WO2013066047A1 - Fusion protein comprising c-terminal domain of ret protein and use thereof as a diagnosing marker - Google Patents

Fusion protein comprising c-terminal domain of ret protein and use thereof as a diagnosing marker Download PDF

Info

Publication number
WO2013066047A1
WO2013066047A1 PCT/KR2012/009056 KR2012009056W WO2013066047A1 WO 2013066047 A1 WO2013066047 A1 WO 2013066047A1 KR 2012009056 W KR2012009056 W KR 2012009056W WO 2013066047 A1 WO2013066047 A1 WO 2013066047A1
Authority
WO
WIPO (PCT)
Prior art keywords
fusion
ret
protein
fusion protein
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2012/009056
Other languages
English (en)
French (fr)
Inventor
Young-Seok JU
Jeong-Sun Seo
Eun-Hee Kim
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Macrogen Inc
Original Assignee
Macrogen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Macrogen Inc filed Critical Macrogen Inc
Priority to EP12845116.8A priority Critical patent/EP2773673B1/en
Priority to KR1020167010433A priority patent/KR101660235B1/ko
Priority to JP2014538724A priority patent/JP6389124B2/ja
Priority to KR1020147013826A priority patent/KR101625139B1/ko
Publication of WO2013066047A1 publication Critical patent/WO2013066047A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/96Stabilising an enzyme by forming an adduct or a composition; Forming enzyme conjugates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5752Immunoassay; Biospecific binding assay; Materials therefor for cancer of the lungs
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10Modifications characterised by
    • C12Q2525/205Aptamer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • a fusion protein including N-terminal domain of a fusion partner at N-terminal and C-terminal domain of RET protein at C-terminal, a fusion gene encoding the fusion protein, and a use of the fusion protein or the fusion gene as a diagnosing marker for a cancer, are provided.
  • Lung cancer remains a leading cause of mortality in cancer, with around 1.38 million deaths worldwide annually.
  • the median survival time for lung cancer patients in advanced stages is less than one year from diagnosis.
  • Tobacco smoking is known to be the major risk factor of lung cancer in
  • NSCLC non-small-cell lung cancer
  • NSCLC a dominant histological type is adenocarcinoma (-70%).
  • Lung cancer of never-smokers tends to be driven by single somatic mutation events, rather than global genetic and epigenetic changes.
  • a subset of somatic mutations has been reported in NSCLC in the past few years, such as EGFR, KRAS and ALK genes (which are conventionally called as 'the triple-markers').
  • Mutations in the tyrosine kinase domain of EGFR which are associated preferentially with NSCLC of non-smokers and Asians, are sensitive to EGFR targeted therapy, such as Gefitinib.
  • Missense mutations in KRAS are common in the lung adenocarcinomas of smokers, and induce resistance to EGFR inhibitors.
  • An embodiment provides a fusion protein consisting essentially of N-terminal domain of a fusion partner and C-terminal domain of RET protein.
  • the fusion protein may be KIF5B-RET fusion protein consisting essentially of N-terminal domain of KIF5B protein and C-terminal domain of RET protein.
  • Another embodiment provides a fusion gene encoding the fusion protein.
  • Another embodiment provides a recombinant vector including the fusion gene.
  • Another embodiment provided a method of diagnosing a lung cancer including: detecting at least one selected from the group consisting of an RET-involved chromosomal rearrangement including inversion or translocation in Chromosome 10; a fusion protein wherein RET protein is fused with other protein; a fusion gene encoding the fusion protein; and the overexpression of RET compared to a standard sample from an individual without a cancer, wherein when at least one selected from the above group is detected in the test sample, the subject from which the test sample taken is determined as a lung cancer patient.
  • Another embodiment provides a use of the KIF5B-RET fusion protein as a marker for diagnosing a lung cancer.
  • compositions for diagnosing a lung cancer comprising a material for detecting the fusion protein or the fusion gene.
  • Another embodiment provides a method of preventing or treating a lung cancer, comprising the step of administering a therapeutically effective amount of at least one inhibitor against the fusion protein, at least one inhibitor against the fusion gene encoding the fusion protein, at least one inhibitor against a RET coding gene, or a combination thereof, to a patient in need thereof.
  • compositions for preventing or treating a lung cancer comprising at least one inhibitor against the fusion protein, at least one inhibitor against the fusion gene encoding the fusion protein, at least one inhibitor against a RET coding gene, or a combination thereof, as an active ingredient.
  • Another embodiment provides a use of at least one inhibitor against the fusion protein, at least one inhibitor against the fusion gene encoding the fusion protein, at least one inhibitor against a RET coding gene, or a combination thereof for preventing or treating a lung cancer.
  • Still another embodiment provides a method of screening an anticancer drug against lung cancer including: treating a cell expressing the fusion protein with a sample compound; measuring the fusion protein expression level in the cell, wherein the fusion protein expression level in the cell treated with the sample compound is decreased compared with that before the treatment with the sample compound or that in a non- treated cell, the sample compound is determined as a candidate compound for the anticancer drug against lung cancer.
  • the present inventors identified a fusion gene generated by a chromosomal inversion event in lung adenocarcinoma patients, to complete the present invention. It is found that the fusion gene is detected even in a young, never-smoker lung adenocarcinoma patient, whose cancer was negative for the previously known triple- markers (EGFR, KRAS and ALK genes). Therefore, the fusion gene is expected as an effective marker for a lung cancer, which can function as a marker even when the previously known triple-markers cannot function.
  • An embodiment provides a fusion gene specifically found at a cancer cell and a fusion protein encoded by the fusion gene.
  • a fusion protein including N-terminal domain of a fusion partner and C-terminal domain of RET protein is provided.
  • the N-terminal domain of a fusion partner may be positioned at N-terminus of the fusion protein
  • the C-terminal domain of RET protein may be positioned at C-terminus of the fusion protein.
  • the fusion partner may be a N-terminal domain of KIF5B protein, which is positioned at N-terminus of the fusion protein.
  • the fusion protein may be represented as KIF5B-RET protein which includes N-terminal domain of KIF5B protein at N-terminus and C-terminal domain of RET protein at C-terminus.
  • Another embodiment provides a fusion gene encoding the fusion protein, where a gene encoding the N-terminal domain of the fusion partner positions at 5' end and a gene encoding the C-terminal domain of the RET protein positions at 3' end.
  • the fusion gene may be represented as KIF5B-RET gene, where a gene encoding the N-terminal domain of KIF5B positions at 5' end and a gene encoding the C-terminal domain of the RET protein positions at 3' end.
  • Another embodiment provides an expression vector including the fusion gene and optionally transcription elements (e.g., a promoter and the like) operably linked to the fusion gene.
  • Another embodiment provides a transformant cell transformed with the expression vector.
  • the RET protein is a transmembrane receptor tyrosine kinase.
  • the RET consists of extracellular region (which contains Cadherin-like domains), a transmembrane domain and an intracellular region containing a tyrosine kinase domain.
  • co-receptors and ligands such as glial derived neurotrophic factor (GDNF)
  • GDNF glial derived neurotrophic factor
  • the downstream signaling cascade of the RET is the mitogen-activated protein kinase (MAPK) pathway, which regulates cell survival/apoptosis, proliferation, differentiation, and migration.
  • MAPK mitogen-activated protein kinase
  • the RET protein may be derived from a mammal, such as a human.
  • the human RET gene encoding the human RET protein is localized to chromosome 10 (10q11.2) and contains 19-21 exons depending on variants.
  • the human RET protein may be encoded by a human RET gene represented by the NCBI accession number NM_020630 or NM_020975.
  • the C-terminal domain of RET protein may include an amino acid sequence encoded by a polynucleotide from 12 th exon to the last exon (for example, 20 th exon) of RET gene (e.g., NM_020630 or NM_020975).
  • the C-terminal domain of RET protein may include consecutive at least about 300 amino acids from the start position of 12 th exon (for example 713 th position for the RET protein encoded byNM_020975) toward C- terminus of the RET protein encoded by NM_020630 or NM_020975.
  • the C-terminal domain of RET protein may include consecutive about 300 to about 450 amino acids, consecutive about 300 to about 420 amino acids, or consecutive about 300 to about 402 amino acids from the start position of 12 th exon (e.g., 713 th position) toward C-terminus of the RET protein encoded by NM_020630 (19 exons) or NM_020975 (20 exons).
  • the KIF5B protein which is also called as Kinesin-1 heavy chain, is a protein encoded by KIF5B gene.
  • the KIF5B protein may be derived from a mammal, such as a human.
  • the human KIF5B gene encoding the human KIF5B protein is localized to chromosome 10 (10q11.22) and contains 26 exons.
  • the human KIF5B protein may be encoded by a human KIF5B gene represented by the NCBI accession number NM_004521.
  • the N-terminal domain of KIF5B protein may include an amino acid sequence encoded by a polynucleotide from the first exon to 16 th exon, or from the first exon to
  • the N- terminal domain of KIF5B protein may include consecutive at least about 329 amino acids from 1 st position (that is, at least amino acid sequence from 1 st to 329 th positions) of the KIF5B protein encoded by NM_004521.
  • the N-terminal domain of KIF5B protein may further include at least two coiled coil domain which starts from the amino acid of the 329 th position of the KIF5B protein encoded by NM_004521.
  • the two coiled coil domain further included may have an amico acid sequence of 329 th to 638 th positions of the KIF5B protein encoded by NM_004521(SEQ ID NO: 21 ).
  • the N-terminal domain of KIF5B protein may include consecutive about 329 to 900 amino acids, consecutive about 329 to 700 amino acids, consecutive about 329 to 650 amino acids, or consecutive about 329 to 638 amino acids from 1 st position of the KIF5B protein encoded by NM_004521.
  • the fusion may occur between the 16 th exon of KIF5B gene and 12 th exon of RET gene, which is called as a fusion point or breakpoint.
  • a fusion region may refer to a polynucleotide fragment (about ⁇ 30 nucleotides) or polypeptide (about -30 amino acids) fragment around the fusion point.
  • the exon number is numbered according to the exon number allocated by NCBI .
  • the fusion protein KIF5B-RET may have the amino acid sequence of SEQ ID NO: 3, 7, 11 or 15, wherein a polypeptide fragment from 629 to 648 th positions of SEQ ID NO: 3, from 629 th to 648 th positions of SEQ ID NO: 7, from 566 th to 585 th positions of SEQ ID NO: 11 , and from 839 th to 858 th positions of SEQ ID NO: 15 may be a fusion region of the fusion protein KIF5B-RET.
  • the fusion region of the fusion protein KIF5B-RET may have the amino acid sequence ofSEQ ID NO: 4, 8, 12 or 16.
  • the fusion gene of KIF5B-RET encoding the fusion protein of KIF5B-RET may have the nucleotide sequence of SEQ ID NO: 1 , 5, 9 or 13, wherein a polynucleotide from 1885 th to 1944 th positions of SEQ ID NO: 1 , 1885 th to 1944 th positions of SEQ ID NO: 5, 1696 th to 1755 th positions of SEQ ID NO: 9, and 2515 th to 2574 th positions of SEQ ID NO: 13 may be a fusion region of the fusion gene KIF5B-RET.
  • the fusion region of the fusion gene KIF5B-RET may have the nucleotide sequence of EQ ID NO: 2, 6, 10 or 14.
  • the fusion genes, the fusion proteins, and the fusion regions thereof are shown in Figs. 27 to 34.
  • the nucleotide sequences of DNA molecules and the amino acid sequences of proteins encoded by the DNA molecules may be determined by an automated DNA sequencer or an automated peptide sequencer.
  • the (nucleotide or amino acid) sequences determined by such automated sequencing means may include partial error compared with actual sequences.
  • the sequences determined by automated sequencing may have sequence identity of at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% compared with actual sequences.
  • the fusion protein, the fusion gene or the fusion region may have an amino acid sequence or a nucleotide sequence having sequence identity of at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% compared with the sequences of SEQ ID NOS: 1 to 17.
  • the fusion protein and the fusion gene are specifically present in cancer region, and they are not present in other region around the cancer region in the same tissue, suggesting a use of the fusion protein and/or the fusion gene as a biomarker for a cancer, for example, a solid cancer, in particular a lung cancer.
  • a RET-involved chromosomal rearrangement including inversion or translocation in Chromosome 10 or an overexpression of RET is also found in a cancer cell, in particular a lung cancer cell.
  • another embodiment provides a method of diagnosing a cancer or a method of providing information for diagnosing a cancer, including detecting, in a test sample obtained from a subject, at least one selected from the group consisting of:
  • RET-involved chromosomal rearrangement including inversion or translocation in Chromosome 10;
  • a fusion protein including N-terminal domain of a fusion partner and C-terminal domain of RET protein
  • the subject is determined as a patient suffered from a cancer.
  • the RET-involved chromosomal rearrangement may result in formation of the fusion protein or the fusion gene.
  • the RET-involved chromosomal rearrangement may be an inversion Chromosome 10.
  • the inversion of Chromosome 10 may be detected by using a polynucleotide (a probe) capable of hybridizing with (complementarily binding to) the inversion region in Chromosome 10 and/or a primer pair capable of detecting the inversion of Chromosome 10, for example, capable of producing a polynucleotide fragment having consecutive 100 to 200 nucleotides including the inversion region in Chromosome 10.
  • the inversion of Chromosome 10 may be detected by using the primer pair may comprise 5'- CAGAATTTCACAAGGAGGGAAG-3' (SEQ ID NO: 18) and 5'- CAGGACCTCTGACTACAGTGGA-3' (SEQ ID NO: 19).
  • the fusion protein and the fusion gene are as described above.
  • the fusion protein may also be detected by detecting the presence of the fusion protein or the fusion gene or mRNA corresponding to the fusion gene.
  • the presence of the fusion protein may be detected be a general assay that measures the interaction between the fusion protein and a material (e.g., an antibody or an aptamer) specifically binding to the fusion protein.
  • the general assay may be immunochromatography, immunohistochemical staining, enzyme liked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay (EIA), florescence immunoassay (FIA), luminescence immunoassay (LIA), western blotting, FACS, and the like.
  • the presence of the fusion gene or the mRNA may be detected by a general assay such as PCR, FISH (fluorescent in situ hybridization), and the like, using a polynucleotide capable of hybridizing with (complementarily binding to) the fusion gene or the mRNA.
  • the fusion gene may be detected and/or validated by using the integration techniques of whole-transcriptome (RNA) and/or whole-genome. (DNA) sequencing through massively parallel sequencing technologies.
  • the polynucleotide capable of hybridizing with the fusion gene or the mRNA may be a siRNA, an oligonucleotide, DNA probe, or DNA primer, which can detect the fusion gene or the mRNA by a direct hybridization with the fused or truncated gene or transcript in the test sample.
  • the fusion gene KIF5B-RET may be detected by using a polynucleotide (a probe) capable of hybridizing with (complementarily binding to) the fusion region of SEQ ID NO: 2, 6, 10 or 14, and/or a primer pair capable of producing a polynucleotide fragment having consecutive 100 to 200 nucleotides including the fusion region of SEQ ID NO: 2, 6, 10 or 14 in SEQ ID NO: 1 , 5, 9 or 13, respectively.
  • a polynucleotide a probe
  • a primer pair capable of producing a polynucleotide fragment having consecutive 100 to 200 nucleotides including the fusion region of SEQ ID NO: 2, 6, 10 or 14 in SEQ ID NO: 1 , 5, 9 or 13, respectively.
  • the fusion gene KIF5B-RET may be detected by using the primer pair of 5'- GTGAAACGTTGCAAGCAGTTAG-3' (KIF5B; SEQ ID NO: 20) and 5'- CCTTGACCACTTTTCCAAATTC-3' (RET; SEQ ID NO: 21 ) or 5'- TAAGGAAATGACCAACCACCAG-3' (KIF5B; SEQ ID NO: 22) and 5'- CCTTGACCACTTTTCCAAATTC-3' (RET; SEQ ID NO: 21 ).
  • the fusion protein KIF5B-RET may be detected using an antibody or aptamer specifically binding to the fusion region of the fusion protein KIF5B-RET.
  • the fusion region of the fusion protein KIF5B-RET may have the amino acid sequence of SEQ ID NO: 4, 8, 12 or 16.
  • the term "capable of hybridizing with the fusion region (or the inversion region)" may refer to having a complementary sequence or a sequence having sequence identity of at least 90% with that of the fusion region (or the inversion region).
  • compositions for diagnosing a cancer including one or more selected from the group consisting of a polynucleotide capable of hybridizing with the fusion region of SEQ ID NO: 2, 6, 10 or 14, a primer pair capable of producing a polynucleotide fragment having consecutive 100 to 200 nucleotides including the fusion region of SEQ ID NO: 2, 6, 10 or 14 in SEQ ID NO: i, 5, 9 or 13, respectively, a polynucleotide capable of hybridizing with the inversion region in Chromosome 10, a primer pair capable of producing a polynucleotide fragment having consecutive 100 to 200 nucleotides including the inversion region of Chromosome 10, and an antibody or aptamer binding to the fusion region of SEQ ID NO: 4, 8, 12 or 16.
  • the primer pair may be at least one selected from the group consisting of the primer pair of 5'-GTGAAACGTTGCAAGCAGTTAG-3' (KIF5B; SEQ ID NO: 20) and 5'-CCTTGACCACTTTTCCAAATTC-3' (RET; SEQ ID NO: 21 ) or 5'- TAAGGAAATGACCAACCACCAG-3' (KIF5B; SEQ ID NO: 22) and 5'- CCTTGACCACTTTTCCAAATTC-3' (RET; SEQ ID NO: 21 ), to detect the fusion gene of KIF5B-RET encoding the fusion protein, and the primer pair of 5'- CAGAATTTCACAAGGAGGGAAG-3' (SEQ ID NO: 18) and 5'- CAGGACCTCTGACTACAGTGGA-3' (SEQ ID NO: 19), to detect the inversion of Chromosome 10.
  • Another embodiment provides a use of the fusion protein and/or the fusion gene for diagnosing a cancer.
  • the patient may be any mammal, for example, a primate such as a human or monkey, a rodent such as a mouse or a rat, in particular a human.
  • the test sample may be a cell (e.g., a lung cell), a tissue (e.g., a lung tissue), or body fluid (e.g., blood) separated from the patient, for example a human.
  • the patient may be being treated or planed to be treated with a kinase inhibitor.
  • the test sample may include a cell derived from a human cancer cell or an extract thereof.
  • the fusion protein and/or the fusion gene may act as a target for treatment of a cancer.
  • another embodiment provides a method of preventing and/or treating a cancer, comprising administering a pharmaceutically (therapeutically) effective amount of at least one inhibitor against the fusion protein, at least one inhibitor against the fusion gene encoding the fusion protein, at least one inhibitor against a RET coding gene, or a combination thereof, to a patient in need thereof.
  • the method may further comprise the step of identifying the patient who needs the prevention and/or treatment of a cancer, prior to the step of administering.
  • Another embodiment provides a composition for preventing and/or treating a cancer, comprising at least one inhibitor against the fusion protein, at least one inhibitor against the fusion gene encoding the fusion protein, at least one inhibitor against a RET coding gene, or a combination thereof.
  • Another embodiment provides a use of an inhibitor against the fusion protein, an inhibitor against the fusion gene encoding the fusion protein, an inhibitor against a RET coding gene, or a combination thereof, for preventing and/or treating a cancer.
  • the inhibitor against the fusion protein of KIF5B-RET may be at least one selected from the group consisting of an aptamer specifically binding to the fusion protein; an antibody specifically binding to the fusion protein; and a kinase inhibitor such as sorafenib(4-[4-[[4-chloro-3-(trifluoromethyl)phenyl]carbamoylamino]phenoxy]-A/- methyl-pyridine-2-carboxamide), cabozantinib(A/-(4-((6,7-Dimethoxyquinolin-4- yl)oxy)phenyl)-A/-(4-fluorophenyl)cyclopropane-1 ,1-dicarboxamide), and the like.
  • the inhibitor against the fusion gene or the RET coding gene may be at least one selected from the group consisting of siRNA, shRNA, miRNA, and an aptamer, which are capable of specifically binding to the fusion gene or the RET coding gene
  • the cancer may be any solid cancer, for example, a lung cancer, a liver cancer, a colon cancer, a pancreatic cancer, a gastric cancer, a breast cancer, an ovarian cancer, a renal cancer, a thyroid cancer, an esophageal cancer, a prostatic cancer, or a brain cancer.
  • the cancer may be a lung cancer, in particular a small cell lung cancer (SCLC) or a non-small cell lung cancer (NSCLC) such as a lung adenocarcinoma, a squamous cell lung carcinoma, or a large cell lung carcinoma.
  • SCLC small cell lung cancer
  • NSCLC non-small cell lung cancer
  • the sample compound is determined as a candidate compound for the anticancer drug.
  • the method of screening an anticancer drug may further include the step of measuring the fusion protein expression level in the cell before the treatment of the sample compound.
  • the sample compound may be determined as a candidate compound for the anticancer drug when the fusion protein expression level after treatment of the sample compound is decreased compared with that before the treatment with the sample compound in the same cell.
  • the method of screening an anticancer drug may include providing cells expressing the fusion protein, and contacting a sample compound to a part of the provided cells.
  • the sample compound may be determined as a candidate compound for the anticancer drug when the fusion protein expression level in the cell contacted with the sample compound is decreased compared with that in the cells which are not contacted with the sample compound.
  • the cell used in the screening method may be a cell derived from a cancer cell where the fusion gene or the fusion protein is expressed and/or activated, an extract of the cell, or a culture of the cell.
  • the cancer cell may be a solid cancer cell, in particular a lung cancer, for example a non-small cell lung cancer such as a lung adenocarcinoma, as described above.
  • the fusion protein expression level may be detected be a general assay such as immunochromatography, immunohistochemical staining, enzyme liked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay (EIA), florescence immunoassay (FIA), luminescence immunoassay (LIA), western blotting, FACS, and the like.
  • ELISA enzyme liked immunosorbent assay
  • RIA radioimmunoassay
  • EIA enzyme immunoassay
  • FIA florescence immunoassay
  • LIA luminescence immunoassay
  • western blotting FACS, and the like.
  • the sample compound may be any natural or synthetic compound, for example at least one selected from the group consisting of a general compound, DNA, RNA, protein, and the like.
  • Fig. 1 is a microscopic image showing a paraffin section from a primary lung cancer tissue of a patient (AK55) obtained by CT-guided biopsy stained by hematoxylin and eosin, in magnification ratio of x100.
  • Fig. 2 is a microscopic image showing a paraffin section from a primary lung cancer tissue of a patient (AK55) obtained by CT-guided biopsy stained by hematoxylin and eosin, in magnification ratio of x400.
  • Fig. 3 is a microscopic image showing a result of immunohistochemical analysis of a primary lung cancer tissue for CK7.
  • Fig. 4 is a microscopic image showing a result of immunohistochemical analysis of a primary lung cancer tissue for TTF1.
  • Fig. 5 is a microscopic image showing a result of immunohistochemical analysis of a primary lung cancer tissue for CK20.
  • Fig. 6 shows a graphical representation of fusion genes identified in the lung cancer transcriptome sequencing.
  • Fig. 7 schematically shows KIF5B-RET fusion gene.
  • Fig. 8 is a graph showing RNA expression level of each RET exon.
  • Fig. 9 schematically shows a 10.6 Mb-long inversion event in chromosome 10 in the massively parallel sequencing of the cancer genome.
  • Fig. 10 shows a PCR amplification result for validation of KIF5B-RET fusion gene in RNA of AK55.
  • Fig. 11 shows a PCR amplification result for validation of KIF5B-RET fusion gene in DNA of AK55.
  • Fig. 12 shows a result of detection of the inversion breakpoint using Sanger sequencing for RNA validation.
  • Fig. 13 shows a result of detection of the inversion breakpoint using Sanger sequencing for DNA validation.
  • Fig. 14 schematically shows functional domains of KIF5B-RET fusion protein.
  • Fig. 15 shows a three-dimensional structure of KIF5B-RET fusion protein as predicted by the PHYRE2 algorithm.
  • Fig. 16 is a microscopic image showing a result of immunohistochemical analysis of KIF5B-RET expression in the lung cancer (bone metastasis) obtained from a patient (AK55) (x400).
  • Fig. 17 is a graph showing the results of analysis of RET expression in other lung adenocarcinomas.
  • Fig. 18 shows a result of network analysis of gene expression in the liver metastasis.
  • Fig. 19 shows results of FISH analysis for normal cell (A) and lung cancer cell
  • FIG. 20 shows western blotting results of NIH3T3 cell line showing the expression of KIF5B-RET fusion protein in NIH3T3 cell line.
  • Fig. 21 shows the colony forming ability of NIH3T3 cell line transfected with KIF5B-RET fusion gene.
  • Fig. 22 shows the protein expression level in NIH3T3 cell line transfected with
  • KIF5B-RET fusion gene under the treatment of a kinase inhibitor, Cabozantinib.
  • Fig. 23 is a graph showing the cell growth rate of KIF5B-RET fusion protein expressing cell under the treatment of a kinase inhibitor, Cabozantinib.
  • Fig. 24 is a gel electrophoresis image of liver metastatic lung cancer (AK55) and triple-negative lung adenocarcinoma (LC_S2).
  • Fig. 25A is a gel electrophoresis image of double-negative lung adenocarcinoma (LC_S6).
  • Fig. 25B is results of Identification of breakpoint of the KIF5B-RET fusion gene in LC_S6 using Sanger sequencing.
  • Fig. 26 schematically shows KIF5B-RET fusion transcripts of AK55, LC_S2, and
  • Fig 27 shows nucleotide sequence of KIF5B-RETa fusion gene and its fusion region, wherein the KIF5B domain is derived from NM_020975.
  • Fig 28 shows amino acid sequence of KIF5B-RETa fusion protein and its fusion region, wherein the KIF5B domain is derived from NM_020975.
  • Fig 29 shows nucleotide sequence of KIF5B-RETc fusion gene and its fusion region, wherein the KIF5B domain is derived from NM_020630.
  • Fig 30 shows amino acid sequence of KIF5B-RETc fusion protein and its fusion region, wherein the KIF5B domain is derived from NM_020630.
  • Fig 31 shows nucleotide sequence of KIF5B-RETa variant fusion gene and its fusion region, obtained from LC_S2.
  • Fig 32 shows amino acid sequence of KIF5B-RETa variant fusion protein and its fusion region, obtained from LC_S2.
  • Fig 33 shows nucleotide sequence of KIF5B-RETa variant fusion gene and its fusion region, obtained from LC_S6.
  • Fig 34 shows amino acid sequence of KIF5B-RETa variant fusion protein and its fusion region, obtained from LC_S6.
  • Example 1 Sample preparations
  • Paraffin-embedded tissues were obtained from primary lung cancer and bone metastasis of a patient AK55.
  • a frozen tissue from biopsy of liver metastatic cancer from AK55 was also available to use.
  • venous blood of AK55 was extracted.
  • Genomic DNA was extracted from the lung cancer, bone metastasis, liver metastasis and blood of the patient AK55.
  • RNA was extracted from the frozen liver metastasis of the patient AK55. Then cDNA was synthesized from total RNA as described in "Ju YS, Kim Jl, Kim S, et al., Nat Genet 2011 ,” which is incorporated herein by reference.
  • Figs. 1 and 2 are microscopic images showing a paraffin section from a primary lung cancer tissue obtained by CT-guided biopsy (stained by hematoxylin and eosin) (Fig. 1 : x100; Fig. 2: x400).
  • CT-guided biopsy stained by hematoxylin and eosin
  • the metastases in liver and multiple bones were also detected in positron emission tomography (PET) studies.
  • PET positron emission tomography
  • the patient AK55 has no known family history of cancers from grandparents and he is a never-smoker.
  • a week after diagnosis he suffered from a neck fracture due to the metastasis in cervical bone, and underwent a C7 corpectomy.
  • his lung adenocarcinoma was negative for known EGFR, KRAS and ALK mutations.
  • the immunohistochemical analysis results for CK7, CK20 and TTF1 were consistent with lung adenocarcinoma (Figs. 3-5; positive for CK7 (Fig. 3) and TTF1 (Fig. 4), negative for CK20 (Fig. 5)).
  • Figs. 3-5 are microscopic images showing results of immunohistochemical analyses of a primary lung cancer tissue (Fig. 3; CK7; Fig. 4: TTF1 ; Fig. 5: CK20). These analyses were done in the metastatic tumor in the cervical bone. CK7 and TTF1 were positive, but CK20 was negative. The results highly suggest that primary lung adenocarcinoma is the origin of this cancer.
  • Genomic variants of each sample obtained from the patient AK55 as described in Example 1 was classified into single nucleotide variation (SNV), short insertion and deletion (indel) and large deletions, using modified criteria of whole-genome sequencing as described in "Ju YS, Kim Jl, Kim S, et al., Nat Genet 2011” and “Kim Jl, Ju YS, Park H, et al., Nature 2009;460:1011-5", which are incorporated herein by reference. Then, the genomic variants in cancer tissue were compared with those in blood to identify cancer-associated somatic mutations. DNA and RNA sequencing data was also analyzed as described in "Ju YS, Kim Jl, Kim S, et al., Nat Genet 2011 ,” which is incorporated herein by reference.
  • Sequencing libraries were generated according to the standard protocol of lllumina Inc. for high-throughput sequencing. Excluding the genomic DNA from paraffin- embedded bone metastasis (of which DNA concentration was too low and it did not qualify under the inventor's criteria for generating the sequencing library), samples were sequenced using lllumina HiSeq2000 and Genome Analyzer llx. From whole-genome deep sequencing of cancer (liver metastasis) and normal tissue (blood) of the patient AK55, the inventors obtained 47.77x and 28.27x average read-depth, respectively. The obtained results are shown in Table 1.
  • Fig. 6 shows a graphical representation of fusion genes identified in the lung cancer transcriptome sequencing. Intra- and inter-chromosomal fusion genes are shown in the central layer. The thickness of lines shows the amount of evidence (number of spanning reads). The KIF5B-RET fusion gene is shown in red. Chromosome ideograms are shown in the outer layer. Coverage of cancer whole-genome sequencing is shown in the 1 st middle layer. This suggests that the cancer genome has no large chromosomal aneuploidy. Expression level of genes is shown in the 2 nd middle layer using heatmap.
  • fusion genes For detection of fusion genes using transcriptome sequencing, discordant reads, where the ends of a read were aligned to different genes, and exon-spanning reads across the fusion breakpoint of chimeric transcripts, were used. For final fusion gene candidates, corresponding genomic rearrangements, such as inversions, translocations and large deletions were assessed in the whole-genome sequencing data.
  • Transcriptome data were analyzed. The inventors have focused on detecting fusion genes since many cancers are known to be driven by fusion genes resulting from pathogenic chromosomal translocation or inversion.
  • each end of about 300bp-long cDNA fragment was sequenced upto 101 bp by next generation sequencing (Ju YS et al., Genome Res. 2012 22:436-445). From the sequence data, we examined the existence of a discordant read wherein the sequences of both ends are aligned on different chromosomes. In addition, exon-spanning reads, one of each end sequence is generated from a breakpoint of the fusion gene, was also examined. Discordant and exon-spanning reads indicate the existence of a fusion gene. Genes that have both discordant reads and exon-spanning reads were determined as lung cancer fusion genes.
  • KIAA1462-KIF5B was excluded, since its expression level is low and KIAA1462 is a hypothetical protein of which the molecular function is not known. Except KIF5B-RET fusion, we could not detect the corresponding chromosomal rearrangements (e.g. large deletion, inversion or translocation) in the fusion gene candidates.
  • the final fusion gene, KIF5B-RET was interesting in particular, since RET is a well known tyrosine-kinase proto-oncogene. In addition, this fusion gene has not been reported in human cancer, hence it is considered to be novel. The characteristics of this gene fusion event were further confirmed using RNA sequencing data. The fusion gene was highly expressed, as evidenced by 34 discordant paired-end reads and 60 spanning reads across the fusion-junction (see Table 2 and Fig. 7). Fig. 7 schematically shows KIF5B-RET fusion gene. In the transcriptome sequencing, 34 discordant paired- end reads and 60 spanning reads across the exon-junction were identified.
  • a discordant paired-end read is defined as a read whose end-sequences are aligned to different genes:
  • a spanning read is a read, one of whose end-sequences is aligned across the junction of the predicted fusion transcripts. In this analysis, the fusion occurred between the 16 exon of KIF5B and 12 th exon of RET.
  • Fig. 8 is a graph showing RNA expression level of each RET exon. ET expression was observed from the 12 th exon, downstream of the junction of the fusion gene. This suggests that all the RET expression originated from the KIF5B-RET fusion gene, rather than normal RET.
  • KIF5B and RET are 10.6 Mb away from each other, located at 10p11 .22 and 10q11.21 , respectively. Because the coding strands for the two genes are different, a 10.6 Mb-long inversion event is necessary for the fusion gene (see Fig. 9).
  • Fig. 9 schematically shows a 10.6 Mb-long inversion event in chromosome 10 in the massively parallel sequencing of the cancer genome. This event is the cause of the KIF5B-RET fusion gene.
  • KIF5B is generally expressed with its universal promoter. After the inversion event, this promoter activates global expression of the KIF5B-RET fusion gene.
  • PCR and Sanger sequencing primers for genomic inversion were 5'- CAGAATTTCACAAGGAGGGAAG-3' (SEQ ID NO: 18) and 5'- CAGGACCTCTGACTACAGTGGA-3' (SEQ ID NO: 19).
  • Primers for fusion transcripts are 5'-GTGAAACGTTGCAAGCAGTTAG-3' (SEQ ID NO: 20) and 5'- CCTTGACCACTTTTCCAAATTC-3' (SEQ ID NO: 21 ). All the Sanger sequencing experiments were performed at Macrogen Inc. (http://www.macrogen.com). All three cancer-related tissues of the patient AK55 (lung cancer, bone and liver metastasis), excluding normal blood, showed PCR products resulting from the inversion event (Figs. 10 and 11). Figs. 10 and 11 show the obtained PCR amplification results for validation of KIF5B-RET fusion gene in RNA (Figs. 10) and DNA (Fig. 11 ) of the patient AK55.
  • KIF5B-RET fusion gene was performed by PCR amplification using inversion-specific primers as described above and electrophoresis.
  • the fusion gene is only detected in the RNA and DNA from the cancer tissue of the patient AK55.
  • Figs. 12 and 13 show results of detection of the inversion breakpoint using Sanger sequencing for RNA (Fig. 12) and DNA (Fig. 13) validation.
  • the fusion gene was successfully validated by Sanger sequencing.
  • the inversion breakpoint in the genome was also identified to single-nucleotide resolution.
  • the genomic breakpoints were located in the introns of KIF5B and RET.
  • the RET oncogene is a transmembrane receptor tyrosine kinase.
  • RET consists of extracellular region (which contains Cadherin-like domains), a trans-membrane domain and an intracellular region containing a tyrosine kinase domain (see Fig. 14).
  • Fig. 14 schematically shows functional domains of KIF5B-RET fusion protein.
  • the fusion protein consists of 638 N-terminal residues of KIF5B and 402 C-terminal residues of RET.
  • the fusion gene has a protein tyrosine kinase domain together with a coiled-coil domain.
  • the coiled-coil domain induces homo-dimerization which will activate the oncogenic protein tyrosine kinase domain by auto-phosphorylation.
  • RET When RET is dimerized by binding co-receptors and ligands, such as glial derived neurotrophic factor (GDNF), it is activated by auto-phosphorylation and then simulates downstream signaling pathways.
  • the downstream signaling cascade of the RET proto-oncogene is the mitogen-activated protein kinase (MAPK) pathway, which regulates cell survival/apoptosis, proliferation, differentiation, and migration.
  • MAPK mitogen-activated protein kinase
  • KIF5B is a microtubule-based motor protein, ubiquitously expressed due to its active promoter and involved in the transport of organelles in eukaryotic cells. Its coiled- coil domain induces homo-dimerization, which is essential for its movement.
  • Fig. 15 shows a three-dimensional structure of KIF5B-RET fusion protein as predicted by the PHYRE2 algorithm.
  • the N- and C-terminal of the fusion protein are colored in red and blue, respectively.
  • Protein 3D modeling was performed using Phyre2 software using the protein sequence of the KIF5B-RET fusion gene (http://www.sbg.bio.ic.ac.uk/phyre2/).
  • the KIF5B-RET fusion gene may be highly expressed and then dimerized after translation owing to KIF5B (Figs. 14 and 15). Then, the dimerized RET protein tyrosine kinase domain may be stimulated abnormally, thus facilitating the stimulation of an oncogenic pathway. Immunohistochemical analysis showed that the tyrosine kinase domain of RET was highly expressed in the lung cancer tissue (Fig. 6).
  • Fig. 16 is a microscopic image showing a result of immunohistochemical analysis of KIF5B-RET expression in the lung cancer (bone metastasis) obtained from a patient (AK55) (x400). The protein is exclusively observed in tumor cells, suggesting the KIF5B- RET fusion protein has important roles in the cancer.
  • Example 5 Frequency assessment of RET overexpression in other lung cancer samples
  • RET oncogenic effect of RET was first identified in papillary thyroid carcinoma (PTC) where diverse kinds of chromosomal translocations and inversions led to the formation of PTC/RET fusion genes. Specific point mutations have also been reported as drivers in multiple endocrine neoplasia (MEN) types 2A and 2B. In addition, activated RET has been observed in prostate cancer, pancreatic cancer and melanoma. Its tumorigenecity is also supported by RET transgenic mice studies which generated a variety of malignancies. However, this gene has not been highlighted in lung cancer previously.
  • PTC papillary thyroid carcinoma
  • MEN multiple endocrine neoplasia
  • RET overexpression in lung adenocarcinoma was evaluated using previous microarray data archived in databases.
  • TCGA Cancer Genome Atlas
  • Fig. 18 shows a result of network analysis of gene expression in the liver metastasis.
  • the network analysis was done using Cytoscape (http://www.cytoscape.org/) along with MiMI plugin (http://mimiplugin.ncibi.org/). Genes overexpressed in the cancer were mapped as a network, where the node size is proportional to the relative expression. Major functional groups were labeled. Functionally important genes were colored in red.
  • FISH fluorescent in situ hybridization
  • FISH reagent 7 ⁇ _ LSI buffer [Vysis, Downers Grove, IL] and 3 ⁇ probe
  • a Hybrite Vysis
  • the slides were then washed in 2Xsaline sodium citrate/0.1 % NP40 (US Biological, Swampscott, MA) at 70° C for 2 minutes and counterstained with 49,6-diamidino-2-phenyl indole dihydrochloride.
  • the cells were analyzed by a microscopist (M.L.) using a fluorescent microscope equipped with appropriate filter sets. Chromosome inversion, a deduced chromosomal rearrangement is responsible for KIF5B-RET fusion.
  • the obtained results of FISH are shown in Fig. 19, showing a split of red and green probes that flank the RET translocation site in a KIF5B-RET fusion positive tumor (arrows).
  • Example 7 Examination of cell growth rate and viability of a mammal cell transfected with KIF5B-RET fusion gene
  • NIH 3T3 cells By transfecting NIH 3T3 cells with a construct including cDNA encoding KIF5B- RET fusion protein and expressing the KIF5B-RET fusion protein, it was confirmed whether or not the expression of the KIF5B-RET fusion protein contributes to conversion from normal cell to tumor cell.
  • NIH 3T3 cells ATCC/ ATCC Number CRL- 1658
  • DMEM medium Gibco BRL
  • FBS fetal bovine serum
  • streptomycin penicillin
  • Preparation of supernatant of retrovirus and transfection were performed according to protocol provided by Platinum Retrovirus Expression System purchased from CELL BIOLABs.
  • NIH3T3 cells were transducted with the supernatant of retrovirus including a pMXs- puro/fusion protein expression vector, and then the transducted cells were selected using puromycin(2ug/ml).
  • Whole cell lysates from cell lines were subjected to SDS- PAGE followed by blotting onto a polyvinylidine difluoride(PVDF) membrane. The blot were blocked TBS containing 0.1 % Tween 20 and 5% BSA, and probed with anti- RET(#3223, Cell signaling, USA), anti-phospho-RET(Tyr905) (#3221 , Cell signaling, USA), and anti-actin (A5441 , Sigma-Aldrich, USA).
  • the membrane After washing with TBS containing 0.1% Tween 20, the membrane were incubated with horseradish peroxidase-conjugated anti-mouse or anti-rabbit secondary antibodies and treated with an enhanced chemiluminescence reagent (Pierce, #34080). The obtained results are shown in Fig. 20, indicating that the selected NIH3T3 cells are stably transformed with KIF5B-RET fusion gene through western blotting.
  • KIF5B-RETa, or KIF5B-RETc fusion gene (NIH3T3/KIF5B-RETa, NIH3T3/KIF5B-RETc) cells in FBS-containing or FBS-free medium were measured and compared with each other.
  • the NIH3T3 cell and Nl H3T3/KI F5B-RET cells were cultured with FBS containing media, or FBS-free media for 24 hour. And then, the obtained images are shown in Fig. 21.
  • the growth of non-transfected NIH3T3 cells is inhibited in FBS-free medium, but KIF5B-RET fusion gene transformed NIH3T3 cells grow and form colonies well even in FBS-free medium.
  • KIF5B-RET fusion protein converts NIH3T3 cells properties and KIF5B-RET fusion gene transfected cells are capable of survival and growth even under the abnormal conditions such as FBS deficient medium owing to the KIF5B-RET fusion protein.
  • Example 8 Examination of inhibition of mammal solid tumor cell growth by the fusion protein inhibitor (Cabozantinib)
  • KIF5B-RET transfected NIH3T3 cells (NIH3T3 /KIF5B-RET) (referring to Example 7) were treated with cabozantinib(4 Chem, Korea) in various concentrations for 2 days as shown in Fig. 22, and the expression levels of RET, phospho-RET, and actin (control) were measured by immunoblotting using corresponding antibodies.
  • Anti-RET and anti-phospho-RET(Tyr905) antibodies were obtained from Cell Signaling Technology(#3223, #3221 ).
  • Anti-actin antibody were obtained from Sigma Aldrich(#A5441 ).
  • Fig. 22 shows that the expression of phospho-RET, which is an active form of RET, is decreased depending on the concentration of cabozantinib.
  • the number of cells expressing the fusion protein is counted, and the cell growth inhibition was analyzed using WST-1 solution cell proliferation assay (Roche) according to protocol provided by the manufacturer.
  • WST-1 solution cell proliferation assay (Roche) according to protocol provided by the manufacturer.
  • About 1000 to 5000 cells of the KIF5B-RET transfected NIH3T3 cells were seeded on 96-well plate, and grown in complete medium (DMEM, Gibco) supplemented with 10%(v/v) FBS. After 24 hours, the medium was replaced with 100 ⁇ of complete growth medium supplemented with 10%(v/v) FBS and cabozantinib in 100 nM concentrations as shown in Fig. 23, and then, the cells were further cultured for 72 hours.
  • each well was added with 10 ⁇ of WST-1 solution and further cultured for 1 to 3 hours. Absorbance at 450nm was measured using a microplate reader. The growth inhibition was evaluated as mean ⁇ SD value of the measured absorbance of cabozantinib treated cells compared with that of non- treated cells. The analyses were performed in triplicate. The obtained results are shown in Fig. 23.
  • the KIF5B-RET fusion protein contributes to increase of cell growth rate and cell survival of human tumor cells(such as NSCLC), and the inhibitor against the fusion protein is capable of leading to deceased cell survival and increased apoptosis.
  • Example 9 Detection of KIF5B-RET fusion gene in other patients
  • a transcriptome of additional triple-negative (EGFR, KRAS, and EML4-ALK) primary lung adenocarcinoma was analyzed using massively parallel sequencing.
  • the additional sample was called as LC_S2 (A 62-year-old man patient received a diagnosis of lung adenocarcinoma stage 3A).
  • the sample of LC_S2 was prepared referring to the method described in Example 1.
  • KIF5B-RET fusion transcripts were found in LC_S2.
  • RET was highly expressed from 12 th exon in LC_S2 as shown in Table 4.
  • KIF5B-RET fusion gene could be expressed by the active promoter of KIF5B in those lung cancer tissues (AK55 and LC_S2). This fusion transcript in LC_S2 was validated using cDNA PCR.
  • Fig. 24 shows the results of analysis using cDNA PCR targeting KIF5B-RET fusion transcripts and gel electrophoresis in the liver metastatic lung cancer of AK55 and the additional triple-negative lung adenocarcinoma (LC_S2).
  • cDNA from AK55(SEQ ID NO: 1 ) and LC_S2(SEQ ID NO: 9) shows clear evidence of the fusion transcript. Because the fusion transcript in AK55 contains one more exon of KIF5B (exon 16) compared with that in LC_S2 (exon 15), the size of the PCR product in AK55 is longer than that in LC_S2.
  • the KIF5B-RET fusion gene was further assessed using cDNA PCR of a double-negative (EGFR and EML4-ALK were negative in pathologic studies; KRAS mutation status was unknown) primary lung adenocarcinoma (LC_S6) (A 58-year-old man patient received a diagnosis of lung adenocarcinoma stage 1A).
  • the sample of LC_S2 was prepared referring to the method described in Example 1 .
  • the fusion transcript in LC_S2 was validated using cDNA PCR, confirming that LC_S6 showed the KIF5B-RET fusion gene (SEQ ID NO: 13) (Fig. 25).
  • Fig. 25 KIF5B-RET fusion gene
  • LC_S6 shows clear evidence of the fusion transcript.
  • the fusion transcript in LC_S6 contains seven more exons of KIF5B (exons 17-23) compared with that in AK55.
  • the breakpoint of the fusion gene in LC_S6 was identified using Sanger sequencing, and the obtained results are shown in Fig. 25B.
  • PCR and Sanger sequencing primers for genomic inversion of AK55 were 5'-CAGAATTTCACAAGGAGGGAAG-3' (KIF5B; SEQ ID NO: 18) and 5'- CAGGACCTCTGACTACAGTG GA-3' (RET; SEQ ID NO: 19).
  • the primers for the fusion transcripts were 5'-GTGAAACGTTGCAAGCAGTTAG-3' (KIF5B; SEQ ID NO: 20; for AK55 and LC_S6) and 5'-CCTTGACCACTTTTCCAAATTC-3' (RET; SEQ ID NO: 21 ; or AK55, LC_S2 and LC_S6).
  • KIF5B 5'-GTGAAACGTTGCAAGCAGTTAG-3'
  • RET 5'-CCTTGACCACTTTTCCAAATTC-3'
  • Fig. 26 schematically shows KIF5B-RET fusion transcripts of AK55 (SEQ ID NO: 1 ), LC_S2(SEQ ID NO: 9), and LC_S6(SEQ ID NO: 13). Each rectangle indicates an exon of KIF5B (blue) and RET (red) gene.
  • KIF5B-RET fusion genes and KIF5B-RET fusion proteins obtained from lung adenocarcinoma samples are summarized in the Table 4:

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Biophysics (AREA)
  • Hospice & Palliative Care (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Cell Biology (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
PCT/KR2012/009056 2011-10-31 2012-10-31 Fusion protein comprising c-terminal domain of ret protein and use thereof as a diagnosing marker Ceased WO2013066047A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP12845116.8A EP2773673B1 (en) 2011-10-31 2012-10-31 Fusion protein comprising c-terminal domain of ret protein and use thereof as a diagnosing marker
KR1020167010433A KR101660235B1 (ko) 2011-10-31 2012-10-31 Ret 단백질의 c-말단 도메인을 포함하는 융합단백질 및 이의 진단마커로의 용도
JP2014538724A JP6389124B2 (ja) 2011-10-31 2012-10-31 Ret蛋白質のc−末端ドメインを含む融合蛋白質及びその診断マーカーとしての用途
KR1020147013826A KR101625139B1 (ko) 2011-10-31 2012-10-31 Ret 단백질의 c-말단 도메인을 포함하는 융합단백질 및 이의 진단마커로의 용도

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201161553483P 2011-10-31 2011-10-31
US61/553,483 2011-10-31
US13/663,565 2012-10-30
US13/663,565 US10023855B2 (en) 2011-10-31 2012-10-30 Fusion protein comprising C-terminal domain of RET protein and use thereof as a diagnosing marker

Publications (1)

Publication Number Publication Date
WO2013066047A1 true WO2013066047A1 (en) 2013-05-10

Family

ID=48192340

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/009056 Ceased WO2013066047A1 (en) 2011-10-31 2012-10-31 Fusion protein comprising c-terminal domain of ret protein and use thereof as a diagnosing marker

Country Status (5)

Country Link
US (1) US10023855B2 (https=)
EP (1) EP2773673B1 (https=)
JP (1) JP6389124B2 (https=)
KR (2) KR101660235B1 (https=)
WO (1) WO2013066047A1 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014039971A1 (en) * 2012-09-07 2014-03-13 Exelixis, Inc. Inhibitors of met, vegfr and ret for use in the treatment of lung adenocarcinoma
US9297011B2 (en) 2011-08-23 2016-03-29 Foundation Medicine, Inc. KIF5B-RET fusion molecules and uses thereof
CN111032696A (zh) * 2017-08-21 2020-04-17 大鹏药品工业株式会社 Dctn1蛋白质与ret蛋白质的融合蛋白
US10668075B2 (en) 2012-09-25 2020-06-02 Chugai Seiyaku Kabushiki Kaisha RET inhibitor

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10202365B2 (en) 2015-02-06 2019-02-12 Blueprint Medicines Corporation 2-(pyridin-3-yl)-pyrimidine derivatives as RET inhibitors
PL3371171T3 (pl) 2015-11-02 2024-03-25 Blueprint Medicines Corporation Inhibitory RET
TW201738228A (zh) 2016-03-17 2017-11-01 藍圖醫藥公司 Ret之抑制劑
US10227329B2 (en) 2016-07-22 2019-03-12 Blueprint Medicines Corporation Compounds useful for treating disorders related to RET
SI3773589T1 (sl) 2018-04-03 2024-03-29 Blueprint Medicines Corporation Inhibitor RET za uporabo pri zdravljenju raka, ki ima RET spremembo
JP2023527412A (ja) 2020-05-29 2023-06-28 ブループリント メディシンズ コーポレイション プラルセチニブの固体形態

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997044356A2 (en) * 1996-05-08 1997-11-27 Biogen, Inc. RET LIGAND (RetL) FOR STIMULATING NEURAL AND RENAL GROWTH
US20070212689A1 (en) * 2003-10-30 2007-09-13 Bianchi Diana W Prenatal Diagnosis Using Cell-Free Fetal DNA in Amniotic Fluid
WO2008031551A2 (en) * 2006-09-12 2008-03-20 Novartis Forschungsstiftung, Zweigniederlassung Non-neuroendocrine cancer therapy
US20090136502A1 (en) * 2005-10-24 2009-05-28 Toshimitsu Arai Preventives/Remedies for Cancer
US7741034B2 (en) * 2000-08-04 2010-06-22 Board Of Regents, The University Of Texas System Detection and diagnosis of smoking related cancers

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130137111A1 (en) 2010-07-26 2013-05-30 Astellas Pharma Inc. Detection method of novel ret fusion
EP2740742B1 (en) 2011-08-04 2018-03-14 National Cancer Center Fusion gene of kif5b gene and ret gene, and method for determining effectiveness of cancer treatment targeting fusion gene
EP3564261B1 (en) * 2011-08-23 2024-11-13 Foundation Medicine, Inc. Kif5b-ret fusion molecules and uses thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997044356A2 (en) * 1996-05-08 1997-11-27 Biogen, Inc. RET LIGAND (RetL) FOR STIMULATING NEURAL AND RENAL GROWTH
US7741034B2 (en) * 2000-08-04 2010-06-22 Board Of Regents, The University Of Texas System Detection and diagnosis of smoking related cancers
US20070212689A1 (en) * 2003-10-30 2007-09-13 Bianchi Diana W Prenatal Diagnosis Using Cell-Free Fetal DNA in Amniotic Fluid
US20090136502A1 (en) * 2005-10-24 2009-05-28 Toshimitsu Arai Preventives/Remedies for Cancer
WO2008031551A2 (en) * 2006-09-12 2008-03-20 Novartis Forschungsstiftung, Zweigniederlassung Non-neuroendocrine cancer therapy

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JU, YOUNG SEOK ET AL.: "A transforming KIF5B and RET gene fusion in lung adenocarcinoma revealed from whole-genome and transcriptome sequencing", GENOME RESEARCH, vol. 22, 22 December 2011 (2011-12-22), pages 436 - 445, XP003031534 *
See also references of EP2773673A4 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9297011B2 (en) 2011-08-23 2016-03-29 Foundation Medicine, Inc. KIF5B-RET fusion molecules and uses thereof
US9884060B2 (en) 2011-08-23 2018-02-06 Foundation Medicine, Inc. KIF5B-RET fusion molecules and uses thereof
US12239648B2 (en) 2011-08-23 2025-03-04 Foundation Medicine, Inc. KIF5B-RET fusion molecules and uses thereof
WO2014039971A1 (en) * 2012-09-07 2014-03-13 Exelixis, Inc. Inhibitors of met, vegfr and ret for use in the treatment of lung adenocarcinoma
US10668075B2 (en) 2012-09-25 2020-06-02 Chugai Seiyaku Kabushiki Kaisha RET inhibitor
US11633402B2 (en) 2012-09-25 2023-04-25 Chugai Seiyaku Kabushiki Kaisha RET inhibitor
CN111032696A (zh) * 2017-08-21 2020-04-17 大鹏药品工业株式会社 Dctn1蛋白质与ret蛋白质的融合蛋白
EP3674325A4 (en) * 2017-08-21 2021-11-03 Taiho Pharmaceutical Co., Ltd. FUSION PROTEIN OF DCTN1 PROTEIN WITH RET PROTEIN
CN111032696B (zh) * 2017-08-21 2023-11-03 大鹏药品工业株式会社 Dctn1蛋白质与ret蛋白质的融合蛋白

Also Published As

Publication number Publication date
EP2773673A1 (en) 2014-09-10
US10023855B2 (en) 2018-07-17
KR101625139B1 (ko) 2016-05-31
KR101660235B1 (ko) 2016-09-27
JP2015504299A (ja) 2015-02-12
KR20160052751A (ko) 2016-05-12
US20130116280A1 (en) 2013-05-09
EP2773673A4 (en) 2015-03-18
KR20140092846A (ko) 2014-07-24
EP2773673B1 (en) 2019-12-04
JP6389124B2 (ja) 2018-09-12

Similar Documents

Publication Publication Date Title
US10023855B2 (en) Fusion protein comprising C-terminal domain of RET protein and use thereof as a diagnosing marker
Wang et al. BRCA1 intronic Alu elements drive gene rearrangements and PARP inhibitor resistance
US20230303985A1 (en) Fusion proteins and methods thereof
US11578372B2 (en) NTRK1 fusion molecules and uses thereof
Fang et al. HIP1–ALK, a novel ALK fusion variant that responds to crizotinib
EP3193944B1 (en) Methods of treating cells containing fusion genes
EP2877854B2 (en) Fgfr-tacc fusion proteins and methods thereof
JP7037836B2 (ja) タンパク質キナーゼ阻害剤に対する感受性予測用バイオマーカー及びその用途
CN109072240A (zh) 使用piRNA诊断和治疗癌症的组合物和方法
WO2013155077A1 (en) Response markers for src inhibitor therapies
CN104619841A (zh) Cep55基因与ret基因的融合基因
Xing et al. Analysis of mutations in primary and metastatic synovial sarcoma
Biswas et al. Genomic profiling of multiple sequentially acquired tumor metastatic sites from an “exceptional responder” lung adenocarcinoma patient reveals extensive genomic heterogeneity and novel somatic variants driving treatment response
Bogale The roles of FGFR3 and c-MYC in urothelial bladder cancer
EP3778644A2 (en) Fgfr-tacc fusion proteins and methods thereof
EP2894169B1 (en) Fusion protein comprising axl and composition for treating cancer comprising same
Noonan et al. A chronic signaling TGFb zebrafish reporter identifies immune response in melanoma
Fong et al. Molecular basis of lung carcinogenesis
US20190062846A1 (en) Compositions and methods for screening pediatric gliomas and methods of treatment thereof
JP2018164442A (ja) 皮膚有棘細胞癌の判定、予防又は治療方法
Wang et al. Study of NSD2 using a dTAG system reveals their molecular mechanism and oncogenic implications in t (4; 14) multiple myeloma
Zhou et al. NTRK1 Facilitates Brain Metastatic Progression in NSCLC Through EMT-Associated Signaling
Yamada et al. Paracrine Receptor Activation by Microenvironment Triggers Bypass Survival Signals and ALK Inhibitor Resistance in

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12845116

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2014538724

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20147013826

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012845116

Country of ref document: EP