WO2013063528A2 - Isoprene synthase variants with improved solubility for production of isoprene - Google Patents
Isoprene synthase variants with improved solubility for production of isoprene Download PDFInfo
- Publication number
- WO2013063528A2 WO2013063528A2 PCT/US2012/062308 US2012062308W WO2013063528A2 WO 2013063528 A2 WO2013063528 A2 WO 2013063528A2 US 2012062308 W US2012062308 W US 2012062308W WO 2013063528 A2 WO2013063528 A2 WO 2013063528A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- atom
- polypeptide
- isoprene
- cell
- host cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
- C12P5/007—Preparation of hydrocarbons or halogenated hydrocarbons containing one or more isoprene units, i.e. terpenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
- C12Y402/03007—Pentalenene synthase (4.2.3.7)
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08L—COMPOSITIONS OF MACROMOLECULAR COMPOUNDS
- C08L7/00—Compositions of natural rubber
Definitions
- the present invention provides methods and compositions comprising isoprene synthase variants.
- the present invention provides variant plant isoprene synthases for increased isoprene production in host cells.
- Isoprene (2-methyl-l,3-butadiene) is a volatile hydrocarbon that is insoluble in water and soluble in alcohol.
- Commercially viable quantities of isoprene can be obtained by direct isolation from petroleum C5 cracking fractions or by dehydration of C5 isoalkanes or isoalkenes (Weissermel and Arpe, Industrial Organic Chemistry, 4 th ed., Wiley- VCH, pp. 117-122, 2003).
- the C5 skeleton can also be synthesized from smaller subunits. It would be desirable, however, to have a commercially viable method of producing isoprene that was independent of nonrenewable resources.
- Isoprene monomer is employed in the manufacture of polyisoprene and various copolymers (with isobutylene, butadiene, styrene, or other monomers).
- IspS isoprene synthase
- IspS isoprene synthases
- an isoprene synthase with improved solubility may be expressed in a host (e.g. a bacterial host).
- the invention provides compositions of variant polypeptides having isoprene activity with improved solubility and methods for making and using such variants for the production of isoprene.
- the invention provides for isolated polypeptides having isoprene synthase activity, wherein the polypeptide variant comprises a substitution at residue X288 corresponding to SEQ ID NO: l, and wherein the polypeptide has increased protein solubility compared a parent polypeptide which does not comprise the substitution at residue X288.
- the substitution is at S288.
- the substitution is S288C.
- the polypeptide has at least about 5% to at least about 75% increased protein solubility compared to the parent polypeptide.
- the polypeptide is derived from a parent polypeptide isolated from a plant.
- the parent polypeptide is isolated from a plant species selected from poplar (Populus sp.), kudzu (Pueraria sp.), English oak (Quercus sp.) or willow (Salix sp.).
- the parent species is Populus sp.
- in the parent is P. alba, P. tremuloides, P. trichocharpa, P. nigra.
- the parent species is Pueraria sp.
- in the parent species is Pueraria montana.
- the parent species is Quercus sp.
- the parent species is Quercus rubur.
- the parent species is Salix sp.
- the parent species is S. alba or S. baylonica.
- the invention provides for recombinant host cells comprising any of the polypeptides described herein.
- the host cell is selected from the group consisting of a bacterial, algal, fungal, yeast, cyanobacterial, or Clostridial cell.
- the host cell is a bacterial cell.
- the bacterial cell is a gram-positive bacterial cell or gram-negative bacterial cell.
- the bacterial cell is selected from the group consisting of E. coli, L. acidophilus, P. citrea, B. subtilis, B.
- amyloliquefaciens B. clausii, B. halodurans, B. megaterium, B. coagulans, B.
- Pseudomonas sp. P. alcaligenes
- Clostridium sp. Clostridium sp.
- Corynebacterium sp. and C.
- the host cell is an algal cell.
- the algal cell is selected from the group consisting of green algae, red algae, glaucophytes, chlorarachniophytes, euglenids, chromista, or dinoflagellates.
- the host cell is a fungal cell.
- the fungal cell is a filamentous fungi.
- the host cell is a yeast cell.
- the yeast cell is selected from the group consisting of
- Saccharomyces sp. Schizosaccharomyces sp., Pichia sp., or Candida sp.
- the yeast cell is a Saccharomyces cerevisiae cell.
- the invention provides for a crystalline form of a polypeptide comprising the amino acid residues of SEQ ID NO:2 (DW614).
- the invention provides for a polynucleotide that encodes for isolated polypeptides having isoprene synthase activity, wherein the polypeptide variant comprises a substitution at residue X288 corresponding to SEQ ID NO: l, and wherein the polypeptide has increased protein solubility compared a parent polypeptide which does not comprise the substitution at residue X288.
- the invention provides for a vector comprising a polynucleotide that encodes for isolated polypeptides having isoprene synthase activity, wherein the polypeptide variant comprises a substitution at residue X288 corresponding to SEQ ID NO: l, and wherein the polypeptide has increased protein solubility compared a parent polypeptide which does not comprise the substitution at residue X288.
- the invention provides for a recombinant host cell comprising the vector described above.
- the invention provides for methods of producing isoprene comprising:
- the invention provides for methods of producing isoprene comprising: (a) culturing the recombinant cell comprising polypeptides having isoprene synthase activity, wherein the polypeptide variant comprises a substitution at residue X288 corresponding to SEQ ID NO: l, and wherein the polypeptide has increased protein solubility compared a parent polypeptide which does not comprise the substitution at residue X288 under conditions suitable for the production of isoprene and (b) producing isoprene.
- Figure 1 shows a monomer view of wild type IspS showing the location of sites located approximately 8 A from the active site (A). Dimethylallyl s- thiolodiphosphate and Mg 2+ (spheres) are placed based on a structural alignment with PDB 3N0G. B) Close-up view of sites in A.
- Figure 2 shows a plasmid maps for pDW218 - MEA P. alba IspS
- Figure 3 shows a map of pCHL243, containing P. alba Isoprene
- Figure 4 shows a plasmid map for B. pDW161 pTrc MEA P. alba IspS
- Figure 5 shows MEA P. alba IspS containing the S288C mutation is soluble.
- FIG. 6 shows MEA P. alba IspS S288C G491S is significantly more soluble than the G491S parent enzyme.
- Figure 7 shows Clustal W alignment between P. alba IspS and S. alba
- Figure 8 shows a plasmid map of pEWL792.
- Figure 9 shows a plasmid map of pEWL795.
- Figure 10 shows Clustal W alignment between P. alba IspS and S. babylonica IspS.
- Figure 11 shows a plasmid map of pEWL834.
- Figure 12 shows a plasmid map of pEWL851.
- Figure 13 shows western blot analysis of IspS in the supernatant and pellet fraction.
- Figure 14 shows protein solubility analysis of IspS by comparison of
- Figure 15 shows a plasmid map of pEWL906.
- Figure 16 shows a plasmid map of pEWL907.
- Figure 17 is a coomassie stained NuPage gel that shows improved
- Figure 18 is a western blot that shows improved Salix IspS solubility due to the S288C mutation.
- Figure 19 shows wild type IspS with anomalous difference map contoured at 5 ⁇ showing location of sulfur atoms.
- Figure 20 shows dimer view of IspS variant A3T/S288C. Chain A is light gray, chain B is dark gray.
- Figure 21 shows a structural alignment of wild type IspS (dark gray) and variant A3T/S288C (light gray).
- Figure 22 shows a structural alignment of wild type IspS (light gray) and variant A3T/S288C (dark gray) showing environment around position 288.
- Figure 23 shows plasmid map pDW196.
- Figure 24 shows plasmid maps pDW204.
- Figure 25 shows positions where the sequence of S. alba differs from
- Mg 2+ spheres
- Figure 26 shows positions where the sequence of S. babylonica differs from P. alba are highlighted .
- Mg 2+ spheres are placed based on a structural alignment with PDB 1N24.
- the invention provides compositions of variant polypeptides having isoprene activity with improved solubility and methods for making and using such variants for the production of isoprene.
- the variant polypeptide has a substitution at X288 residue corresponding to reference sequence SEQ ID NO: l.
- the sequence of MEA P. alba isoprene synthase is as follows:
- X refers to any amino acid residue. However, when in the context of an amino acid substitution (e.g. "X003C"), it is to be understood that "X” refers to an amino acid residue other than the amino acid residue resulting from the substitution (e.g., X is an amino acid residue other than C). In some embodiments, the additional zeros in front of the residue position are not included, thus for example "X003” can also be referred to as "X3" to refer to residue position 3.
- Isoprene refers to 2-methyl-l,3-butadiene (CAS# 78-79-5 ). It can refer to the direct and final volatile C5 hydrocarbon product from the elimination of pyrophosphate from 3,3-dimethylallyl pyrophosphate (DMAPP). It may not involve the linking or polymerization of one or more isopentenyl diphosphate (IPP) molecules to one or more DMAPP molecules. Isoprene is not limited by the method of its manufacture.
- isoprene synthase As used herein, the terms “isoprene synthase,” “isoprene synthase variant”, and “IspS,” refer to enzymes that catalyze the elimination of pyrophosphate from diemethylallyl diphosphate (DMAPP) to form isoprene.
- DMAPP diemethylallyl diphosphate
- An “isoprene synthase” may be a wild type sequence or an isoprene synthase variant.
- isoprene synthase variant indicates a non-wild type polypeptide having isoprene synthase activity.
- One skilled in the art can measure isoprene synthase activity using known methods. See, for example, by GC-MS (see, e.g., WO
- Variants may have substitutions, additions, deletions, and/or truncations from a wild type isoprene synthase sequence. Variants may have substitutions, additions, deletions, and/or truncations from a non-wild type isoprene synthase sequence.
- the variants described herein contain at least one amino acid residue substitution from a parent isoprene synthase polypeptide. In some embodiments, the parent isoprene synthase polypeptide is a wild type sequence. In some embodiments, the parent isoprene synthase polypeptide is a non-wild type sequence.
- the variant will have at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, at least about 200% of the activity of a wild type isoprene synthase.
- the variant will have at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity to a wild type isoprene synthase.
- the number of differing amino acid residues between the variant and the wild type may be one or more, e.g. 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, or more amino acid residues.
- Wild type isoprene synthases can include any isoprene synthases from plants, for example, kudzu isoprene synthases, poplar isoprene synthases, English oak isoprene synthases, and willow isoprene synthases.
- an amino acid residue of an amino acid sequence of interest that "corresponds to” or is “corresponding to” or in “correspondence with” an amino acid residue of a reference amino acid sequence indicates that the amino acid residue of the sequence of interest is at a location homologous or equivalent to an enumerated residue in the reference amino acid sequence.
- One skilled in the art can determine whether a particular amino acid residue position in a polypeptide corresponds to that of a homologous reference sequence.
- the sequence of an isoprene synthase polypeptide may be aligned with that of a reference sequence (e.g.
- SEQ ID NO: 1 using known techniques (e.g., basic local alignment search tool (BLAST), ClustalW2, Structure based sequences alignment program (STRAP), or the like).
- crystal structure coordinates of a reference sequence may be used as an aid in determining a homologous polypeptide residue's three dimensional structure (see, for example, PCT/US2010/032134 (WO 2010/124146)).
- equivalent residues may be identified by determining homology at the level of tertiary structure.
- the amino acid residues of an isoprene synthase polypeptide or isoprene synthase variant may be numbered according to the corresponding amino acid residue position numbering of the reference sequence.
- the amino acid sequence of SEQ ID NO: 1 may be used for determining amino acid residue position numbering of each amino acid residue of an isoprene synthase variant of interest.
- nucleic acids or polypeptide sequences refers to the residues in the two sequences that are the same when aligned for maximum correspondence, as measured using one of the following sequence comparison or analysis algorithms.
- homology refers to sequence similarity or identity, with identity being preferred. Homology may be determined using standard techniques known in the art (see, e.g., Smith and Waterman, Adv. Appl. Math. 2:482 [1981]; Needleman and Wunsch, J. Mol. Biol. 48:443 [1970 ⁇ ; Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444 [1988]; software programs such as GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI); and Devereux et al., Nucl. Acid Res. 12:387-395 [1984]).
- PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pair- wise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng and Doolittle (see Feng and Doolittle, J. Mol. Evol. 35:351-360
- Useful PILEUP parameters including a default gap weight of 3.00, a default gap length weight of 0.10, and weighted end gaps.
- Another example of a useful algorithm is the BLAST algorithm, described by Altschul et al., (see Altschul et al., J. Mol. Biol. 215:403-410 [1990]; and Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5787 [1993]).
- a particularly useful BLAST program is the WU-BLAST-2 program (see Altschul et al., Meth. Enzymol.
- WU-BLAST-2 uses several search parameters, most of which are set to the default values.
- the HSP S and HSP S2 parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched. However, the values may be adjusted to increase sensitivity.
- the percent sequence identity between a reference sequence and a test sequence of interest may be readily determined by one skilled in the art.
- the percent identity shared by polynucleotide or polypeptide sequences is determined by direct comparison of the sequence information between the molecules by aligning the sequences and determining the identity by methods known in the art.
- An example of an algorithm that is suitable for determining sequence similarity is the BLAST algorithm, (see Altschul, et al., J. Mol. Biol, 215:403-410 [1990]).
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.
- This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence.
- HSPs high scoring sequence pairs
- These initial neighborhood word hits act as starting points to find longer HSPs containing them.
- the word hits are expanded in both directions along each of the two sequences being compared for as far as the cumulative alignment score can be increased. Extension of the word hits is stopped when: the cumulative alignment score falls off by the quantity X from a maximum achieved value; the cumulative score goes to zero or below; or the end of either sequence is reached.
- the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
- the BLAST program uses as defaults a wordlength (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915 [1992]) alignments (B) of 50, expectation (E) of 10, M'5, N'-4, and a comparison of both strands.
- the BLAST algorithm then performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, supra).
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P(N) the smallest sum probability
- a nucleic acid is considered similar to a isoprene synthase nucleic acid of this invention if the smallest sum probability in a comparison of the test nucleic acid to a isoprene synthase nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
- test nucleic acid encodes an isoprene synthase polypeptide
- it is considered similar to a specified isoprene synthase nucleic acid if the comparison results in a smallest sum probability of less than about 0.5, and more preferably less than about 0.2.
- Percent "identical” or “identity” in the context of two or more nucleic acid or polypeptide sequences refers to two or more sequences that are the same or have a specified percentage of nucleic acid residues or amino acid residues, respectively, that are the same, when compared and aligned for maximum similarity, as determined using a sequence comparison algorithm or by visual inspection.
- Percent sequence identity or “% identity” or “% sequence identity or “% amino acid sequence identity” of a subject amino acid sequence to a reference amino acid sequence means that the subject amino acid sequence is identical (i.e., on an amino acid-by-amino acid basis) by a specified percentage to the reference amino acid sequence over a comparison length when the sequences are optimally aligned.
- 80% amino acid sequence identity or 80% identity with respect to two amino acid sequences means that 80% of the amino acid residues in two optimally aligned amino acid sequences are identical.
- Percent sequence identity or “% identity” or “% sequence identity” of a subject nucleic acid sequence to a reference nucleic acid sequence means that the subject nucleic acid sequence is identical (i.e., on a nucleotide-by-nucleotide basis for a polynucleotide sequence) by a specified percentage to the reference sequence over a comparison length when the sequences are optimally aligned.
- 80% nucleotide sequence identity or 80% identity with respect to two nucleic acid sequences means that 80% of the nucleotide residues in two optimally aligned nucleic acid sequences are identical.
- the "percent sequence identity” or "% sequence identity” or “% identity” of a subject sequence to a reference sequence can be calculated by optimally aligning the two sequences and comparing the two optimally aligned sequences over the comparison length. The number of positions in the optimal alignment at which identical residues occur in both sequences is determined, thereby providing the number of matched positions, and the number of matched positions is then divided by the total number of positions of the comparison length (which, unless otherwise specified, is the length of the reference sequence). The resulting number is multiplied by 100 to yield the percent sequence identity of the subject sequence to the reference sequence.
- Optimal alignment refers to the alignment of two (or more) sequences giving the highest percent identity score.
- optimal alignment of two polypeptide sequences can be achieved by manually aligning the sequences such that the maximum number of identical amino acid residues in each sequence are aligned together or by using software programs or procedures described herein or known in the art.
- Optimal alignment of two nucleic acid sequences can be achieved by manually aligning the sequences such that the maximum number of identical nucleotide residues in each sequence are aligned together or by using software programs or procedures described herein or known in the art.
- “optimally aligned” when they are aligned using defined parameters, such as a defined amino acid substitution matrix, gap existence penalty (also termed gap open penalty), and gap extension penalty, so as to achieve the highest similarity score possible for that pair of sequences.
- a defined amino acid substitution matrix such as BLOSUM62 scoring matrix (see Henikoff and Henikoff, supra) is often used as a default scoring substitution matrix in polypeptide sequence alignment algorithms (e.g., BLASTP).
- the gap existence penalty is imposed for the introduction of a single amino acid gap in one of the aligned sequences, and the gap extension penalty is imposed for each residue position in the gap.
- the alignment score is defined by the amino acid positions of each sequence at which the alignment begins and ends (e.g., the alignment window), and optionally by the insertion of a gap or multiple gaps into one or both sequences, so as to achieve the highest possible similarity score
- Optimal alignment between two or more sequences can be determined manually by visual inspection or by using a computer, such as, but not limited to e.g., the BLASTP program for amino acid sequences and the BLASTN program for nucleic acid sequences (see, e.g., Altschul et al., Nucleic Acids Res. 25(17):3389- 3402 (1997); see also the National Center for Biotechnology Information (NCBI) website) or CLUSTALW program.
- BLASTP program for amino acid sequences
- BLASTN program for nucleic acid sequences
- a polypeptide of interest may be said to be "substantially identical" to a reference polypeptide if the polypeptide of interest comprises an amino acid sequence having at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about
- polypeptides 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity to the amino acid sequence of the reference polypeptide.
- the percent identity between two such polypeptides can be determined manually by inspection of the two optimally aligned polypeptide sequences or by using software programs or algorithms (e.g., BLAST, ALIGN, CLUSTAL) using standard parameters.
- One indication that two polypeptides are substantially identical is that the first polypeptide is immunologically cross-reactive with the second polypeptide. Typically, polypeptides that differ by conservative amino acid substitutions are immunologically cross-reactive.
- a polypeptide is substantially identical to a second polypeptide, e.g., where the two peptides differ only by a conservative amino acid substitution or one or more conservative amino acid substitutions.
- a nucleic acid of interest may be said to be "substantially identical" to a reference nucleic acid if the nucleic acid of interest comprises a nucleotide sequence having at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity to the nucleotide sequence of the reference nucleic acid.
- the percent identity between two such nucleic acids can be determined manually by inspection of the two optimally aligned nucleic acid sequences or by using software programs or algorithms (e.g., BLAST, ALIGN, CLUSTAL) using standard parameters.
- One indication that two nucleic acid sequences are substantially identical is that the two nucleic acid molecules hybridize to each other under stringent conditions (e.g., within a range of medium to high stringency).
- nucleic acid refers to two or more deoxyribonucleotides and/or ribonucleotides in either single or double- stranded form. It is to be understood that mutations, including single nucleotide mutations, can occur within a nucleic acid as defined herein.
- a "recombinant nucleic acid” refers to a nucleic acid of interest that is free of one or more nucleic acids (e.g., genes) which, in the genome occurring in nature of the organism from which the nucleic acid of interest is derived, flank the nucleic acid of interest.
- the term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of an anaerobic microorganism, or which exists as a separate molecule (e.g., a cDNA, a genomic DNA fragment, or a cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences.
- a recombinant nucleic acid may be obtained using molecular biology techniques that are known in the art, or part or all of a recombinant nucleic acid may be chemically synthesized.
- a "heterologous nucleic acid” can be a nucleic acid whose nucleic acid sequence is from another species than the host cell or another strain of the same species of the host cell. In some embodiments, the sequence is not identical to that of another nucleic acid naturally found in the same host cell. In some embodiments, a heterologous nucleic acid is not identical to a wild-type nucleic acid that is found in the same host cell in nature.
- An "endogenous nucleic acid” is a nucleic acid whose nucleic acid sequence is naturally found in the host cell. In some embodiments, an endogenous nucleic acid is identical to a wild-type nucleic acid that is found in the host cell in nature. In some embodiments, one or more copies of endogenous nucleic acids are introduced into a host cell.
- a nucleic acid or protein of the invention may be in isolated or purified form.
- isolated with respect to nucleic acid or protein, means separated from other components, such as, but not limited to a cell or cell culture. It is preferably in a homogeneous state although it can be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques, such as polyacrylamide gel electrophoresis or high performance liquid chromatography.
- a protein or nucleic acid that is the predominant species present in a preparation is substantially purified.
- purified denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. Particularly, “purified” means that when isolated, the isolate contains at least 90%, at least 95%, at least 98%, or more preferably at least 99% of nucleic acid or protein by weight of the isolate.
- Purified polypeptides may be obtained by a number of methods including, for example, laboratory synthesis, chromatography, preparative
- Polypeptides includes polypeptides, proteins, peptides, fragments of polypeptides, and fusion polypeptides. It is also understood that a polypeptide may be coded for by more than one nucleotide sequence due to the degeneracy of the genetic code.
- heterologous polypeptide is a polypeptide encoded by a heterologous nucleic acid.
- sequence is not identical to that of another polypeptide encoded by a nucleic acid naturally found in the same host cell.
- heterologous proteins include enzymes such as isoprene synthases.
- the genes encoding the proteins are naturally occurring genes, while in other embodiments mutated and/or synthetic genes are used.
- an "endogenous polypeptide” is a polypeptide whose amino acid sequence is naturally found in the host cell. In some embodiments, an endogenous polypeptide is identical to a wild-type polypeptide that is found in the host cell in nature.
- nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively.
- the invention features compositions of variant polypeptides having isoprene synthase activity and having improved solubility as well as methods for making such polypeptides and methods for producing increased amounts of isoprene.
- the polypeptide has at least about 5% to at least about 75% increased protein solubility compared to a parent polypeptide.
- the polypeptide has at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75% increased protein solubility compared to a parent polypeptide.
- these compositions and methods may increase the rate of isoprene production and the total amount of isoprene that is produced.
- the biosynthetic processes for isoprene production described herein are a desirable alternative to using natural rubber.
- the amount of isoprene produced by cells can be greatly increased by introducing a heterologous nucleic acid encoding an isoprene synthase (IspS) variant into the cells.
- IspS isoprene synthase
- isoprene production by cells containing a heterologous isoprene synthase nucleic acid can be enhanced by increasing the amount of one or more DXP pathway polypeptides (e.g., a l-deoxy-D-xylulose-5-phosphate synthase (DXS) polypeptide) and/or an isopentenyl diphosphate isomerase (IDI) polypeptide, expressed by the cells.
- DXP pathway polypeptides e.g., a l-deoxy-D-xylulose-5-phosphate synthase (DXS) polypeptide
- IDI isopentenyl diphosphate isomerase
- a DXS nucleic acid and/or an IDI nucleic acid can be introduced into the cells.
- the DXS nucleic acid may be a heterologous nucleic acid or a duplicate copy of an endogenous nucleic acid.
- the IDI nucleic acid may be a heterologous nucleic acid or a duplicate copy of an endogenous nucleic acid.
- the amount of DXS and/or IDI polypeptide is increased by replacing the endogenous DXS and/or IDI promoters or regulatory regions with other promoters and/or regulatory regions that result in greater transcription of the DXS and/or IDI nucleic acids.
- the cells contain both a heterologous nucleic acid encoding an isoprene synthase polypeptide (e.g., a plant isoprene synthase nucleic acid) and a duplicate copy of an endogenous nucleic acid encoding an isoprene synthase polypeptide.
- a heterologous nucleic acid encoding an isoprene synthase polypeptide (e.g., a plant isoprene synthase nucleic acid) and a duplicate copy of an endogenous nucleic acid encoding an isoprene synthase polypeptide.
- DXS and IDI polypeptides are part of the DXP pathway for the biosynthesis of isoprene.
- DXS polypeptides convert pyruvate and D- glyceraldehyde-3-phosphate into l-deoxy-D-xylulose-5-phosphate. While not intending to be bound by any particular theory, it is believed that increasing the amount of DXS polypeptide increases the flow of carbon through the DXP pathway, leading to greater isoprene production.
- IDI polypeptides catalyze the interconversion of isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). While not intending to be bound by any particular theory, it is believed that increasing the amount of IDI polypeptide in cells increases the amount of IPP that is converted into DMAPP, which in turn is converted into isoprene.
- the production of isoprene by cells containing a heterologous isoprene synthase nucleic acid can be augmented by increasing expression of one or more MVA polypeptide(s) in the cells.
- Exemplary MVA pathways polypeptides include any of the following polypeptides: acetyl-CoA acetyltransferase (AA-CoA thiolase) polypeptides, 3-hydroxy-3- methylglutaryl-CoA synthase (HMG-CoA synthase) polypeptides, 3-hydroxy-3- methylglutaryl-CoA reductase (HMG-CoA reductase) polypeptides, mevalonate kinase (MVK) polypeptides, phosphomevalonate kinase (PMK) polypeptides, diphosphomevalonte decarboxylase (MVD) polypeptides, IDI polypeptides, and polypeptides (e.g., fusion polypeptides) having an activity of two or more MVA pathway polypeptides.
- AA-CoA thiolase 3-hydroxy-3- methylglutaryl-CoA synthase
- one or more MVA pathway nucleic acids can be introduced into the cells.
- the cells contain the upper MVA pathway, which includes AA-CoA thiolase, HMG-CoA synthase, and HMG-CoA reductase nucleic acids.
- the cells contain the lower MVA pathway, which includes MVK, PMK, MVD, and IDI nucleic acids.
- the cells contain the entire MVA pathway, which includes AA-CoA thiolase, HMG-CoA synthase, HMG-CoA reductase, MVK, PMK, MVD, and IDI nucleic acids.
- the MVA pathway nucleic acids may be heterologous nucleic acids or duplicate copies of endogenous nucleic acids.
- the amount of one or more MVA pathway polypeptides is increased by replacing the endogenous promoters or regulatory regions for the MVA pathway nucleic acids with other promoters and/or regulatory regions that result in greater transcription of the MVA pathway nucleic acids.
- the cells contain both a heterologous nucleic acid encoding an isoprene synthase polypeptide (e.g., a plant isoprene synthase nucleic acid) and a duplicate copy of an endogenous nucleic acid encoding an isoprene synthase polypeptide.
- At least a portion of the cells maintain the heterologous isoprene synthase, DXS, IDI, other DXP pathway and/or MVA pathway nucleic acids for at least about 5, 10, 20, 50, 75, 100, 200, 300, or more cell divisions in a continuous culture (such as a continuous culture without dilution).
- the nucleic acid comprising the heterologous or duplicate copy of an endogenous isoprene synthase, DXS, IDI, other DXP pathway and/or MVA pathway nucleic acids also comprises a selective marker, such as a kanamycin, ampicillin, carbenicillin, gentamicin, hygromycin, phleomycin, bleomycin, neomycin, or chloramphenicol antibiotic resistance nucleic acid
- DMAPP DMAPP
- isoprene synthase polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an isoprene synthase polypeptide.
- Standard methods can be used to determine whether a polypeptide has isoprene synthase polypeptide activity by measuring the ability of the polypeptide to convert DMAPP into isoprene in vitro, in a cell extract, or in vivo. Isoprene synthase polypeptide activity in the cell extract can be measured, for example, as described in Silver et al., J. Biol. Chem. 270: 13010- 13016, 1995 and references therein.
- DMAPP (Sigma) is evaporated to dryness under a stream of nitrogen and rehydrated to a concentration of 100 mM in 100 mM potassium phosphate buffer pH 8.2 and stored at -20 °C.
- Isoprene synthase variants may be generated from a parent isoprene synthase, wherein the parent isoprene synthase may be an isoprene synthase as described herein, including wild type and non-wild type isoprene synthases.
- Exemplary parent isoprene synthase nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of an isoprene synthase polypeptide.
- Exemplary parent isoprene synthase polypeptides and nucleic acids include naturally-occurring polypeptides and nucleic acids from any of the source organisms described herein as well as variant polypeptides and nucleic acids derived from any of the source organisms described herein.
- the parent isoprene synthase is from the family
- the parent isoprene synthase polypeptide or nucleic acid is a naturally- occurring polypeptide or nucleic acid from Pueraria montana (kudzu) (Sharkey et al., Plant Physiology 137: 700-712, 2005), poplar (such as Populus alba x tremula CAC35696, Miller et al., Planta 213: 483-487, 2001) or Populus alba, aspen (such as Populus tremuloides) Silver et al, JBC 270(22): 13010-1316, 1995), or English Oak (Quercus robur) (Zimmer et al., WO 98/02550).
- Suitable parent isoprene synthases include, but are not limited to, those identified by GenBank Accession Nos. AY341431,
- the parent isoprene synthase has at least about
- the parent isoprene synthase has at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 92%, at least about 94%, at least about 96%, at least about 98%, at least about 99% sequence identity with MEA P. alba.
- the parent isoprene synthase has at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 92%, at least about 94%, at least about 96%, at least about 98%, at least about 99% sequence identity with full-length P. alba or complete P. alba.
- Variants with improved solubility can be made by including a mutation at X288 corresponding to SEQ ID NO: l.
- X288 is S288.
- the mutation is S288C. Exemplary methods of measuring solubility is described below in the Examples.
- nucleic acids encoding the isoprene synthase variants of the invention are provided and contemplated within the scope of the invention.
- the nucleic acid is a recombinant nucleic acid.
- an isoprene synthase variant nucleic acid is operably linked to another nucleic acid encoding all or a portion of another polypeptide such that the
- recombinant nucleic acid encodes a fusion polypeptide that includes an isoprene synthase variant and all or part of another polypeptide (e.g., a peptide that facilitates purification or detection of the fusion polypeptide, such as a His-tag).
- part or all of a recombinant nucleic acid is chemically synthesized.
- the nucleic acid is a heterologous nucleic acid.
- heterologous nucleic acid is meant a nucleic acid whose nucleic acid sequence is not identical to that of another nucleic acid naturally found in the same host cell.
- the nucleic acid includes at least or about 50,
- the nucleic acid has one or more mutations compared to the sequence of a wild- type (i.e., a sequence occurring in nature) isoprene synthase nucleic acid. In some embodiments, the nucleic acid has one or more mutations (e.g., a silent mutation) that increase the transcription or translation of isoprene synthase nucleic acid. In some embodiments, the nucleic acid is a degenerate variant of any nucleic acid encoding an isoprene synthase polypeptide.
- An isoprene synthase nucleic acid can be incorporated into a vector, such as an expression vector, using standard techniques known to one of skill in the art. Methods used to ligate the DNA construct comprising a nucleic acid of interest such as isoprene synthase, a promoter, a terminator, and other sequences and to insert them into a suitable vector are well known in the art. Additionally, vectors can be constructed using known recombination techniques (e.g., Invitrogen Life
- one or more polypeptides from the DXP pathway and/or MVA pathway can be used to increase the production of isoprene in conjunction with using the isoprene synthase variants described herein.
- the one or more nucleic acids encoding one or more MVA pathway polypeptides is a heterologous nucleic acid.
- the one or more nucleic acids encoding one or more MVA pathway polypeptides is a copy of an endogenous nucleic acid.
- one or more MVA pathway polypeptides can be selected from (a) an enzyme that condenses two molecules of acetyl-CoA to form acetoacetyl-CoA; (b) an enzyme that condenses acetoacetyl-CoA with acetyl- CoA to form HMG-CoA (e.g., HMG synthase); (c) an enzyme that converts HMG- CoA to mevalonate; (d) an enzyme that phosphorylates mevalonate to mevalonate 5- phosphate; (e) an enzyme that converts mevalonate 5-phosphate to mevalonate 5- pyrophosphate; (f) an enzyme that converts mevalonate 5-pyrophosphate to isopentenyl pyrophosphate; and (g) an enzyme that converts isopentenyl
- one or more MVA pathway polypeptides is selected from (a) an enzyme that condenses acetoacetyl-CoA with acetyl-CoA to form HMG-CoA (e.g., HMG synthase); (b) an enzyme that converts HMG-CoA to mevalonate; (c) an enzyme that phosphorylates mevalonate to mevalonate 5-phosphate; (d) an enzyme that converts mevalonate 5- phosphate to mevalonate 5-pyrophosphate; and (e) an enzyme that converts mevalonate 5-pyrophosphate to isopentenyl pyrophosphate.
- HMG-CoA e.g., HMG synthase
- the enzyme that phosphorylates mevalonate to mevalonate 5-phosphate can be selected from the group consisting of M. mazei mevalonate kinase, Lactobacillus mevalonate kinase polypeptide,
- Lactobacillus sakei mevalonate kinase polypeptide lactobacillus sakei mevalonate kinase polypeptide, yeast mevalonate kinase polypeptide, Saccharomyces cerevisiae mevalonate kinase polypeptide, Streptococcus mevalonate kinase polypeptide, Streptococcus pneumoniae mevalonate kinase polypeptide, and Streptomyces mevalonate kinase polypeptide, M. Burtonii mevalonate kinase, or Streptomyces CL190 mevalonate kinase polypeptide.
- the enzyme that phosphorylates mevalonate to mevalonate 5- phosphate is M. mazei mevalonate kinase.
- the upper portion of the MVA pathway uses acetyl Co-A produced during cellular metabolism as the initial substrate for conversion to mevalonate via the actions of polypeptides having either: (a) (i) thiolase activity or (ii) acetoacetyl-CoA synthase activity, (b) HMG-CoA reductase, and (c) HMG-CoA synthase enzymatic activity.
- acetyl Co-A is converted to acetoacetyl CoA via the action of a thiolase or an acetoacetyl-CoA synthase (which utilizes acetyl-CoA and malonyl- CoA).
- HMG-CoA 3-hydroxy-3-methylglutaryl-CoA
- Non-limiting examples of upper MVA pathway polypeptides include acetyl-CoA acetyltransferase (AA-CoA thiolase) polypeptides, acetoacetyl-CoA synthase polypeptides, 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase) polypeptides, 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase) polypeptides.
- Upper MVA pathway polypeptides can include
- polypeptides fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an upper MVA pathway polypeptide.
- exemplary upper MVA pathway nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of an upper MVA pathway polypeptide.
- MVA pathway polypeptide exemplary MVA pathway polypeptides and nucleic acids include naturally- occurring polypeptides and nucleic acids from any of the source organisms described herein. Thus, it is contemplated herein that any gene encoding an upper MVA pathway polypeptide can be used in the present invention.
- L. grayi, E. faecium, E. gallinarum, E. casseliflavus and/or E. faecalis alone or in combination with one or more other mvaE and mvaS genes encoding proteins from the upper MVA pathway are contemplated within the scope of the invention.
- an acetoacetyl-CoA synthase gene is contemplated within the scope of the present invention in combination with one or more other genes encoding: (i) 3- hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase) polypeptides and 3- hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase) polypeptides.
- HMG-CoA synthase 3- hydroxy-3-methylglutaryl-CoA synthase
- HMG-CoA reductase HMG-CoA reductase
- L. grayi, E. faecium, E. gallinarum, E. casseliflavus and/or E. faecalis alone or in combination with one or more other mvaE and mvaS genes encoding proteins from the upper MVA pathway are contemplated within the scope of the invention.
- the mvaE gene encodes a polypeptide that possesses both thiolase and HMG-CoA reductase activities.
- the mvaE gene product represented the first bifunctional enzyme of IPP biosynthesis found in eubacteria and the first example of HMG-CoA reductase fused to another protein in nature (Hedl, et al., J Bacteriol. 2002 April; 184(8): 2116- 2122).
- the mvaS gene encodes a polypeptide having an HMG- CoA synthase activity.
- recombinant cells e.g., E. coli
- recombinant cells can be engineered to express one or more mvaE and mvaS genes from L. grayi, E. faecium, E. gallinarum,
- the one or more mvaE and mvaS genes can be expressed on a multicopy plasmid.
- the plasmid can be a high copy plasmid, a low copy plasmid, or a medium copy plasmid.
- the one or more mvaE and mvaS genes can be integrated into the host cell's chromosome.
- expression of the genes can be driven by either an inducible promoter or a constitutively expressing promoter.
- the promoter can be a strong driver of expression, it can be a weak driver of expression, or it can be a medium driver of expression of the one or more mvaE and mvaS genes.
- the recombinant host cells can further comprise one or more nucleic acids encoding one or more 1-deoxy-D-xylulose 5- phosphate (DXP) pathway polypeptides.
- DXP 1-deoxy-D-xylulose 5- phosphate
- one or more nucleic acids that encode for one or more DXP pathway polypeptides is a heterologous nucleic acid.
- the one or more nucleic acids encoding one or more DXP pathway polypeptides is a copy of an endogenous nucleic acid.
- the one or more DXP pathway polypeptides is selected from (a) l-deoxy-D-xylulose-5- phosphate synthase (DXS), (b) l-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR), (c) 4-diphosphocytidyl-2C-methyl-D-erythritol synthase (MCT), (d) 4- diphosphocytidyl-2-C-methyl-D-erythritol kinase (CMK), (e) 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MCS), (f) l-hydroxy-2-methyl-2-(E)-butenyl 4- diphosphate synthase (HDS), and (g) l-hydroxy-2-methyl-2-(E)-butenyl 4- diphosphate reductase (HDR).
- DXS l-de
- one of skill in the art can use an alternate metabolic process which can potentially produce three molecules of acetyl-CoA from one molecule of glucose using a pathway which does not rely on the Wood-Ljungdahl pathway enzymes. Instead, it makes use of a phosphoketolase enzyme found in certain organisms, particularly among Bifidobacteria [see, for example, Biology of the Prokaryotes (ed. Lengeler, Drews and Schlegel); Blackwell Science, New York ,1999, p. 299-301; Meile et al., J. of Bacteriology, 2001, 183:9, 2929-36; Jeong et al., J. Microbiol.
- Phosphoketolase enzymes allow for formation of acetyl-CoA (via acetyl-phosphate) from xylulose 5-phosphate or fructose 6-phosphate rather than through oxidation of pyruvate as in typical metabolism.
- Increased biosynthesis of acetyl CoA by the use of a phosphoketolase polypeptide can result in increased productivity of the upper mevalonate-dependent biosynthetic pathway which can substantially increase biosynthesis of mevalonate and,
- Standard methods can be used to determine whether a polypeptide has phosphoketolase peptide activity by measuring the ability of the peptide to convert D- fructose 6-phosphate or D-xylulose 5-phosphate into acetyl-P. Acetyl-P can then be converted into ferryl acetyl hydroxamate, which can be detected
- Any polypeptide identified as having phosphoketolase peptide activity is suitable for use in the present invention.
- Exemplary phosphoketolase nucleic acids include, but are not limited to, a phosphoketolase isolated from Lactobacillus reuteri, Bifidobacterium longum, Ferrimonas balearica, Pedobactor saltans, Streptomyces griseus, and/or Nocardiopsis rougevillei. Lower MVA pathway polypeptides
- the cells described in any of the compositions or methods described herein further comprise one or more nucleic acids encoding a lower mevalonate (MVA) pathway polypeptide(s).
- the lower MVA pathway polypeptide is an endogenous polypeptide.
- the endogenous nucleic acid encoding a lower MVA pathway polypeptide is operably linked to a constitutive promoter.
- the endogenous nucleic acid encoding a lower MVA pathway polypeptide is operably linked to an inducible promoter.
- the endogenous nucleic acid encoding a lower MVA pathway polypeptide is operably linked to a strong promoter.
- the cells are engineered to over-express the endogenous lower MVA pathway polypeptide relative to wild-type cells.
- the endogenous nucleic acid encoding a lower MVA pathway polypeptide is operably linked to a weak promoter.
- the lower mevalonate biosynthetic pathway comprises mevalonate kinase (MVK), phosphomevalonate kinase (PMK), and diphosphomevalonte decarboxylase (MVD).
- the lower MVA pathway can further comprise isopentenyl diphosphate isomerase (ID I).
- Cells provided herein can comprise at least one nucleic acid encoding isoprene synthase, one or more upper MVA pathway polypeptides, and/or one or more lower MVA pathway polypeptides.
- Polypeptides of the lower MVA pathway can be any enzyme (a) that phosphorylates mevalonate to mevalonate 5-phosphate; (b) that converts mevalonate 5-phosphate to mevalonate 5-pyrophosphate; and (c) that converts mevalonate 5-pyrophosphate to isopentenyl pyrophosphate. More particularly, the enzyme that phosphorylates mevalonate to mevalonate 5-phosphate can be from the group consisting of M.
- the enzyme that phosphorylates mevalonate to mevalonate 5-phosphate is M. mazei mevalonate kinase.
- the lower MVA pathway polypeptide is a
- the cells comprise more than one copy of a heterologous nucleic acid encoding a lower MVA pathway polypeptide.
- the heterologous nucleic acid encoding a lower MVA pathway polypeptide is operably linked to a constitutive promoter.
- the heterologous nucleic acid encoding a lower MVA pathway polypeptide is operably linked to an inducible promoter.
- the heterologous nucleic acid encoding a lower MVA pathway polypeptide is operably linked to a strong promoter.
- the heterologous nucleic acid encoding a lower MVA pathway polypeptide is operably linked to a weak promoter.
- the heterologous lower MVA pathway polypeptide is a polypeptide from Saccharomyces cerevisiae, Enterococcus faecalis, or Methanosarcina mazei.
- the nucleic acids encoding a lower MVA pathway polypeptide(s) can be integrated into a genome of the cells or can be stably expressed in the cells.
- the nucleic acids encoding a lower MVA pathway polypeptide(s) can additionally be on a vector.
- MVK mevalonate kinase
- PMK phosphomevalonate kinase
- the lower MVK polypeptide can be from the genus Methanosarcina and, more specifically, the lower MVK polypeptide can be from Methanosarcina mazei. In some embodiments, the lower MVK polypeptide can be from M. burtonii. Additional examples of lower MVA pathway polypeptides can be found in U.S. Patent Application Publication 2010/0086978 the contents of which are expressly incorporated herein by reference in their entirety with respect to lower MVK pathway polypeptides and lower MVK pathway polypeptide variant.
- Lower MVA pathway polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of a lower MVA pathway polypeptide.
- Exemplary lower MVA pathway nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of a lower MVA pathway polypeptide.
- Exemplary lower MVA pathway polypeptides and nucleic acids include naturally- occurring polypeptides and nucleic acids from any of the source organisms described herein. In addition, variants of lower MVA pathway polypeptides that confer the result of better isoprene production can also be used as well.
- the lower MVA pathway polypeptide is a polypeptide from Saccharomyces cerevisiae, Enterococcus faecalis, or Methanosarcina mazei.
- the MVK polypeptide is selected from the group consisting of
- Lactobacillus mevalonate kinase polypeptide Lactobacillus sakei mevalonate kinase polypeptide, yeast mevalonate kinase polypeptide, Saccharomyces cerevisiae mevalonate kinase polypeptide, Streptococcus mevalonate kinase polypeptide, Streptococcus pneumoniae mevalonate kinase polypeptide, Streptomyces mevalonate kinase polypeptide, Streptomyces CL190 mevalonate kinase polypeptide,
- Methanosarcina mazei mevalonate kinase polypeptide, and M. Burtonii mevalonate kinase polypeptide Any one of the promoters described herein (e.g., promoters described herein and identified in the Examples of the present disclosure including inducible promoters and constitutive promoters) can be used to drive expression of any of the MVA polypeptides described herein.
- Any one of the cells described herein can comprise IDI nucleic acid(s)
- Isopentenyl diphosphate isomerase polypeptides catalyzes the interconversion of isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) (e.g., converting IPP into DMAPP and/or converting DMAPP into IPP).
- IDI polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an IDI polypeptide.
- Standard methods can be used to determine whether a polypeptide has IDI polypeptide activity by measuring the ability of the polypeptide to interconvert IPP and DMAPP in vitro, in a cell extract, or in vivo.
- IDI nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of an IDI polypeptide.
- Exemplary IDI polypeptides and nucleic acids include naturally- occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein.
- Acetoacetyl-CoA Synthase Gene [0105]
- acetoacetyl-CoA synthase gene (aka nphTT) can be used.
- the acetoacetyl-CoA synthase gene is a gene encoding an enzyme having the activity of synthesizing acetoacetyl-CoA from malonyl-CoA and acetyl-CoA and having minimal activity (e.g., no activity) of synthesizing acetoacetyl-CoA from two acetyl-CoA molecules. See, e.g., Okamura et al., PNAS Vol 107, No. 25, pp.
- acetoacetyl-CoA synthase gene from an actinomycete of the genus Streptomyces CL190 strain was described in JP Patent Publication (Kokai) No. 2008- 61506 A and US2010/0285549.
- Acetoacetyl-CoA synthase can also be referred to as acetyl CoA:malonyl CoA acyltransferase.
- a representative acetoacetyl-CoA synthase (or acetyl CoA:malonyl CoA acyltransferase) that can be used is Genbank
- an enzyme that has the ability to synthesize acetoacetyl-CoA from malonyl-CoA and acetyl-CoA can be used.
- an acetoacetyl-CoA synthase gene derived from an actinomycete of the genus Streptomyces having the activity of synthesizing acetoacetyl-CoA from malonyl-CoA and acetyl-CoA can be used.
- a variety of host cells can be used to make a recombinant host cell that can express isoprene synthase variants and to produce isoprene in the methods of the claimed invention.
- the host cell may be a cell that naturally produces isoprene or a cell that does not naturally produce isoprene.
- the host cell naturally produces isoprene using the DXP pathway, and an isoprene synthase variant, DXP pathway polypeptide (e.g., DXS), and/or IDI nucleic acid is added to enhance production of isoprene using this pathway.
- the host cell naturally produces isoprene using the MVA pathway, and an isoprene synthase variant and/or one or more MVA pathway nucleic acids are added to enhance production of isoprene using this pathway.
- the host cell naturally produces isoprene using the DXP pathway and one or more MVA pathway nucleic acids are added to produce isoprene using part or all of the MVA pathway as well as the DXP pathway.
- the host cell naturally produces isoprene using both the DXP and MVA pathways and one or more isoprene synthase variants, DXS, IDI, or MVA pathway nucleic acids are added to enhance production of isoprene by one or both of these pathways.
- the host cell is a yeast, such as Saccharomyces sp., Schizosaccharomyces sp., Pichia sp., Candida sp. or Y. lipolytica.
- the host cell is a bacterium, such as strains of
- Bacillus such as B. lichenformis or B. subtilis, strains of Pantoea such as P. citrea, strains of Pseudomonas such as P. alcaligenes, strains of Streptomyces such as S. lividans or S. rubiginosus, strains of Escherichia such as E. coli, strains of
- Enterobacter strains of Streptococcus, strains of Archaea such as Methanosarcina mazei or strains of Corynebacterium such as C. glutamicum.
- the genus Bacillus includes all species within the genus “Bacillus,” as known to those of skill in the art, including but not limited to B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. clausii, B. halodurans, B. megaterium, B. coagulans, B. circulans, B. lautus, and B. thuringiensis. It is recognized that the genus Bacillus continues to undergo taxonomical reorganization. Thus, it is intended that the genus include species that have been reclassified, including but not limited to such organisms as B. stearothermophilus, which is now named "Geobacillus
- Halobacillus Paenibacillus, Salibacillus, Thermobacillus, Ureibacillus, and
- the host cell is a gram-positive bacterium.
- Non-limiting examples include strains of Streptomyces (e.g., S. lividans, S.
- the source organism is a gram-negative bacterium, such as E. coli or Pseudomonas sp.
- the host cell is a plant, such as a plant from the family Fabaceae, such as the Faboideae subfamily.
- the source organism is kudzu, poplar (such as Populus alba x tremula CAC35696), aspen (such as Populus tremuloides), or Quercus robur.
- the host cell is an algae, such as a green algae, red algae, glaucophytes, chlorarachniophytes, euglenids, chromista, or dinoflagellates.
- the host cell is a cyanobacteria, such as cyanobacteria classified into any of the following groups based on morphology:
- the host cell is an anaerobic organisms.
- anaerobe is an organism that does not require oxygen for growth.
- An anaerobe can be an obligate anaerobe, a facultative anaerobe, or an aerotolerant organism. Such organisms can be any of the organisms listed above, bacteria, yeast, etc.
- An "obligate anaerobe” is an anaerobe for which atmospheric levels of oxygen can be lethal.
- obligate anaerobes include, but are not limited to, Clostridium,
- the obligate anaerobes can be any one or combination selected from the group consisting of Clostridium ljungdahlii,
- a "facultative anaerobe” is an anaerobe that is capable of performing aerobic respiration in the presence of oxygen and is capable of performing anaerobic fermentation under oxygen-limited or oxygen-free conditions.
- facultative anaerobes include, but are not limited to, Escherichia, Pantoea, yeast, and Yarrowia.
- the host cell is a photo synthetic cell. In other embodiments, the host cell is a non-photo synthetic cell.
- Isoprene synthase, DXS, IDI, and/or MVA pathway nucleic acids or vectors containing them can be inserted into a host cell ⁇ e.g., a bacterial cell) using standard techniques for expression of the encoded isoprene synthase, DXS, IDI, and/or MVA pathway polypeptide.
- a DNA construct or vector into a host cell can be performed using techniques such as transformation, electroporation, nuclear microinjection, transduction, transfection ⁇ e.g., lipofection mediated or DEAE-Dextrin mediated transfection or transfection using a recombinant phage virus), incubation with calcium phosphate DNA precipitate, high velocity
- the introduced nucleic acids may be integrated into chromosomal DNA or maintained as extrachromosomal replicating sequences.
- Any carbon source can be used to cultivate the host cells.
- carbon source refers to one or more carbon-containing compounds capable of being metabolized by a host cell or organism.
- the cell medium used to cultivate the host cells may include any carbon source suitable for maintaining the viability or growing the host cells.
- the carbon source is a carbohydrate (such as monosaccharide, disaccharide, oligosaccharide, or polysaccharides), invert sugar (e.g., enzymatically treated sucrose syrup), glycerol, glycerine (e.g., a glycerine byproduct of a biodiesel or soap-making process), dihydroxyacetone, one-carbon source, fatty acid (e.g., a saturated fatty acid, unsaturated fatty acid, or polyunsaturated fatty acid), lipid, phospholipid, glycerolipid, monoglyceride, diglyceride, triglyceride,
- carbohydrate such as monosaccharide, disaccharide, oligosaccharide, or polysaccharides
- invert sugar e.g., enzymatically treated sucrose syrup
- glycerol e.g., a glycerine byproduct of a biodiesel or soap
- polypeptide e.g., a microbial or plant protein or peptide
- renewable carbon source e.g., a biomass carbon source such as a hydrolyzed biomass carbon source; beet sugar or cane sugar molasses
- yeast extract component from a yeast extract, polymer, acid, alcohol, aldehyde, ketone, amino acid, succinate, lactate, acetate, ethanol, or any combination of two or more of the foregoing.
- the carbon source is a product of photosynthesis, including, but not limited to, glucose.
- Exemplary monosaccharides include glucose and fructose; exemplary oligosaccharides include lactose and sucrose, and exemplary polysaccharides include starch and cellulose.
- Exemplary carbohydrates include C6 sugars (e.g., fructose, mannose, galactose, or glucose) and C5 sugars (e.g., xylose or arabinose).
- the cell medium includes a carbohydrate as well as a carbon source other than a carbohydrate (e.g., glycerol, glycerine, dihydroxyacetone, one-carbon source, fatty acid, lipid, phospholipid, glycerolipid, monoglyceride, diglyceride, triglyceride, renewable carbon source, or a component from a yeast extract).
- the cell medium includes a carbohydrate as well as a polypeptide (e.g., a microbial or plant protein or peptide).
- the microbial polypeptide is a polypeptide from yeast or bacteria.
- the plant polypeptide is a polypeptide from soy, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, rapeseed, cottonseed, palm kernel, olive, safflower, sesame, or linseed.
- the concentration of the carbohydrate is at least or about 5 grams per liter of broth (g/L, wherein the volume of broth includes both the volume of the cell medium and the volume of the cells), such as at least or about 10, 15, 20, 30, 40, 50, 60, 80, 100, 150, 200, 300, 400, or more g/L.
- g/L grams per liter of broth
- the volume of broth includes both the volume of the cell medium and the volume of the cells
- the concentration of the carbohydrate is between about 50 and about 400 g/L, such as between about 100 and about 360 g/L, between about 120 and about 360 g/L, or between about 200 and about 300 g/L. In some embodiments, this concentration of carbohydrate includes the total amount of carbohydrate that is added before and/or during the culturing of the host cells.
- Exemplary lipids are any substance containing one or more fatty acids that are C4 and above fatty acids that are saturated, unsaturated, or branched.
- Exemplary fatty acids include compounds of the formula R-COOH, where "R” is a hydrocarbon.
- Exemplary unsaturated fatty acids include compounds where "R” includes at least one carbon-carbon double bond.
- Exemplary unsaturated fatty acids include, but are not limited to, oleic acid, vaccenic acid, linoleic acid, palmitelaidic acid, and arachidonic acid.
- Exemplary polyunsaturated fatty acids include compounds where "R” includes a plurality of carbon-carbon double bonds.
- Exemplary saturated fatty acids include compounds where "R" is a saturated aliphatic group.
- the carbon source includes one or more C12-C22 fatty acids, such as a C 12 saturated fatty acid, a C14 saturated fatty acid, a C16 saturated fatty acid, a C18 saturated fatty acid, a C20 saturated fatty acid, or a C22 saturated fatty acid.
- the fatty acid is palmitic acid.
- the carbon source is a salt of a fatty acid (e.g., an unsaturated fatty acid), a derivative of a fatty acid (e.g., an unsaturated fatty acid), or a salt of a derivative of fatty acid (e.g., an unsaturated fatty acid).
- Suitable salts include, but are not limited to, lithium salts, potassium salts, sodium salts, and the like.
- Di- and triglycerols are fatty acid esters of glycerol.
- the concentration of the lipid, fatty acid, monoglyceride, diglyceride, or triglyceride is at least or about 1 gram per liter of broth (g/L, wherein the volume of broth includes both the volume of the cell medium and the volume of the cells), such as at least or about 5, 10, 15, 20, 30, 40, 50, 60, 80, 100, 150, 200, 300, 400, or more g/L.
- the concentration of the lipid, fatty acid, monoglyceride, diglyceride, or triglyceride is between about 10 and about 400 g/L, such as between about 25 and about 300 g/L, between about 60 and about 180 g/L, or between about 75 and about 150 g/L. In some embodiments, the concentration includes the total amount of the lipid, fatty acid, monoglyceride, diglyceride, or triglyceride that is added before and/or during the culturing of the host cells.
- the carbon source includes both (i) a lipid, fatty acid, monoglyceride, diglyceride, or triglyceride and (ii) a carbohydrate, such as glucose.
- the ratio of the lipid, fatty acid, monoglyceride, diglyceride, or triglyceride to the carbohydrate is about 1 : 1 on a carbon basis (i.e., one carbon in the lipid, fatty acid, monoglyceride, diglyceride, or triglyceride per carbohydrate carbon).
- the amount of the lipid, fatty acid, monoglyceride, diglyceride, or triglyceride is between about 60 and 180 g/L, and the amount of the carbohydrate is between about 120 and 360 g/L.
- Exemplary microbial polypeptide carbon sources include one or more polypeptides from yeast or bacteria.
- Exemplary plant polypeptide carbon sources include one or more polypeptides from soy, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, rapeseed, cottonseed, palm kernel, olive, safflower, sesame, or linseed.
- Exemplary renewable carbon sources include cheese whey permeate, cornsteep liquor, sugar beet molasses, barley malt, and components from any of the foregoing.
- Exemplary renewable carbon sources also include glucose, hexose, pentose and xylose present in biomass, such as corn, switchgrass, sugar cane, cell waste of fermentation processes, and protein by-product from the milling of soy, corn, or wheat.
- the biomass carbon source is a lignocellulosic, hemicellulosic, or cellulosic material such as, but are not limited to, a grass, wheat, wheat straw, bagasse, sugar cane bagasse, soft wood pulp, corn, corn cob or husk, corn kernel, fiber from corn kernels, corn stover, switch grass, rice hull product, or a by-product from wet or dry milling of grains (e.g., corn, sorghum, rye, triticate, barley, wheat, and/or distillers grains).
- Exemplary cellulosic materials include wood, paper and pulp waste, herbaceous plants, and fruit pulp.
- the carbon source includes any plant part, such as stems, grains, roots, or tubers. In some embodiments, all or part of any of the following plants are used as a carbon source: corn, wheat, rye, sorghum, triticate, rice, millet, barley, cassava, legumes, such as beans and peas, potatoes, sweet potatoes, bananas, sugarcane, and/or tapioca. In some embodiments, the carbon source is a biomass hydrolysate, such as a biomass hydrolysate that includes both xylose and glucose or that includes both sucrose and glucose.
- the renewable carbon source (such as biomass) is pretreated before it is added to the cell culture medium.
- the pretreatment includes enzymatic pretreatment, chemical pretreatment, or a
- the renewable carbon source is partially or completely hydrolyzed before it is added to the cell culture medium.
- the renewable carbon source such as corn stover
- AFEX ammonia fiber expansion
- AFEX pretreatment a renewable carbon source is treated with liquid anhydrous ammonia at moderate temperatures (such as about 60 to about 100 °C) and high pressure (such as about 250 to about 300 psi) for about 5 minutes. Then, the pressure is rapidly released. In this process, the combined chemical and physical effects of lignin solubilization, hemicellulose hydrolysis, cellulose decrystallization, and increased surface area enables near complete enzymatic conversion of cellulose and hemicellulose to fermentable sugars.
- AFEX pretreatment has the advantage that nearly all of the ammonia can be recovered and reused, while the remaining serves as nitrogen source for microbes in downstream processes.
- AFEX is basically a dry-to-dry process.
- the treated renewable carbon source is stable for long periods and can be fed at very high solid loadings in enzymatic hydrolysis or fermentation processes.
- the concentration of the carbon source is equivalent to at least or about 0.1, 0.5, 1, 1.5 2, 3, 4, 5, 10, 15, 20, 30, 40, or 50% glucose (w/v).
- the equivalent amount of glucose can be determined by using standard HPLC methods with glucose as a reference to measure the amount of glucose generated from the carbon source.
- the concentration of the carbon source is equivalent to between about 0.1 and about 20% glucose, such as between about 0.1 and about 10% glucose, between about 0.5 and about 10% glucose, between about 1 and about 10% glucose, between about 1 and about 5% glucose, or between about 1 and about 2% glucose.
- the carbon source includes yeast extract or one or more components of yeast extract.
- the concentration of yeast extract is at least 1 gram of yeast extract per liter of broth (g/L, wherein the volume of broth includes both the volume of the cell medium and the volume of the cells), such at least or about 5, 10, 15, 20, 30, 40, 50, 60, 80, 100, 150, 200, 300, or more g/L.
- the concentration of yeast extract is between about 1 and about 300 g/L, such as between about 1 and about 200 g/L, between about 5 and about 200 g/L, between about 5 and about 100 g/L, or between about 5 and about 60 g/L.
- the concentration includes the total amount of yeast extract that is added before and/or during the culturing of the host cells.
- the carbon source includes both yeast extract (or one or more components thereof) and another carbon source, such as glucose.
- the ratio of yeast extract to the other carbon source is about 1:5, about 1: 10, or about 1:20 (w/w).
- the carbon source may also be one-carbon substrates such as carbon dioxide, or methanol.
- Glycerol production from single carbon sources e.g., methanol, formaldehyde, or formate
- single carbon sources e.g., methanol, formaldehyde, or formate
- methylotrophic yeasts Yamada et al, Agric. Biol. Chem., 53(2) 541-543, 1989
- bacteria Heunter et. al, Biochemistry, 24, 4148-4155, 1985.
- These organisms can assimilate single carbon compounds, ranging in oxidation state from methane to formate, and produce glycerol.
- the pathway of carbon assimilation can be through ribulose monophosphate, through serine, or through xylulose-momophosphate (Gottschalk, Bacterial
- the ribulose monophosphate pathway involves the condensation of formate with ribulose-5-phosphate to form a six carbon sugar that becomes fructose and eventually the three carbon product glyceraldehyde-3-phosphate.
- the serine pathway assimilates the one-carbon compound into the glycolytic pathway via
- methylotrophic organisms are also known to utilize a number of other carbon containing compounds such as methylamine, glucosamine and a variety of amino acids for metabolic activity.
- methylotrophic yeast are known to utilize the carbon from methylamine to form trehalose or glycerol (Bellion et al., Microb. Growth CI Compd., Int. Symp., 7th ed., 415-32. Editors: Murrell et al, Publisher: Intercept, Andover, UK, 1993).
- various species of Candida metabolize alanine or oleic acid (Suiter et al, Arch. Microbiol. 153(5), 485-9, 1990).
- cells are cultured in a standard medium containing physiological salts and nutrients (see, e.g., Pourquie, J. et al, Biochemistry and Genetics of Cellulose Degradation, eds. Aubert et al, Academic Press, pp. 71-86, 1988; and Ilmen et al, Appl. Environ. Microbiol. 63: 1298-1306, 1997).
- Exemplary growth media are common commercially prepared media such as Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth, or Yeast medium (YM) broth.
- the cell medium desirably contains suitable minerals, salts, cofactors, buffers, and other components known to those skilled in the art suitable for the growth of the cultures or the enhancement of isoprene production ⁇ see, for example, WO 2004/033646 and references cited therein and WO 96/35796 and references cited therein).
- an isoprene synthase, DXS, IDI, and/or MVA pathway nucleic acid is under the control of an inducible promoter
- the inducing agent e.g., a sugar, metal salt or
- cell medium has an antibiotic (such as kanamycin) that corresponds to the antibiotic resistance nucleic acid (such as a kanamycin resistance nucleic acid) on a vector that has one or more DXS, IDI, or MVA pathway nucleic acids.
- antibiotic such as kanamycin
- the cells are cultured in a culture medium under conditions permitting the production of isoprene by the cells.
- the cells in culture produce isoprene at greater than or about 1, 10, 25, 50, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 4,000, 5,000, or more nmole of isoprene/gram of cells for the wet weight of the cells/hour (nmole/gwcm/hr).
- the amount of isoprene is between about 2 to about 5,000 nmole/gwcm/hr, such as between about 2 to about 100 nmole/gwcm/hr, about 100 to about 500 nmole/gwcm/hr, about 150 to about 500 nmole/gwcm /hr, about 500 to about 1,000 nmole/gwcm/hr, about 1,000 to about 2,000 nmole/gwcm/hr, or about 2,000 to about 5,000 nmole/gwcm/hr.
- the amount of isoprene in units of nmole/gwcm/hr can be measured as disclosed in U.S. Patent No.
- two mL of headspace ⁇ e.g., headspace from a culture such as 2 mL of culture cultured in sealed vials at 32°C with shaking at 200 rpm for approximately 3 hours
- a standard gas chromatography system such as a system operated isothermally (85°C) with an n- octane/porasil C column (Alltech Associates, Inc., Deerfield, IL) and coupled to a RGD2 mercuric oxide reduction gas detector (Trace Analytical, Menlo Park, CA) ⁇ see, e.g., Greenberg et al, Atmos. Environ.
- the gas chromatography area units are converted to nmol isoprene via a standard isoprene concentration calibration curve.
- the value for the grams of cells for the wet weight of the cells is calculated by obtaining the A 6 oo value for a sample of the cell culture, and then converting the A 6 oo value to grams of cells based on a calibration curve of wet weights for cell cultures with a known A 6 oo value.
- the grams of the cells is estimated by assuming that one liter of broth (including cell medium and cells) with an A 6 oo value of 1 has a wet cell weight of 1 gram. The value is also divided by the number of hours the culture has been incubating for, such as three hours.
- the cells in culture produce isoprene at greater than or about 1, 10, 25, 50, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900,
- the amount of isoprene is between about 2 to about 5,000 ng/gwcm/h, such as between about 2 to about 100 ng/gwcm/h, about 100 to about 500 ng/gwcm/h, about 500 to about 1,000 ng/gwcm/h, about 1,000 to about 2,000 ng/gwcm/h, or about 2,000 to about 5,000 ng/gwcm/h.
- the amount of isoprene in ng/gwcm/h can be calculated by multiplying the value for isoprene production in the units of nmole/gwcm/hr discussed above by 68.1 (as described in Equation 5 below).
- the cells in culture produce a cumulative titer
- total amount of isoprene at greater than or about 1, 10, 25, 50, 100, 150, 200, 250,
- the amount of isoprene is between about 2 to about
- 5,000 mg/L broth such as between about 2 to about 100 mg/L broth, about 100 to about 500 mg/L broth, about 500 to about 1,000 mg/L broth, about 1,000 to about
- productivity of isoprene in mg of isoprene/L of headspace from shake flask or similar cultures can be measured by taking a 1 ml sample from the cell culture at an OD 6 oo value of approximately 1.0, putting it in a 20 mL vial, incubating for 30 minutes, and then measuring the amount of isoprene in the headspace. If the ⁇ 6 ⁇ value is not 1.0, then the measurement can be normalized to an ⁇ 6 ⁇ value of 1.0 by dividing by the OD 6 oo value.
- the value of mg isoprene/L headspace can be converted to
- mg/Lbroth/hr/OD6oo of culture broth by multiplying by a factor of 38.
- the value in units of mg/Lbroth/hr/OD6oo can be multiplied by the number of hours and the ⁇ 6 ⁇ value to obtain the cumulative titer in units of mg of isoprene/L of broth.
- the instantaneous isoprene production rate in mg/L broth/hr in a fermentor can be measured by taking a sample of the fermentor off-gas, analyzing it for the amount of isoprene (in units such as mg of isoprene per L of gas), and multiplying this value by the rate at which off-gas is passed though each liter of broth (e.g., at 1 vvm (volume of air/volume of broth/minute) this is 60 Lgas per hour).
- an off-gas level of 1 mg/Lgas corresponds to an instantaneous production rate of 60 mg/Lbroth/hr at air flow of 1 vvm.
- the value in the units mg/Lbroth/hr can be divided by the ⁇ 6 ⁇ value to obtain the specific rate in units of mg/Lbroth/hr/OD.
- the average value of mg isoprene/Lgas can be converted to the total product productivity (grams of isoprene per liter of fermentation broth, mg/Lbroth) by multiplying this average off-gas isoprene concentration by the total amount of off-gas sparged per liter of fermentation broth during the fermentation.
- an average off- gas isoprene concentration of 0.5 mg/Lbroth/hr over 10 hours at 1 vvm corresponds to a total product concentration of 300 mg isoprene/Lbroth.
- the cells in culture convert greater than or about
- the percent conversion of carbon into isoprene is between about 0.002 to about 1.6%, such as about 0.002 to about 0.005%, about 0.005 to about
- the percent conversion of carbon into isoprene can be measured by dividing the moles carbon in the isoprene produced by the moles carbon in the carbon source (such as the moles of carbon in batched and fed glucose and yeast extract). This number is multiplied by 100% to give a percentage value (as indicated in Equation 1). Equation 1
- yeast extract can be assumed to contain 50% w/w carbon.
- Equation 10 can be used to convert any of the units that include the wet weight of the cells into the corresponding units that include the dry weight of the cells.
- Dry weight of cells (wet weight of cells)/3.3
- a cell comprising a heterologous nucleic acid encoding an isoprene synthase variant polypeptide produces an amount of isoprene that is at least or about 2-fold, 3-fold, 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 150-fold, 200-fold, 400-fold, or greater than the amount of isoprene produced from a corresponding cell grown under essentially the same conditions without the heterologous nucleic acid encoding the isoprene synthase variant polypeptide.
- a cell comprising a heterologous nucleic acid encoding an isoprene synthase variant polypeptide and one or more heterologous nucleic acids encoding a DXS, IDI, and/or MVA pathway polypeptide produces an amount of isoprene that is at least or about 2-fold, 3-fold, 5- fold, 10-fold, 25-fold, 50-fold, 100-fold, 150-fold, 200-fold, 400-fold, or greater than the amount of isoprene produced from a corresponding cell grown under essentially the same conditions without the heterologous nucleic acids.
- any of the methods described herein further include recovering the isoprene.
- the isoprene produced using the compositions and methods of the invention can be recovered using standard techniques, such as gas stripping, fractionation, adsorption/desorption, pervaporation, thermal or vacuum desorption of isoprene from a solid phase, or extraction of isoprene immobilized or absorbed to a solid phase with a solvent ⁇ see, for example, U.S. Patent Nos. 4,703,007 and 4,570,029).
- the recovery of isoprene involves the isolation of isoprene in a liquid form (such as a neat solution of isoprene or a solution of isoprene in a solvent).
- Gas stripping involves the removal of isoprene vapor from the fermentation off-gas stream in a continuous manner. Such removal can be achieved in several different ways including, but not limited to, adsorption to a solid phase, partition into a liquid phase, or direct condensation.
- the recovery is performed as described in U.S. Provisional Patent Appl. No. 61/288,142, filed on December 18, 2009.
- the recovery of isoprene may involve one step or multiple steps.
- the removal of isoprene vapor from the fermentation off-gas and the conversion of isoprene to a liquid phase are performed simultaneously.
- isoprene can be directly condensed from the off-gas stream to form a liquid.
- the removal of isoprene vapor from the fermentation off-gas and the conversion of isoprene to a liquid phase are performed sequentially.
- isoprene may be adsorbed to a solid phase and then extracted from the solid phase with a solvent.
- any of the methods described herein further include purifying the isoprene.
- the isoprene produced using the compositions and methods of the invention can be purified using standard techniques. Purification refers to a process through which isoprene is separated from one or more components that are present when the isoprene is produced. In some embodiments, the isoprene is obtained as a substantially pure liquid. Examples of purification methods include (i) distillation from a solution in a liquid extractant and (ii) chromatography. As used herein, "purified isoprene” means isoprene that has been separated from one or more components that are present when the isoprene is produced. See, e.g. U.S.
- the isoprene is at least about 20%, by weight, free from other components that are present when the isoprene is produced. In various embodiments, the isoprene is at least or about 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 95%, or 99%, by weight, pure. Purity can be assayed by any appropriate method, e.g., by column chromatography, HPLC analysis, or GC-MS analysis.
- a pool of mutants located near the active site of MEA P. alba was screened for the ability to convert DMAPP to isoprene and confer improved growth to the host expression strain. After several rounds of enrichment, the S288C mutation was the predominant variant in the mutant pool. S288C conferred significantly increased solubility to MEA P. alba when expressed in host cells. S288C conferred increased solubility to IspS during large scale fermentation, and also significantly increased the solubility of IspS enzymes derived from Salix alba and Salix babylonica willow species.
- Example 1 Enrichment of a pool of MEA P. alba mutants near the enzyme active site identified the S288C mutation [0153] A pool of mutants located near the active site of MEA P. alba was screened for the ability to convert DMAPP to isoprene and confer improved growth to the host expression strain.
- This pool was then subjected to several rounds of enrichment by growth under MVA supplement and induction of IspS by IPTG as previously described in US 2010/0003716.
- the IspS ORF in either 8 or 16 individual isolates was fully sequenced prior to the next round of enrichment. The enrichment procedure was stopped after round six.
- Enrichment of the pool of individual mutants in the 51 positions near the active site of MEA P. alba IspS identified the S288C variant as the predominant mutation after 5 rounds of selection.
- Table 2 shows that 13 out of 16 sequenced variants randomly isolated after round 5 harbored the S288C mutation. S288C was not present in any of 8 isolated variants post earlier rounds 3 or 4, and was only present in 2 isolated variants (out of 16) after round 6.
- Table 2 also shows that after round 6, the predominant mutation was a silent R435R (CGT to CGG), which likely caused a simple IspS expression increase in the host strain. This indicates that in the enrichment procedure there is a narrow window for identification of variants that convey beneficial properties to IspS, prior to the proliferation of variants that simply improve expression.
- V299V (gta - R435R (cgt -
- strain DW425 containing the pCL201 plasmid encoding wild type IspS and strain DW526 containing the pDW218 plasmid encoding the S288C variant were inoculated into LB medium, grown, and induced with IPTG according to standard molecular biology practices (See Table 5 and Table 6).
- the S288C mutation was introduced into pCHL243 ( Figure 3), which contains the G491S variant of isoprene synthase, by the QuikChange procedure described above using primers shown in Table 4.
- the pCHL243 was generated by introduction of the G491S mutation into pDW34 (see below for pDW34 generation), which encodes the wild-type isoprene synthase, by QuikChange (Stratagene) mutagenesis (see below for PCR cycling parameters).
- pDW161 The resultant plasmid from introduction of S288C into pCHL243 was termed pDW161 and was confirmed by sequencing to harbor the MEA P. alba S288C G491S variant of IspS (See Figure 4 and Table 4).
- Strain DW532 was generated by co-transformation of plasmid pMCM82 and pDW161 into strain CMP451 using standard molecular biology practices (Table 6). Positive strains resistant to both carbenicillin and spectinomycin were selected for fermentation at the 14 L scale. Samples from either shake flask experiments or fermentation were subjected to centrifugation and frozen at -80°C prior to analysis.
- Tris 100 mM NaCl pH 7.6 buffer, 0.1 mg/ml DNase, 0.5 mM PMSF/AEBSF, 5 mM MgC12) and passed through a French pressure cell as previously described. Lysed cultures were then spun at full speed in a table-top microcentrifuge for 10 minutes at 4°C. The supernatants were removed, and the pellets were washed IX in lysis buffer before a second centrifugation step in the microcentrifuge. Samples were removed from the centrifuge, and pellets were resuspended in lysis buffer to exactly the same volume as the supernatant from the first centrifugation step.
- Strain DW526 was isolated directly from the enrichment pool, induced and fractionated to determine the effect of S288C on solubility in comparison to wild type.
- Figure 5 shows that the MEA P. alba IspS S288C variant is absent from the insoluble fraction compared to the control molecule (lane 2 compared to lane 4 of the Coomassie gel).
- Figure 5 also shows that the control IspS enzyme was present in the soluble and insoluble fractions at an approximate ratio of 1: 1, while the S288C was found exclusively in the soluble fraction.
- Figure 6 shows the effect of the S288C mutation on the solubility of IspS in a larger scale fermentation experiment.
- Example 3 The S288C mutation increases the solubility of IspS enzymes from Salix alba and Satix babylonica
- the pTrcHis2B plasmid was then purified using a 1% EX gel and extracted using the QIAquick Gel Extraction Kit.
- the S. alba IspS gene was ligated into the pTrcHis2B plasmid using T4 DNA ligase (New England Biolabs) based on the manufacturer's protocol at room temperature.
- the ligation mixture was desalted by floating a 0.025 ⁇ nitrocellulose membrane filter (Millipore) in a petri dish of ddH 2 0 and applying the ligation mixture gently on top of the nitrocellulose membrane filter for 30 minutes at room temperature.
- Strain MCM446 cells were grown in LB to midlog phase and then washed three times in ice- cold, sterile water. Mixed 50 ⁇ 1 of cell suspension with 5 ⁇ 1 of desalted pTrc S.alba IspS ligation mix. The cell suspension mixture was electroporated in a 2mm cuvette at 2.5 Volts and 25 ⁇ Fd using a Gene Pulser Xcell Electroporator (BioRad). Cells were recovered in 1ml of LB and incubated for 2 hours at 30°C with shaking.
- Transformants were selected on LA + 50 / 1 carbenicillin + lOmM mevalonic acid plates and incubated overnight at 37°C. The next day, several transformants were picked and grown in 5ml LB + 50 ⁇ / ⁇ 1 carbenicillin tubes overnight at 30°C.
- Plasmid preps were performed on the overnight cultures using QIAquick Spin Miniprep Kit (Qiagen). Plasmids were digested with restriction endonucleases Ncol and Pstl at 37°C and analyzed on a 1.2% E-gel (Invitrogen) to ensure correct sized fragments were obtained. Plasmids from several transformants were shipped to Sequetech (Mountain View, CA) for sequencing with primers EL1005, EL1006, EL1270, and EL1271 (Table 7). DNA sequencing results showed that plasmids were correct. One plasmid was selected and designated as pEWL792 ( Figure 8, Table 8).
- MVK gene using plasmid MCM376 as the template, primers MCM165 and
- MCM177 and Pfu Ultra II Fusion DNA polymerase (Agilent) according to manufacturer's protocol. PCR conditions were as follows: 95°C for 2 minutes (first cycle only), 95°C for 25 seconds, 55°C for 25 seconds, 72°C for 18 seconds, repeat for 29 cycles, with final extension at 72°C for 2 minutes.
- the M. mazei MVK PCR product was purified using QIAquick PCR Purification Kit (Qiagen).
- the M. mazei MVK PCR product was digested with restriction endonuclease Pmel (New England Biolabs) based on manufacturer's protocol at 37°C.
- the digested PCR fragment was then purified using the QIAquick PCR Purification Kit.
- a sequential restriction digest was performed with restriction endonuclease Nsil (Roche) based on manufacturer's protocol at 37°C.
- the digested M. mazei MVK fragment was then purified using the QIAquick PCR Purification Kit.
- Plasmid pEWL792 was digested with restriction endonuclease Pmel based on manufacturer's protocol at 37°C.
- the digested pEWL792 fragment was then purified using the QIAquick PCR Purification Kit. A sequential restriction digest was performed with restriction endonuclease Nsil based on manufacturer's protocol at 37°C. The digested pEWL792 fragment was then gel purified using a 1% EX gel and extracted using the QIAquick Gel Extraction Kit. The M. mazei MVK gene was ligated into the pEWL792 plasmid using T4 DNA ligase based on the manufacturer's protocol overnight at 16°C.
- the ligation mixture was desalted by floating a 0.025 ⁇ nitrocellulose membrane filter in a petri dish of ddH 2 0 and applying the ligation mixture gently on top of the nitrocellulose membrane filter for 30 minutes at room temperature.
- MCM446 cells were grown in LB to midlog phase and then washed three times in ice-cold, sterile water.
- the cell suspension mixture was electroporated in a 2mm cuvette at 2.5 Volts and 25 ⁇ Fd using a Gene Pulser Xcell Electroporator.
- Plasmids were digested with restriction endonucleases Ncol (Roche) and Pmel (New England Biolabs) using Buffer 4 (New England Biolabs) at 37°C and analyzed on a 1.2% E-gel to ensure correct sized fragments were obtained. Plasmids from several transformants were shipped to Sequetech for sequencing with primers EL1003, EL1005, EL1006, EL1270, EL1271, and EL1272 (Table 7). DNA sequencing results showed that plasmids were correct. One plasmid was selected and designated as pEWL795 ( Figure 9, Table 8).
- strain EWL804 (BL21, pgl+ PL.2-mKKDyI, GI1.2-gltA, pTrc S. alba IspS-mMVK)
- Strain CMP451 cells were grown in LB to midlog phase and then washed three times in ice-cold, sterile water. Mixed 50 ⁇ 1 of cell suspension with ⁇ of plasmid pEWL795. The cell suspension mixture was electroporated in a 2mm cuvette at 2.5 Volts and 25 ⁇ Fd using a Gene Pulser Xcell Electroporator. Cells were recovered in 1ml of LB and incubated for 2 hours at 30°C with shaking. Transformants were selected on LA + 5C ⁇ g ⁇ l carbenicillin + 5mM mevalonic acid plates and incubated overnight at 37°C. One colony was selected and designated as strain EWL804 (Table 9).
- strain EWL810 (BL21, pgl+ PL.2-mKKDyI, GI1.2-gltA, pTrc S. alba IspS-mMVK, pCL Ptrc-Upper MVA)
- Strain EWL804 cells were grown in LB to midlog phase and then washed three times in ice-cold, sterile water. Mixed 50 ⁇ 1 of cell suspension with ⁇ of plasmid MCM82 (pCL Ptrc Upper MVA). The cell suspension mixture was electroporated in a 2mm cuvette at 2.5 Volts and 25 ⁇ Fd using a Gene Pulser Xcell Electroporator. Cells were recovered in 1ml of LB and incubated for 2 hours at 30°C with shaking. Transformants were selected on LA + 5C ⁇ g ⁇ l carbenicillin + 5C ⁇ g ⁇ l spectinomycin plates and incubated overnight at 37°C. One colony was selected and designated as strain EWL810 (Table 9)
- ⁇ g of the pGOv4 S. babylonica IspS plasmid was digested with restriction endonucleases Ncol and PstI based on the manufacturer's protocol at 37°C.
- the digested S. babylonica IspS fragment was then purified using a 1% EX gel and extracted using the QIAquick Gel Extraction Kit.
- the pTrcHis2B plasmid was then purified using a 1% EX gel and extracted using the QIAquick Gel Extraction Kit.
- the S. babylonica IspS gene was ligated into the pTrcHis2B plasmid using T4 DNA ligase based on the manufacturer's protocol at room temperature.
- the ligation mixture was desalted by floating a 0.025 ⁇ nitrocellulose membrane filter (Millipore) in a petri dish of ddH 2 0 and applying the ligation mixture gently on top of the nitrocellulose membrane filter for 30 minutes at room temperature.
- Strain MCM446 cells were grown in LB to midlog phase and then washed three times in ice-cold, sterile water. Mixed 50 ⁇ 1 of cell suspension with5 ⁇ l of desalted pTrc S.baylonica IspS ligation mix.
- the cell suspension mixture was electroporated in a 2mm cuvette at 2.5 Volts and 25 ⁇ Fd using a Gene Pulser Xcell Electroporator. Cells were recovered in 1ml of LB and incubated for 2 hours at 30°C with shaking. Transformants were selected on LA + 50 ⁇ g/ ⁇ l carbeniciUin + lOmM mevalonic acid plates and incubated overnight at 37°C. The next day, several transformants were picked and grown in 5ml LB + 50 ⁇ g/ ⁇ l carbeniciUin tubes overnight at 30°C. Plasmid preps were performed on the overnight cultures using QIAquick Spin Miniprep Kit.
- Plasmids were digested with restriction endonucleases Ncol and Pstl at 37°C and analyzed on a 1.2% E-gel to ensure correct sized fragments were obtained. Plasmids from several transformants were shipped to Sequetech for sequencing with primers EL1004, EL1006, EL1285, EL1286, EL1287 (Table 7). DNA sequencing results showed that plasmids were correct. One plasmid was selected and designated as pEWL834 ( Figure 11, Table 8).
- Plasmid pEWL851 (pTrc S. babylonica IspS-mMVK)
- MVK gene using plasmid MCM376 as the template, primers MCM165 and
- MCM177 and Pfu Ultra II Fusion DNA polymerase (Agilent) according to manufacturer's protocol. PCR conditions were as follows: 95°C for 2 minutes (first cycle only), 95°C for 25 seconds, 55°C for 25 seconds, 72°C for 18 seconds, repeat for 29 cycles, with final extension at 72°C for 2 minutes.
- the M. mazei MVK PCR product was purified using QIAquick PCR Purification Kit.
- the M. mazei MVK PCR product was digested with restriction endonuclease Pmel (New England Biolabs) based on manufacturer's protocol at 37°C.
- the digested PCR fragment was then purified using the QIAquick PCR Purification Kit.
- a sequential restriction digest was performed with restriction endonuclease Nsil based on manufacturer's protocol at 37°C.
- the digested M. mazei MVK fragment was then purified using the QIAquick PCR Purification Kit.
- Plasmid pEWL834 was digested with restriction endonuclease Pmel based on manufacturer's protocol at 37°C.
- the digested pEWL834 fragment was then purified using the QIAquick PCR Purification Kit. A sequential restriction digest was performed with restriction endonuclease Nsil based on manufacturer's protocol at 37°C. The digested pEWL834 fragment was then gel purified using a 1% EX gel and extracted using the QIAquick Gel Extraction Kit. The M. mazei MVK gene was ligated into the pEWL834 plasmid using T4 DNA ligase based on the manufacturer's protocol overnight at 16°C.
- the ligation mixture was desalted by floating a 0.025 ⁇ nitrocellulose membrane filter in a petri dish of ddH 2 0 and applying the ligation mixture gently on top of the nitrocellulose membrane filter for 30 minutes at room temperature.
- MCM446 cells were grown in LB to midlog phase and then washed three times in ice-cold, sterile water.
- the cell suspension mixture was electroporated in a 2mm cuvette at 2.5 Volts and 25 ⁇ Fd using a Gene Pulser Xcell Electroporator.
- Plasmids from several transformants were shipped to Sequetech for sequencing with primers EL1004, EL1005, EL1006, EL1285, EL1286, and EL1287 (Table 6). DNA sequencing confirmed the plasmid sequences.
- One plasmid was selected and designated as pEWL851 ( Figure 12, Table 8).
- strain EWL887 (BL21, pgl+ PL.2-mKKDyI, GI1.2-gltA, pTrc S. babylonica IspS-mMVK)
- Strain CMP451 cells were grown in LB to midlog phase and then washed three times in ice-cold, sterile water. Mixed 50 ⁇ 1 of cell suspension with ⁇ of plasmid pEWL851. The cell suspension mixture was electroporated in a 2mm cuvette at 2.5 Volts and 25 ⁇ Fd using a Gene Pulser Xcell Electroporator. Cells were recovered in 1ml of LB and incubated for 2 hours at 30°C with shaking.
- strain EWL893 (BL21, pgl+ PL.2-mKKDyI, GI1.2-gltA, pTrc S. babylonica IspS-mMVK, MCM82)
- Strain EWL887 cells were grown in LB to midlog phase and then washed three times in ice-cold, sterile water. Mixed 50 ⁇ 1 of cell suspension with ⁇ of plasmid MCM82. The cell suspension mixture was electroporated in a 2mm cuvette at 2.5 Volts and 25 ⁇ Fd using a Gene Pulser Xcell Electroporator. Cells were recovered in 1ml of LB and incubated for 2 hours at 30°C with shaking.
- strain EWL900 (BL21, PL.2-mKKDyI, pTrc S. alba IspS) and EWL903 (BL21, PL.2-mKKDyI, pTrc S. babylonica IspS)
- Strain MCM531 cells were grown in LB to midlog phase and then washed three times in ice-cold, sterile water. Mixed 50 ⁇ 1 of cell suspension with ⁇ of plasmid pEWL792 (pTrc S. alba IspS) or pEWL834 (pTrc S. babylonica IspS). The cell suspension mixture was electroporated in a 2mm cuvette at 2.5 Volts and 25 ⁇ Fd using a Gene Pulser Xcell Electroporator. Cells were recovered in 1ml of LB and incubated for 2 hours at 30°C with shaking.
- Transformants were selected on LA + 5C ⁇ g ⁇ l carbenicillin + 5mM mevalonic acid plates and incubated overnight at 37°C.
- EWL900 and pTrc S. babylonica IspS were grown in LB media, induced at OD 60 o - 0.5 with 200 ⁇ IPTG, and induced for 4 hours. Cell pellets were collected by centrifugation and stored at -80°C. The cells were lysed by French Press and analyzed for protein solubility by Western Blot. Results showed that S. alba IspS and S. babylonica IspS are more insoluble than P. alba IspS ( Figure 13 and Figure 14).
- Plasmid pEWL792 pTrc S. alba IspS
- pEWL834 pTrc S. babylonica IspS
- PCR conditions were as follows: 95°C for 2 minutes (first cycle only), 95°C for 30 seconds, 55°C for 1 minute, 68°C for 6 minute, repeat for 16 cycles.
- the parental template for each PCR reaction were digested by addition of 2 ⁇ 1 Dpnl restriction endonuclease (Roche) and incubated at 37°C for 2 hours.
- Strain MCM531 cells were grown in LB to midlog phase and then washed three times in ice-cold, sterile water.
- the cell suspension mixture was electroporated in a 2mm cuvette at 2.5 Volts and 25 ⁇ Fd using a Gene Pulser Xcell Electroporator. Cells were recovered in 1ml of LB and incubated for 2 hours at 30°C with shaking.
- Transformants were selected on LA + 50 ⁇ g/ ⁇ l carbenicillin + 5mM mevalonic acid plates and incubated overnight at 37°C. The next day, several transformants were picked from each and grown in 5ml LB + 50 ⁇ g/ ⁇ l carbenicillin tubes overnight at 30°C. Plasmid preps were performed on the overnight cultures using QIAquick Spin Miniprep Kit. Plasmids from several transformants were shipped to Sequetech for sequencing. Primers EL1005, EL1006, EL1270, EL1271, and EL1272 were used for sequencing pTrc S. alba IspS S288C (see Table 7).
- Plasmid pTrc S. alba IspS S288C was designated pEWL906 ( Figure 15, Table 8). Plasmid pTrc S. babylonica IspS S288C was designated pEWL907 ( Figure 16, Table 8). Plasmid pEWL906 was transformed into MCM531 cells to generate the expression strain EWL913 (Table 9). Plasmid pEWL907 was transformed into MCM531 cells to generate expression strain
- TGTGATCACC GAACCGATCCTTCCGTTTGAAAGATGACTGCAGCTGGTACC
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Nutrition Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| HK15101956.3A HK1201554A1 (en) | 2011-10-27 | 2012-10-26 | Isoprene synthase variants with improved solubility for production of isoprene |
| CA2853125A CA2853125A1 (en) | 2011-10-27 | 2012-10-26 | Isoprene synthase variants with improved solubility for production of isoprene |
| JP2014539095A JP6101275B2 (ja) | 2011-10-27 | 2012-10-26 | イソプレン産生時の溶解度が向上されたイソプレン合成酵素変異体 |
| BR112014010053A BR112014010053A8 (pt) | 2011-10-27 | 2012-10-26 | variantes de isopreno sintase com solubilidade aprimorada para produção de isopreno |
| DK12787268.7T DK2771460T3 (en) | 2011-10-27 | 2012-10-26 | ISOPRENE SYNTHASE VARIETIES WITH IMPROVED SOLUBILITY FOR THE PREPARATION OF ISOPRENE |
| EP12787268.7A EP2771460B1 (en) | 2011-10-27 | 2012-10-26 | Isoprene synthase variants with improved solubility for production of isoprene |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161552453P | 2011-10-27 | 2011-10-27 | |
| US61/552,453 | 2011-10-27 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2013063528A2 true WO2013063528A2 (en) | 2013-05-02 |
| WO2013063528A3 WO2013063528A3 (en) | 2013-06-20 |
Family
ID=47178953
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/062308 Ceased WO2013063528A2 (en) | 2011-10-27 | 2012-10-26 | Isoprene synthase variants with improved solubility for production of isoprene |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US8735134B2 (https=) |
| EP (1) | EP2771460B1 (https=) |
| JP (1) | JP6101275B2 (https=) |
| BR (1) | BR112014010053A8 (https=) |
| CA (1) | CA2853125A1 (https=) |
| DK (1) | DK2771460T3 (https=) |
| HK (1) | HK1201554A1 (https=) |
| WO (1) | WO2013063528A2 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2913392A4 (en) * | 2012-10-23 | 2016-06-22 | Sekisui Chemical Co Ltd | RECOMBINANT CELL AND METHOD FOR THE PRODUCTION OF ISOPRENE |
| CN105985971A (zh) * | 2015-02-10 | 2016-10-05 | 中国科学院微生物研究所 | 异戊二烯合成酶基因及其应用 |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2337845A1 (en) * | 2008-09-15 | 2011-06-29 | Danisco US Inc. | Increased isoprene production using mevalonate kinase and isoprene synthase |
| JP6101275B2 (ja) | 2011-10-27 | 2017-03-22 | ダニスコ・ユーエス・インク | イソプレン産生時の溶解度が向上されたイソプレン合成酵素変異体 |
| WO2013096683A2 (en) * | 2011-12-23 | 2013-06-27 | Danisco Us Inc. | Enhanced production of isoprene using marine bacterial cells |
| JPWO2015076392A1 (ja) | 2013-11-22 | 2017-03-16 | 味の素株式会社 | 改変イソプレンシンターゼ |
Citations (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4570029A (en) | 1985-03-04 | 1986-02-11 | Uop Inc. | Process for separating isoprene |
| US4703007A (en) | 1984-03-27 | 1987-10-27 | Ontario Research Foundation | Separation of volatiles from aqueous solutions by gas stripping |
| WO1996035796A1 (en) | 1995-05-12 | 1996-11-14 | E.I. Du Pont De Nemours And Company | Bioconversion of a fermentable carbon source to 1,3-propanediol by a single microorganism |
| WO1998002550A2 (de) | 1996-07-15 | 1998-01-22 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Mikrobielle erzeugung von isopren |
| US5849970A (en) | 1995-06-23 | 1998-12-15 | The Regents Of The University Of Colorado | Materials and methods for the bacterial production of isoprene |
| US6106888A (en) | 1998-04-30 | 2000-08-22 | Board Of Trustees Operating Michigan State University | Process for treating cellulosic materials |
| WO2002010398A2 (en) | 2000-07-31 | 2002-02-07 | Hahn Frederick M | Manipulation of genes of the mevalonate and isoprenoid pathways to create novel traits in transgenic organisms |
| WO2004033646A2 (en) | 2002-10-04 | 2004-04-22 | E.I. Du Pont De Nemours And Company | Process for the biological production of 1,3-propanediol with high yield |
| JP2008061506A (ja) | 2006-09-04 | 2008-03-21 | Adeka Corp | 新規なアセトアセチルCoA合成酵素、それをコードするDNA配列、当該酵素の製造方法および当該酵素を利用したメバロン酸の製造方法 |
| US20090076743A1 (en) | 2007-08-01 | 2009-03-19 | Drexel University | Novel method for zero point detection |
| WO2009076676A2 (en) | 2007-12-13 | 2009-06-18 | Danisco Us Inc. | Compositions and methods for producing isoprene |
| WO2009132220A2 (en) | 2008-04-23 | 2009-10-29 | Danisco Us Inc. | Isoprene synthase variants for improved microbial production of isoprene |
| WO2010003007A2 (en) | 2008-07-02 | 2010-01-07 | Danisco Us Inc. | Compositions and methods for producing isoprene free of c5 hydrocarbons under decoupling conditions and/or safe operating ranges |
| WO2010005525A1 (en) | 2008-06-30 | 2010-01-14 | The Goodyear Tire & Rubber Company | Polymers of isoprene from renewable resources |
| WO2010031079A1 (en) | 2008-09-15 | 2010-03-18 | Danisco Us Inc. | Systems using cell culture for production of isoprene |
| WO2010031062A1 (en) | 2008-09-15 | 2010-03-18 | Danisco Us Inc. | Increased isoprene production using the archaeal lower mevalonate pathway |
| WO2010031068A1 (en) | 2008-09-15 | 2010-03-18 | Danisco Us Inc. | Reduction of carbon dioxide emission during isoprene production by fermentation |
| WO2010031076A2 (en) | 2008-09-15 | 2010-03-18 | Danisco Us Inc. | Conversion of prenyl derivatives to isoprene |
| WO2010031077A1 (en) | 2008-09-15 | 2010-03-18 | Danisco Us Inc. | Increased isoprene production using mevalonate kinase and isoprene synthase |
| WO2010078457A2 (en) | 2008-12-30 | 2010-07-08 | Danisco Us Inc. | Methods of producing isoprene and a co-product |
| WO2010124146A2 (en) | 2009-04-23 | 2010-10-28 | Danisco Us Inc. | Three-dimensional structure of isoprene synthase and its use thereof for generating variants |
| US20100285549A1 (en) | 2009-05-08 | 2010-11-11 | Toyota Jidosha Kabushiki Kaisha | Recombinant microorganism having butanol production capacity and butanol production method |
| WO2010148144A1 (en) | 2009-06-17 | 2010-12-23 | Danisco Us Inc. | Polymerization of isoprene from renewable resources |
| WO2010148150A1 (en) | 2009-06-17 | 2010-12-23 | Danisco Us Inc. | Improved isoprene production using the dxp and mva pathway |
| WO2011075534A2 (en) | 2009-12-18 | 2011-06-23 | Danisco Us Inc. | Purification of isoprene from renewable resources |
| WO2011075748A1 (en) | 2009-12-22 | 2011-06-23 | Danisco Us Inc. | Membrane bioreactor for increased production of isoprene gas |
| WO2011079314A2 (en) | 2009-12-23 | 2011-06-30 | Danisco Us Inc. | Compositions and methods of pgl for the increased production of isoprene |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7947478B2 (en) | 2006-06-29 | 2011-05-24 | The Regents Of The University Of California | Short chain volatile hydrocarbon production using genetically engineered microalgae, cyanobacteria or bacteria |
| CA2816306A1 (en) * | 2010-10-27 | 2012-05-03 | Danisco Us Inc. | Isoprene synthase variants for improved production of isoprene |
| JP6101275B2 (ja) | 2011-10-27 | 2017-03-22 | ダニスコ・ユーエス・インク | イソプレン産生時の溶解度が向上されたイソプレン合成酵素変異体 |
-
2012
- 2012-10-26 JP JP2014539095A patent/JP6101275B2/ja not_active Expired - Fee Related
- 2012-10-26 CA CA2853125A patent/CA2853125A1/en not_active Abandoned
- 2012-10-26 HK HK15101956.3A patent/HK1201554A1/xx unknown
- 2012-10-26 US US13/662,328 patent/US8735134B2/en not_active Expired - Fee Related
- 2012-10-26 BR BR112014010053A patent/BR112014010053A8/pt not_active Application Discontinuation
- 2012-10-26 EP EP12787268.7A patent/EP2771460B1/en not_active Not-in-force
- 2012-10-26 DK DK12787268.7T patent/DK2771460T3/en active
- 2012-10-26 WO PCT/US2012/062308 patent/WO2013063528A2/en not_active Ceased
-
2014
- 2014-04-11 US US14/251,311 patent/US9273299B2/en not_active Expired - Fee Related
Patent Citations (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4703007A (en) | 1984-03-27 | 1987-10-27 | Ontario Research Foundation | Separation of volatiles from aqueous solutions by gas stripping |
| US4570029A (en) | 1985-03-04 | 1986-02-11 | Uop Inc. | Process for separating isoprene |
| WO1996035796A1 (en) | 1995-05-12 | 1996-11-14 | E.I. Du Pont De Nemours And Company | Bioconversion of a fermentable carbon source to 1,3-propanediol by a single microorganism |
| US5849970A (en) | 1995-06-23 | 1998-12-15 | The Regents Of The University Of Colorado | Materials and methods for the bacterial production of isoprene |
| WO1998002550A2 (de) | 1996-07-15 | 1998-01-22 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Mikrobielle erzeugung von isopren |
| US6106888A (en) | 1998-04-30 | 2000-08-22 | Board Of Trustees Operating Michigan State University | Process for treating cellulosic materials |
| US6176176B1 (en) | 1998-04-30 | 2001-01-23 | Board Of Trustees Operating Michigan State University | Apparatus for treating cellulosic materials |
| WO2002010398A2 (en) | 2000-07-31 | 2002-02-07 | Hahn Frederick M | Manipulation of genes of the mevalonate and isoprenoid pathways to create novel traits in transgenic organisms |
| WO2004033646A2 (en) | 2002-10-04 | 2004-04-22 | E.I. Du Pont De Nemours And Company | Process for the biological production of 1,3-propanediol with high yield |
| JP2008061506A (ja) | 2006-09-04 | 2008-03-21 | Adeka Corp | 新規なアセトアセチルCoA合成酵素、それをコードするDNA配列、当該酵素の製造方法および当該酵素を利用したメバロン酸の製造方法 |
| US20090076743A1 (en) | 2007-08-01 | 2009-03-19 | Drexel University | Novel method for zero point detection |
| WO2009076676A2 (en) | 2007-12-13 | 2009-06-18 | Danisco Us Inc. | Compositions and methods for producing isoprene |
| US20090203102A1 (en) | 2007-12-13 | 2009-08-13 | Cervin Marguerite A | Compositions and methods for producing isoprene |
| WO2009132220A2 (en) | 2008-04-23 | 2009-10-29 | Danisco Us Inc. | Isoprene synthase variants for improved microbial production of isoprene |
| US20100003716A1 (en) | 2008-04-23 | 2010-01-07 | Cervin Marguerite A | Isoprene synthase variants for improved microbial production of isoprene |
| WO2010005525A1 (en) | 2008-06-30 | 2010-01-14 | The Goodyear Tire & Rubber Company | Polymers of isoprene from renewable resources |
| WO2010003007A2 (en) | 2008-07-02 | 2010-01-07 | Danisco Us Inc. | Compositions and methods for producing isoprene free of c5 hydrocarbons under decoupling conditions and/or safe operating ranges |
| WO2010031079A1 (en) | 2008-09-15 | 2010-03-18 | Danisco Us Inc. | Systems using cell culture for production of isoprene |
| WO2010031062A1 (en) | 2008-09-15 | 2010-03-18 | Danisco Us Inc. | Increased isoprene production using the archaeal lower mevalonate pathway |
| WO2010031068A1 (en) | 2008-09-15 | 2010-03-18 | Danisco Us Inc. | Reduction of carbon dioxide emission during isoprene production by fermentation |
| WO2010031076A2 (en) | 2008-09-15 | 2010-03-18 | Danisco Us Inc. | Conversion of prenyl derivatives to isoprene |
| WO2010031077A1 (en) | 2008-09-15 | 2010-03-18 | Danisco Us Inc. | Increased isoprene production using mevalonate kinase and isoprene synthase |
| US20100086978A1 (en) | 2008-09-15 | 2010-04-08 | Beck Zachary Q | Increased isoprene production using the archaeal lower mevalonate pathway |
| WO2010078457A2 (en) | 2008-12-30 | 2010-07-08 | Danisco Us Inc. | Methods of producing isoprene and a co-product |
| WO2010124146A2 (en) | 2009-04-23 | 2010-10-28 | Danisco Us Inc. | Three-dimensional structure of isoprene synthase and its use thereof for generating variants |
| US20100285549A1 (en) | 2009-05-08 | 2010-11-11 | Toyota Jidosha Kabushiki Kaisha | Recombinant microorganism having butanol production capacity and butanol production method |
| WO2010148144A1 (en) | 2009-06-17 | 2010-12-23 | Danisco Us Inc. | Polymerization of isoprene from renewable resources |
| WO2010148150A1 (en) | 2009-06-17 | 2010-12-23 | Danisco Us Inc. | Improved isoprene production using the dxp and mva pathway |
| WO2011075534A2 (en) | 2009-12-18 | 2011-06-23 | Danisco Us Inc. | Purification of isoprene from renewable resources |
| WO2011075748A1 (en) | 2009-12-22 | 2011-06-23 | Danisco Us Inc. | Membrane bioreactor for increased production of isoprene gas |
| WO2011079314A2 (en) | 2009-12-23 | 2011-06-30 | Danisco Us Inc. | Compositions and methods of pgl for the increased production of isoprene |
Non-Patent Citations (50)
| Title |
|---|
| "Animal Cell Culture", 1987 |
| "Biology of the Prokaryotes", 1999, BLACKWELL SCIENCE, pages: 299 - 301 |
| "Current Protocols in Molecular Biology", 1987 |
| "Current Protocols in Nucleic Acid Chemistry", 2000, JOHN WILEY & SONS, INC. |
| "Gene Transfer Vectors for Mammalian Cells", 1987 |
| "Handbook of Experimental Immunology" |
| "Molecular Cloning: A Laboratory Manual", 2001 |
| "Oligonucleotide Synthesis", 1984 |
| "PCR: The Polymerase Chain Reaction", 1994 |
| "Protocols for Oligonucleotides and Analogs, Synthesis and Properties", 1993, HUMANA PRESS INC. |
| ACTA CRYSTALLOGRAPHICA SECTION D, vol. 50, 1994, pages 760 - 763 |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410 |
| ALTSCHUL ET AL., METH. ENZYMOL., vol. 266, 1996, pages 460 - 480 |
| ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, no. 17, 1997, pages 3389 - 3402 |
| BELLION ET AL.: "Microb. Growth Cl Compd., Int. Symp.", 1993, INTERCEPT, pages: 415 - 32 |
| CAMPBELL ET AL., CURR GENET, vol. 16, 1989, pages 53 - 56 |
| DAVIS, I. W. ET AL., NUCL. ACIDS RES, vol. 35, 2007, pages W375 - W383 |
| DEUTSCHER: "Methods in Enzymology", vol. 182, 1990, ACADEMIC PRESS, INC. |
| DEVEREUX ET AL., NUCL. ACID RES., vol. 12, 1984, pages 387 - 395 |
| EMSLEY, P. ET AL., ACTA CRYSTALLOGRAPHICA SECTION D, vol. 66, 2010, pages 486 - 501 |
| FARZANEH ET AL., BIORESOURCE TECHNOLOGY, vol. 96, no. 18, 2005, pages 2014 - 2018 |
| FENG; DOOLITTLE, J. MOL. EVOL., vol. 35, 1987, pages 351 - 360 |
| GREENBERG ET AL., ATMOS. ENVIRON., vol. 27A, 1993, pages 2689 - 2692 |
| HEDL ET AL., J BACTERIOL., vol. 184, no. 8, April 2002 (2002-04-01), pages 2116 - 2122 |
| HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 10915 |
| HIGGINS; SHARP, CABIOS, vol. 5, 1989, pages 151 - 153 |
| HUNTER, BIOCHEMISTRY, vol. 24, 1985, pages 4148 - 4155 |
| JEONG ET AL., J. MICROBIOL BIOTECHNOL., vol. 17, no. 5, 2007, pages 822 - 829 |
| KARLIN; ALTSCHUL, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5787 |
| LESLIE, A., J. OF APPL. CRYSTALLOGRAPHY, vol. 30, 1998, pages 1036 - 1040 |
| LLMEN ET AL., APPL. ENVIRON. MICROBIOL., vol. 63, 1997, pages 1298 - 1306 |
| MEILE ET AL., J. OF BACTERIOLOGY, vol. 183, no. 9, 2001, pages 2929 - 36 |
| MEILE, J. BACT., vol. 183, 2001, pages 2929 - 2936 |
| MILLER ET AL., PLANTA, vol. 213, 2001, pages 483 - 487 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| OKAMURA ET AL., PNAS, vol. 107, no. 25, 2010, pages 11265 - 11270 |
| PEARSON; LIPMAN, PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444 |
| POURQUIE, J. ET AL.: "Biochemistry and Genetics of Cellulose Degradation", 1988, ACADEMIC PRESS, pages: 71 - 86 |
| R SCOPES: "Protein Purification", 1982, SPRINGER-VERLAG |
| READ, R. J.; MCCOY, A. J., ACTA CRYSTALLOGRAPHIC A SECTION D, vol. 67, 2011, pages 338 - 344 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR |
| SHARKEY ET AL., PLANT PHYSIOLOGY, vol. 137, 2005, pages 700 - 712 |
| SILVER ET AL., J. BIOL. CHEM., vol. 270, 1995, pages 13010 - 13016 |
| SILVER ET AL., JBC, vol. 270, no. 22, 1995, pages 13010 - 1316 |
| SILVER ET AL., PLANT PHYSIOL., vol. 97, 1991, pages 1588 - 1591 |
| SULTER ET AL., ARCH. MICROBIOL., vol. 153, no. 5, 1990, pages 485 - 9 |
| VAGIN, A.; TEPLYAKOV, A., J. OF APPL. CRYSTALLOGRAPHY, vol. 30, 1997, pages 1022 - 1025 |
| WEISSERMEL; ARPE: "Industrial Organic Chemistry", 2003, WILEY-VCH, pages: 117 - 122 |
| YAMADA ET AL., AGRIC. BIOL. CHEM., vol. 53, no. 2, 1989, pages 541 - 543 |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2913392A4 (en) * | 2012-10-23 | 2016-06-22 | Sekisui Chemical Co Ltd | RECOMBINANT CELL AND METHOD FOR THE PRODUCTION OF ISOPRENE |
| US9783828B2 (en) | 2012-10-23 | 2017-10-10 | Sekisui Chemical Co., Ltd. | Recombinant cell, and method for producing isoprene |
| EP4234704A3 (en) * | 2012-10-23 | 2024-01-03 | Sekisui Chemical Co., Ltd. | Recombinant cell and production method for isoprene |
| CN105985971A (zh) * | 2015-02-10 | 2016-10-05 | 中国科学院微生物研究所 | 异戊二烯合成酶基因及其应用 |
| CN105985971B (zh) * | 2015-02-10 | 2021-01-22 | 中国科学院微生物研究所 | 异戊二烯合成酶基因及其应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| US9273299B2 (en) | 2016-03-01 |
| EP2771460B1 (en) | 2017-04-26 |
| BR112014010053A2 (pt) | 2017-06-13 |
| DK2771460T3 (en) | 2017-06-06 |
| EP2771460A2 (en) | 2014-09-03 |
| BR112014010053A8 (pt) | 2017-06-20 |
| US20130295632A1 (en) | 2013-11-07 |
| JP2015503904A (ja) | 2015-02-05 |
| US20140315275A1 (en) | 2014-10-23 |
| JP6101275B2 (ja) | 2017-03-22 |
| WO2013063528A3 (en) | 2013-06-20 |
| CA2853125A1 (en) | 2013-05-02 |
| US8735134B2 (en) | 2014-05-27 |
| HK1201554A1 (en) | 2015-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2009240505B2 (en) | Isoprene synthase variants for improved microbial production of isoprene | |
| CA2816306A1 (en) | Isoprene synthase variants for improved production of isoprene | |
| WO2013063528A2 (en) | Isoprene synthase variants with improved solubility for production of isoprene | |
| AU763068B2 (en) | Nucleic acids encoding (taxus) geranylgeranyl diphosphate synthase, and methods of use | |
| CA2759700A1 (en) | Three-dimensional structure of isoprene synthase and its use thereof for generating variants | |
| CN111699247A (zh) | 通过发酵产生(6e)-8-羟基香叶醇的经改造的生物合成途径 | |
| WO2014169787A1 (zh) | 利用蓝藻生产异戊二烯的方法 | |
| CN103243083B (zh) | 一种新的倍半萜合成酶及其用途 | |
| US8921654B2 (en) | Gene cluster involved in biosynthesis of isopentenyl diphosphate in the non-mevalonate pathway of Hevea brasiliensis | |
| CN111466511B (zh) | 含有去环氧基蛋白酶的组合物及脱毒方法 | |
| AU2013266994A1 (en) | Isoprene synthase variants for improved microbial production of isoprene | |
| HK1161292A (en) | Isoprene synthase variants for improved microbial production of isoprene | |
| CN121343787A (zh) | 一种基因高拷贝整合高产香叶醇的酿酒酵母重组菌株及其构建方法和应用 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12787268 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2853125 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2014539095 Country of ref document: JP Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2012787268 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012787268 Country of ref document: EP |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12787268 Country of ref document: EP Kind code of ref document: A2 |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112014010053 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112014010053 Country of ref document: BR Kind code of ref document: A2 Effective date: 20140425 |