve the selected viscosity. Viscous compositions are normally prepared from solutions by the addition of such thickening agents.
- a pharmaceutically acceptable preservative can be employed to increase the shelf life of the compositions.
- Benzyl alcohol can be suitable, although a variety of preservatives including, for example, parabens, thimerosal, chlorobutanol, or benzalkonium chloride can also be employed.
- a suitable concentration of the preservative can be from 0.02% to 2% based on the total weight although there can be appreciable variation depending upon the agent selected.
- Pulmonary delivery of the conjugate can also be employed.
- the conjugate is delivered to the lungs of a mammal while inhaling and traverses across the lung epithelial lining to the blood stream.
- a wide range of mechanical devices designed for pulmonary delivery of therapeutic products can be employed, including but not limited to nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those of ordinary skill in the art.
- These devices employ formulations suitable for the dispensing of the conjugate.
- each formulation is specific to the type of device employed and can involve the use of an appropriate propellant material, in addition to diluents, adjuvants, and/or carriers useful in therapy.
- the conjugate is advantageously prepared for pulmonary delivery in particulate form with an average particle size of from 0.1 ⁇ or less to 10 ⁇ or more, more such as from about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, or 0.9 ⁇ to about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, or 9.5 ⁇ for pulmonary delivery.
- Pharmaceutically acceptable carriers for pulmonary delivery of the conjugates include carbohydrates such as trehalose, mannitol, xylitol, sucrose, lactose, and sorbitol.
- DPPC dipalmitoylphosphatidylcholine
- DOPE dioleoyl phosphatidylethanolamine
- DSPC distearoyl phosphatidylcholine
- DOPC dioleoyl phosphatidylcholine
- Natural or synthetic surfactants can be used, including polyethylene glycol and dextrans, such as cyclodextran.
- Bile salts and other related enhancers, as well as cellulose and cellulose derivatives, and amino acids can also be used.
- Liposomes, microcapsules, microspheres, inclusion complexes, and other types of carriers can also be employed.
- Formulations suitable for use with a nebulizer typically comprise the conjugate dissolved or suspended in water at a concentration of about 0.01 mg or less to 100 mg or more of conjugate per mL of solution, such as from about 0.1, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mg to about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 mg of conjugate per mL of solution.
- the formulation can also include a buffer and a simple sugar (for example, for protein stabilization and regulation of osmotic pressure).
- the nebulizer formulation can also contain a surfactant, to reduce or prevent surface induced aggregation of the conjugate caused by atomization of the solution in forming the aerosol.
- Formulations for use with a metered-dose inhaler device generally comprise a finely divided powder containing the inventive compound suspended in a propellant with the aid of a surfactant.
- the propellant can include conventional propellants, such as a chlorofluorocarbon, a
- hydrochlorofluorocarbon hydrofluorocarbons, and hydrocarbons, such as trichlorofluoromethane, dichlorodifluoroethane, dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, and combinations thereof.
- Suitable surfactants include sorbitan trioleate, soya lecithin, and oleic acid.
- Formulations for dispensing from a powder inhaler device typically comprise a finely divided dry powder containing the conjugate, optionally including a bulking agent, such as lactose, sorbitol, sucrose, mannitol, trehalose, or xylitol in an amount that facilitates dispersal of the powder from the device, typically from about 1 wt. % or less to 99 wt. % or more of the formulation, such as from about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 wt. % to about 55, 60, 65, 70, 75, 80, 85, or 90 wt. % of the formulation.
- a bulking agent such as lactose, sorbitol, sucrose, mannitol, trehalose, or xylitol in an amount that facilitates dispersal of the powder from the device, typically from about 1 wt. % or less to 99 wt. % or more of the formulation, such as from about 5,
- the composition can be in the form of a pyrogen-free, parenterally acceptable aqueous solution.
- parenterally acceptable solutions with suitable pH, isotonicity, stability, and the like, is within the ordinary skill in the art.
- a pharmaceutical composition for injection contains an isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's Injection, or other vehicles as are known in the art.
- the pharmaceutical compositions can also contain stabilizers, preservatives, buffers, antioxidants, or other additives known to those of ordinary skill in the art.
- the duration of the injection can vary depending upon various factors, and can comprise a single injection administered over the course of a few seconds or less, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours or more of continuous intravenous administration.
- the conjugate can be administered topically, systematically, or locally, via a liquid or gel, or as an implant or device.
- the disclosed conjugates or the disclosed conjugation methods can be useful in preparing vaccines for the treatment, inhibition, or prevention of a variety of bacterial infections, including but not limited to infections by Neisseria meningitidis, Neisseria gonorrhoeae, Streptococcus pneumoniae, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalaciae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, Haemophilus influenzae, and
- Salmonella typhi Salmonella typhi.
- the conjugates can be administered in combination with various vaccines either currently being used or in development, whether intended for human or non-human subjects.
- vaccines for human subjects and directed to infectious diseases include combined diphtheria and tetanus toxoids vaccine; pertussis whole cell vaccine; inactivated influenza vaccine; 23-valent pneumococcal vaccine; live measles vaccine; live mumps vaccine; live rubella vaccine; Bacille Calmette- Guerin I (BCG) tuberculosis vaccine; hepatitis A vaccine; hepatitis B vaccine; hepatitis C vaccine; rabies vaccine (e.g., human diploid cell vaccine); inactivated polio vaccine;
- BCG Bacille Calmette- Guerin I
- meningococcal polysaccharide vaccine e.g., Menomune®, Sanofi Pasteur
- quadrivalent meningococcal conjugate vaccine e.g., Menactra® (Sanofi Pasteur) or Menveo® (Novartis)
- yellow fever live virus vaccine typhoid killed whole cell vaccine
- cholera vaccine Japanese B encephalitis killed virus vaccine
- adenovirus vaccine cytomegalovirus vaccine
- rotavirus vaccine varicella vaccine
- anthrax vaccine small pox vaccine
- other commercially available and experimental vaccines e.g., Menomune®, Sanofi Pasteur
- quadrivalent meningococcal conjugate vaccine e.g., Menactra® (Sanofi Pasteur) or Menveo® (Novartis)
- yellow fever live virus vaccine e.g., typhoid killed whole cell vaccine
- cholera vaccine Japanese B encephalitis killed virus vaccine
- adenovirus vaccine
- the conjugates can be provided to an administering physician or other health care professional in the form of a kit.
- the kit is a package which houses a container which contains the immunogenic conjugate and instructions for administering the composition to a subject.
- the kit can optionally also contain one or more other therapeutic agents.
- the kit can optionally contain one or more diagnostic tools and instructions for use.
- a composition containing two or more of the disclosed immunogenic conjugates or other vaccines can be included, or separate pharmaceutical compositions containing different conjugates, vaccines, or therapeutic agents.
- the kit can also contain separate doses of the immunogenic conjugate for serial or sequential administration.
- the kit can contain suitable delivery devices, e.g., syringes, inhalation devices, and the like, along with instructions for administrating the therapeutic agents.
- the kit can optionally contain instructions for storage, reconstitution (if applicable), and administration of any or all therapeutic agents included.
- the kits can include a plurality of containers reflecting the number of administrations to be given to a subject. If the kit contains a first and second container, then a plurality of these can be present.
- MAPS was produced by SynCo BioPartners, Amsterdam, The Netherlands. MCPS was from FioCruz, BioMaguinhus, Brazil. MWPS and MYPS were from Chiron (Emoryville, CA). Tetanus toxoid (TT) was obtained from Wyeth Vaccines and Serum Institute of India, l-cyano-4- dimethylaminopyridinium tetrafluoroborate (CDAP) was purchased from Sigma- Aldrich (St. Louis, MO).
- the gene of fHbpl was amplified by PCR using genomic N. meningitidis H44/76 genomic DNA as a template and forward primer
- AAGCTTCCTCGAGTGAGCAGTGGAGGGGGTGGTGTCGCC (SEQ ID NO: 9) and reverse primer GGCGGGGAATTCACTTATTGCTTGGCGGCAAGGCCGAT (SEQ ID NO: 10).
- the gene of fHbp2 was amplified by PCR using genomic N. meningitidis 7608 genomic DNA as a template and forward primer AAGCTTCCTCGAGTGAGCAGTGGAGGCGGCGGTGTCGCC (SEQ ID NO: 11) and reverse primer
- GGCGGGGAATTCACTTACTACTGTTTGCCGGCGATGCC (SEQ ID NO: 12).
- the PCR products were cloned in the XhoI-EcoRI site of pT7-MAT-Tag-Flag-l vector (Sigma- Aldrich) which were then used to transform E. coli cells BL21(DE3).
- the transformed cells were grown in LB broth, induced with 1 mM IPTG, the cells were lysed, and the His-tagged proteins purified on Ni columns.
- fHbpl/fHbp2 fusion protein (fHbpl+2)
- the gene of fHbpl was amplified by PCR using genomic N. meningitidis H44/76 genomic DNA as a template and the forward primer used for fHbpl (SEQ ID NO: 9) and the reverse primer
- PCR product was reamplified using the same forward primer and the reverse primer GCCGCCTCCTCTAGAACCGCCACCGCCAGAGCCACC (SEQ ID NO: 14).
- the gene of fHbp2 was amplified by PCR using genomic N. meningitidis 7608 genomic DNA as a template and the forward primer
- GGTGGCGGTTCTAGAGGAGGCGGCGGTGTCGCC (SEQ ID NO: 16) and the same reverse primer.
- the fHbpl PCR product was digested with Xhol and Xbal, while the fHbp2 PCR product was digested with Xbal and EcoRI.
- the digested products were cloned into the XhoI-EcoRI site of pT7-MATTag-Flag-l vector (Sigma- Aldrich) which was then used to transform E. coli cells
- the transformed cells were grown in LB broth, induced with 1 mM IPTG, the cells were lysed and the His-tagged proteins purified on Ni columns.
- the purified proteins were analyzed on 10% SDS-PAGE gels and Western blots using the Jar 5 and Jar 11 monoclonal antibodies.
- FIGS. 1A-B The SDS-PAGE gels and Western blots of the purified fHbpl, fHbp2 and fHbp(l+2) proteins used for the production of the conjugate vaccine are shown in FIGS. 1A-B.
- the purified fHbp (1+2) protein was conjugated to PS either by the conventional CDAP conjugation method developed by Lees at al. (Vaccine 26: 190-198, 1996) which required 2-2.5 minutes activation time of PS at room temperature in order to achieve maximal yield or by the modified method where activation of PS with CDAP was performed at 4°C for 1.5 to 2 hours. Size exclusion HPLC profiles of the products of the two methods showed that the modified method resulted in higher conjugation yield when compared to the conventional method (FIG. 2).
- the modified conjugation method was used for the subsequent conjugation of all the purified fHbp proteins to meningococcal polysaccharides.
- the peak of each of the fHbpl, fHbp2 and fHbp(l+2) is at 22-23 minutes. Conjugate formation between PS and the proteins is indicated by the shift of protein signal from 22-23 minute to higher molecular weight position at 15-19 minutes upon conjugation, with remaining leftover unconjugated protein residue unmoved.
- mice Groups of 5 or 10 NIH-Swiss mice were immunized subcutaneously with 0.1 mL inoculum containing conjugates prepared in Example 1 or mixture of fHbp and native PS (control) on days 0 and 14, and 28 with sera collected on day 35.
- IMMUNLON® IB plates (Dynatech) were coated with 100 of coating solution containing PBS, pH 7.4, native Mn A, C, W135 or Y PS (5 ⁇ g/mL) admixed with methylated human serum albumin (5 ⁇ g/mL), or 1 ⁇ g/mL fHbpl or fHbp2 for two hours, and washed three times with 150 ⁇ , of washing buffer (PBS, pH 7.4, 0.05% TWEEN® 20 and 0.02% NaN 3 ).
- washing buffer PBS, pH 7.4, 0.05% TWEEN® 20 and 0.02% NaN 3
- Serum samples or reference serum (assigned with 3,200 units/mL anti-Mn A, C, W135 or Y PS antibody, or 32,000 units/mL for anti-fflbpl or fHbp2) were diluted with dilution buffer (PBS, pH 7.4, 4% newborn calf serum, 0.02% NaN 3 ) in a series of two-fold dilutions starting from 1:200.
- dilution buffer PBS, pH 7.4, 4% newborn calf serum, 0.02% NaN 3
- Plates were incubated overnight at room temperature, washed three times with 150 ⁇ ⁇ washing buffer, and then incubated with 100 ⁇ ⁇ goat anti-mouse IgG Fc conjugated with alkaline phosphatase (1/3000 dilution in dilution buffer) for two hours. The plates were washed three times with 150 ⁇ ⁇ washing buffer and incubated with 100 ⁇ ⁇ p-nitrophenyl phosphate (1 mg/mL in 1 M Tris, pH 9 plus 0.3 mM MgCl 2 ) to develop color.
- mice immunized with MCPS conjugates to fHbpl, fHbp2 and fHbp(l+2) mounted a strong IgG response to both the carrier proteins fHbpl, fHbp2 and fHbp(l+2) and also the meningococcal C polysaccharide (Table 1). As expected, an immune response to the meningococcal C
- fHbp(l+2)MCPS conjugates could induce comparable antibody levels (units/mL) as the unconjugated protein in the control groups. Since the fusion protein fHbp(l+2) was capable of inducing a strong immune response to both fHbpl and fHbp2, it was used as the carrier protein for subsequent experiments.
- the level of antibody against the carrier protein induced in mice immunized with the conjugate was similar to the level of antibody induced in mice immunized with the unconjugated carrier fHbp (1+2) protein (23,195-98,252 units/mL vs. 64,468 units/mL for fHbpl component; and 10,611-35,327 units/mL vs. 6,393 units/mL for fHbp2 component).
- fHbp(l+2) can serve as an effective carrier protein for conjugates of meningococcal groups A, C, W135 and Y PS in singular monovalent or combined formulations.
- the serum bactericidal assay was performed as previously described (Moran et ah, Infect. Immun. 62:5290-295, 1994) using normal human serum pre-screened for lack of bactericidal activity against the test strain as a source of complement. Individual mouse sera from each group of mice were pooled before being tested in the serum bactericidal assay. Depending on the amount of serum available and the expected titer, the pooled mouse sera were tested using a starting dilution of 1:2 to 1:8. When starting dilutions of 1:4 or 1:8 were used, results were extrapolated to lower dilutions using a typical killing curve.
- the reciprocal of the highest dilution of serum that killed >50% of the bacteria was taken as the end point titer of the serum. If the percent kill was between 35% and 50% at the lowest dilution tested, the serum was assigned the titer of the next lower dilution. If the percent kill was between 0% and 35% the serum was assigned a titer two dilutions lower. If there was less than 50% killing at a dilution of 1:2, the serum was assigned a titer of 1: 1. The highest dilution tested was 1:512. All the pre- vaccination sera from the mice lacked bactericidal antibodies against any of the test strains and were assigned a titer of 1: 1.
- the bactericidal activity of the induced IgG antibody against fHbp(l+2) was tested against N. meningitidis serogroup B fHbpl -expressing strains 44/76 and 8570, and fHbp2-expressing strains 7608 and 8047, and serogroup X strains 9557, 9558, and 9559 shown in Table 3.
- the pre- bleed control group showed little bactericidal activity, and its titer was assigned with 1.
- Bactericidal antibodies to fHbpl -expressing serogroup B and X N. meningitidis strains were observed in the sera of mice immunized with the unconjugated mixture of fHbp(l+2) and serogroups A, C, W-135, and Y PS. While antibodies to fHbp2 were observed in the induced antisera, they were not found to be bactericidal. Bactericidal antibodies to fHbpl -expressing serogroup B and X N. meningitidis strains were also observed in the sera of mice immunized with fHbp(l+2) and serogroups A, C, W-135, and Y PS conjugates.
- Bactericidal antibodies to fHbp2 was variable in the sera of mice immunized with the conjugate, and in general the bactericidal antibodies to fHbpl immunized with fHbp(l+2)MWPS conjugate was comparatively lower than the levels present in sera of mice immunized with the other fHbp(l+2) PS conjugates.
- the full dosage group (group f) had about the same bactericidal titer (titer 4) as the control group for serogroup B fHbpl -expressing strains and a reduced titer (titer 2) for serogroup X strains, while the 1 ⁇ 4 dosage group had reduced titer (titer 2) for both groups B and X strains.
- group f had about the same bactericidal titer (titer 4) as the control group for serogroup B fHbpl -expressing strains and a reduced titer (titer 2) for serogroup X strains, while the 1 ⁇ 4 dosage group had reduced titer (titer 2) for both groups B and X strains.
- Table 3 Table 3.
- the bactericidal activity of the PS-specific IgG antibody was measured by bactericidal assay against PS-homologous strains (4 strains for serogroups A and C and 3 strains for W-135 and Y) (Table 4).
- PS-homologous strains (4 strains for serogroups A and C and 3 strains for W-135 and Y)
- the pre-bleed and the mixture of ACWY PS and fHbp(l+2) control groups showed no bactericidal activity (titer 1). All the tested antisera induced by monovalent conjugates or combined formulations were found to be bactericidal to the tested PS-homologous strains (Table 4).
- capsular polysaccharides from serogroups A, C, W-135 and Y are known to be non- immunogenic in mice, these data suggest that fHbp can indeed be used as a carrier protein for a conjugate vaccine which in turn would induce PS-specific IgG antibody. Comparing the
- serogroups A, C and Y monovalent conjugates induced antisera with equal or higher titer than the combined formulations.
- sero group W-135 monovalent conjugate induced antisera with equal or lower titer than the combined formulations.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Virology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/402,988 US9427476B2 (en) | 2012-05-24 | 2013-05-23 | Multivalent meningococcal conjugates and methods for preparing conjugates |
| CN201380037403.7A CN104428008B (zh) | 2012-05-24 | 2013-05-23 | 多价脑膜炎球菌缀合物及制备缀合物的方法 |
| IN9791DEN2014 IN2014DN09791A (https=) | 2012-05-24 | 2014-11-19 | |
| US15/225,102 US9956278B2 (en) | 2012-05-24 | 2016-08-01 | Multivalent meningococcal conjugates and methods for preparing conjugates |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261651382P | 2012-05-24 | 2012-05-24 | |
| US61/651,382 | 2012-05-24 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/402,988 A-371-Of-International US9427476B2 (en) | 2012-05-24 | 2013-05-23 | Multivalent meningococcal conjugates and methods for preparing conjugates |
| US15/225,102 Division US9956278B2 (en) | 2012-05-24 | 2016-08-01 | Multivalent meningococcal conjugates and methods for preparing conjugates |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013177397A1 true WO2013177397A1 (en) | 2013-11-28 |
Family
ID=48579502
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/042428 Ceased WO2013177397A1 (en) | 2012-05-24 | 2013-05-23 | Multivalent meningococcal conjugates and methods for preparing cojugates |
Country Status (4)
| Country | Link |
|---|---|
| US (2) | US9427476B2 (https=) |
| CN (1) | CN104428008B (https=) |
| IN (1) | IN2014DN09791A (https=) |
| WO (1) | WO2013177397A1 (https=) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160166674A1 (en) * | 2012-06-14 | 2016-06-16 | Novartis Ag | Vaccines for serogroup x meningococcus |
| US9550814B2 (en) | 2002-11-22 | 2017-01-24 | Glaxosmithkline Biologicals Sa | Multiple variants of meningococcal protein NMB1870 |
| US9572884B2 (en) | 2009-03-24 | 2017-02-21 | Glaxosmithkline Biologicals Sa | Adjuvanting meningococcal factor H binding protein |
| US9579372B2 (en) | 2008-02-21 | 2017-02-28 | Glaxosmithkline Biologicals Sa | Meningococcal fHBP polypeptides |
| US9610342B2 (en) | 1999-05-19 | 2017-04-04 | Glaxosmithkline Biologicals Sa | Combination neisserial compositions |
| CN108144056A (zh) * | 2016-12-02 | 2018-06-12 | 武汉博沃生物科技有限公司 | 多价肺炎球菌多糖结合疫苗及其制备方法 |
| WO2022084663A1 (en) * | 2020-10-20 | 2022-04-28 | The Chancellor, Masters And Scholars Of The University Of Oxford | Compositions and methods for inducing an immune response |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104428008B (zh) * | 2012-05-24 | 2020-10-09 | 美国政府(由卫生和人类服务部的部长所代表) | 多价脑膜炎球菌缀合物及制备缀合物的方法 |
| BR112019003992A2 (pt) | 2016-09-02 | 2019-05-28 | Sanofi Pasteur Inc | vacina contra neisseria meningitidis |
| CN107151270B (zh) * | 2017-03-22 | 2018-07-31 | 武汉博沃生物科技有限公司 | 重组ΔfHbp-NadA融合蛋白载体及其制备方法和应用 |
| CN117643624A (zh) * | 2024-01-30 | 2024-03-05 | 成都康华生物制品股份有限公司 | 一种双价多糖结合疫苗的制备方法及双价多糖结合疫苗 |
Citations (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6194388B1 (en) | 1994-07-15 | 2001-02-27 | The University Of Iowa Research Foundation | Immunomodulatory oligonucleotides |
| US6207646B1 (en) | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| US6214806B1 (en) | 1997-02-28 | 2001-04-10 | University Of Iowa Research Foundation | Use of nucleic acids containing unmethylated CPC dinucleotide in the treatment of LPS-associated disorders |
| US6218371B1 (en) | 1998-04-03 | 2001-04-17 | University Of Iowa Research Foundation | Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines |
| US6239116B1 (en) | 1994-07-15 | 2001-05-29 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| US6339068B1 (en) | 1997-05-20 | 2002-01-15 | University Of Iowa Research Foundation | Vectors and methods for immunization or therapeutic protocols |
| US6406705B1 (en) | 1997-03-10 | 2002-06-18 | University Of Iowa Research Foundation | Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant |
| US6429199B1 (en) | 1994-07-15 | 2002-08-06 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules for activating dendritic cells |
| WO2005014037A2 (en) | 2003-08-06 | 2005-02-17 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Polysaccharide-protein conjugate vaccines |
| US6921496B2 (en) | 2000-03-20 | 2005-07-26 | Massachusetts Institute Of Technology | Inorganic particle conjugates |
| WO2007109129A2 (en) | 2006-03-17 | 2007-09-27 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Methods for preparing complex multivalent immunogenic conjugates |
| US20080025993A1 (en) * | 2002-08-30 | 2008-01-31 | Ralph Biemans | Method for Refolding Neisserial Nspa Protein |
| WO2011110634A1 (en) * | 2010-03-10 | 2011-09-15 | Glaxosmithkline Biologicals S.A. | Vaccine composition |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8048432B2 (en) | 2003-08-06 | 2011-11-01 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Polysaccharide-protein conjugate vaccines |
| CN102356089B (zh) | 2008-02-21 | 2014-02-19 | 诺华股份有限公司 | 脑膜炎球菌fHBP多肽 |
| CN102421449A (zh) | 2009-03-24 | 2012-04-18 | 诺华有限公司 | 含14型肺炎球菌糖的组合 |
| EP3017826A1 (en) | 2009-03-24 | 2016-05-11 | Novartis AG | Combinations of meningococcal factor h binding protein and pneumococcal saccharide conjugates |
| EP2538969A4 (en) | 2010-02-22 | 2013-11-27 | Liquidia Technologies Inc | VACCINES FROM POLYSACCHARIDE PARTICLES |
| CN104428008B (zh) * | 2012-05-24 | 2020-10-09 | 美国政府(由卫生和人类服务部的部长所代表) | 多价脑膜炎球菌缀合物及制备缀合物的方法 |
-
2013
- 2013-05-23 CN CN201380037403.7A patent/CN104428008B/zh active Active
- 2013-05-23 WO PCT/US2013/042428 patent/WO2013177397A1/en not_active Ceased
- 2013-05-23 US US14/402,988 patent/US9427476B2/en active Active
-
2014
- 2014-11-19 IN IN9791DEN2014 patent/IN2014DN09791A/en unknown
-
2016
- 2016-08-01 US US15/225,102 patent/US9956278B2/en active Active
Patent Citations (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6429199B1 (en) | 1994-07-15 | 2002-08-06 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules for activating dendritic cells |
| US6207646B1 (en) | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| US6194388B1 (en) | 1994-07-15 | 2001-02-27 | The University Of Iowa Research Foundation | Immunomodulatory oligonucleotides |
| US6239116B1 (en) | 1994-07-15 | 2001-05-29 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| US6214806B1 (en) | 1997-02-28 | 2001-04-10 | University Of Iowa Research Foundation | Use of nucleic acids containing unmethylated CPC dinucleotide in the treatment of LPS-associated disorders |
| US6406705B1 (en) | 1997-03-10 | 2002-06-18 | University Of Iowa Research Foundation | Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant |
| US6339068B1 (en) | 1997-05-20 | 2002-01-15 | University Of Iowa Research Foundation | Vectors and methods for immunization or therapeutic protocols |
| US6218371B1 (en) | 1998-04-03 | 2001-04-17 | University Of Iowa Research Foundation | Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines |
| US6921496B2 (en) | 2000-03-20 | 2005-07-26 | Massachusetts Institute Of Technology | Inorganic particle conjugates |
| US20080025993A1 (en) * | 2002-08-30 | 2008-01-31 | Ralph Biemans | Method for Refolding Neisserial Nspa Protein |
| WO2005014037A2 (en) | 2003-08-06 | 2005-02-17 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Polysaccharide-protein conjugate vaccines |
| WO2005037320A2 (en) | 2003-08-06 | 2005-04-28 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Process for preparing polysaccharide-protein conjugate vaccines |
| WO2007109129A2 (en) | 2006-03-17 | 2007-09-27 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Methods for preparing complex multivalent immunogenic conjugates |
| WO2011110634A1 (en) * | 2010-03-10 | 2011-09-15 | Glaxosmithkline Biologicals S.A. | Vaccine composition |
Non-Patent Citations (22)
| Title |
|---|
| "Molecular Biology and Biotechnology: a Comprehensive Desk Reference", 1995, VCH PUBLISHERS, INC. |
| "Remington: The Science and Practice of Pharmacy", 2005, LIPPINCOTT, WILLIAMS, & WILKINS |
| "The Encyclopedia of Molecular Biology", 1994, BLACKWELL SCIENCE LTD. |
| "Vaccine Design, the Subunit and Adjuvant Approach", 1995, PLENUM PRESS |
| APPL. BIOCHEM. BIOTECH., vol. 9, 1984, pages 285 - 305 |
| BENJAMIN LEWIN: "Genes V", 1994, OXFORD UNIVERSITY PRESS |
| DINTZIS, PNAS, vol. 73, 1976, pages 3671 - 75 |
| FINNE ET AL., LANCET, vol. 2, 1983, pages 355 - 357 |
| FLETCHER ET AL., INF. IMMUN, vol. 72, 2004, pages 2088 - 2100 |
| FLETCHER ET AL., INF. IMMUN., vol. 72, 2004, pages 2088 - 2100 |
| GREGORY MOE ET AL: "Sequential immunization with vesicles prepared from heterologous Neisseria meningitidis strains elicits broadly protective serum antibodies to group B strains.", INFECTION AND IMMUNITY, vol. 70, no. 11, 1 November 2002 (2002-11-01), pages 6021 - 6031, XP055013367, ISSN: 0019-9567, DOI: 10.1128/IAI.70.11.6021-6031.2002 * |
| JOACHIM KOHN ET AL: "The use of cyanogen bromide and other novel cyanylating agents for the activation of polysaccharide resins", APPLIED BIOCHEMISTRY AND BIOTECHNOLOGY ; PART A: ENZYME ENGINEERING AND BIOTECHNOLOGY, HUMANA PRESS INC, NEW YORK, vol. 9, no. 3, 1 June 1984 (1984-06-01), pages 285 - 305, XP035176719, ISSN: 1559-0291, DOI: 10.1007/BF02798493 * |
| LEE ET AL., J. IMMUNOL., vol. 116, 1976, pages 1711 - 18 |
| LEE ET AL., VACCINE, vol. 27, 2009, pages 726 - 732 |
| LEES ET AL., VACCINE, vol. 26, 1996, pages 190 - 198 |
| LEES, VACCINE, vol. 26, 1996, pages 190 - 198 |
| LEWIS ET AL., PLOS PATHOGENS, vol. 6, pages E1001027 |
| MASIGNANI ET AL., J. EXP. MED., vol. 197, 2003, pages 789 - 799 |
| MORAN ET AL., INFECT. IMMUN., vol. 62, 1994, pages 5290 - 295 |
| POZSGAY ET AL., PNAS, vol. 96, 1999, pages 5194 - 97 |
| SEIB K L ET AL: "Influence of serogroup B meningococcal vaccine antigens on growth and survival of the meningococcus in vitro and in ex vivo and in vivo models of infection", VACCINE, ELSEVIER LTD, GB, vol. 28, no. 12, 11 March 2010 (2010-03-11), pages 2416 - 2427, XP026930023, ISSN: 0264-410X, [retrieved on 20100110], DOI: 10.1016/J.VACCINE.2009.12.082 * |
| WEYNANTS ET AL., INF. IMMUN., vol. 77, 2009, pages 2084 - 2093 |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9610342B2 (en) | 1999-05-19 | 2017-04-04 | Glaxosmithkline Biologicals Sa | Combination neisserial compositions |
| US9550814B2 (en) | 2002-11-22 | 2017-01-24 | Glaxosmithkline Biologicals Sa | Multiple variants of meningococcal protein NMB1870 |
| US10328142B2 (en) | 2002-11-22 | 2019-06-25 | Glaxosmithkline Biologicals Sa | Multiple variants of meningococcal protein NMB1870 |
| US9579372B2 (en) | 2008-02-21 | 2017-02-28 | Glaxosmithkline Biologicals Sa | Meningococcal fHBP polypeptides |
| US9572884B2 (en) | 2009-03-24 | 2017-02-21 | Glaxosmithkline Biologicals Sa | Adjuvanting meningococcal factor H binding protein |
| US10245311B2 (en) | 2009-03-24 | 2019-04-02 | Glaxosmithkline Biologicals Sa | Adjuvanting meningococcal factor H binding protein |
| US10568953B2 (en) | 2009-03-24 | 2020-02-25 | Glaxosmithkline Biologicals Sa | Adjuvanting meningococcal factor H binding protein |
| US20160166674A1 (en) * | 2012-06-14 | 2016-06-16 | Novartis Ag | Vaccines for serogroup x meningococcus |
| AU2013276083B2 (en) * | 2012-06-14 | 2018-04-05 | Institut Pasteur | Vaccines for serogroup X meningococcus |
| US10376573B2 (en) * | 2012-06-14 | 2019-08-13 | Glaxosmithkline Biologicals Sa | Vaccines for serogroup X meningococcus |
| CN108144056A (zh) * | 2016-12-02 | 2018-06-12 | 武汉博沃生物科技有限公司 | 多价肺炎球菌多糖结合疫苗及其制备方法 |
| WO2022084663A1 (en) * | 2020-10-20 | 2022-04-28 | The Chancellor, Masters And Scholars Of The University Of Oxford | Compositions and methods for inducing an immune response |
Also Published As
| Publication number | Publication date |
|---|---|
| US20160331824A1 (en) | 2016-11-17 |
| CN104428008A (zh) | 2015-03-18 |
| US9427476B2 (en) | 2016-08-30 |
| CN104428008B (zh) | 2020-10-09 |
| IN2014DN09791A (https=) | 2015-07-31 |
| US20150110829A1 (en) | 2015-04-23 |
| US9956278B2 (en) | 2018-05-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9956278B2 (en) | Multivalent meningococcal conjugates and methods for preparing conjugates | |
| JP7690523B2 (ja) | 多価肺炎球菌多糖体-タンパク質複合体組成物 | |
| CN103623405B (zh) | 多糖-蛋白轭合物疫苗 | |
| EP3576784B1 (en) | Methods for making polysaccharide-protein conjugates | |
| JP6101330B2 (ja) | アジュバント添加した髄膜炎菌h因子結合タンパク質 | |
| JP5380111B2 (ja) | 莢膜性多糖類の可溶化および組合せワクチン | |
| EP1355673B1 (en) | Multivalent meningococcal polysaccharide-protein conjugate vaccine | |
| JP2021512870A (ja) | 多価肺炎球菌多糖体−タンパク質複合体組成物 | |
| JP2025084846A (ja) | 免疫原性血清型35b肺炎球菌多糖類-タンパク質コンジュゲート及びそれを作成するためのコンジュゲーションプロセス | |
| JP2011074087A (ja) | 髄膜炎菌血清群aおよびcに対する免疫方法 | |
| CN103402544A (zh) | 缀合方法 | |
| AU2014201676B2 (en) | Multivalent meningococcal polysaccharide-protein conjugate vaccine | |
| HK1195512B (en) | Polysaccharide-protein conjugate vaccines | |
| AU2002241951A1 (en) | Multivalent meningococcal polysaccharide-protein conjugate vaccine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13728055 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14402988 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 13728055 Country of ref document: EP Kind code of ref document: A1 |