WO2013113252A1 - Procédé de régulation du niveau d'expression du gène cpy et utilisation de celui-ci - Google Patents

Procédé de régulation du niveau d'expression du gène cpy et utilisation de celui-ci Download PDF

Info

Publication number
WO2013113252A1
WO2013113252A1 PCT/CN2013/000091 CN2013000091W WO2013113252A1 WO 2013113252 A1 WO2013113252 A1 WO 2013113252A1 CN 2013000091 W CN2013000091 W CN 2013000091W WO 2013113252 A1 WO2013113252 A1 WO 2013113252A1
Authority
WO
WIPO (PCT)
Prior art keywords
acid molecule
gene
expression
nucleic acid
cyp
Prior art date
Application number
PCT/CN2013/000091
Other languages
English (en)
Chinese (zh)
Inventor
杜权
Original Assignee
北京大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 北京大学 filed Critical 北京大学
Publication of WO2013113252A1 publication Critical patent/WO2013113252A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/531—Stem-loop; Hairpin

Definitions

  • the present invention relates to the field of biomedical technology, and in particular to a method for regulating the expression level of a CYP450 gene in a non-human mammal and the application of the method in preparing a non-human mammalian model system; further, the present invention relates to the use of the method Production of animal model systems, and application of animal model systems in medical, pharmacological, preclinical drug research, drug development, laboratory animal model system preparation, disease diagnosis or disease treatment methods, especially in preclinical drug research . Background technique
  • Cytochrome P450 (Cytochrome P450, or CYP or P450 for short) is a superfamily of heme-thiol protein, which has 55 functional genes and 29 pseudogenes. According to the homology of gene sequences, this gene is super The family can be further divided into 17 gene families and 42 subfamilies.
  • CYP protein is mainly distributed on the endoplasmic reticulum and mitochondrial inner membrane. As a terminal oxygenase, it participates in the metabolism of major endogenous and exogenous substances in organisms, including the synthesis of alcohol hormones. , drug metabolism, etc.
  • CYP1A2 and clinical drug metabolism
  • CYP1A2 is a CYP subtype induced by polycyclic aromatic hydrocarbons, mainly expressed in the liver.
  • the expression of CYP1A2 gene in human liver accounts for about 13% of the total CYP protein.
  • the expression levels of CYP1A2 genes vary widely and are affected by non-genetic factors, with significant ethnic and gender differences.
  • CYP1A2 is mainly involved in the metabolism of more than 20 kinds of drugs such as caffeine, phenacetin, acetaminophen, 17 ⁇ -estradiol, propranol, verapamil, nifedipine, imipramine, etc. It plays an important role in the activation or inactivation of pre-carcinogens. Studies have shown that the physiological activity of the CYP1A2 gene is closely related to the efficacy, toxicity, and susceptibility of certain tumors.
  • CYP enzyme and drug metabolism and drug clinical research recently reported in the United States that only about 10% of drug candidates in the clinical drug research process can finally enter the market, about 40% of drug candidates are due to no in vivo activity or drug generation The kinetic parameters were poor and were eliminated.
  • the process of new drug research can be generally divided into two stages: drug design and new drug development.
  • drug development phase the candidate needs to be evaluated for metabolism, toxicity and efficacy.
  • Drug metabolism studies, especially the role of the CYP superfamily in drug metabolism, are an important aspect.
  • the CYP study provides a more optimized technical solution, but because of its long cycle, high cost, and gene function compensation, etc. The reason is that the application of this technology is still very limited. In large animal models commonly used in drug metabolism, such as dogs and monkeys, transgenic technology is not yet mature.
  • the present invention applies a bulk RNA interference technique or a genetic engineering overexpression technique to drug metabolism research, and utilizes an in vivo delivery system to modulate an oligonucleic acid molecule capable of expressing a certain CYP gene ( siRNA, miRNA or its analog) or its expression vector, an expression vector capable of expressing a certain CYP gene, is introduced into a non-human mammal, and the expression level of the CYP in the animal is reduced or increased, thereby studying the target CYP in drug metabolism. effect.
  • the present invention provides a technical solution and system that can be used for preclinical research of drugs, enabling drug metabolism studies to be carried out in biological systems that mimic the complex environment of the human body as much as possible.
  • the present invention provides a method for manipulating the expression level of a CYP gene in a non-human mammal, comprising the steps of: 1) obtaining an oligonucleic acid molecule capable of inhibiting expression of a CYP gene of interest, or a CYP gene capable of producing an inhibitory target An expression vector for the expressed oligonucleic acid molecule, or an expression vector capable of expressing the CYP gene of interest; 2) contacting the oligonucleic acid molecule or expression vector of step 1 with a delivery system to form a mixture; 3) step 2 The mixture is introduced into the non-human mammal; 4) detecting the expression level of the CYP gene of interest in the non-human mammal obtained in step 3).
  • the CYP gene described in the present invention includes, but is not limited to, the in vivo and exogenous CYP genes of the animal; preferably, the CYP gene of the present invention is a human derived CYP gene.
  • the invention provides a method for manipulating the expression level of a CYP gene in a non-human mammal, said mammal being preferably a commonly used model animal; more preferably, the invention provides a method commonly used in medicine A method of manipulating the expression level of a CYP gene in a non-human mammal in a preclinical metabolic study; more preferably, the present invention provides a method of manipulating the expression level of a CYP gene in a mouse, rat, dog, pig or monkey.
  • the invention provides a method of manipulating the expression level of a CYP gene in a non-human mammal, the CYP gene being one or more members of the cytochrome P450 (Cytochrome P450) gene superfamily.
  • the CYP gene being one or more members of the cytochrome P450 (Cytochrome P450) gene superfamily.
  • the CYP gene includes, but is not limited to, the following genes: 1 , 1A, 1 a, 1A1 , 1 a1 , 1A2, 1a2, 1A4, 1A5, 1A8P, 1 B, 1 b, 1 B1 , 1 b1 , 1 C1 , 1 C2, 1 D1, 1 D1 P, 2, 2A, 2a, 2a1, 2a2, 2a3, 2a4, 2a5, 2A6, 2A7, 2A7PC, 2A7PT, 2A8, 2A9, 2A10, 2A1 1 , 2a12, 2A13, 2A18PC, 2A18PN, 2A19, 2a21, 2a22, 2A23, 2A24, 2A25, 2B, 2b, 2b1, 2b2, 2b3, 2B6, 2B7P, 2B8, 2b9, 2b10, 2B1 1 , 2B12, 2b13, 2B14, 2B15, 2B16P, 2B17
  • the invention provides a method of manipulating a level of expression of a CYP gene in a non-human mammal, the CYP gene comprising a CYP gene expressed in the animal, including but not limited to, a CYP gene expressed in vivo in an animal, The full-length or partial sequence of the endogenous CYP gene or the transcript thereof exogenously introduced into the animal, the full-length or partial sequence of the exogenously introduced non-endogenous CYP gene or a transcript thereof; preferably, the CYP The gene is a human-derived CYP gene introduced exogenously.
  • the method of the present invention for manipulating the expression level of a CYP gene in a non-human mammal comprises all methods for altering the expression level of a CYP gene in the animal, including but not limited to increasing or decreasing the expression level of an endogenous CYP gene, Or reducing the expression level of the exogenous CYP gene; preferably, increasing or decreasing the expression level of the human-derived CYP gene in the non-human mammal.
  • the methods provided herein increase expression levels in a non-human mammal by introducing an expression vector capable of expressing a CYP gene of interest into a non-human mammal.
  • the expression vector capable of expressing the CYP gene of interest includes, but is not limited to, a vector construct comprising all or part of the genomic sequence of the CYP gene of interest; the CYP gene of interest includes, but is not limited to, the in vivo CYP gene of the non-human mammal A full-length or partial sequence of a full-length or partial sequence of an exogenous CYP gene; preferably, the CYP gene of interest is a human-derived CYP gene.
  • the present invention provides a method for reducing the expression level of a CYP gene of interest by introducing an oligonucleic acid molecule capable of inhibiting expression of a CYP gene in the non-human mammal or an expression vector thereof into the animal.
  • the oligonucleic acid molecule capable of inhibiting the expression of the CYP gene of interest or an expression vector thereof includes a small interfering nucleic acid molecule, an antisense nucleic acid molecule, a microRNA and an analog thereof or a miRNA inhibitor, a siRNA expression vector or a shRNA expression vector.
  • the sense strand and the antisense strand of the small interfering nucleic acid molecule provided herein are 15-35 nucleotides in length, preferably 19-23 nucleotides, more preferably 21 nucleotides.
  • the terminal of any of the above small interfering nucleic acid molecules may be a blunt end or a 3' overhanging end having a 3' overhanging sequence; the number of bases of the 3' overhanging sequence is 1 -6 nucleotides, preferably 2 4 nucleotides, more preferably 2 nucleotides.
  • the sense strand of the small interfering nucleic acid molecule consists of two or more separate nucleic acid strands.
  • the small interfering nucleic acids provided by the invention include unmodified natural small interfering nucleic acid molecules and chemically modified non-native small interfering nucleic acid molecules.
  • the chemical modification is a modification of the ribose 2'-OH in the nucleotide; more preferably, the chemical modification is such that the ribose 2'-OH in the nucleotide is replaced by a methoxy or fluoro .
  • the chemical modification is such that the phosphodiester bond between the nucleotides is replaced by a phosphorothioate linkage.
  • the chemically modified base of the nucleotide is substituted with a non-RNA base; preferably, the non-RNA base
  • the base is selected from the group consisting of thymine 5-methylcytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propyne 5-propynyluracil, 5-propyny-6-fluoroluracil, 5-methylthiazoleuracil, 6-aminopurine (6-aminopurine) -aminopurine), 2-aminopurine, inosine, 2,6-diaminopurine, 7-propynyl-7-deaza adenine (7 -propyne-7-deazaadenine) 7-propyne-7-deazaguanine, 2-chloro-6-aminopurine.
  • the chemical modification is such that a base in a nucleotide is substituted with a DNA base.
  • a delivery system for delivering an oligonucleic acid molecule or expression vector into the non-human mammal of the invention comprises all delivery vehicle systems capable of accomplishing the purpose, including but not limited to liposomes, high molecular weight polymers, Polypeptides, nanoparticles.
  • in vivo delivery vehicles for use in the present invention can be prepared according to the methods described in the following references, which are incorporated herein by reference in its entirety. References: 1.
  • Invention patent application number WO2010144740-A1 and US2010324120-A1 inventors: CHEN J, ANSELL S, AKINC A, DORKIN JR, QIN X, CANTLEY W, MANOHARAN M, RAJEEV KG, NARAYANANNAIR JK, JAYARAMAN M ; Patentee: ALNYLAM PHARM INC. 2.
  • Semple SC Akinc A, Chen J, Sandhu AP, Mui BL, Cho CK, Sah DW, Stebbing D, Crosley EJ, Yaworski E, Hafez IM, Dorkin JR, Qin J, Lam K, Rajeev KG, Wong KF, Jeffs LB, Nechev L, Eisenhardt ML, Jayaraman M, Kazem M, Maier MA, Srinivasulu M, Weinstein MJ, Chen Q, Alvarez R, Barros SA, De S, Klimuk SK, Borland T, Kosovrasti V, Cantley WL, Tarn YK , Manoharan M, Ciufolini MA, Tracy MA, de Fougerolles A, MacLachlan I, Cullis PR, Madden TD, Hope MJ. Rational design of cationic lipids for siRNA delivery. Nature Biotechnology. 2010 Feb; 28(2): 172-6.
  • the invention manipulates expression levels of CYP genes in different tissues of the non-human mammal, including but not limited to liver, kidney, lung, muscle, jejunum, ileum, colon, depending on the nature of the delivery vehicle and tissue targeting. Among them, liver is preferred.
  • the method provided by the present invention further comprises a chemically modified small interfering nucleic acid or an antisense nucleic acid for chemically modifying the small nucleic acid molecule; preferably, the chemically modified small interfering nucleic acid molecule or the antisense nucleic acid molecule is at least one end A small interfering nucleic acid molecule or antisense nucleic acid molecule that is linked to cholesterol or PEG (polyethylene glycol).
  • the method for detecting the expression level of a CYP gene of interest is included in the method provided by the present invention, including A method for detecting the expression levels of all genes; a preferred method for detecting gene expression levels is real-time fluorescence quantification
  • RT-PCR RT-PCR
  • Taqman PCR Northern hybridization
  • Western hybridization PCR
  • the present invention provides the use of the method in constructing a non-human mammalian model system, and the constructed non-human mammalian model system; further, the present invention provides a constructed non-human mammalian model system Application in preclinical studies of drugs; further, the present invention provides the use of the constructed non-human mammalian model system in preclinical drug metabolism studies; further, the present invention provides a constructed non-human mammalian model The use of the system in the study of drug extrahepatic metabolism; further, the present invention provides the use of the constructed non-human mammalian model system in drug interaction studies; further, the present invention provides a constructed non-human mammal
  • the model system is used as a model system for drug development, pharmacology, or medical research.
  • the invention provides for the use of the method in constructing a non-human mammalian disease model system, and in the development of new disease diagnosis or treatment strategy studies.
  • the present invention provides a technical solution capable of manipulating the expression level of one or several CYP genes in a non-human mammal, and the manipulation is reversible, enabling drug metabolism studies to be carried out in a biological system that mimics the physiological environment of the human body as much as possible.
  • Significant technological advances compared to in vitro and other in vivo research models.
  • various conventional nucleic acid synthesis methods can be used to complete the synthesis of the oligonucleic acid molecules involved in the present invention, or a specialized biotechnology service company can be entrusted to complete the synthesis of oligonucleic acid molecules, such as entrusting Guangzhou Ruibo Biotechnology Co., Ltd. or Yingjun Biotechnology Co., Ltd. (invitrogen) performs synthesis.
  • oligonucleic acid molecules involves the following four steps: (1) synthesis of oligoribonucleotides; (2) deprotection; (3) purification separation; (4) desalting.
  • siRNA having the nucleotide sequence shown in SEQ ID NO: 4 are as follows:
  • a sense strand or antisense strand oligonucleotide sequence for synthesizing 1 millimolar amount of siRNA is set on a DNA/RNA automatic synthesizer (for example, Applied Biosystems EXPEDITE 8909), setting each The coupling time of the cycle is 10-15 minutes, the starting material is a solid phase-linked 5'-0-p-dimethoxy-thymidine support, and the first cycle connects a base on the solid support. Then, in the nth (2 ⁇ n ⁇ 35) cycle, one base is ligated to the base to which the n-1th cycle is ligated, and the cycle is repeated until the synthesis of all nucleic acid sequences is completed.
  • a DNA/RNA automatic synthesizer for example, Applied Biosystems EXPEDITE 8909
  • the obtained crude product of the oligonucleotide was dissolved in 2 ml of an aqueous solution of ammonium acetate having a concentration of 1 mol/ml, and then separated by C18 high pressure liquid chromatography to obtain a purified oligonucleotide product.
  • the purified oligonucleotide product was washed 24 times (2 ml each time) with a 75% by weight aqueous solution of ethanol, the salt was removed, and dried at room temperature; the oligoribonucleotide of the sense strand and the antisense strand were mixed and dissolved in 1 - 2 ml of buffer (10 mM Tris, pH 7.5-8.0 50 mM NaCI), heat the solution to 95 ° C, then slowly cool the solution to room temperature and maintain it at room temperature for 16-22 hours. That is, a siRNA solution was obtained.
  • the manner of chemical modification is well known to those skilled in the art.
  • the chemical modification of the nucleic acid molecule of the present invention is one or more of the following modifications:
  • the chemical modification is a modification of the ribose 2'-OH in the nucleotide; more preferably, the chemical modification is such that the ribose 2'-OH in the nucleotide is replaced by a methoxy or fluoro . In another preferred aspect, the chemical modification is the replacement of a phosphodiester bond between the nucleotides by a phosphorothioate linkage.
  • the chemically modified base of the nucleotide is substituted with a non-RNA base; preferably, the non-RNA base is selected from the group consisting of thymine, 5-methylcytosine ( 5-methylcytosine), isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 5-propionyluracil 5-propyny-6-fluoroluracil, 5-methylthiazoleuracil, 6-aminopurine, 2-aminopurine ), inosine, 2,6-diaminopurine, 7-propyne-7-deazaadenine 7-propynyl- 7-propyne-7-deazaguanine, 2-chloro-6-aminopurine.
  • the non-RNA base is selected from the group consisting of thymine, 5-methylcytosine ( 5-methylcytosine), isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynylura
  • the chemical modification is such that a base in a nucleotide is substituted with a DNA base.
  • Modifications to the citric acid diester linkage include, but are not limited to, modifications to the oxygen in the phosphodiester linkage, such as Phosphorthioate and Boranophosphate. The oxygen in the phosphodiester bond is replaced with sulfur and boron quinone as shown. Both modifications stabilize the structure of the siRNA molecule, maintaining the specificity and affinity of base pairing. Boronated phosphate-modified siRNAs are highly hydrophobic and easily form hydrated proteins in plasma, and have less toxic side effects on humans than phosphorothioate-modified siRNAs.
  • any of the above chemically modified siRNA molecules may have a sense strand and an antisense strand of 15-35 nucleotides in length, preferably 19-23 nucleotides in length, more preferably 21 nucleotides in length.
  • Any of the above chemically modified siRNA molecules, which may be blunt ends or 3' overhangs, and the 3' overhangs may be 1-6 nucleotides, preferably 2-4 nucleotides. More preferably, it is 2 nucleotides.
  • the ribose modification includes, but is not limited to, modification of the hydroxyl group (2'-0H) in the nucleotide pentose.
  • the introduction of certain substituents such as methoxy or fluorine at the hydroxyl position of the ribose gives the SiRNA a stronger resistance to nuclease hydrolysis.
  • Nucleotide The modification of the hydroxyl group in the pentose sugar includes 2'-fluro modification, 2'-oxymethyl modification (2'- ⁇ ), 2'-methoxyethyl modification (2'- ⁇ ), 2 4'-DNP modification (LNA), 2'-amino modification (Amina modifi modification (2'-Deoxy modification, etc.).
  • the base modifications include, but are not limited to, modifications to the bases of the nucleotides, such as 5'-bromo-uracil and 5', which introduce bromine or iodine at the 5' position of uracil.
  • -5'-iodo-uracil modification is a commonly used base modification method, and other N3-methyl-uracil modification, 2,6-diaminopurine (2, 6-diaminopurine
  • the modification is a modification of the 2'-OH of the ribose in the nucleotide of the nucleic acid molecule; further preferably, the modification is the 2'-OH of the ribose in the nucleotide of the nucleic acid molecule Replaced by methoxy or fluorine.
  • the expression vector used in the present invention including an expression vector for an oligonucleic acid molecule and an expression vector for expressing the CYP gene of interest, may be various commercial vectors operably linked to full-length or partial CYP genomic sequences, transcription of the CYP gene.
  • the shRNA sequences specific for the CYP gene are preferably various eukaryotic expression vectors.
  • the method of constructing an expression vector is a conventional molecular biological method such as a digestion-ligation, an in-fusion method, or the like.
  • the in vivo delivery system employed in the present invention may be any delivery system capable of delivering a target nucleic acid molecule into the body, such as a liposome, a polypeptide, a high molecular polymer, a nanoparticle, etc.; preferably, the delivery system has a liver A delivery system of targeted nature.
  • the siRNA was designed for the CYP gene sequence in Table 1, and Guangzhou Ruibo Biotechnology Co., Ltd. was commissioned to synthesize various chemically modified and unmodified siRNAs.
  • the Invitrogen Beijing Branch was commissioned to synthesize the DNA fragments required for the present invention for fusion of reporter gene expression vectors and detection of CYP gene expression levels.
  • CYP3A13 gene cDNA sequence NM— 007819 SEQ ID NO: 2
  • CYP3A25 gene cDNA sequence NM-019792 (SEQ ID NO: 3) Table 2.
  • CYP3A11 full-length cDNA amplification primer combination
  • CYP3A11 upstream primer 5'-aaaaagcttATGGACCTGGTTTCAGCTCTCTCAC (SEQ ID NO: 6)
  • CYP3A11 downstream primer 5'-aaactcgagTCATGCTCCAG ATGACTGCATCC (SEQ ID NO: 65)
  • CYP3A13 full-length cDNA amplification primer combination 5'-aaaaaagcttATGGACCTGGTTTCAGCTCTCTCAC (SEQ ID NO: 6)
  • CYP3A11 downstream primer 5'-aaactcgagTCATGCTCCAG ATGACTGCATCC (SEQ ID NO: 65)
  • CYP3A13 full-length cDNA amplification primer combination 5'-aaaaaagcttATGGACCTGGTTTCAGCTCTCTCAC (SEQ ID NO: 6)
  • CYP3A11 downstream primer 5'-aaactcgagTCATGCTCCAG ATGACT
  • CYP3A13 upstream primer 5'-aaaaagcttATGGACCTGATCCCAAACTTTTCCAT (SEQ ID NO: 66)
  • CYP3A13 downstream primer 5'-aaactcgagTCATTCATCAC ACAGTCTCATCT (SEQ ID NO: 67)
  • CYP3A25 full-length cDNA amplification primer combination 5'-aaaaaagcttATGGACCTGATCCCAAACTTTTCCAT (SEQ ID NO: 66)
  • CYP3A13 downstream primer 5'-aaactcgagTCATTCATCAC ACAGTCTCATCT (SEQ ID NO: 67)
  • CYP3A25 full-length cDNA amplification primer combination 5'-aaaaaagcttATGGACCTGATCCCAAACTTTTCCAT (SEQ ID NO: 66)
  • CYP3A13 downstream primer 5'-aaactcgagTCATTCATCAC
  • CYP3A25 upstream primer 5'-aaaaagcttATGGAGCTCATCCCCAACCTTTCTATA (SEQ ID NO: 68)
  • CYP3A25 downstream primer 5'- aaactcgagTCATGATCCAG CTGGG! TATCT (SEQ ID NO: 69)
  • Table 5 RT-PCR gene expression detection primer combination
  • CYP3A11 upstream primer 5'- GCTGTCACAGACCCAGAGACG (SEQ ID NO: 70)
  • CYP3A11 downstream primer 5'-GGCTTGCCTTTCTTTGCCTTCTGC (SEQ ID NO: 71) CYP3A13 upstream primer 5'-TGGGCTATTCATTCCCAAAG (SEQ ID NO: 72) CYP3A13 downstream primer 5'-AATGCAGTTCCTTGGTCCAC (SEQ ID NO: 73) CYP3A25 upstream primer 5'-AAACCAGAAGAACCGAGTGG ( SEQ ID NO:74) CYP3A25 downstream primer 5 -TGGAAGTGCTTGTGGCATC (SEQ ID NO:75) beta-actin upstream antibody 5'-AGACTAGGGCCAGAGGCGGC (SEQ ID NO:76) beta-actin downstream primer 5 -CCCTGCGGGGTACCTCACCT (SEQ ID NO. 77) Table 6. Antisense nucleic acid sequences
  • CYP3A11-AS1 5'-ATTCCTTCACTAGCACATTC
  • CYP3A11-AS2 5'-CATCTCATATACTGGTGTCA
  • CYP3A1 1-AS3 5 -TTACAGACTCTCTCAAGTCT
  • CYP3A13-AS1 5 '-GATAGCCAGCACAGGCTGTC
  • SEQ ID NO: 81 CYP3A13-AS2-.
  • CYP3A13-AS3 5'-CTTTCATTCGTTCTACTGAA
  • CYP3A25-AS1 5'-TGATCTCTGGATCCATGATA
  • CYP3A25-AS2 5'-GGCCTTTGGAGTTCTGAGTA
  • SEQ ID NO:85 CYP3A25-AS3: 5'-GGTACTCCATGTCCATCAGG
  • rGTTGCnCCTTCGAGAATGGAAAGGAAG1AS 5ACGCATCCATTTCCCPA1AAAGA25sNA2GTCT C>T3hR-- -.
  • GAS 5ATCCCCAG3 ⁇ 4TATTAATTTATAT3A3sNA GC1TA CYP1hR1-- -, CGC3GTCCAAGTTCCGnGAATTs: 3CCAAGGGTACATAAATT3ATACTTGA>TA1sNA2AGAAA C31hR---.
  • GCGACACCTT CGCCAGATTTCAGAATAATAGGAAAsS 5ACGTTGCTTTAATAATT CYP3A11hRNA2GTT-- - NA11shRA2 ⁇ T3- AGCCCGTCCAACA 3TCTCGGAGAAGTTCTCTTCTTTCAAAGATTG3ANAs:GC3GAGTTAAAT CYP11shRA1---,.
  • the recombinant firefly luciferase reporter plasmid containing the siRNA isolated target site was constructed by referring to the following literature.
  • the reporter plasmid vector can be obtained from the author of the paper. (Du Q, Thonberg H, Zhang HY, Wahlestedt C & Liang Z. Validating siRNA Using a Reporter Made from Synthetic DNA Oligonucleotides. Biochem Biophys Res Commun. 325:243-9, 2004; Du Q, Thonberg H, Wang J, Wahlestedt C & Liang Z. A Systematic Analysis of the Silencing Effects of an Active siRNA at All Single-nucleotide Mismatched Target Sites. Nucleic Acids Res.
  • HEK293 human embryonic kidney cells (HEK293) cultured in DMEM medium (10% FBS, 2 mM L-glutamine, 100 units/ml penicillin and 100 pg/ml streptomycin) were inoculated into a 24-well plate. Medium (1 ⁇ 10 5 cells / 0.5 ml medium / well). After the cells were grown for 24 hours, when the degree of cell fusion was about 50-70%, the medium was changed to Opti-MEM medium (Gibco).
  • a recombinant firefly luciferase reporter plasmid carrying the siRNA isolated target site was transfected into the cell using Lipofectamine 2000 (Invitrogen, USA), and pRL-TK (encoded Renilla luciferase) was also transfected into the cell.
  • Control plasmid Promega, Madison Wl, USA
  • Each well contained 0.17 g of recombinant plasmid and 0.017 g of pRL-TK control plasmid with a final concentration of siRNA of 13 nM.
  • DMEM medium (10% FBS, 2 mM L-glutamine, 100 units/ml penicillin and 100 pg/ml streptomycin).
  • Inhibitory activity 1- (experimental amount of firefly luciferase reporter gene in experimental group / expression level of test group of renilla luciferase in experimental group) / (expression of firefly luciferase reporter gene in control group / control of sea kidney fluorescence The expression level of the prime enzyme reporter gene) x100%
  • recombinant firefly luciferase reporter plasmids containing the siRNA sense strand target sites were constructed according to the protocol described in step 1) (target sequence construction fragment sequences are shown in Table 3). ).
  • the modified and unmodified siRNA molecules shown in Table 2 were synthesized.
  • the inhibitory activities of various siRNA molecules on the sense strand target site were respectively examined.
  • Each siRNA was made in parallel with 3 replicate wells per experiment, and each experiment was repeated at least 2 times.
  • the inhibitory activity of the siRNA on the fusion target site was calculated according to the method of step 3).
  • Figure 1 shows the inhibitory activity of unmodified siRNA.
  • Figure 2 shows the inhibitory activity of modified siRNA.
  • Example 3 In vivo delivery of vectors and vectors - Preparation of siRNA mixtures
  • In vivo Delivery Vector Preparation In vivo delivery vectors and siRNA-carrier mixtures for use in the present invention were prepared according to the methods described in the following references (Reference 1. Semple SC, Akinc A, Chen J, Sandhu AP, Mui BL Cho CK, Sah DW, Stebbing D, Crosley EJ, Yaworski E, Hafez IM, Dorkin JR, Qin J, Lam K, Rajeev KG, Wong KF, Jeffs LB, Nechev L, Eisenhardt ML, Jayaraman M, Kazem M, Maier MA, Srinivasulu M , Weinstein MJ, Chen Q, Alvarez R, Barros SA, De S, Klimuk SK, Borland T, Kosovrasti V, Cantley WL, Tarn YK, Manoharan, Ciufolini MA, Tracy MA, de Fougerolles A, MacLachlan I, Cullis PR, Madden TD, Hope MJ.
  • siRNA dilution The siRNA was dissolved in 10 mM citric acid / 30 mM NaCI, pH 6.0 to prepare a siRNA stock solution at a concentration of 20 uM.
  • Storage solution where DSPC is Distearoylphosphatidylcholine, -
  • the lipid stock solution was added to a 50 m citric acid (pH 4.0) solution under agitation to form pre-formed vesicles.
  • the final concentration of liposomes was 8 mM and the final concentration of ethanol was 30%.
  • siRNA entrapment Take a certain amount of siRNA stock solution and add it to ethanol-50 mM citric acid (pH 4.0) solution to form siRNA dilution. The final concentration of ethanol is 30%.
  • siRNA dilution and liposome solution were incubated for 10 minutes at 3540 °C, respectively.
  • the siRNA dilution was slowly added to the liposome solution under agitation; the mixture was further incubated for 30 minutes at 35 ° C; after the end of the warm bath, the siRNA-carrier mixture was dialyzed against PBS (pH 7.4). Overnight; then ion exchange column chromatography was performed to remove unencapsulated siRNA.
  • the amount of total lipid was calculated by directly detecting the amount of cholesterol (Cholesterol) in the siRNA-carrier mixture.
  • the cholesterol content is detected using a commercial total cholesterol test kit, and the specific procedure is carried out according to the instructions.
  • In vivo delivery vehicle preparation An in vivo delivery vehicle for use in the present invention is prepared according to the methods described in the following, which is hereby incorporated by reference in its entirety herein
  • Plasmid DNA dilution The purified plasmid DNA was dissolved in 10 mM citric acid / 30 mM NaCI (pH 6.0) to prepare a plasmid DNA stock solution at a concentration of 10 nM.
  • lipid storage solution was added to a 50 mM citric acid (pH 4.0) solution under stirring to form a pre-formed vesicle.
  • the final concentration of liposomes was 8 mM and the final concentration of ethanol was 30%.
  • Plasmid DNA entrapment Take a certain amount of plasmid DNA stock solution and add it to ethanol-50 mM citric acid (pH 4.0) to form a plasmid DNA dilution with a final concentration of 30% ethanol.
  • the plasmid DNA dilution and the entrapped liposome solution were incubated for 10 minutes at 3540 ° C; the plasmid DNA dilution was slowly added to the encapsulated liposome solution under stirring; at 35 ° C The mixture was further incubated for 30 minutes; after the end of the incubation, the plasmid DNA-liposome mixture was dialyzed against PBS (pH 7.4) overnight; then, the unencapsulated plasmid DNA was removed by ion exchange column chromatography.
  • the amount of total lipid was estimated by directly detecting the content of cholesterol in the plasmid DNA-liposome mixture. Use a commercial total cholesterol test kit to detect cholesterol levels. follow the instructions.
  • Total RNA extraction from the liver The liver tissue of the mouse isolated from the surgery was obtained, and the total RNA was extracted using NORGEN's animal tissue RNA purification kit to quantify the total RNA extracted.
  • RNA Reverse Transcription The reverse transcription reaction of RNA was carried out using Tiangen Biochemical Technology's reverse transcription kit (TIANScript M-MLV, cat: ER104-03) according to the kit instructions. The specific steps are as follows: Take 1 ug of total RNA, Add 2 ⁇ (10 ⁇ ) 6-base random reverse transcription primer, 2 ⁇ dNTP (10 mM), mix and denature in a 70 ° C water bath for 5 minutes; allow the reaction system to stand on ice for 3 minutes; Add 4 ⁇ 5xFirst-Strand Buffer, 0.5 ⁇ RNase inhibitor (40 U/ ⁇ ), 1 ⁇ M M-MLV (200 U/ ⁇ ), total volume 20 ⁇ , mix and centrifuge briefly, in an Eppendorf PCR machine Reverse transcription reaction, the specific parameters are The reaction was carried out at 25 ° C for 10 minutes, at 42 ° C for 50 minutes, at 95 ° C for 5 minutes, and then at 4 ° C for storage.
  • RNase inhibitor is a product of Promega (cat# N
  • the PCR reaction conditions were: 94 °C, 5 minutes; 30 ⁇ (94 ° C, 30 seconds; 60 ° C, 30 seconds; 72 ° C, 2 minutes); 72 ° C, 10 minutes.
  • 3 ul of the PCR product was electrophoresed on a 1% agarose gel, and the amplified fragment of the target was collected and recovered, and purified and recovered by the universal DNA purification and recovery kit of Tiangen Biochemical Technology Co., Ltd., and the recovered product was quantified.
  • the 4.5 ug PCR product was double-digested with Hindlll and Xhol (NEB) restriction enzymes in a 100 ul system at 37 ° C overnight, and the pEGFP-C expression vector was linearized by the same restriction enzyme conditions.
  • RNA from mouse liver tissue was extracted as described in Example 5 and reverse transcribed into cDNA.
  • Real-time PCR Using the primer combinations listed in Table 5, the expression levels of the CYP3A11, CYP3A13, and CYP3A25 genes were separately measured, and the specific steps are as follows. Quantitative detection of CYP gene expression in samples using Hot Master Taq DNA polymerase (cat #: ET106-01-01) by Tiangen Biotechnology Co., Ltd. The specific method was carried out according to the product manual.
  • the procedure was as follows: Take 2 ⁇ reverse transcription product , add 2.5 ⁇ 10x Hot Master Taq Buffer, 0.5 ⁇ (10 ⁇ ) upstream primer, 0.5 ⁇ (10 ⁇ ) downstream primer, 1 ⁇ dNTP mixture (2.5 ⁇ M each), 1 ⁇ SYBR Green I (5 ⁇ ), 0.2 ⁇ Hot Master Taq DNA polymerase (2.5 u/ ⁇ ), and finally 17.3 ⁇ ddH 2 O, the total reaction volume was 25 ⁇ . After mixing, the cells were briefly centrifuged and placed in an Eppendorf PCR machine for PCR amplification reaction.
  • the reaction parameters were pre-denaturation at 95 ° C for 2 minutes, denaturation at 95 ° C for 15 seconds, annealing at 58 ° C for 15 seconds, and extension at 72 ° C for 30 seconds.
  • the number of cycles is 40 cycles. Three replicates were set for each reaction.
  • the probe preparation process includes two steps of linearization and in vitro transcription of the probe plasmid, as follows:
  • Linearization of the probe plasmid Take 5 pg of the CYP gene full-length cDNA clone plasmid obtained in Example 5, add 10 ⁇ 10 ⁇ restriction enzyme buffer, 1 ⁇ BSA, and 2 ⁇ Sal I (NEB) or Other restriction enzymes that linearize the cDNA plasmid, supplement the reaction system to 100 ⁇ with distilled water, digest for 3-4 hours in a 37 ° C water bath, and take a small amount of the digestion product in a 1% agarose gel. , confirm that the linearization is complete.
  • the digested product was purified and recovered using a universal DNA purification and recovery kit (Cat: DP214-03) from Tiangen Biotechnology Co., Ltd., and the fragmented plasmid was eluted with 35 ⁇ M of distilled water and quantified.
  • RNA probes for hybridization were prepared using the following reaction systems and conditions.
  • the reaction system includes 1 pg plasmid template (5 ⁇ M), 1 ⁇ rNTP (10 mM, Promega), 1 ⁇ M Biotinylated UTP (1 mM, Roche), 2 ⁇ M DTT (100 mM, Promega), 1 ⁇ M T7 polymerase (Promega), 4 ⁇ 5 ⁇ transcription buffer (Promega), 1 ⁇ Ribonuclease inhibitor (Promega), the reaction system was supplemented to 20 ⁇ by force into DEPC water.
  • RNAse-free DNase I NEB, Cat: M0303S
  • NEB RNAse-free DNase I
  • the specific process is to add the reaction system to 100 ⁇ with DEPC water, add an equal volume of phenol-chloroform-isoamyl alcohol, shake vigorously for 15 seconds, centrifuge at 13,000 rpm for 5 minutes at 4 ° C; take the supernatant (about 100 ⁇ ) Place in a new RNase-free centrifuge tube, add 250 ⁇ M pre-cooled absolute ethanol, add 10 yl NaAc (3 ⁇ ), precipitate at -80 ° C for more than half an hour; at 4 ° C, at maximum speed (about MOOOrpm) Centrifuge for 15 minutes, discard the supernatant; add 500 ⁇ M of 80% ethanol to the pellet, wash once, centrifuge at 13000 rpm for 5 minutes at 4 °C, discard the supernatant; dry on ice 5- After 10 minutes, add 20 ⁇ M DEPC water to dissolve back, measure the concentration, and store in a refrigerator at -80 °C for use.
  • RNA extraction from mouse liver Liver tissues of surgically isolated mice were obtained, and total RNA was extracted using NORGEN's animal tissue RNA purification kit to quantify the total RNA extracted.
  • Northern hybridization The positively charged nylon membrane was cut into a size of 7 ⁇ 8.3 cm with a paper cutter; the total RNA obtained was electrophoresed, and the electrophoresis strip was transferred to a nylon membrane; the nylon membrane was placed in a hybridization flask. Add 5 ml DIG EasyHyb (Roche, Cat: 11603558001), pre-half for half an hour at 68 °C; take 1 g of biotin-UTP-labeled RNA probe during the pre-mixing process, and denature at 95 °C for 5 minutes.
  • Anti-CYP protein antibodies (sc-365415 and sc-30612) were purchased from Santa Cruz, Inc. (www.scbt.com).
  • Mouse liver protein extraction According to the instructions of the kit, the protein component of mouse liver tissue (CAT#:90707-50) was extracted by the Tissue Protein Ultrafast Micro Extraction Kit provided by Beijing Tianenze Gene Technology Co., Ltd. Proceed as follows. 1) Weigh 100 mg of mouse liver tissue isolated from surgery and transfer to a pre-cooled mortar; 2) Add a small amount of liquid nitrogen, grind it into powder with a grind; 3) Add 1 ml of solution A to dissolve the powder, and dissolve the solution.
  • Western blotting Take 50 ug of total protein extracted, add a certain amount of 5 ⁇ SDS-PAGE loading buffer to a final concentration of 1 x, and immediately after loading for 5 minutes in boiling water, apply to 10% SDS polyacrylamide gel. Perform electrophoretic separation. Transfer it to a polyvinyl fluoride membrane (MiHipore, Bedford, Massachusetts, USA) at 25 volts; TBST rinse, 5% skim milk for 2 hours; add 1:100 dilution of primary antibody at 4 °C Overnight; a 1:1000 dilution of HRP-labeled secondary antibody (Jackson Immuno Research) was added and allowed to react for 1 hour. Each step is washed 3 times with TBST.
  • the protein bands were developed using a chemiluminescent labeling kit, and the developed strips were subjected to gray scale scanning (National Institutes of Health, Bethesda, MD, USA) using Image J software to quantify the signal intensity of the control and control samples.
  • the other protein bands were normalized according to the value of the internal reference GAPDH.
  • Example 9 Using small interfering nucleic acids to reduce the expression level of CYP gene in mice
  • siRNAs Two unmodified high-activity siRNAs were selected for each target gene for in vivo functional studies, namely CYP3A11-3, CYP3A11-5, CYP3A13-1, CYP3A13-4. CYP3A25-2 and CYP3A25 ⁇ 4; Chemically modified siRNAs (CYP3A13-401 and CYP3A13408) were tested for in vivo function.
  • siRNA-liposome mixture of each siRNA was prepared as described in Example 3.
  • the siRNA-liposome mixture was introduced into the mouse by tail vein injection.
  • Female C57BL/6 mice aged 8-10 weeks were used, and the siRNA-liposome mixture was diluted to a suitable concentration with PBS and injected into the tail vein.
  • the amount of siRNA was 0.01 mg per kg body weight (0.01 mg/kg). ).
  • Two days later, the mice were sacrificed and the liver tissues of the mice were isolated. The same number of untreated mice were selected as normal controls.
  • RNA level RNA level
  • Example 8 protein level
  • Inhibitory activity II (expression level of CYP gene in treated mice) / (expression level of CYP gene in control mice) ⁇ 100%
  • Example 10 Reduction of expression level of CYP gene in mice by antisense nucleic acid
  • siRNA sequence of Example 9 was replaced with the antisense nucleic acid sequence listed in Table 6 by the method described in Example 9, and introduced into a mouse to examine its inhibitory effect on the expression level of CYP gene in the liver of mice.
  • mice The same number of untreated mice were selected as controls.
  • RNA level RNA level
  • Example 8 protein level
  • CYP3A13-AS3 and CYP3A25-AS 2 were all effective in inhibiting the expression level of the target CYP gene in the mouse liver.
  • Inhibitory activity 1- (expression level of CYP gene in treated mice) / (expression level of CYP gene in control mice) ⁇ 100%
  • Example 1 Use shRNA expression vector to reduce expression level of CYP gene in mice
  • shRNA expression vector The oligo DNA nucleotide strand synthesized according to the sequence listed in Table 7 was dissolved in deionized water to prepare a solution of 1 mg/ml. Take 2 ul of the corresponding oligonucleotide chain solution, add to 46 ul of 1 x PBS solution, denature at 90 ° C for 3 minutes, then slowly cool the temperature to 37 ° C in 1 hour, complementary strand annealing A double-stranded DNA fragment is obtained afterwards.
  • the pSilencerTM 4.1-CMV neo vector (Invitrogen, Catalog: AM5779) was digested with Bam HI and Hind III restriction enzymes, and the linearized vector was cleaved.
  • the obtained double-stranded DNA fragment was ligated to the linearized vector overnight at 16 ° C, and the ligation reaction was set at a ratio of 1:5 vector: target fragment, and E. coli transformation and colony PCR identification were performed the next day. Positive clones were selected for sequencing and the correct plasmid clones were sequenced for subsequent experiments.
  • a plasmid DNA-liposome mixture was prepared as described in Example 4. Using a tail vein injection, the plasmid
  • mice Female C57BIJ6 mice of 8-10 weeks old were selected, and the plasmid DNA-liposome mixture was diluted to a suitable concentration with PBS, and introduced into mice by tail vein injection. Each The amount of plasmid DNA in mice was 30 ug. Two days later, the mice were sacrificed and liver tissues were isolated for gene expression analysis. The same number of untreated mice were selected as controls.
  • RNA level RNA level
  • Example 8 protein level
  • shRNA shRNA was calculated for the target gene according to the following formula. Inhibition.
  • the experimental results shown in Figure 5 indicate that CYP3A11-shRNA1, CYP3A11-shRNA2, CYP3A13-shRNA1, CYP3A25-shRNA1 and CYP3A25-shRNA2 are both effective in inhibiting the expression level of the target CYP gene in mouse liver.
  • Inhibitory activity 1 - (expression level of CYP gene in treated mice) / (expression level of CYP gene in control mice) 100%
  • Example 12 Using expression vector to increase expression level of CYP gene in mice
  • mice The overexpression experiment in mice was carried out using the full-length cDNA clone of the CYP gene constructed in Example 5. Two expression plasmids were selected for each CYP gene, designated p3A11-1, p3A11-2, p3A13-1 p3A13-2, P3A25-1, and p3A25-2, respectively.
  • a mixture of cDNA expression plasmid-liposomes for in vivo transfection was prepared as described in Example 4.
  • the cDNA expression plasmid-liposome mixture was introduced into the mouse by tail vein injection as follows: Female C57BL/6 mice of 8-10 weeks old were selected, and the plasmid DNA-liposome mixture was diluted with PBS to the appropriate The concentration was introduced into mice by tail vein injection, and the amount of plasmid DNA was 0.01 mg (0.01 mg/kg) per kg body weight. Two days later, the mice were sacrificed and liver tissue was isolated.
  • mice The same number of untreated mice were selected as controls.
  • RNA level RNA level
  • Example 8 protein level
  • Figure 6 The experimental results shown indicate that these CYP gene expression plasmids can effectively increase the expression level of the target CYP gene in mouse liver.
  • siRNA siRNA
  • CYP3A134 siRNA was used to prepare a mouse model of CYP3A13 gene expression inhibition, and the degree and duration of inhibition of CYP3A13 gene expression in mouse liver were evaluated.
  • siRNA dose and inhibitory effect Twenty female C57BU6 mice, 8-10 weeks old, were randomly divided into 4 groups of 5 animals each. The dose of 0.01 mg siRNA per kilogram of body weight is doubled, respectively 1/4, 1/2, 1 and 2 doses of CYP3A13 ⁇ 4 siRNA were introduced into the mice from the tail vein. The same number of untreated mice were selected as controls. The mice were sacrificed the next day (48 hours) after injection of the siRNA-liposome mixture, and CYP 3A13 in the liver of siRNA-treated and untreated control mice was detected by real-time fluorescent quantitative RT-PCR as described in Example 6. The expression level of the gene was calculated by the following formula to determine the inhibitory activity of the siRNA on the target gene.
  • Inhibitory activity 1 - (expression level of CYP gene in treated mice) / (expression level of CYP gene in control mice)
  • the experimental results shown in Figure 7 indicate that compared with untreated control mice, the mice were compared.
  • In vivo introduction of CYP3A134 siRNA can effectively inhibit the expression of the target gene in mouse liver.
  • the effect of inhibition of expression is reproducible, reflecting the stability of the technical effect of the present invention; from the dose-effect relationship, there is a significant difference between the degree of inhibition of the target gene in mice and the dose of siRNA. Correlation.
  • CYP3A13-4 siRNA was introduced into 30 8-10 week old female C57BU6 mice at a dose of 0.01 mg/kg according to the method described in Example 10, and the mice were randomly divided into 6 groups. , 5 mice per group. The same number of untreated mice were selected as controls. After the second day (48 hours) from the tail vein injection of the siRNA-liposome mixture, a group of mice was sacrificed every 24 hours, and the siRNA treatment was detected by real-time fluorescent quantitative RT-PCR as described in Example 6. The expression level of the CYP3A13 gene in the liver of the control mice which were not treated with siRNA was calculated according to the above formula.
  • CYP3A13-shRNA1 was selected to prepare a mouse model of CYP3A13 gene expression inhibition, and the duration of inhibition of CYP3A13 gene expression in mouse liver was evaluated.
  • the CYP3A13-shRNA1 expression plasmid was introduced into 30 female C57BL/6 mice, 8-10 weeks old, according to the method and dosage of Example 11, and the mice were randomly divided into 6 groups, each Group 5 mice. The same number of untreated mice were selected as controls.
  • the plasmid DNA-liposome mixture was injected from the tail vein, and after the next day (48 hours), a group of mice was sacrificed every 24 hours, and the shRNA was detected by real-time fluorescent quantitative RT-PCR according to the method described in Example 6.
  • the expression levels of the plasmid-treated and untreated mouse liver CYP3A13 genes were expressed, and the inhibitory activity of the shRNA expression vector against the target gene was calculated according to the following formula.
  • Inhibitory activity 1 - (expression level of CYP gene in treated mice) / (expression level of CYP gene in control mice) X100%
  • the CYP3A13 overexpression plasmid p3A13-1 constructed in Example 12 was used, and the P3A13-1 plasmid was introduced into 30 female C57BL/6 mice of 8-10 weeks old, respectively, according to the method and dosage described in Example 12.
  • the mice were divided into 6 groups of 5 mice each. The same number of untreated mice were selected as controls.
  • the expression level of the CYP3A13 gene in the liver of the plasmid-treated and untreated mice was calculated by the following formula to calculate the over-expression level of the CYP3A13 gene.
  • Gene expression level (expression level of CYP gene in treated mice) / (expression level of CYP gene in control mice) ⁇ 100%
  • the CYP3A11-3 siRNA was used to prepare a mouse model of CYP3A13 gene expression inhibition, and the degree of inhibition and duration of expression of the mouse liver CYP3A13 gene was evaluated according to the protocol described in Example 13. The experimental results are shown in Figures 9 and 10. These results indicated that CYP3A11-3 siRNA can effectively inhibit the expression of the target gene in the liver of mice, and has a dose-effect relationship with the inhibition of the target gene, and the duration is more than 6 days, which can meet the needs of in vivo drug metabolism research.
  • Example 17 Application of CYP3A11 expression inhibition mouse model in preclinical studies of drugs
  • CYP3A11-3 siRNA 40 mouse models of CYP3A11 gene expression inhibition were prepared according to the method of Example 13, and the amount of siRNA was 0.01 mg per kg of body weight; the same number of untreated mice were obtained as a control group.
  • mice and control mice were randomly divided into 8 groups of 5 mice each.
  • a commercialized paclitaxel solution (PTX, paclitaxel) was introduced into the model and control mice at a dose of 10 mg per kg of body weight by tail vein injection.
  • a group of model groups and a group of control mice were sacrificed at intervals of 2 hours, 4 hours, 8 hours, and 24 hours, and blood of the mice was obtained for analysis. Residues according to standard protocols reported in the literature The dose of the drug is analyzed, and specific reference can be made to relevant standards and literature, such as Pharmacokinetics of combined doxorubicin and paclitaxel in mice. Gustafson DL, Merz AL, Long ME. Cancer Lett. 2005 Apr 8; 220(2): 161-9. This document is incorporated herein by reference in its entirety.
  • a mouse model of CYP3A25 gene expression inhibition was prepared by selecting CYP3A25-2 siRNA, and the mouse model was evaluated according to the method described in Example 13.
  • the experimental results showed that introduction of CYP3A25-2 siRNA into mice could effectively inhibit the expression of the target gene in the liver of mice compared with untreated control mice.
  • the effect of expression inhibition in the same group of mice was reproducible.
  • the expression inhibition of the target CYP gene in different groups of mice had a significant dose-effect relationship, and the duration of inhibition could meet the needs of the usual metabolic studies in vivo.
  • a mouse model of 50 CYP3A25 gene expression inhibition was prepared according to the method described in Example 17, and the amount of siRNA was 0.01 mg per kg body weight ; the same number of untreated mice were obtained as a control group.
  • Model mice and control mice were randomly divided into 10 groups of 5 mice each.
  • a commercialized midazolam solution (Midazolum) was introduced into the model and control mice at a dose of 10 mg per kilogram of body weight by tail vein injection.
  • a group of model groups and a group of control mice were sacrificed at intervals of 7.5 minutes, 15 minutes, 30 minutes, 60 minutes, and 90 minutes, and blood of the mice was obtained for analysis. Blood concentration and metabolite 1-OH midazolam and 4-OH midazolam were analyzed according to the standard protocol reported in the literature.
  • W 201 Specifically, obtain 20ul of plasma, add it to 100ul of deionized water, add 20 ul 0.5 ug / ml clonazepam as internal reference, add an equal volume of methanol, mix, add 200ul 5 mM After NaOH; after mixing, diethyl ether was added thereto, and the organic phase was evaporated under liquid nitrogen, and dissolved in 5% (v/v) acetonitrile solution of 0.1% (v/v) acetic acid; The uL sample was subjected to LC-MS analysis to obtain the concentration of the drug and its main metabolite in the blood. The curve of the drug concentration in the blood was analyzed as a function of time, and the results are shown in FIG. Example 20. Preparation of CYP3A13/25 Gene Expression Co-inhibition Mouse Model Using siRNA
  • the CYP3A13/25 gene expression co-suppression mouse model was prepared according to the method of Example 13 by selecting CYP3A1 1-3 and CYP3A25-2, and the expression inhibition of CYP3A1 1 and CYP3A25 genes in the liver of mice was evaluated.
  • mice Five 8-10 week old female cd1 mice were used as a group, and 0.01 mg of each siRNA per kg body weight was introduced into a group of mice from the tail vein. The same number of untreated mice were selected as controls. Mice were sacrificed the next day (48 hours) after injection of the siRNA-liposome mixture, and CYP 3A13 in the liver of siRNA-treated and untreated control mice was detected by real-time quantitative RT-PCR as described in Example 6. And the expression level of the CYP3A25 gene. The results showed that the introduction of siRNA into mice can effectively inhibit the expression of two target genes in mouse liver compared with untreated control mice, and achieve the joint inhibition of two target CYP genes, including inhibition of CYP3A11.
  • CYP shRNA adenovirus expression vector and adeno-associated virus expression vector and virus packaging were completed by Beijing Wujiahe Institute of Molecular Medicine (http://www.five-plus.com.cn/index.asp), the viral vector used.
  • the company provides the serotype 5 (Ad5) adenoviral vector and the AAV1 type adeno-associated virus vector.
  • the five-plus and molecular medical research institutes of Beijing designed the corresponding inserts for viral vector construction according to the characteristics of the viral vectors provided, so that the constructed viral vectors can express these targets.
  • the shRNA at the site achieves the effect of inhibiting the expression of the corresponding CYP gene.
  • the specific target site sequence is as follows:
  • CYP3A25-shRNA1 5'-CCATCAGTATGAAAGACAT-3'
  • CYP3A25-shRNA2 5'-GCACTTCCATTTCCCTCAT-3'
  • mice Thirty-five female C57BL/6 mice, aged 8-10 weeks, were randomly divided into 7 groups, 5 in each group. Except for one control group, each group of mice was used for the detection of the activity of a shRNA adenovirus. 1 x 10 9 pfu of shRNA adenovirus was introduced into each mouse by tail vein injection, and 5 mice were introduced for each adenovirus. Two days later, the mice were sacrificed and liver tissues were isolated for gene expression analysis.
  • the expression level of the target CYP gene in the shRNA adenovirus-treated and untreated mouse livers was examined, and the inhibitory effect of shRNA on the target gene was calculated according to the following formula.
  • Inhibitory activity 1- (expression level of CYP gene in treated mice) / (expression level of CYP gene in control mice)
  • the CYP3A13-shRNA2 adenovirus has an inhibitory activity against the target gene of 80%; the CYP3A25-shRNA1 adenovirus has an inhibitory activity against the target gene of 90%; and the CYP3A25-shRNA2 adenovirus has an inhibitory activity against the target gene of 94%; Preparation of CYP gene expression inhibition mouse model by using adeno-associated virus
  • mice Thirty-five female C57BIJ6 mice, aged 8-10 weeks, were randomly divided into 7 groups, 5 in each group. Except for one control group, each group of mice was used for the detection of a shRNA adeno-associated virus activity. Using tail vein injection, 2x10" pfu shRNA adeno-associated virus was introduced into each mouse, and each adeno-associated virus was introduced into 5 mice. Two days later, the mice were sacrificed, and liver tissues were isolated for gene expression analysis.
  • the expression level of the target CYP gene in shRNA adeno-associated virus-treated and untreated mouse liver was examined, and the inhibitory effect of shRNA on the target gene was calculated according to the following formula.
  • Inhibitory activity 1- (expression level of CYP gene in treated mice) / (expression level of CYP gene in control mice)
  • mice 40 female C57BL/6 mice of 8-10 weeks old were randomly divided into 8 groups, 4 model groups and 4 control groups, 5 mice in each group.
  • each mouse was injected with CYP3A11-shRNA1 adenovirus 1 x 10 9 pfu in the tail vein.
  • a commercialized paclitaxel solution PTX, paclitaxel
  • a group of model groups and a group of control mice were sacrificed at intervals of 2 hours, 4 hours, 8 hours, and 24 hours, and the blood of the mice was obtained for analysis.
  • the dosage of the residual drug is analyzed according to the standard protocol reported in the literature. For details, refer to relevant standards and literature, such as Pharmacokinetics of combined doxorubicin and paclitaxel in mice. Gustafson DL, Merz AL, Long ME. Cancer Lett. 2005 Apr 8; 2): 161-9. This document is incorporated herein by reference in its entirety.
  • Docetaxel docetaxel
  • 100 ul of mouse plasma was obtained, and 25 pmol of docetaxel (Docetaxel) was added thereto as an internal control; after mixing, 10 mM acetic acid acetonitrile solution was added thereto to precipitate protein; and centrifuged under 10000 RCF conditions. Minutes, the supernatant was separated; the volume of the supernatant was adjusted to 1 mL using the mobile phase used for mass spectrometry, and 20 uL was taken for LC-MS analysis to obtain the concentration of the drug in the blood.
  • Docetaxel docetaxel
  • the corresponding inserts were designed for viral vector construction, so that the constructed viral vector can express shRNA against these target sites, and the effect of inhibiting the expression of the corresponding CYP gene can be achieved.
  • the specific target site sequence is as follows:
  • CYP3A25-shRNA2 5'-GCACTTCCATTTCCCTCAT-3' Targeting target (take CYP3A25-shRNA1 as an example) Entrusted Beijing Yingjun to synthesize both ends with Hpa / and ⁇ ⁇ /
  • the double-stranded DNA Oligo sequence at the cohesive site of the cleavage site (Table 8); the pGCSIL-GFP vector was treated with h/pa / and ⁇ ⁇ / restriction enzymes (provided by Shanghai Jikai Gene Chemical Technology Co., Ltd., Figure 13 ), linearize it, and identify the fragment by agarose gel electrophoresis.
  • Table 8 Double-stranded DNA Oligo with both ends of the Hpa mXho I cleavage site (using CYP3A11-shRNA1 as an example)
  • the double-enzymatic linearization (double digestion reaction system shown in Table 9, 37 ° C, reaction for 1 hour) of the vector DNA and the purified double-stranded DNA Oligo were ligated by T4 DNA ligase in a suitable buffer system ( Connected at 16 ° C overnight as shown in Table 10 to recover the ligation product.
  • Fresh E. coli competent cells prepared by transforming the ligation product into calcium chloride (Refining Operational Reference: Molecular Cloning, A Laboratory Guide, Second Edition, pp. 55-56). Dip the surface of the growth-producing clones, dissolve in 10 ⁇ LB medium, and mix 1 ⁇ as a template.
  • RNA interference plasmid pGCSIL-GFP-CYP3A25-shRNA1 was extracted using Qiagen's plasmid extraction kit to prepare a 100 ng/ ⁇ stock solution.
  • human embryonic kidney cell 293T cells in logarithmic growth phase were digested with trypsin, adjusted to a cell density of 1.5 ⁇ 10 5 cells/ml in DMEM complete medium containing 10% fetal bovine serum, and inoculated into 6-well plates. , 37 ° C, 5% C0 2 incubator culture. It can be used for transfection when the cell density reaches 70%-80%.
  • PVM Packing Mix
  • ⁇ 12 ⁇ serum-free DMEM medium 400 ⁇ , 20 ⁇ of the above extracted, according to the instructions of Sigma-aldrich's MISSION Lentiviral Packaging Mix kit. Plasmid DNA was added to the above PVM/PEI/DMEM mixture. Incubate the above transfection mixture at room temperature After 15 min, the cells were transferred to a medium of 293T cells of human embryonic kidney cells, and cultured at 37 ° C for 16 hours in a 5% C0 2 incubator.
  • the culture medium containing the transfection mixture was discarded, washed with PBS solution, 2 ml of complete medium was added, and incubation was continued for 48 hours.
  • the cell supernatant was collected, purified and concentrated by Centricon Plus-20 centrifugal ultrafiltration unit (Millipore) (see Table 13 for process conditions).
  • the centrifugal force does not exceed 1000 g for 2 min. Remove the centrifuge cup from the sample collection cup. The virus concentrate in the sample collection cup
  • mice Thirty-five female C57BL/6 mice, aged 8-10 weeks, were randomly divided into 7 groups, 5 in each group. Except for one control group, each group of mice was used for the detection of a shRNA lentivirus activity. 5 ⁇ 10 8 TU shRNA lentivirus was introduced into each mouse by tail vein injection, and 5 mice were introduced for each lentivirus. Mice were sacrificed one week later and liver tissues were isolated for gene expression analysis.
  • the expression level of the target CYP gene in shRNA lentivirus-treated and untreated mouse livers was examined by the method described in Example 6, and the inhibitory effect of shRNA on the target gene was calculated according to the following formula.
  • Inhibitory activity 1- (expression level of CYP gene in treated mice) / (expression level of CYP gene in control mice) ⁇ 100% Experimental results showed that CYP3A11-shRNA1 lentivirus inhibited target gene by 92%; CYP3A1 The inhibitory activity of 1-shRNA2 lentivirus on the target gene was 91%; the inhibitory activity of CYP3A13-shRNA1 lentivirus on the target gene was 96%; the inhibitory activity of CYP3A13-shRNA2 lentivirus on the target gene was 85%; CYP3A25-shRNA1 lentivirus The inhibitory activity against the target gene was 90%; the inhibitory activity of the CYP3A25-shRNA2 lentivirus against the target gene was 94%.
  • mice Forty female C57BL/6 mice, 8-10 weeks old, were randomly divided into 8 groups, including 4 model groups and 4 control groups, with 5 mice in each group.
  • each mouse was injected with CYP3A11-shRNA1 lentivirus 5x10 8 TU in the tail vein.
  • a commercialized paclitaxel solution PTX, paclitaxel
  • a group of model groups and a group of control mice were sacrificed at intervals of 2 hours, 4 hours, 8 hours, and 24 hours, and blood of the mice was obtained for analysis.
  • the dosage of the residual drug is analyzed according to the standard protocol reported in the literature.
  • Docetaxel docetaxel
  • 100 ul of mouse plasma was obtained, and 25 pmol of docetaxel (Docetaxel) was added thereto as an internal control; after mixing, 10 mM ammonium acetate acetonitrile solution was added thereto to precipitate protein; and centrifuged under 10000 RCF conditions. Minutes, the supernatant was separated; the volume of the supernatant was adjusted to 1 mL using the mobile phase used for mass spectrometry, and 20 uL was taken for LC-MS analysis to obtain the concentration of the drug in the blood.
  • Docetaxel docetaxel

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention se rapporte à un procédé de régulation du niveau d'expression du gène du cytochrome P450 (CPY) de mammifère non humain et à son utilisation dans la production d'un modèle mammifère non humain. L'invention porte également sur des modèles animaux produits au moyen de ce procédé et sur des applications de ces modèles animaux dans l'étude préclinique de médicaments.
PCT/CN2013/000091 2012-02-02 2013-01-30 Procédé de régulation du niveau d'expression du gène cpy et utilisation de celui-ci WO2013113252A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
CN201210023123 2012-02-02
CN201210023123.8 2012-02-02
CN201310015230.0 2013-01-16
CN 201310015230 CN103243120A (zh) 2012-02-02 2013-01-16 一种调控cyp基因表达水平的方法及其应用

Publications (1)

Publication Number Publication Date
WO2013113252A1 true WO2013113252A1 (fr) 2013-08-08

Family

ID=48904406

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2013/000091 WO2013113252A1 (fr) 2012-02-02 2013-01-30 Procédé de régulation du niveau d'expression du gène cpy et utilisation de celui-ci

Country Status (2)

Country Link
CN (1) CN103243120A (fr)
WO (1) WO2013113252A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003014387A2 (fr) * 2001-08-08 2003-02-20 Epidauros Biotechnologie Ag Polymorphismes du gene humain de cyp1a2 et utilisation de ceux-ci dans des applications diagnostiques et therapeutiques
US20090265795A1 (en) * 2008-04-22 2009-10-22 Clemson University Research Foundation Methods of Inhibiting Multiple Cytochrome P450 Genes with siRNA
CN101591653A (zh) * 2008-05-27 2009-12-02 中国人民解放军军事医学科学院野战输血研究所 低表达cyp7a1的肝细胞及其构建方法

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003014387A2 (fr) * 2001-08-08 2003-02-20 Epidauros Biotechnologie Ag Polymorphismes du gene humain de cyp1a2 et utilisation de ceux-ci dans des applications diagnostiques et therapeutiques
US20090265795A1 (en) * 2008-04-22 2009-10-22 Clemson University Research Foundation Methods of Inhibiting Multiple Cytochrome P450 Genes with siRNA
CN101591653A (zh) * 2008-05-27 2009-12-02 中国人民解放军军事医学科学院野战输血研究所 低表达cyp7a1的肝细胞及其构建方法

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BI, HUANGLEI ET AL.: "Hua xue xiu shi xiao gan rao RNA zuo wei zhi liao yao wu de yan jiu jin zhan.", JOURNAL OF INTERNATIONAL PHARMACEUTICAL RESEARCH, vol. 36, no. 4, 31 August 2009 (2009-08-31), pages 291 - 295 *
PANG, HAO ET AL.: "Establishment of CYP3AI gene knock-down mouse by lentiviral transgenesis.", ACTA ACADEMIAE MEDICINAE MILITARIS TERTIAE, vol. 32, no. 5, 15 March 2010 (2010-03-15), pages 422 - 426 *
WANG, YONG ET AL.: "Lentiviral transgenic microRNA-based shRNA suppressed mouse cytochromosome P450 3A (CYP3A) expression in a dose-dependent and inheritable manner, art e30560", PLOS ONE, vol. 7, no. 1, 24 January 2012 (2012-01-24), XP055079756 *

Also Published As

Publication number Publication date
CN103243120A (zh) 2013-08-14

Similar Documents

Publication Publication Date Title
EP1871426B1 (fr) Petits ARN activateurs et leurs utilisation
JP2022008404A (ja) Ｃ／ＥＢＰα小分子活性化ＲＮＡ組成物
US9290763B2 (en) Construction of bifunctional short hairpin RNA
US20090220589A1 (en) Treatment, diagnostic, and method for discovering antagonist using sparc specific mirnas
JP2018529340A (ja) 核酸のエキソソームパッケージング
DK3134526T3 (en) LNC RNAs for therapy and diagnosis of cardiac hypertrophy
JPWO2009044899A1 (ja) 細胞の増殖を制御する核酸
JP2011519951A (ja) ｍｉＲＮＡによる薬物治療の増強
TW201136594A (en) Modulation of hsp47 expression
AU2014284836A1 (en) Respiratory disease-related gene specific siRNA, double-helical oligo RNA structure containing siRNA, compositon containing same for preventing or treating respiratory disease
US9879254B2 (en) Targeting RNAs to microvesicles
JP2019528736A (ja) ｍｏｄＲＮＡの細胞特異的発現
KR20220119129A (ko) Leaper 기술에 기반한 mps ih 치료 방법 및 조성물
JP2013511984A (ja) 副溝結合剤（ＭＧＢ）−オリゴヌクレオチドｍｉＲＮＡアンタゴニスト
WO2020243560A1 (fr) Utilisations de compositions trem pour moduler des ensembles d'arnt
US20130267577A1 (en) Gene Silencing by Single-Stranded Polynucleotides
JP2011507554A (ja) 遺伝子発現を増加させるための方法および組成物
TW201119681A (en) Compositions and methods for inhibiting expression of KIF10 genes
WO2013113252A1 (fr) Procédé de régulation du niveau d'expression du gène cpy et utilisation de celui-ci
WO2010079819A1 (fr) Composition pharmaceutique destinée au traitement de l'obésité ou du diabète
KR20220119084A (ko) 폴리뉴클레오티드를 엑소솜에 전달하기 위한 핵산 구축물
WO2011074652A1 (fr) Acide nucléique capable d'inhiber l'expression de hif-2a
JP2022515211A (ja) 合成マイクロｒｎａミミック
WO2011130464A1 (fr) Régulation traductionnelle de sparc par les micro-arn mir29a, b et c
AU2010211370A1 (en) Pharmaceutical composition containing L-ribozyme for treating adverse reactions by administering Spiegelmers

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13743598

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205 DATED 20/11/2014)

122 Ep: pct application non-entry in european phase

Ref document number: 13743598

Country of ref document: EP

Kind code of ref document: A1