WO2013047941A1 - 비소세포성 폐암에서 ｔｍ４ｓｆ４의 발현 또는 활성의 조절을 통한 방사선 저항성 및 암세포의 성장, 전이, 및 침윤능력을 저하시키는 방법 - Google Patents

비소세포성 폐암에서 ｔｍ４ｓｆ４의 발현 또는 활성의 조절을 통한 방사선 저항성 및 암세포의 성장, 전이, 및 침윤능력을 저하시키는 방법 Download PDF

Info

Publication number
WO2013047941A1
WO2013047941A1 PCT/KR2011/007900 KR2011007900W WO2013047941A1 WO 2013047941 A1 WO2013047941 A1 WO 2013047941A1 KR 2011007900 W KR2011007900 W KR 2011007900W WO 2013047941 A1 WO2013047941 A1 WO 2013047941A1
Authority
WO
WIPO (PCT)
Prior art keywords
tm4sf4
lung cancer
adenocarcinoma
small cell
cell lung
Prior art date
Application number
PCT/KR2011/007900
Other languages
English (en)
French (fr)
Inventor
김인규
최수임
신병철
Original Assignee
한국원자력연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국원자력연구원 filed Critical 한국원자력연구원
Priority to JP2014531696A priority Critical patent/JP5887413B2/ja
Priority to US14/347,506 priority patent/US9075064B2/en
Publication of WO2013047941A1 publication Critical patent/WO2013047941A1/ko

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57423—Specifically defined cancers of lung
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3023—Lung
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the present invention relates to an anticancer agent or anticancer adjuvant for preventing and treating non-small cell lung cancer, comprising as an active ingredient a substance that modulates the expression or activity of TM4SF4 (transmembrane 4 L six family member 4).
  • Lung cancer is the second most common cancer in both genders and accounts for 15% of all cancers. According to a 2011 American cancer society report, more than 220,000 cases of lung cancer are diagnosed each year, of which about 70% die, accounting for 27% of cancer deaths.
  • non small lung cancer is a kind of carcinoma and refers to all epithelial lung cancers, not small lung cancers. Account for 85% to 90%.
  • Non-small cell lung cancer is relatively less sensitive to chemotherapy than pulmonary cancer and divides cancer stages based on TOM classification: the size of tumor and to the local lymph nodes. Degree of cancer spread and the presence of cancer metastasis.
  • non-small cell lung cancer In the "treatment of non-small cell lung cancer, the initial non-3 ⁇ 4 reason (non-metastatic) non-small cell lung cancer is secondary associated with cisplatin (cisplatin) containing, typically platinum because the sensitivity to chemotherapy and radiation is very low Surgery should be performed with routine 1 lary chemotherapy.
  • cisplatin cisplatin
  • various chemotherapy and radiation treatments are used. Symptoms of non-small cell lung cancer include persistent cough, chest pain, weight loss, nail fencing, joint pain, and shortness of breath. Almost invisible Therefore, early detection and treatment of non-small cell lung cancer is difficult, and it is more likely to be detected after metastasis to the whole body such as bone, liver, small intestine, and brain.
  • Non-small cell lung cancer is divided into several subtypes according to the size, shape, and chemical composition of cancer cells, and adenocarcinoma, squamous cell carcinoma, and large cell carcinoma are typical.
  • Adenocarcinoma is the highest incidence of lung cancer, accounting for over 40% of all lung cancers. It is found in the outer regions of the lung and tends to progress more slowly than other lung cancers.
  • Radiation resistance Squamous cell carcinoma is a type of non-small cell lung cancer that accounts for 25-30% of all lung cancers.
  • Cancer development begins with abnormal cell growth.
  • mutations in DNA of various genes including genes responsible for cell cycle and DNA repair mechanisms that spontaneously remove mutations, inactivate tumor suppressor genes or oncogenes.
  • Cells can have abnormal proliferation or growth capacity.
  • Non-Patent Document 1 Intracellular signal pathways that are important for cell proliferation and migration include phosphat idyl inositol 3-kinases (PI3K) —protein kinase B (Akt). In cancer cells, the PI3K-Akt signaling pathway- It is always active compared to normal cells.
  • PI3K phosphat idyl inositol 3-kinases
  • Akt protein kinase B
  • ⁇ P is a protease that degrades extracellular matrix, and the activity of MMPs is dependent on cell migration, intravasion, extravasion, angiogenesis, and metastasis. ) Is essential.
  • P is expressed in tissue remodeling or wound healing, but cancer cells overexpress and secrete li P, resulting in migration and metastasis of cancer cells through angiogenesis. Etc. (nonpatent literature 2). therefore Cancer cells with such characteristics as compared to normal cells is hypertrophic hin-and the growth is spread to other organs, eventually ⁇ If untreated, cancer cells spread to the whole body is destroying normal tissue.
  • TM4SF4 transmembrane 4 L six family member 4
  • tetraspanin is a kind of cell membrane protein called tetraspanin and is a member of the transmembrane 4 super f ami ly of the L6 family
  • Non-Patent Document 3 Cell membrane proteins of the tetraspanin super f ami ly are involved in many biological systems involved in diseases including cancer and have been reported to act on a broad spectrum in the various processes that occur in cells. Most studies have shown that cancer development markers are regulated according to the expression level of tetraspanin protein and are involved in the process of at least malignant cancer cells (Non-Patent Document 4).
  • TM4SF5 is closely related to tumorigenesis and metastasis (Non Patent Literature 5-6), and TM4SF4 has been reported to be involved in the differentiation of rat pancreas and hepatocyte regeneration during development (Non Patent Literature 7-8).
  • TM4SF4 has been reported as a gene candidate group having relatively low expression in normal cells and high expression in adenocarcinoma cells (non-patent document 9). However, there is no report on the exact function of TM4SF4 yet.
  • TM4SF4 TM4SF4
  • the expression level of TM4SF4 is different depending on the type of non-small cell lung cancer, radiation sensitivity of non-small cell lung cancer by the control of the expression level of TM4SF4, It was confirmed that it affects the growth, metastasis and infiltration ability of the cells.
  • adenocarcinoma cell lines (A549, Calu-3) of non-small cell carcinoma showed higher expression of TM4SF4 than other cell lines, and when the expression or activity of TM4SF4 was suppressed using the antibody or si NA of TM4SF4, the cancer progression ability of the cells.
  • compositions that reduce the expression of TM4SF4 are effective in preventing and treating adenocarcinoma in non-small cell lung cancer.
  • the present invention suggests that the pharmaceutical composition that increases the expression of TM4SF4 can be used very effectively to prevent and treat non-small cell lung cancers except adenocarcinoma, as well as more effectively than when used with radiation therapy. Was completed. [Preceding technical literature]
  • Non-Patent Document 1 Fresno Vara: JA. et al., Cancer Treat Rev. 2004 Apr; 30 (2): 193-204.
  • Non-Patent Document 2 Joyce E. Rundhaug. , Clin Cancer Res 2003; 9 (2): 551-4.
  • Non-Patent Document 3 Wright MD et al. , Protein Sci 2000; 9 (8): 1594-1600.
  • Non-Patent Document 4 Zevian S et al. , J. Biol. Chem. 2001; 286 (9): 7496-7506.
  • Non-Patent Document 5 Lee SA et al. , J. Clin. Invest. 118 (4): 1354-66.
  • Non-Patent Document 6 Lee SA et al. , Blood. 2009; 113 (8): 1845-55.
  • Non-Patent Document 7 Liu Z et al.-, Biochim. Biophys. Acta 2001: 1518 (1-2): 183-9.
  • Non-Patent Document 8 Anderson K et al. , Development 2011; 138 (15): 3213-24.
  • Non-Patent Document 9 Nakamura N et al. , Oncogene 2006 28; 4245-4255.
  • An object of the present invention is to reduce the growth, metastasis, and invasiveness of non-small cell lung cancer cells by using expression or activity modulators of TM4SF4 (transmembrane 4 L six family member 4), and to increase the sensitivity to radiation, which is an effective non-small cell.
  • TM4SF4 transmembrane 4 L six family member 4
  • TM4SF4 transmembrane 4 L six fami ly
  • a pharmaceutical composition for preventing and treating adenocarcinoma of non-small cell lung cancer, which contains an inhibitor of member 4) as an active ingredient is provided.
  • the present invention also provides an anticancer adjuvant for adenocarcinoma in non-small cell lung cancer containing an inhibitor of expression or activity of TM4SF4 as an active ingredient.
  • the present invention also provides a pharmaceutical composition for the prevention and treatment of non-small cell lung cancer except adenocarcinoma containing an expression vector containing a gene encoding a TM4SF4 protein as an active ingredient.
  • the present invention also provides an anticancer adjuvant for non-small cell lung cancer except adenocarcinoma containing an expression vector containing a gene encoding a TM4SF4 protein as an active ingredient.
  • the present invention also provides a composition for enhancing sensitivity to radiation of adenocarcinoma cells in non-small cell lung cancer containing an inhibitor of expression or activity of TM4SF4 as an active ingredient.
  • the present invention also provides a composition for enhancing sensitivity to radiation of non-small cell lung cancer cells, except adenocarcinoma containing an expression vector containing a gene encoding a TM4SF4 protein as an active ingredient.
  • the present invention also provides a method for enhancing sensitivity of radiation of adenocarcinoma cells in non-small cell lung cancer, comprising administering an inhibitor of expression or activity of TM4SF4 to adenocarcinoma cells in non-small cell lung cancer.
  • the present invention provides a method for enhancing sensitivity to radiation of non-small cell lung cancer cells other than adenocarcinoma, comprising administering a vector including the TM4SF4 gene to non-small cell lung cancer cells other than adenocarcinoma.
  • the present invention also provides a method for screening an anticancer agent or a radiation sensitivity enhancer candidate for adenocarcinoma cells in non-small cell lung cancer comprising the following steps:
  • the present invention also provides a method for screening an anticancer agent or a radiation sensitivity enhancer candidate for non-small cell lung cancer cells other than adenocarcinoma comprising the following steps:
  • test material to increase the expression or activity of the TM4SF4 protein compared to the control group not treated with the test material.
  • the present invention also provides a method of treating adenocarcinoma in non-small cell lung cancer, comprising administering a pharmaceutically effective amount of TM4SF4 expression or activity inhibitor to a subject having adenocarcinoma in non-small cell lung cancer.
  • the present invention also provides a method for preventing adenocarcinoma in non-small cell lung cancer, comprising administering to a subject a pharmaceutically effective amount of an inhibitor of expression or activity of TM4SF4.
  • the present invention also provides a method of treating non-small cell lung cancer, except adenocarcinoma, comprising administering an expression vector comprising a gene encoding a pharmaceutically effective amount of a TM4SF4 protein to an individual suffering from non-small cell lung cancer, except adenocarcinoma.
  • a method of treating non-small cell lung cancer comprising administering an expression vector comprising a gene encoding a pharmaceutically effective amount of a TM4SF4 protein to an individual suffering from non-small cell lung cancer, except adenocarcinoma.
  • the present invention also provides a method for preventing non-small cell lung cancer, except adenocarcinoma, comprising administering to a subject an expression vector comprising a gene encoding a pharmaceutically effective amount of a TM4SF4 protein.
  • the present invention also provides the use of an inhibitor of expression or activity of TM4SF4 for use as a pharmaceutical composition for preventing and treating adenocarcinoma in non-small cell lung cancer.
  • the present invention also provides the use of an inhibitor of expression or activity of TM4SF4 for use as an anticancer adjuvant against adenocarcinoma in non-small cell lung cancer.
  • the present invention also provides the use of an expression vector comprising a gene encoding the TM4SF4 protein for use as a pharmaceutical composition for the prevention and treatment of non-small cell lung cancer except adenocarcinoma. .
  • the present invention also provides the use of an expression vector containing the oil, e TM4SF4 encoding the protein for use as anti-cancer adjuvant of the non-small cell lung cancer, excluding adenocarcinoma.
  • the present invention also provides the use of an inhibitor of expression or activity of TM4SF4 for use as an enhancer for radiation sensitivity of adenocarcinoma cells in non-small cell lung cancer.
  • the present invention provides the use of a vector comprising a TM4SF4 gene for use as a radiosensitive sensitizer for non-small cell lung cancer cells other than adenocarcinoma.
  • the present invention provides a pharmaceutical composition for preventing and treating adenocarcinoma in non-small cell lung cancer containing TM4SF4 (transmembrane 4 L six family member 4) expression or activity inhibitor as an active ingredient.
  • TM4SF4 transmembrane 4 L six family member 4
  • the TM4SF4 protein has an amino acid sequence as set forth in SEQ ID NO: 1, but is not limited thereto, and an amino acid sequence in which some amino acids are deleted, added or substituted in the amino acid sequence, specifically 80% or more of the amino acid sequence, more specifically Any sequence having at least 90% homology to the amino acid sequence can be used. ⁇
  • TM4SF4 The active ingredient that inhibits the expression of TM4SF4 is an antisense nucleotide or small interfering RNA (siRNA), which specifically binds to m RNA, which specifically inhibits the expression of TM4SF4 gene, but is not limited thereto.
  • siRNA small interfering RNA
  • the inhibitor of expression of the TM4SF4 protein is a transcription of the gene of TM4SF4,
  • TM4SF4 protein Blocking the expression of TM4SF4 protein with normal activity by blocking post-transcript ion translating or post-translational processes and blocking the process from DNA to protein. More specifically, it may be an antisense nucleotide or small interfering RNA (siRNA) that complementarily binds to the mRNA of the TM4SF4 gene, but is not limited thereto.
  • the antisense nucleotides are those that bind to (combine) the complementary sequencing of DNA, immature -mRNA or mature mRNA to inhibit expression into the protein, as defined by Watson-Click base pairs. The nature of antisense nucleotides specific to the target sequence makes them exceptionally multifunctional.
  • antisense nucleotides are long chains of monomer units, they can be easily synthesized for the target RNA sequence.
  • the siRNA may be 15 to 30 mers, more specifically, 2 () to 25 mers, which are selected from the nucleotide sequence of mRNA of a gene encoding the human TM4SF4 protein (SEQ ID NO: 2), but are not limited thereto. It consists of an antisense sequence that complementarily binds to the sense sequence, wherein the sense sequence is not particularly limited to this, and may be specifically composed of 19 bases, but is not limited thereto. Many recent studies have suggested biochemicals for studying target proteins.
  • antisense nucleotides in particular siRNAs targeting mRNA, were demonstrated (Rothenberg et al., J. Natl. Cancer Inst., 81: 1539—1544, 1999).
  • the use of antisense nucleotides can be considered as a novel form of inhibitor because of recent advances in nucleotide synthesis and in the field of nucleotide synthesis that exhibit enhanced cell adsorption, target binding affinity and nuclease resistance.
  • the active ingredient that inhibits the activity of the TM4SF4 may be selected from the group consisting of compounds that inhibit the activity of the TM4SF4 protein, more specifically, a compound complementary to the TM4SF4 protein, peptides, peptide mimetics and antibodies, but is not limited thereto. Do not. ;
  • Peptide Minetics is a peptide or non-peptide that inhibits the binding domain of TM4SF4 protein to inhibit the activity of TM4SF4 protein.
  • Major residues of the non-hydrolyzable peptide analogs include ⁇ -turn dipeptide cores (Nagai et al. Tetrahedron Lett 26: 647, 1985), keto-methylene pseudopeptides (Ewenson et al. J Med Chew 29: 295, 1986; and Ewenson et al in Peptides:. Structure and Funct ion (Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985), kinase "pin (Huffman et al in Peptides:.
  • TM4SF4 adenocarcinoma cell lines
  • RT-PCR reverse transcription polymerase chain reaction
  • TM4SF4 reduces the activation of IGFlR
  • P matrix metal loproteinases
  • a pharmaceutical composition comprising a component that inhibits the expression and activity of TM4SF4 may be used to reduce the cell's ability to metabolize, metastasize and infiltrate through the reduction of the activation of intracellular IGF1RP / PI3K—Akt / ⁇ - ⁇ and VIIIP. It can be usefully used for the prevention and treatment of adenocarcinoma among non-small cell lung cancer.
  • the present invention also provides an anticancer adjuvant for adenocarcinoma in non-small cell lung cancer containing an inhibitor of expression or activity of TM4SF4 as an active ingredient.
  • the anticancer adjuvant may enhance sensitivity to radiation of adenocarcinoma cells in non-small cell.
  • the radiation may use both gamma radiation, X-rays or electron beams, more specifically gamma radiation, and more specifically 60 Co Y-rays, but is not limited thereto.
  • the radiation dose may be 0.2-20 Gy, more specifically 0.5-10 Gy, more specifically 2 Gy, but not limited thereto.
  • the radiation dose irradiation rate is 0.02-2 Gy / min, more specifically 0.05—lGy / niin, More specifically, 0.2 Gy / min may be used, but is not limited thereto.
  • TM4SF4 expression on the cell sensitivity to radiation in the adenocarcinoma cell line (A549) of non-small cell lung cancer, more specifically the TM4SF4 gene .
  • TM4SF4 gene in the adenocarcinoma cell line (A549) of non-small cell lung cancer, more specifically the TM4SF4 gene .
  • colony formation analysis confirmed the resistance to radiation, more specifically gamma radiation.
  • the colony of the A549 cell line which expresses TM4SF4 under irradiation was remarkably increased, which decreased the resistance of the cell line to radiation when TM4SF4 was expressed, that is, increased sensitivity to radiation. Point to doing.
  • compositions containing an inhibitor of the expression or activity of TM4SF4 protein of the present invention as an active ingredient may comprise from 0.00 to 50% by weight of the active ingredient relative to the total weight of the composition.
  • composition of the present invention may contain one or more active ingredients exhibiting the same or similar function in addition to the expression or activity inhibitor of the TM4SF4 protein.
  • composition of the present invention may be prepared by including one or more pharmaceutically acceptable carriers in addition to the above-described active ingredients for administration.
  • Pharmaceutically acceptable carriers may be used in combination with saline, sterile water, Ringer's solution, complete saline, textose solution, maltotextile solution, glycerol, ethanol liposomes and one or more of these components ; If necessary, other conventional additives such as antioxidants, buffers, bacteriostatics, etc. may be added.
  • Target organ specific antibodies or kiti-ligands can be used in combination with a single-group carrier.
  • it may be preferably formulated according to each disease or component using an appropriate method in the art or using a method disclosed in Remington's Pharmaceutical Science (Recent Edition, Mack Publishing Company, East on PA). Can be.
  • Nucleotides or nucleic acids can be prepared for oral, topical parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal administration.
  • the nucleic acid or vector is used in injectable form.
  • the area to be treated may be combined with any pharmaceutically acceptable vehicle for injectable compositions for direct infusion.
  • the composition of the present invention may in particular comprise an isotonic sterile solution or a lyophilized composition which allows the composition of an injectable solution upon the addition of dry, in particular sterile water or a suitable physiological saline solution.
  • nucleic acid into a patient's tumor is advantageous because it allows the treatment efficiency to be focused on the infected tissue.
  • the dosage of nucleic acid used can be adjusted by various parameters, in particular genes, vectors, mode of administration used, disease in question or alternatively desired duration of treatment.
  • the patient's weight, age, sex, health status, diet, time of administration The range varies depending on the method of administration, the rate of excretion and the severity of the disease. To-one days, and from about 0.001 to 100mg / kg, preferably 0.01 to 10mg / kg, preferably administered once a day by dividing to several times.
  • the present invention also provides a pharmaceutical composition for the prevention and treatment of non-small cell lung cancer except adenocarcinoma containing an expression vector containing a gene encoding a TM4SF4 protein as an active ingredient.
  • the expression vector including the genetic character encoding the TM4SF4 protein has a gene sequence as set forth in SEQ ID NO: 2, but is not limited thereto.
  • the vector may comprise a non-viral vector or a viral vector.
  • Nonviral vectors include, but are not limited to, linear DNA, plasmid DNA ⁇ liposomes.
  • Virus vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, and herpes viruses.
  • a pharmaceutical composition containing a component that increases the expression of TM4SF4 is a cell It can be usefully used for the prevention and treatment of non-small cell lung cancer except adenocarcinoma by reducing the growth ability.
  • adenocarcinoma containing an expression vector containing a gene coding for a protein as an active ingredient TM4SF4 provides anti-cancer supplements for non-small cell lung cancer.
  • the anticancer adjuvant is radiation for non-small cell lung cancer cells except adenocarcinoma Sensitivity can be enhanced.
  • the characteristics of the radiation used, the irradiation method, the dose, and the like are the same as above.
  • Non-small cell lung cancer except adenocarcinoma excludes adenocarcinoma, more specifically squamous eel 1 carcinoma, and large cell carcinoma, and more specifically, large cell carcinoma. However. It is not limited to this.
  • an anticancer adjuvant comprising a recombinant expression vector expressing a gene of TM4SF4 described in SEQ ID NO: 2, the content of the recombinant expression vector expressing the TM4SF4 gene is in the composition of the entire anticancer adjuvant. It may be 0.01 to 50% by weight based on solids, but is not limited thereto.
  • the anticancer adjuvant may include additives such as purified water, excipients, stabilizers or preservatives in addition to the recombinant expression vector expressing TM4SF4.
  • An anticancer adjuvant containing a recombinant expression vector expressing the gene of TM4SF4 of the present invention is prepared in various formulations such as tablets, capsules, infusions, granules, or pills, oral, injectable, topical, or It can be used for application.
  • the present invention also provides a composition for enhancing sensitivity to radiation of adenocarcinoma cells in non-small cell lung cancer containing an inhibitor of expression or activity of TM4SF4 as an active ingredient.
  • the present invention also provides a composition for enhancing sensitivity to radiation of non-small cell lung cancer cells, except adenocarcinoma containing an expression vector containing a gene encoding a TM4SF4 protein as an active ingredient.
  • the present invention also provides a method of enhancing sensitivity to radiation of adenocarcinoma cells in non-small cell lung cancer, comprising administering an inhibitor of expression or activity of TM4SF4 to adenocarcinoma cells in non-small cell lung cancer.
  • the present invention is TM4SF4 gene.
  • a method for enhancing sensitivity to radiation of non-small cell lung cancer cells other than adenocarcinoma comprising administering an expression vector comprising the same to non-small cell lung cancer cells other than adenocarcinoma.
  • the radiation may use both gamma radiation, X-rays or electron beams, more specifically gamma radiation, and more specifically 60 Co ⁇ —rays, but is not limited thereto.
  • the radiation dose is 0.2-20 Gy, more specifically 0.5-10 Gy, more specifically 2Gy may be used but is not limited thereto.
  • the radiation dose rate may be 0.02-2 Gy / min, more specifically 0.05—lGy / min, and more specifically 0.2 Gy / min, but is not limited thereto.
  • the present invention
  • TM4SF4 protein of step 1) may have an amino acid sequence represented by SEQ ID NO: 1, but is not limited thereto.
  • the expression level of the protein in step 2) may be any method for measuring the amount of a transcript or a protein encoded therefrom known to those skilled in the art; more specifically, immunoprecipitation radioimmunoassay.
  • Assay RIA
  • enzyme immunoassay ELISA
  • Immunohistochemistry RT—PCR
  • Western blotting and flow cytometry FACS
  • the degree of activity of the protein of step 2) can be measured by any one selected from the group consisting of SDS-PAGE, immunofluorescence, enzyme immunoassay (ELISA), mass spectrometry and protein chip, but is not limited thereto.
  • the radiation of step 3 may be gamma radiation, X-ray, or electron beam, and more specifically gamma radiation, but is not limited thereto.
  • adenocarcinoma the growth, metastasis and invasion, and the radiation sensitivity of adenocarcinoma and other non-small cell lung cancers were changed according to the regulation of TM4SF4, respectively.
  • Non-small cell lung cancer was shown to have a mutually opposite action. More specifically, in adenocarcinoma, cell growth 'metastasis, invasion, and radiation resistance were decreased when TM4SF4 expression was decreased, and cell growth and radiation resistance was decreased when TM4SF4 expression was increased in non-small cell lung cancer except adenocarcinoma. Showed.
  • a test substance that affects the expression of TM4SF4 non-small cell lung cancer adenocarcinoma or adenocarcinoma except for adenocarcinoma: anti-cancer agent or anti-cancer adjuvant with radiation enhancement effect can be selected.
  • the present invention also provides a method of treating adenocarcinoma in non-small cell lung cancer, comprising administering a pharmaceutically effective amount of an inhibitor of expression or activity of TM4SF4 to a subject having adenocarcinoma in non-small cell lung cancer.
  • the present invention also provides a method for preventing adenocarcinoma in non-small cell lung cancer, comprising administering to a subject a pharmaceutically effective amount of an inhibitor of expression or activity of TM4SF4.
  • the present invention also provides a method of treating non-small cell lung cancer other than adenocarcinoma, comprising administering an expression vector containing a gene encoding a TM4SF4 protein in an amount that is academically effective to a subject having non-small cell lung cancer other than adenocarcinoma.
  • a method of treating non-small cell lung cancer other than adenocarcinoma comprising administering an expression vector containing a gene encoding a TM4SF4 protein in an amount that is academically effective to a subject having non-small cell lung cancer other than adenocarcinoma.
  • the present invention also includes administering to a subject an expression vector comprising a gene encoding a pharmaceutically effective amount of a TM4SF4 protein, except adenocarcinoma.
  • an expression vector comprising a gene encoding a pharmaceutically effective amount of a TM4SF4 protein, except adenocarcinoma.
  • a method for preventing non-small cell lung cancer Provided a method for preventing non-small cell lung cancer.
  • the present invention also provides the use of an inhibitor of expression or activity of TM4SF4 for use as a pharmaceutical composition for preventing and treating adenocarcinoma in non-small cell lung cancer.
  • the present invention also provides the use of an inhibitor of expression or activity of TM4SF4 for use as an anticancer adjuvant against adenocarcinoma in non-small cell lung cancer.
  • the present invention also provides the use of an expression vector comprising a gene encoding the TM4SF4 protein for use as a pharmaceutical composition for the prevention and treatment of non-small cell lung cancer except adenocarcinoma.
  • the present invention also provides the use of an expression vector comprising a gene encoding the TM4SF4 protein for use as an anticancer adjuvant for non-small cell lung cancer except adenocarcinoma.
  • the present invention also provides the use of an inhibitor of expression or activity of TM4SF4 for use as an enhancer for radiation sensitivity of adenocarcinoma cells in non-small cell lung cancer.
  • the present invention provides a use of a vector comprising a TM4SF4 gene for use as a radiation sensitivity enhancer of non-small cell lung cancer cells except adenocarcinoma.
  • the present invention has been shown to reduce the growth, migration and invasion, and radiation resistance of cancer cells by regulating the expression and activity of TM4SF4 (transmembrane 4 L six family member 4) in non-small cell lung-cell lines. More specifically, the inhibition of TM4SF4 expression or activity in adenocarcinoma cell lines among non-small cell lung cancers resulted in a decrease in the growth, metastasis, and invasiveness of cancer cells and a significant increase in sensitivity to radiation. In other non-small cell lung cancer cell lines, increased expression of TM4SF4 resulted in decreased cell growth and radiation resistance. Thus, pharmaceutical compositions that modulate the expression or activity of TM4SF4 are useful for the prevention and treatment of cancer. Can be used.
  • Figure 1 is a schematic diagram showing the cloning of the expression vector TM4SF4 / pcDNA3.1 to overexpress TM4SF4 through transduction in various lung cancer cell lines.
  • Figure 2 is a variety of lung cancer cell line
  • FIG. 1 Figure showing the expression level of TM4SF4 (transiiieinbrane 4 L six family member 4) using reverse transcriptase reaction and western blotting (WB) in A549 / H460 / A431 / H23 / H1299 / H2009 / H358 / Calu-3 to be.
  • WB western blotting
  • FIG. 3 to 5 shows colony formation to examine cell growth (FIG. 3) and radiosensitivity (FIG. 4) when TM4SF4 gene is overexpressed in H1299 or H460 cells, which are large cell carcinoma in non-small cell lines.
  • FIG. 4 shows the results of the colony formation analysis.
  • Figure 5 is a diagram showing the results of colony formation analysis to determine the growth and radiosensitivity of cells when low expression of TM4SF4 in H460 cells.
  • Figure 6 is a diagram showing the results of colony formation analysis to determine the growth and radiation sensitivity of the cells when TM4SF4 low expression in A549 cells, adenocarcinoma cell line of A549 lung cancer cell line.
  • FIG. 7 shows the phosphorylation of intracellular signals related to cell proliferation and resistance (IGF1R / PI3K / Akt / NF-KB, EGFR, ERK) in TM549 cells suppressed TM4SF4 and control A549 cells by western blotting. The figure shows the result.
  • FIG. 8 is a diagram showing the results of observing the mobility difference between the A549 cells and the control A549 cells suppressed TM4SF4 through the wound healing method over time.
  • FIG. 9 is a diagram showing the results of experiments comparing the mobility and degree of infiltration of A549 cells with TM4SF4 inhibition and control A549 cells.
  • FIG. 10 is a diagram showing the results of Western blotting to determine the correlation of ⁇ P— 2, 7, and 9 with low expression of TM4SF4 in A549 cells.
  • FIG. 11 is a diagram showing colony formation analysis to investigate cell growth and radiation resistance when TM4SF4 is overexpressed in A549 cells.
  • FIG. 12 shows the results of Western blotting of IGF1R, PI3K / PTEN / Akt, NF- ⁇ , ERK, and EGFR to compare markers related to cell proliferation and resistance when overexpressing TM4SF4 in A549 cells.
  • FIG. 13 is a diagram illustrating the results of wound healing (wound healing) in order to determine the difference in cell mobility during overexpression of TM4SF4 in A549 cells.
  • FIG. 14 is a diagram showing the results of H & E (hematoxylin & eosin) staining to determine the mobility and infiltration of TM4SF4 overexpressed in A549 cells.
  • 15 is a diagram showing the results of Western blotting to determine the correlation between MMP-2, 7, 9 when TM4SF4 overexpressed in A549 cells.
  • Figure 16 shows the results of colony formation to determine the cell proliferation according to the concentration of TM4SF4 antibody when overexpressing TM4SF4 in A549 cells.
  • Example 1 Preparation of TM4SF4 Expression Vector for Transfection
  • the PCR has had banung under the conditions of the dielectric DNA 1 ⁇ ⁇ , 10pm primers each thereof ⁇ , maxim PCR premix (maxim TM PCR preMix, i- Taq) (iNtRON biotechnology, Sungnam, Korea).
  • maxim PCR premix maximum TM PCR preMix, i- Taq
  • conditions of PCR cycles was 1 min at 94 ° C (denaturation; denaturation), (annealing; annealing) for 30 seconds at 58.9 ° C, 1 min at 72 ° C; and (height elongation), was repeated 30 times.
  • the Post-elongation was maintained at 72 ° C. for 5 minutes.
  • the expression vector pcDNA3.1 (+) vector was mixed with ⁇ and buffers, respectively, of the same restriction enzymes EcoRI and Xhol (invotrogen), and reacted at 37 ° C for 2 hours or more.
  • the expression vector, TM4SF4 DNA, T4 ligase and T4 buffer obtained by the PCR were mixed and reacted at 16 ° C. for 2 hours or more.
  • a schematic diagram for the production of the expression vector is shown in Figure 1-.
  • the expression vector prepared with DH5a (iNtRON biotechnology, Sungnam, Korea) E. coli host was mixed and left at 4 ° C. for 30 minutes, then subjected to thermal shock at 42 ° C. for 90 seconds, inoculated in S0C medium at 37 ° C.
  • the colony DNA was inserted into an LB solid medium containing ampicillin as an antibiotic marker and cultured for 16 hours in an incubator at 37 ° C for treatment with EcoRI and Xhol (invotrogen) restriction enzymes. Confirmation via sequencing. After overnight incubation of 100% matched colonies in Ampicillin-containing LB broth, the DNA-spin plasmid DNA extraction kit (iNtRON biotechnology, Sungnam, Korea) was used. Plasmid DNA was extracted. A549, H460, A431, H23, H1299, H2009, H358 and Calu-3 cells were placed in 6 well plates at 4xl0 5 cells / well and optimized for effective transduction. MEM) to change the medium.
  • EcoRI and Xhol invotrogen
  • TM4SF4 / pcDNA3.1 DNA 4yg and lipofectamine 2000 lipofectamine 2000, invitrogen
  • TM4SF4 / pcDNA3.1 DNA 4yg and lipofectamine 2000 lipofectamine 2000, invitrogen
  • RPMI1640 lipofectamine 2000, invitrogen
  • TM4SF4 reverse transcriptase polymerase reaction
  • RT-PCR reverse transcriptase polymerase reaction
  • Western blotting was performed to determine the mRNA and protein levels of TM4SF4, respectively.
  • RT-PCR contains the total RNA ig in the Maxim RT premix-up (dT) 15 primer (Maxim TM RT Pr eM i x-01 i go (dT) 15Pr i mer) (iNtRON biotechnology, Sungnam, Korea)
  • the reaction mixture was prepared with 20 ⁇ 1 and then reacted at 45 ⁇ for 60 minutes at 95 ° C. for 5 minutes to synthesize RT-PCR cDNA.
  • TM4SF4 primer with synthesized cDNA template 5'—CCACGAATTCATGTGCACTGGGGGC— 3 (SEQ ID NO: 3) ', reverse: 5'-TCCTCGAGTTAAACGGGTCCATdTCCC-3' (SEQ ID NO: 4)] or ⁇ -actin (act in) : 5'— CATCCTCACCCTGAAGTACCC— 3 '(SEQ ID NO: 5), reverse: 5'— AGCCTGGATAGCMCGTACATG— 3' (SEQ ID NO: 6)], respectively, ⁇ , maximal 20 ⁇ 1 with sterile water 16 ⁇ 1, Maxim TM PCRPreMix , i-Taq) (iNtRON biotechnology, Sungnam, Korea).
  • PCR was performed using a thermal cycler (APOLLO, San Diego, USA), 1 minute at 94 ° C (denaturation), 30 seconds at 58.9 ° C (annealing), 1 minute at 72 ° C (height). The test was repeated 30 times under conditions of and maintained at 72 ° C. for 5 minutes (after extension). PCR products were observed on electrophoresis using EtBr (ethidi ⁇ bromide) staining on 1% agarose gel (agarose gel).
  • EtBr ethidi ⁇ bromide
  • Cells were cultured at 37t, 5% C0 2 using RPMI 1640 medium containing 10% fetal bovine serum (FBS, Hyclone) and antibiotics (10O / ml penicillin and lOOjjg / ml streptomycin, Hyclone).
  • FBS fetal bovine serum
  • antibiotics 10O / ml penicillin and lOOjjg / ml streptomycin, Hyclone.
  • A549, H460, A431, H23, Calu-3, H1299 ⁇ H2009 and H358 cells of lxlO 7 were obtained and washed twice with PBS, followed by protease inhibitor cocktail (2 mM AEBSF, ImM EDTA, 130 ⁇ M).
  • Electrophoresis was performed for 1 hour at 80V and 90 minutes at 100V. Using a semi-dry transfer (Bio-Rad, USA) on a PVDF membrane (Bio-Rad, USA) that had been pre-soaked in 100% methanol for 10 seconds and then fully hydrated with distilled water. The separated protein was transferred to the electrophoresis for 1 hour at 20V. After 1 h of reaction at room temperature with blocking solution (5% BSA, 0.1% Tween-20 / TBS) to exclude nonspecific binding, the primary antibody, anti—TM4SF4 antibody (abeam, # abl02946) and Anti- ⁇ -actin antibody (Sigma-aldrich, # A3854) was bound overnight at 4 ° C.
  • blocking solution 5% BSA, 0.1% Tween-20 / TBS
  • anti-IgG antibodies (Cel 1-signaling, # 7076 and # 7074) bound to the secondary antibody peroxidase were reacted at room temperature for 1 hour.
  • the results of the expression pattern of TMSF4 are shown in FIG. 1 by identifying the color development using an ECL detection kit (detect ion kit, Amersham, UK).
  • ECL detection kit detect ion kit, Amersham, UK.
  • ⁇ -actin was performed together as a loading control and the same amount of ⁇ -actin means that the same protein amount was loaded.
  • TM4SF4 TM4SF4 protein
  • Example 3 H1299, a large cell carcinoma cell line, among lung cancer cells Reduction of Cell Growth and Radiation Resistance by Overexpression of TM4SF4 in Colony Formation Assay in H460 Cells
  • Example 2 According to the results of Example 2, despite being the same lung cancer cell line, adenocarcinoma cell line and non-cancer cell line showed different expression patterns of TM4SF4. Therefore, in order to investigate the function of TM4SF4, this experiment was carried out to investigate how the expression level of TM4SF4 in lung cells H1299 and H460 cells of large cell carcinoma correlates with the cell growth and radiation resistance characteristic of cancer cells. Was performed.
  • step 1 The expression vector obtained in step 1 was subjected to transient transduction as described in Example 1 using lipofectamine 2000 together with 4yg of TM4SF4 / pcDNA3.1. After 8 days, live cells were stained and observed with 0.5% (w / v) crystal vial solution. The control group was experimented with the empty ground.
  • TM4SF4 was overexpressed in H1299 and H260 cells, which are large cell carcinoma cell lines.
  • Example 3-1 The same procedure as in Example 3-1 was performed to overexpress TM4SF4 in H460 cells.
  • overexpression of TM4SF4 was performed in the same manner as in Example 3-1, and after 72 hours, cells were obtained and analyzed for irradiation. Irradiation was performed once with 2Gy dose of 0.2Gy / niin using 60 Co line. After culturing the cells at 5% CO 2) 36 ° C. for 8 days, the cells were stained and observed with 0.5% (w / v) crystal violet solution. As a result, it was confirmed that cell growth is inhibited when TM4SF4 is overexpressed in H460 cells as in Example 3-1 (Fig. 4, above).
  • TM4SF4-siRNA duplex oligoribonucleotides primers that inhibit TM4SF4 gene expression were replaced with 5'-gccucucaaugugguucccLiggaau-3 '(SEQ ID NO: 7: sense) / 5'-auuccagggaaccacauugagaggc-3' No. 8: antisense) to target a portion of the TM4SF4 gene (SEQ ID NO: 9) to inhibit gene expression.
  • Stealth TM RNA targeting TM4SF4 was transiently transduced into cells using Lipofectamine TM RNAi MAX reagent (invitrogen) in the same manner as described in Example 1.
  • Example 4 Confirmation of increase in cell growth and radiation resistance due to low expression of TM4SF4 through colony formation analysis of adenocarcinoma cell line A549 in lung cancer cells
  • Example 5 Decreased intracellular signaling pathway activity through Western blotting when TM4SF4 is low in A549 cells, lung cancer cells.
  • TM4SF4 The low expression of TM4SF4 resulted in decreased cell growth and increased radiation sensitivity in A549, an adenocarcinoma cell line.
  • TM4SF4 expression was investigated the effect of TM4SF4 expression on the activation of intracellular signaling pathways that mediate cell growth. The experiment was performed. Intracellular signals are serially linked by a series of proteins and their activation is usually mediated by phosphorylation of serine, threonine and tyrosine residues. Therefore, the degree of phosphorylation means the degree of activation. In this experiment, the degree of phosphorylation of proteins that mediate various signaling pathways in cells was measured using Western blotting when TM4SF4 was overexpressed and underexpressed.
  • Transcription factor ⁇ - ⁇ as well as the IGFlRPCinsulin—like growth factor 1 receptor ⁇ ), known to be responsible for enhanced sensitivity, and the PI3 (phosphat idyl inositol 3 kinase) pathways (such as PTEN and Akt) that make up their intracellular signaling system And phosphorylation of ERK. Geek-phosphorylation of signal pathways Western blotting was performed in the same manner as described in Example 2. When overexpression or underexpression of TM4SF4, when there is no stimulation, the results of phosphorylation of EGFR, IGFIRP, PI3K, ⁇ - ⁇ or ERK in each cell was measured by Western blotting using respective antibodies (Cell signaling, USA) As shown in FIG.
  • EGFR mediates a signaling pathway important for cell growth and radiation sensitivity.
  • SiRNA is used to induce low expression of TM4SF4 in A549 cells as described in Examples 3-3. After 72 hours, A549 cells were transferred to a 35-counter culture vessel and cultured to 90% or more of saturation. After rinsing with PBS, the medium was changed to RPMI 1640 medium containing 0.5% of FBS. C0 2 , 37 ° C. was incubated (starvation) to be. Using a 200 ⁇ 1 tip on the bottom of the container, the cells were scratched and then washed slowly with PBS again, and cultured with the cell culture medium again. The intervals between the cells were observed after 0 hours, 24 hours, and 36 hours. Intervals between the cells are expressed as percentage percentages relative to the control.
  • TM4SF4 expression plays an important role in the continuous migration of cells in A549, adenocarcinoma cell line.
  • Example 7 Low Expression of TM4SF4 in Adenocarcinoma Cell Line A549 Among Lung Cancer Cells Decreased cell mobility and invasiveness through transwells
  • Example 6 the change in cell mobility according to the expression of TM4SF4 was observed using a transwell in this experiment. In addition, this transwell was used to determine whether there was a change in expression of TM4SF4 in the cell invasion ability.
  • Cell migration and invasiveness are essential cell characteristics necessary for metastasis of cancer cells. This experiment is not only for cell mobility but also to examine how TM4SF4 expression affects cancer cell metastasis.
  • SiR A is used to induce low expression of TM4SF4 in A549 cells.
  • A549 cells were incubated in RPMI 1640 medium containing 10% fetal bovine serum (FBS, Hyclone) and antibiotics (lOOU / ml penicillin and 100 yg / ml streptomycin, Hyclone) in transwell (Cell biolabs). Put 2 ⁇ 10 5 / 300 ⁇ 1 into the chamber of the chamber.
  • 500 ml of PMI 1640 medium without fetal calf serum was added and incubated for 24 hours at 53 ⁇ 4 CO 2 , 37 ° C. After incubation, the cells were transferred to the bottom surface of the transwell and stained with CyQuant®GR staining reagent. The number of cells shown in the field was measured and expressed as percentage ratio (%) relative to the control,
  • SiRNA was used to induce low expression of TM4SF4 in A549 cells. After 72 hours, 5 ⁇ 50 A549 cells were prepared, coated with Matrigel TM 10 ⁇ 1 on the top of the transwell, dried, and incubated with fetal bovine serum-free RPMI 1640 medium for 30 minutes at room temperature. Thereafter, experiments were performed using a transwell in the same manner as the cell mobility measurement method described in Example 7-1. After incubation, the top surface of the well was removed with a cotton swab and stained with CyQuant®GR staining reagent to observe the infiltrated cells. The number of cells shown in the field was measured and expressed as percentage ratio (%) relative to the control.
  • TM4SF4 low expression of TM4SF4 in adenocarcinoma cell line A549 increased invasiveness by about 403 ⁇ 4 (below FIG. 9).
  • expression of TM4SF4 was found to increase cell mobility and invasiveness in A549, an adenocarcinoma cell line, which means that it plays an important role in promoting metastasis of cancer cells.
  • Example 8 Reduction of MMKmatrix nietalloprotease expression according to low expression of TM4SF4 through Western blotting in adenocarcinoma cell line A549 cells among lung cancer cells
  • angiogenesis is essential for cancer cell metastasis.
  • MMP is a protease that degrades extracellular matrix and is well known as one of the essential factors for angiogenesis.
  • siRNA was used to induce low expression of TM4SF4 in A549 cells. After 72 hours, the whole cell lysate of cells without any stimulation was obtained by the same method as described in Example 2, and the expression levels of MMP's 2, 7, and 9 were determined for each antibody (R & D system, USA). ) was confirmed by Western blotting. ⁇ -actin was performed together as a loading control.
  • TM4SF4 regulates the expression of ⁇ P– 2, 7, 9 in cells.
  • TM4SF4 inhibits the activity of intracellular signals responsible for cell growth and radiation resistance, leading to a decrease in the growth and radiation resistance of the cells. This was done to determine whether it affects the activity of these intracellular signals (EGFR, IGF1RP, PI3K, NK- ⁇ and ERK).
  • TM4SF4 in A549 cells was performed as described in Example 3-2 above, and as described in Example 5 above to investigate the activation of intracellular signaling pathways.
  • TM4SF4 in adenocarcinoma cell line A549 cells resulted in an increase in IGF1R 3, PI3K, Nk- ⁇ phosphorylation, and did not significantly affect the activity of EGFR and ERK (FIG. 12). Therefore, an increase in cell sexual characteristics, and radiation resistance as a result of Example 9 was caused by the over-expression of TM4SF4 increasing activation of IGFIRP, ⁇ 3 ⁇ , ⁇ - ⁇ . ⁇
  • the method for overexpressing TM4SF4 in A549 cells was performed in the same manner as described in Example 3-2. Thereafter, the mobility of the cells was measured in the same manner as described in Example 6 to observe the mobility of the cells through wound repair, and the results were shown.
  • TM4SF4 When overexpressed, the cell mobility was increased by about 3 (compared to that of the control group (Fig. 14, above).
  • TM4SF4 Overexpression of TM4SF4 was induced in A549 cells in the same manner as described in Example 3-3. Then; A whole cell lysate was obtained in the same manner as described in Example 2, followed by western blotting to obtain P-2, 7, 9 Expression level was confirmed.
  • TM4SF4 hinge ⁇ As a result, by using siRNA in the same manner as that inhibit the expression of TM4SF4 hinge ⁇ , was a decrease in the number of colonies observed in a concentration-dependent manner in the treated antibody di- (Fig. 16). This indicates that TM4SF4, a membrane protein, plays an important role in the growth of adenocarcinoma cell line (A549) in non-plastic cell lung cancer, and the cell growth ability is the same as when the membrane protein is neutralized with antibody and siRNA is inhibited in expression. Greatly damaged. '

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Toxicology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)

Abstract

본 발명은 TM4SF4(transmembrane 4 L six family member 4)의 발현 또는 활성을 조절하는 물질을 포함하는 비소세포성 폐암을 예방 및 치료하기 위한 약학적 조성물 또는 항암 보조제에 관한 것이다. 보다 상세하게는, 비소세포성 폐암 중 선암에서 TM4SF4의 발현을 감소시킴으로써 선암 세포의 성장, 전이 및 침윤 능력, 및 방사선 저항성을 감소시키고, 선암을 제외한 다른 비소세포성 폐암에서 TM4SF4의 발현을 증가시킴으로써 상기 세포의 성장, 전이 및 침윤, 및 방사선 저항성을 감소시킬 수 있는 것을 확인함으로써, TM4SF4의 발현 또는 활성 조절 물질의 비소세포성 폐암에 대한 항암제 또는 항암 보조제로서의 용도에 관한 것이다.

Description

【명세서】
【발명의 명칭】 '
비소세≥성 폐암에서 TM4 S F 4의 발현 또는 활성의 조절을 통한 방사선 저항성 및 암세포의 성장， 전이, 및 침윤능력을 저하시키는 방법
【기술분야 Ϊ
본 발명은 TM4SF4( transmembrane 4 L six family member 4)의 발현 또는 활성을 조절하는 물질을 유효성분으로 포함하는 비소세포성 폐암 예방 및 치료용 항암제 또는 항암 보조제에 관한 것이다.
.
【배경기술】
폐암 (lung cancer)은 남녀 모두의 성별에서 두 번째로 흔히 발생하는 암으로서， 모든 암에서 15%를 차지한다. 2011년 미국 암 학희 (American cancer society)의 보고에 따르면， 한 해 22만건 이상이 폐암으로 진단을 받으며， 이 중 약 70%가 사망에 이르는데 이는 암 사망 중에서 27%를 차지한다. 폐암 중에서 비소세포성 폐암 (non small lung cancer)은 상피성 암 (carcinoma)의 일종으로 폐소성암 (small lung cancer)이 아닌 모든 상피성 폐암 (epi thel ial lung cancer)을 일컫으며， 폐암 전체의 약 85% 내지 90%를 차지한다. 비소세포성 폐암은 폐소성암에 비해 상대적으로 화학요법 (chemotherapy)에 덜 민감하며， TOM 분류법에 기초하여 암의 단계를 나눈다:종양의 크기 (the size of tumor)，국소 림프절 (reginal lymph node)로의 암 확산 정도 및 암 전이 (metastasis)의 유무. 비소세포성 폐암의' 치료에 있어서， 초기의 비 ¾이성 (non-metastatic) 비소세포성 폐암은 화학요법 및 방사선에 대한 민감도가 매우 낮기 때문에， 일반적으로 백금을 함유하는 시스플라틴 (cisplatin)과 관련된 보조적인 화학요법 (anci 1 lary chemotherapy)와 함께 수술올 한다. 반면에 초기 단계를 지나, 전이성 비소세포성 폐암인 경우에는， 다양한 화학요법 및 방사선 치료가 사용된다. 비소세포성 폐암의 증상는 지속적인 기침, 흉부 통증, 체중감소, 손톱 손싱-, 관절 통증, 호흡의 단기화 (shortness of breath) 등이 있으나， 비소세포성 폐암은 일반적으로 천천히 진행되기 때문에 초기에는 그 증상을 거의 보이지 않는다. 따라서, 비소세포성 폐암의 조기 발견 및 치료가 어려우며， 뼈， 간, 소장, 및 뇌 등 전신에 전이된 후에 발견할 가능성이 높다ᅳ 따라서， 높은 발병률과 사망률에도 불구하고 아직 비소세포성 폐암올 극복할 수 있는 어떠한 약물 또는 치료방법이 개발되지 않았으며, 그 필요성이 대두되고 있다. 비소세포성폐암은 암세포의 크기， 모양 및 화학적 구성에 따라 몇가지 하위 종류로 나뉘며， 대표적으로는 선암 (adenocarcinoma) , 편평상피암 (squamous cell carcinoma) , 대세포암 (large cell carcinoma)등이 있디. 선암은 전체 폐암의 40%이상올 차지할 정도로 가장 높은 빈도로 발생하는 폐암으로서， 폐의 바깥부위 (outer region)에서 발견되며 다른 폐암보다 천천히 진행되는 경향이 있으나， 초기에 높은 전이 경향을 보이고 또한 높은 방사선 저항성을 보인다. 편평상피암은 전체 폐암의 25-30%를 차지하는 비소세포성 폐암의 한 종류로서， 기도 (airway)를 이루고 있는 세포의 초기 단계 (early version)에서 시작되며， 상기 암은 주로 흡연자에게서 높은 발병률을 보인다. .또한 전체 폐암의 10-15% 정도를 차지하는 대세포암은 폐의 어느 부위에서나 발병할 수 있으며， 그 진행속도가 소세포성 폐암 (small cell lung cancer)과 유사할만큼 빠르기 때문에 그 치료는 현재까지도 난제로 떠오르고 있다. 암의 발달은 비정상적인 세포의 성장으로부터 시작된디. 일반적으로 세포의 주기를 담당하는 유전자， 돌연변이를 자발적으로 제거하는 DNA 수선 기작 담당 유전자를 포함한 다양한 유전자의 DNA에 돌연변이가 생김으로써, 종양 억제 유전자 (tumor suppressor gene)를 비활성화시키거나 종양 유전자 (oncogene)을 활성화시켜 세포는 비정상적인 증식 또는 성장 능력을 가질 수 있다. 예를 들면， 비소세포성 폐암에서는 EGFR( epidermal growth factor receptor)의 돌연변이가 원인이 되어 그 리간드인 EGF(epidermal growth factor)가 없어도 계속 활성화되어 비정상적인 증식 또는 성장 능력을 갖게 된다 (비특허문헌 1). 세포의 증식 및 이동 (migration) 등에 중요한 세포내 신호 경로 (signal pathway)에는 PI3K(phosphat idyl inositol 3-kinases)—Akt(protein kinase B)가 있는데， 일반적으로 암세포에서는 상기 PI3K-Akt 신호경로기- 일반 세포에 비해 항상 활성화되어 있다. 또한， 암세포의 대표적인 특징은 丽 Kmatrix metal loprotease)를 과발현한다는 것이다. 匪 P는 세포외 기질을 분해하는 단백질 분해효소로서， MMP의 활성은 세포의 이동 (cell migration) , 혈관내유입 ( intravasion) , 혈관외유출 (extravasion)， 혈관생성 (angiogenesis) 및；전이 (metastasis) 등에 필수적이다. 일반적으로 匪 P는 조직의 리모델링 (tissue remodeling) 또는 상처회복 (wound healing)와 같은 경우에 발현되지만， 암세포는 丽 P를 과발현하여 분비함으로써 혈관형성 통한 암세포의 이동 (migration) 성장， 전이 (metastasis) 등을 매개한다 (비특허문헌 2). 따라서 정상세포에 비해 이러한 특징을 갖는 암세포는 비대힌- 성장을 하게 되고 다른 기관으로 전이되어， 결국 치료되지 않으면■ 암세포는 온몸으로 퍼져 정상조직을 파괴하게 된다. TM4SF4( transmembrane 4 L six family member 4)는 테트라스파닌 (tetraspanin)이라는 세포막 단백질의 일종으로， L6계열의 막관통 4 대계열 (transmembrane 4 super f ami ly)의 일원이다 (비특허문헌 3). 테트라스파닌 대계열 (tetraspanin super f ami ly)의 세포막 단백질은 암을 포함한 질병에 관련되어 있는 많은 생물학적 시스템에 관여하여， 세포에서 일어나는 다양한 과정 (process)에 광범위한 스펙트럼으로 작용한다는 보고가 있다. 대부분의 연구에 의하면 테트라스파닌 단백질의 발현 정도에 따라 암 발생 마커가 조절되며 적어도 암세포의 악성화되는 과정에 관여한다고 한다 (비특허문헌 4). 막관통 4 L6 대계열에는 L6, L6D, TM4SF4, TM4SF5가 있으며 , 이들은 전체적인 구조는 유사하나, C-말단에 의해 다양성이 구축된다. TM4SF5는 종양형성과 전이에 밀접한 관련이 있고 (비특허문헌 5—6)， TM4SF4는 발생과정에서 쥐 (rat)의 췌장의 분화 및 간세포 재생에 관여한다고 보고되었다 (비특허문헌 7—8). 또한 TM4SF4는 정상세포에서는 그 발현이 상대적으로 낮고 선암 세포 (adenocarcinoma)에서는 발현이 높은 유전자 후보군으로 보고되기도 하였다 (비특허문헌 9). 그러나， TM4SF4의 정확한 기능에 대한 보고는 아직 없을 뿐만 아니.라， 톡히 사람세포 및 암세포를 이용한 TM4SF4의 구체적인 기능에 관한 연구는 보고.된 바가 없다. 이에， 본 발명자들은 암세포에서 TM4SF4의 기능을 알아보기 위해 노력한 결과， TM4SF4의 발현 수준이 비소세포성 폐암의 종류에 따라 차이가 있으며， TM4SF4의 발현수준의 조절에 의해 비소세포성 폐암의 방사선 민감도, 세포의 성장, 전이 및 침윤 능력에 영향을 미치^ 것을 확인하였다. 구체적으로 비소 세포암 중 선암 세포주 (A549, Calu— 3)는 다른 세포주보다 높은 TM4SF4의 발현을 나타냈으며 TM4SF4의 항체 또는 si NA를 이용하여 TM4SF4의 발현 또는 활성을 억제시켰을 때 세포의 암 진행화 능력， 즉 세포의 성장， 전이 및 침윤 능력이 감소 되었을 뿐만 아니라 방사선 저항성도' 감소 되는 것을 보였다. 반면 , 상대적으로 낮은 TM4SF4의 발현을 나타내는 선암을 제외한 비소세포성 폐암의 세포주에서는 TM4SF4의 발현백터를 이용하여 TM4SF4의 발현을 증가시켰을 때 세포의 성장 및 방사선 저항성이 감소되는 것을 보였다. 또한， 본 발명자들은 TM4SF4의 발현 및 활성 조절이 암 세포내의 IGF1R/PI3K— Akt/ΝΚ-κΒ의 활성도 및 醒 P의 발현을 조절함으로써 상기 효과를 나타내는 것임을 확인하였다. 따라서, 본 발명자들은 TM4SF4의 발현을 감소시키는 약학적 조성물은 비소세포성 폐암 중 선암을 예방 및 치료하는데 효과적이고ᅳ . TM4SF4의 발현을 증가시키는 약학적 조성물은 선암을 제외한 비소세포성 폐암을 '예방 및 치료하는데 매우 효과적으로 이용될 수 있을 뿐 아니라 방사선 요법과 함께 사용하였을 때보다 더 효과적으로 이용될 수 있음을 제시하여 본 발명을 완성하였다. [선행기술문헌]
[비특허문헌]
(비특허문헌 1) Fresno Vara: JA. et al .， Cancer Treat Rev. 2004 Apr ;30(2)： 193-204.
(비특허문헌 2) Joyce E. Rundhaug. , Clin Cancer Res 2003;9(2) :551-4.
(비특허문헌 3) Wright MD et al . , Protein Sci 2000； 9(8)： 1594-1600.
(비특허문헌 4) Zevian S et al . , J. Biol. Chem. 2001 ;286(9) :7496-7506.
(비특허문헌 5) Lee SA et al . , J. Clin. Invest . 2008； 118(4)： 1354-66.
(비특허문헌 6) Lee SA et al . , Blood. 2009； 113(8)： 1845-55.
(비특허문헌 7) Liu Z et al.-, Biochim. Biophys. Acta 2001:1518(1- 2) :183-9.
(비특허문헌 8) Anderson K et al . , Development 2011； 138(15) :3213-24.
(비특허문헌 9) Nakamura N et al . , Oncogene 2006 28； 4245-4255.
【발명의 상세한 설명】
【기술적 과제】
본 발명의 목적은 TM4SF4( transmembrane 4 L six family member 4)의 발현 또는 활성 조절제를 이용하여， 비소세포성 폐암 세포의 성장， 전이， 침윤능력을 저하시키고， 방사선에 대한 민감도를 증진시켜 효과적인 비소세포성 폐암을 치료를 위한 항암제 및 항암 보조제를 제공하는 것이다.
【기술적 해결방법】
[본 발명의 개요]
상기 목적을 달성하기 :::위하여， 본 발명은 TM4SF4( transmembrane 4 L six fami ly member 4)의 발현 또는 활성 억제제를 유효성분으로 함유하는 비소세포성 폐암 증 선암 예방 및 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 TM4SF4의 발현 또는 활성 억제제를 유효성분으로 함유하는 비소세포성 폐암 중 선암에 대한 항암 보조제를 제공한다.
또한， 본 발명은 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 유효성분으로 함유하는 선암을 제외한 비소세포성 폐암의 예방 및 치료용 약학적 조성물을 제공한다.
또한， 본 발명은 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 유효성분으로 함유하는 선암을 제외한 비소세포성 폐암에 대한 항암 보조제를 제공한다.
또한, 본 발명은 TM4SF4의 발현 또는 활성 억제제를 유효성분으로 함유하는 비소세포성 폐암 중 선암 세포의 방사선에 대한 민감도 증진용 조성물을 제공한다. 또한， 본 발명은 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 유효성분으로 함유하는 선암을 제외한 비소세포성 폐암 세포의 방사선에 대한 민감도 증진용 조성물을 제공한다.
또한, 본 발명은 TM4SF4의 발현 또는 활성 억제제를 비소세포성 폐암 중 선암 세포에 투여하는 단계를 포함하는 비소세포성 폐암 중 선암 세포의 방사선에 대한 민감도 증진 방법을 제공한다.
또한， 본 발명은 TM4SF4 유전자를 포함하는 백터를 선암을 제외한 비소세포성 폐암 세포에 투여하는 단계를 포함하는 선암을 제외한 비소세포성 폐암 세포의 방사선에 대한 민감도 증진 방법을 제공한다.
또한， 본 발명은 하기의 단계를 포함하는 비소세포성 폐암 중 선암 세포에 대한 항암제 또는 방사선 민감도 증진제 후보물질의 스크리닝 방법을 제공한다:
1) TM4SF4 단백질 발현 세포주에 피검물질을 처리하는 단계 ;
2) 상기 세포주의 TM4SF4 단백질의 발현 또는 활성 정도를 측정하는 단계 ; 및
3) 상기 TM4SF4 단백질의 발현 또는 활성 정도가 피검물질을 처리하지 않은 대조군에 비해 감소하는 피검물질을 선별하는 단계 .
또한， 본 발명은 하기의 단계를 포함하는 선암을 제외한 비소세포성 폐암 세포에 대한 항암제 또는 방사선 민감도 증진제 후보물질의 스크리닝 방법을 제공한다:
1) TM4SF4 단백질 발현 세포주에 피검물질을 처리하는 단계 ; 2) 상기 세포주의 TM4SF4 단백질의 발현 또는 활성 정도를 측정하는 단계 ; 및
3) 상기 TM4SF4 단백질의 발현 또는 활성 정도가 피검물질을 처리하지 않은 대조군에 비해 증가하는 피검물질을 선별하는 단계.
또한, 본 발명은 약학적으로 유효한 양의 TM4SF4의 발현 또는 활성 억제제를 비소세포성 폐암 중 선암에 걸린 개체에 투여하는 단계를 포함하는, 비소세포성 폐암 중 선암의 치료 방법을 제공한다.
또한， 본 발명은 약학적으로 유효한 양의 TM4SF4의 발현 또는 활성 억제제를 개체에 투여하는 단계를 포함하는， 비소세포성 폐암 중 선암의 예방 방법을 제공한다.
또한, 본 발명은 약학적으로 유효한 양의 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 선암을 제외한 비소세포성 폐암에 걸린 개체에 투여하는 단계를 포함하는, 선암을 제외한 비소세포성 폐암의 치료 방법을 제공한다.
또한, 본 발명은 약학적으로 유효한 양의 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 개체에 투여하는 단계를 포함하는 선암을 제외한 비소세포성 폐암의 예방 방법을 제공한다.
또한， 본 발명은 비소세포성 폐암 중 선암 예방 및 치료용 약학적 조성물로 사용하기 위한 TM4SF4의 발현 또는 활성 억제제의 용도를 제공한다.
또한， 본 발명은 비소세포성 폐암 중 선암에 대한 항암 보조제로 사용하기 위한 TM4SF4의 발현 또는 활성 억제제의 용도를 제공한다.
또한， 본 발명은 선암을 제외한 비소세포성 폐암의 예방 및 치료용 약학적 조성물로 사용하기 위한 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터의 용도를 제공한다. .
또한， 본 발명은 선암을 제외한 비소세포성 폐암에 대한 항암 보조제로 사용하기 위한 TM4SF4 단백질을 암호화하는 유'전자를 포함하는 발현백터의 용도를 제공한다.
또한， 본 발명은 비소세포성 폐암 중 선암 세포의 방사선에 대한 민감도 증진제로 사용하기 위한 TM4SF4의 발현 또는 활성 억제제의 용도를 제공한다.
아을러， 본 발명은 선암을 제외한 비소세포성 폐암 세포의 방사선에 대한 민감도 증진제로 사용하기 위한 TM4SF4유전자를 포함하는 백터의 용도를 제공한다. [본 발명의 상세한 설명]
' 이하， 본 발명을 상세히 설명한다. 본 발명은 TM4SF4( transmembrane 4 L six family member 4)의 발현 또는 활성 억제제를 유효성분으로 함유하는 비소세포성 폐암 중 선암 예방 및 치료용 약학적 조성물을 제공한다. ■
상기 TM4SF4 단백질은 서열번호 1로 기재되는 아미노산 서열을 갖지만 이에 한정되지 않으며， 상기 아미노산 서열에서 몇 개의 아미노산이 결실, 추가 또는 치환되는 아미노산 서열， 구체적으로 상기 아미노산 서열에 80%이상， 보다 구체적으로 상기 아미노산 서열에 90%이상의 상동성을 갖는 서열은 모두 사용 가능하다. ᅵ
상기 TM4SF4의 발현을 억제하는 유효성분은 TM4SF4 유전자의 발현을 억제하는， 보다 구체적으로 mRNA에 상보적으로 결합하는 안티센스 유클레오티드 또는 작은 간섭 (small interfering RNA; siRNA)이지만 이에 한정되지 않는다.
상기 TM4SF4 단백질의 발현 억제제는 TM4SF4의 유전자의 전사 (transcript ion)，
■ 전사. 후 (post-transcript ion) 번역 ( translat ion)， 또는 번역 후 (post-translational) 등의 과정을 저해하여 DNA에서 단백질로 되는 과정을 차단함으로써 정상적인 활성을 갖는 TM4SF4 단백질로의 발현을 차단하는 것으로， 보다 구체적으로 TM4SF4 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드 또는 작은 간섭 腿 (small interfering RNA; siRNA)일 수 있으나 이에 한정되지 않는다. 상기 안티센스 뉴클레오티드는 왓슨ᅳ클릭 염기쌍에 정의된 바에 따라， DNA, 미성숙 -mRNA 또는 성숙된 mRNA의 상보적 염기서열에 결합 (흔성화)하여 단백질로의 발현을 억제하는 것이다. 표적 서열에 특이성이 있는 안티센스 뉴클레오티드의 성질은 그것들을 예외적으로 다기능이 되도록 한다. 안티센스 뉴클레오티드는 모노머 (monomer) 단위의 긴 사슬이기 때문에 이들은 표적 RNA 서열에 대해 쉽게 합성될 수 있다. 상기 siRNA는 인간 TM4SF4 단백질을 암호화하는 유전자 (서열번호: 2)의 mRNA의 염기서열 내에서 선택되는 15 내지 30머 (mer), 보다 구체적으로 2()— 25머일 수 있으나 이에 한정되지 않으며， 상기 센스 서열에 상보적으로 결합하는 안티센스 서열로 구성되며， 이때， 상기 센스 서열은 특별히 이에 한정되지 않고， 보다 구체적으로 19개의 염기로 구성될 수 있으나 이에 한정되지 않는다. 최근 많은 연구들은 표적 단백질을 연구하기 위한 생화학적 수단으로 안티센스 뉴클레오티드, 특히 mRNA를 표적으로 하는 siRNA의 유용성을 증명하였다 (Rothenberg et al. , J. Natl. Cancer Inst. , 81:1539—1544， 1999) . 을리고뉴클레오티드 화학 및 향상된 세포흡착, 표적결합 친화도 및 뉴클레아제 내성을 나타내는 뉴클레오티드 합성 분야에서 최근 많은 진보가 있었으므로 안티센스 뉴클레오티드의 사용은 새로운 형태의 억제제로 고려될 수 있다.
상기 TM4SF4의 활성을 억제하는 유효성분은 TM4SF4 단백질의 활성을 저해하는， 보다 구체적으로 TM4SF4 단백질에 상보적으로 결합하는 화합물， 펩티드, 펩티드미메틱스 및 항체로 이루어진 군으로부터 선택될 수 있으나 이에 한정되지 않는다. ；
상기 펩티드 미메틱스 (Peptide Minetics)는 TM4SF4 단백질의 결합 도메인을 억제하는 펩티드 또는 비펩티드로서 TM4SF4 단백질의 활성을 억제하는 것이다. 비가수분해성 펩티드 유사체의 주요 잔기로는 β—턴 디펩티드 코어 (Nagai et al . Tetrahedron Lett 26:647， 1985) , 케토-메틸렌 슈도펩티드류 (Ewenson et al . J Med Chew 29:295， 1986； 및 Ewenson et al . in Peptides: Structure and Funct ion(Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985) , 아제 '핀 (Huffman et al. in Peptides: Chemistry and Biology, G.R. Marshall ed. , ESC0M Publisher: Leiden, - Netherlands, 1988)， 벤조디아제핀 (Freidhiger et al . in Peptides; Chemistry and Biology, G.R. Marshal 1 ed. , ESC0M Publisher: Leiden, Netherlands, 1988)， β -아미노알콜 (Gordon et al . Biochem Biophys Res Co讓 un 126:419 1985) 및 치환 감마 락탐환 (Garvey et al. in Peptides: Chemistry and Biology, G.R. Mar she 11 ed. , ESC0M Publisher: Leiden, Netherlands, 1988)을 사용하여 생성할 수 있다. · 본 발명자들은 역전사 중합효소연쇄반응 (reverse transcription polymerase chain reaction, RT-PCR) 및 웨스턴 블랏팅 (Western blot )을 통하여 비소세포성 폐암 중 선암 세포주 (A549, Cahi— 3)에서 다른 비소세포성 폐암의 세포주보다 TM4SF4의 발현이 높은 것을 보였다. 또한, siRNA를 이용하여 TM4SF4의 발현을 억제하였을 때， 콜로니 형성 분석을 통해 세포의 성장이 감소하는 것을 나타내었다. 또한 트랜스웰 (transwell) 또는 상처회복 (wound healing) 실험을 통하여 TM4SF4의 발현이 억제된 상기 암세포주가 이동 및 침윤 능력이 감소하는 것을 보였다. 또한， TM4SF4의 항체를 처리하여 상기 단백질의 활성을 중화하였을 때， 콜로니 형성 분석을 이용하여 처리한 항ᅳ TM4SF4 항체 농도 의존적으로 세포의 성장이 감소하는 것을 보였다. 또한， TM4SF4를 저발현시켰을 때 상기 세포 내에서 세포의 성장을 야기시키는 IGFlR|3/PI3K-Akt/NK-i B의 활성화가 감소하며, TM4SF4 발현백터를 사용하여 TM4SF4의 과발현시 상기 신호전달체계의 활성화가 증가 되었다. 또한， TM4SF4 저발현시 전이 (metastasis)에 증요한 혈관생성 (aniogenesis)에 필수적인 匪 P(matrix metal loproteinase)-2, 7 및 9의 발현이 감소하고， TM4SF4의 과발현시 腿 P-2, 7 및 9의 발현이 증가하는 것을 보였다. 따라서， TM4SF4의 발현 및 활성을 억제하는 성분을 포함하는 약학적 조성물은 세포내 IGF1RP/PI3K— Akt/ΝΚ-κΒ 및 匪 P의 활성화의 감소를 통해 세포의 성징-, 전이 및 침윤 능력을 감소시킴으로써 비소세포성 폐암 중 선암의 예방 및 치료를 위해 유용하게 사용될 수 있다. 또한， 본 발명은 TM4SF4의 발현 또는 활성 억제제를 유효성분으로 함유하는 비소세포성 폐암 중 선암에 대한 항암 보조제를 제공한다.
상기 항암 보조제는 비소세포성 중 선암세포의 방사선에 대한 민감도를 증진시킬 수 있다.
상기 방사선은 감마 방사선, X선 또는 전자선 모두 이용할 수 있고， 보다 구체적으로는 감마 방사선， 보다 더 구체적으로 60Co Y-선을 이용할 수있지만 이에 한정되지는 않는다.
방사선 선량은 1회 0.2-20Gy, 보다 구체적으로 0.5-10Gy, 보다 더 구체적으로 2Gy를 사용할 수 있으나 이에 한정하지 않는다ᅳ 방사선 선량 조사 속도는 0.02-2Gy/min, 보다 구체적으로 0.05— lGy/niin, 보다 더 구체적으로 0.2Gy/min를 이용할 수 있으나 이에 한정하지 않는다.
본 발명에서는 TM4SF4의 발현 억제기- 방사선에 대한 세포의 민감도에 미치는 영향을 확인하기 위하여， 비소세포성 폐암 중 선암 세포주 (A549)에서 TM4SF4유전자, 보다 구체적으로 TM4SF4의 . mRNA에 대한 상보적 siR A를 이용함으로써 TM4SF4의 발현을 억제하였을 때， 콜로니 형성 분석 (colony formation analysis)을 통하여 방사선， 보다 구체적으로 감마 방사선에 대한 저항력을 확인하였다. 그 결과, 방사선 조사시 TM4SF4를 저발현하는 상기 A549 세포주의 콜로니가 현저하게 증가하는 것을 관찰하였으며， 이는 상기 세포주가 TM4SF4의 저발현시 방사선에 대하여 저항력이 감소하는 것, 즉 방사선에 대한 민감도가 증가하는 것을 가르킨다. 따라서， 암세포의 치료에 있어서 TM4SF4 단백질의 발현 또는 활성을 억제하여 암세포의 방사선에 대한 민감도를 증진시킴으로써 TM4SF4 단백질 발현 또는 활성 0 억제제는 방사선 치료와 함께 항암보조제로써 유용하게 사용될 수 있다. 본 발명의 TM4SF4 단백질의 발현 또는 활성 억제제를 유효성분으로 함유하는 조성물은，조성물 총 중량에 대하여 상기 유효성분을 0.00이내지 50중량 %로 포함할 수 있다.
본 발명의 조성물은 상기 TM4SF4 단백질의 발현 또는 활성 억제제에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 함유할 수 있다.
본 발명의 조성물은， 투여를 위해서 상기 기재한 유효성분 이외에 추가로 약제학적으로 허용 가능한 담체를 1종 이상 포함하여 제조할 수 있다. 약제학적으로 허용 가능한 담체는 식염수， 멸균수， 링거액, 완층 식염수， 텍스트로즈 용액, 말토 텍스트린 용액， 글리세를, 에탄올 리포좀 및 이들 성분 중 1성분 이상을 흔합하여 사용할 수 있으며， ; 필요에 따라 항산화제， 완충액 , 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 회석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약， 캡술， 과립 또는 정제로 제제화할 수 있으며 , 표적 기관에 특이적으로 작용할 수 있도록 표적 기관 특이적 항체 또는 기티- 리간드를 싱-기 담체와 결합시켜 사용할 수 있다. 더 나아가 당해 기술분야의 적정한 방법으로 또는 레밍턴의 문헌 (Remington's Pharmaceutical Science (최근판), Mack Publishing Company , East on PA)에 개시되어 있는 방법을 이용하여 각 질환에 따라 또는 성분쎄 따라 바람직하게 제제화할 수 있다.
본 발명에서 사용되는; :뉴클레오티드 또는 핵산은， 경구, 국소 비경구ᅳ 비 내， 정맥 내， 근육 내, 피하, 안 내， 경피 등의 투여를 목적으로 제조될 수 있다. 바람직하게는， 핵산 또는 백터가 주사가능한 형태로 사용된디-. 이에 따라서 특히 처리될 영역으로는 직접적인 주입을 위하여 주사 가능한 조성물을 위한 임의의 약학적으로 허용되는 매개체와 흔합될 수 있디-. 본 발명의 조성물은 특히 등장 멸균 용액 또는 건조 특히 멸균수 또는 적절한 생리 식염수의 첨가에 따라 주사 가능한 용액의 조성을 가능케 하는 동결건조 조성물을 포함할 수 있다. 환자의 종양으로의 핵산의 직접적인 주입은 치료 효율을 감염된 조직에 집중시키도록 하므로 유리하다. 사용되는 핵산의 투여량은 다양한 파라미터， 특히 유전자， 백터， 사용되는 투여 방식 , 문제시되는 질병 또는 대안적으로 요구되는 치료기간에 의해 조절될 수 있다. 또한， 환자의 체중， 연령， 성별， 건강상태, 식이， 투여시간， 투여방법， 배설률 및 질환의 중증도 등에 따라 그 범위가 다양하다. 일일 투 ' 약 0.001 내지 100mg/kg이고, 바람직하게는 0.01 내지 10mg/kg이며， 하루 1회 내지 수회 나누어 투여하는 것이 바람직하다. 또한， 본 발명은 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 유효성분으로 함유하는 선암을 제외한 비소세포성 폐암의 예방 및 치료용 약학적 조성물을 제공한다.
상기의 TM4SF4 단백질을 암호화하는 유전.자를 포함하는 발현백터는 서열번호 2로 기재되는 유전자 서열을 갖지만 이에 한정되지 않으며， 상기 유전자 서열에서 하나 또는 몇 개의 DNA가 결실， 추가 또는 치환되는 유전자 서열， 구체적으로 상기 유전자 서열에 대해 80% 이상， 보다 구체적으로 상기 유전자 서열에 대해 90%이상의 상동성을 갖는 서열은 포함될 수 있다.
백터는 비바이러스 백터 또는 바이러스 백터를 포함할 수 있다. 비바이러스 백터는 선형 DNA, 플라스미드 DNAᅳ 리포좀을 포함하며 이에 한정되지 않는다. 바이러스 백터는 레트로 바이러스， 아데노 바이러스， 아데노 부속 바이러스 및 허피스바이러스를 포함하며 이에 한정되지 않는다.
본 발명자들은 RT— PCR 및. 웨스턴 블랏팅을 통하여 선암 세포주를 제외한 비소세포성 폐암의 세포주 ((H460, A431, H23, H1299, H2009 및 H358)에서 선암 세포주 (A549, Calu-3)보다 TM4SF4를 적게 발현한다는 것을 보였다. 따라서， 본 발명자들은 상기 선암을 제외한 비소세포성 폐암 세포주에서 콜로니 형성 분석을 통하여 TM4SF4의 발현이 세포 성장에 미치는 영향을 알아보고자， TM4SF4의 발현백터인 pcDNA3.1을 이용하여 TM4SF4가 과발현시켰디-. 그 결과， TM4SF4를 과발현하는 선암을 제외한 비소세포성 폐암 세포주의 성장이 억제되는 것을 '확인하였다. 따라서， 선암을 제외한 비소성세포 폐암에서， TM4SF4의 발현을 증가시키는 성분을 포함하는 약학적 조성물은 세포의 성장 능력을 감소시킴으로써 선암을 제외한 비소세포성 폐암의 예방 및 치료를 위해 유용하게 사용될 수 있다. 또한, 본 발명은 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 유효성분으로 함유하는 선암을 제외한 비소세포성 폐암에 대한 항암 보조제를 제공한다.
상기 항암 보조제는 선암을 제외한 비소세포성 폐암 세포에 대한 방사선 민감도를 증진시킬 수 있다. 사용되는 방사선의 특징, 조사법， 조사량 등은 상기와 동일하다.
상기의 선암을 제외한 비소세포성 폐암은 선암을 제외하며， 보다 구체적으로는 편평상피암 (squamous eel 1 carcinoma) , 대세포암 (large cell carcinoma)을 포함하며， 보다 더 구체적으로는 대세포암을 포함하지만. 이에 한정되지 않는다.
서열번호 2로 기재되는 TM4SF4의 유전자를 발현하는 재조합 발현백터를 유효성분으로 하는 항암 보조제에서， 상기 TM4SF4의 유전자를 발현하는 재조합 발현백터의 함유량은 전체 항암 보조제의 조성물에. 대하여 고형분 기준으로 0.01 내지 50% 중량일 수 있으나 이에 한정하지 않는다. 상기 항암 보조제는 상기 TM4SF4를 발현하는 재조합 발현백터 이외에도 정제수， 부형제, 안정제 또는 보존제와 같은 첨가제를 포함할 수 있다.
본 발명의 상기 TM4SF4의 유전자를 발현하는 재조합 발현백터를 함유하는 항암보조제 정제, 캡슬 (capsules), 수액제， 과립제， 또는 환제 등의 여러 가지 제형으로 제조되어， 경구용， 주사용， 국소용, 또는 도포용 등으로 사용될 수 있다. 또한, 본 발명은 TM4SF4의 발현 또는 활성 억제제를 유효성분으로 함유하는 비소세포성 폐암 중 선암 세포의 방사선에 대한 민감도 증진용 조성물을 제공한다. 또한， 본 발명은 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 유효성분으로 함유하는 선암을 제외한 비소세포성 폐암 세포의 방사선에 대한 민감도 증진용 조성물을 제공한다.
또한， 본 발명은 TM4SF4의 발현 또는 활성 억제제를 비소세포성 폐암 중 선암 세포에 투여하는 단계를 포함하는 비소세포성 폐암 중 선암 세포의 방사선에 대한 민감도 증진 방법을 제공한다.
또한， 본 발명은 TM4SF4 유전자를. 포함하는 발현백터를 선암을 제외한 비소세포성 폐암 세포에 투여하는 단계를 포함하는 선암을 제외한 비소세포성 폐암 세포의 방사선에 대한 민감도 증진 방법을 제공한다.
상기 방사선은 감마 방사선, X선 또는 전자선 모두 이용할 수 있고， 보다 구체적으로는 감마 방사선， 보다 더 구체적으로 60Co γ—선을 이용할 수있지만 이에 한정되지는 않는다,
방사선 선량은 1회 0.2— 20Gy, 보다 구체적으로 0.5-10Gy, 보다 더 구체적으로 2Gy를 사용할 수 있으나 이에 한정하지 않는다. 방사선 선량 조사 속도는 0.02-2Gy/min, 보다 구체적으로 0.05— lGy/min, 보다 더 구체적으로 0.2Gy/min를 이용할 수 있으나 이에 한정하지 않는다. 또한， 본 발명은
1) TM4SF4 단백질 발현 세포주에 피검물질을 처리하는 단계; 및
2) 상기 세포주의 TM4SF4 단백질의 발현 또는 활성을 조절하는 물질을 선별하여 비소세포성 폐암에 대한 항암제 또는 항암 보조제를 스크리닝하는 방법을 제공한다. 구체적으로， 본 발명은
1) TM4SF4 단백질 발현 세포주에 피검물질을 처리하는 단계;
2) 상기 세포주의 TM4SF4 단백질의 발현 또는 활성 정도를 측정하는 단계 ; 및
3) 상기 TM4SF4 단백질의 발현 또는 활성 정도가 피검물질을 처리하지 않은 대조군에 비해 감소하는 피검물질을 선별하는 단계로 구성된 비소세포성 폐암 중 선암 세포에 대한 항암제 또는 방사선 민감도 증진제 후보물질의 스크리닝 방법을 제공한다. 또한， 구체적으로， 본 발명은
1) TM4SF4 단백질 발현 세포주에 피검물질을 처리하는 단계;
2) 상기 세포주의 TM4SF4 단백질의 발현 또는 활성 정도를 측정하는 단계 ; 및
3) 상기 TM4SF4 단백질의 발현 또는 활성 정도가 피검물질을 처리하지 않은 대조군에 비해 증가하는 피검물질을 선별하는 단계로 구성된 선암을 제외한 비소세포성 폐암 세포에 대한 항암제 또는 방사선 민감도 증진제 후보물질의 스크리닝 방법을 제공한다.
상기 2가지 스크리닝 방법에 있어서，단계 1)의 TM4SF4단백질은 서열번호 1로 기재되는 아미노산 서열을 가질 수 있으나 이에 한정되지 않는다.
상기 2가지 스크리닝 방법에 있어서， 단계 2)의 단백질의 발현 정도는 당업자에게 알려진 전사체 또는 그로부터 코딩된 단백질의 양을 측정하는 모든 방법을 사용할 수 있고，； 보다 구체적으로 면역침강법 (immunoprecipitation 방사능면역분석법 (RIA)， 효소면역분석법 (ELISA)， 면역조직화학법 (immunohistochemistry), RT—PCR, 웨스턴 블랏팅 (Western blotting) 및 유세포 분석법 (FACS)으로 이루어진 군으로부터 선택된 어느 하나로 측정될 수 있으나 이에 한정하지 않는다. 또한， 단계 2)의 단백질의 활성 정도는 SDS-PAGE, 면역형광법， 효소면역분석법 (ELISA), 질량분석 및 단백질 칩으로 이루어진 군으로부터 선택된 어느 하나로 측정될 수 있으나 이에 한정하지 않는다.
상기 2가지 스크리닝 방법에 있어서, 단계 3)의 방사선은 감마 방사선， X선 또는 전자선 모두 가능하고， 보다 구체적으로 감마 방사선일 수 있으나 이에 한정되지 않는다.
본 발명에서는 비소세포성 폐암 중에서도 선암과 그 외의 비소세포성 폐암에서 각각 TM4SF4의 발현 조절에 따라 세포의 성장， 전이 및 침윤, 및 방사선 민감도가 변하는 것을 관찰하였으며, 비소세포성 폐암 중 선암과 그 외의 비소세포성 폐암에서 서로 상반적인 작용이 나타남을 확인하였다. 보다 구체적으로 상기 선암에서는 TM4SF4 발현의 감소할 때 세포의 성장' 전이 및 침윤， 방사선 저항성이 감소하였으며， 선암을 제외한 비소세포성 폐암에서는 TM4SF4 발현이 증가할때 세포의 성장 및 방사선 저항성이 감소하는 효과를 보였다. 따라서 TM4SF4의 발현에 영향을 주는 피검물질을 선별하여 비소세포성 폐암의 선암 또는 선암을 제외한 비소 ：세포성 폐암에 대한 항암제 또는 방사선 증진 효과가 있는 항암 보조제를 선별할 수 있디-. 또한, 본 발명은 약학적으로 유효한 양의 TM4SF4의 발현 또는 활성 억제제를 비소세포성 폐암 중 선암에 걸린 개체에 투여하는 단계를 포함하는， 비소세포성 폐암 중 선암의 치료 방법을 제공한디-.
또한， 본 발명은 약학적으로 유효한 양의 TM4SF4의 발현 또는 활성 억제제를 개체에 투여하는 단계를 포함하는， 비소세포성 폐암 중 선암의 예방 방법을 제공한다.
또한， 본 발명은 학적으로 유효한 양의 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 선암을 제외한 비소세포성 폐암에 걸린 개체에 투여하는 단계를 포함하는， 선암을 제외한 비소세포성 폐암의 치료 방법 ¾ 제공한다.
또한 본 발명은 약학적으로 유효한 양의 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 개체에 투여하는 단계를 포함하는， 선암을 제외한 비소세포성 폐암의 예방 방법을 제공한디-. 또한， 본 발명은 비소세포성 폐암 중 선암 예방 및 치료용 약학적 조성물로 사용하기 위한 TM4SF4의 발현 또는 활성 억제제의 용도를 제공한다.
또한， 본 발명은 비소세포성 폐암 중 선암에 대한 항암 보조제로 사용하기 위한 TM4SF4의 발현 또는 활성 억제제의 용도를 제공한다.
또한， 본 발명은 선암을 제외한 비소세포성 폐암의 예방 및 치료용 약학적 조성물로 사용하기 위한 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터의 용도를 제공한다.
또한， 본 발명은 선암을 제외한 비소세포성 폐암에 대한 항암 보조제로 사용하기 위한 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터의 용도를 제공한다.
또한， 본 발명은 비소세포성 폐암 중 선암 세포의 방사선에 대한 민감도 증진제로 사용하기 위한 TM4SF4의 발현 또는 활성 억제제의 용도를 제공한다.
아울러， 본 발명은 선암을 제외한 비소세포성 폐암 세포의 방사선에 대한 민감도 증진제로 사용하기 위한 TM4SF4 유전자를 포함하는 백터의 용도를 제공한다.
【유리한 효과】
본 발명은 비소세포성 폐임- 세포주에서 TM4SF4( transmembrane 4 L six family member 4)의 발현 및 활성을 조절하여 암세포의 성장， 이동 및 침윤， 및 방사선 저항성의 감소하는 것을 보였다. 더 구체적으로 비소세포성 폐암 중 선암 세포주에서 TM4SF4 발현 또는 활성을 억제하였을 때， 암세포의 성장， 전이， 및 침윤능력이 감소하고 방사선에 대한 민감도가 현저하게 증가하는 것을 나타내었고， 이와는 반대로 선암을 제외한 다른 비소세포성 폐암의 세포주에서는 TM4SF4의 발현을 증가시켰을 때 세포의 성장 및 방사능 저항성의 감소효과를 나타내었다， 따라서， TM4SF4의 발현 또는 활성을 조절하는 약학적 조성물은 암 예방 및 치료를 위해 유용하게 사용될 수 있다.
【도면의 간단한 설명】
도 1은 여러가지 폐암세포주에서 형질도입을 통해 TM4SF4의 과발현시키기 위해 발현백터인 TM4SF4/pcDNA3.1을 클로닝하는 과정을 나타낸 모식도이다. 도 2는 다양한 종류의 폐암세포주인
A549/H460/A431/H23/H1299/H2009/H358/Calu-3에서 역전사중합효소 반웅 및 웨스턴 블랏팅 (western blotting; WB)을 이용하여 TM4SF4(transiiieinbrane 4 L six family member 4) 발현량을 나타낸 그림이다.
도 3 ~ 5는 비소세포성 세포주 중 대세포암종 (large cell carcinoma)인 H1299 또는 H460세포에 TM4SF4유전자를 과발현시켰을 때 세포의 성장 (도 3) 및 방사선민감성 (도 4)을 알아보기 위해 콜로니 형성 분석 (colony formation analysis)의 결과를 나타낸 그림이다. 또한， 도 5는 H460 세포에서 TM4SF4의 저발현시켰을 때 세포의 성장 및 방사선민감성을 알아보기 위해 콜로니 형성 분석의 결과를 나타낸 그림이다.
도 6은 A549 폐암세포주 중 선암 세포주인 A549세포에서 TM4SF4를 저발현시켰을 때 세포의 성장 및 방사선 민감성을 알아보기 위해 콜로니 형성 분석의 결과를 나타낸 그림이다.
도 7은 TM4SF4가 억제된 A549세포와 대조군 A549세포에서 세포 증식과 저항성에 관련된 세포내 신호 (IGF1R/PI3K/Akt/NF-KB, EGFR, ERK)의 인산화를 웨스턴 블랏팅 (western blotting)을 통해 확인한 결과를 나타낸 그림이다.
도 8은 TM4SF4가 억제된 A549세포와 대조군 A549세포의 이동성 차이를 시간별로 wound healing 방법을 통해 관찰한 결과를 나타낸 그림이다.
도 9는 TM4SF4가 억제된 A549세포와 대조군 A549 세포의 이동성과 침윤 정도를 비교한 실험의 결과를 나타낸 그림이다.
도 10은 A549세포에서 TM4SF4를 저발현시 醒 P— 2，7，9의 상관관계를 알아보기 위해 웨스턴 블랏팅 결과를 나타낸 그림이다ᅳ
도 11은 A549세포에서 TM4SF4를 과발현시 세포성장 및 방사선 저항성을 알아보기 위해 콜로니 형성 분석을 나타낸 그림이다.
도 12는 A549세포에서 TM4SF4를 과발현시 세포 증식과 저항성에 관련된 마커들을 비교해보기 위해 IGF1R, PI3K/PTEN/Akt, NF-κΒ, ERK, EGFR의 웨스턴 블랏팅 결과를 나타낸 그림이다ᅳ
도 13은 A549세포에서 TM4SF4를 과발현시 세포의 이동성 차이를 알아보기 위해 상처치유 (wound healing) 방법을 통해 관찰한 결과를 나타낸 그림이다.
도 14는 A549세포에서 TM4SF4를 과발현시 세포의 이동성과 침윤 정도를 알아보기 위해 H&E(hematoxylin&eosin) 염색의 결과를 나타낸 그림이다. 도 15는 A549세포에서 TM4SF4를 과발현시 MMP-2,7,9의 상관관계를 알아보기 위해 웨스턴 블랏팅 결과를 나타낸 그림이다.
도 16은 A549세포에서 TM4SF4를 과발현시 TM4SF4 항체를 농도에 따른 세포 증식을 알아보기 위한 콜로니 형성 결과를 나타낸 그림이디-.
【발명의 실시를 위한 최선의 형태】
이하,본 발명을 하기：:실시예에 의해 상세히 설명한다 . 단，하기 살시예는 본 발명을 예시하는 것일 뿐 본 발명의 내용을 한정하지 않는다. <실시예 1> 형질도입 (transfection)을 위한 TM4SF4 발현백터의 제작
인간의 TM4SF4 유전자의 발현 백터를 만들기 위하여， 정방향 및 역방향 프라이머 (primer) [EcoRI/정방향: 5'-CCACGMTTCATGTGCACTGGGGGC— 3' (서열번호 3)， Xhol/역방향: 5'-TCCTCGAGTAMCG( TCCATCTC(X-3' (서열번호' 4)]을 사용하여 TM4SF4가 높게 발현된 A549 세포의 유전체 DNA(genomic DNA)로부터 써말 사이클러 (Thermal cycler) (APOLLO, San Diego, USA)를 이용한 연쇄중합반웅 (PCR)에 의해 626bp 크기의 TM4SF4* 얻었다. 상기 PCR은 유전체 DNA 1μ§, 10pm이의 프라이머를 각각 Ιμΐ, 맥심 PCR 프리믹스 (Maxim™ PCR PreMix, i-Taq) (iNtRON biotechnology, Sungnam, Korea)의 조건으로 반웅시켰다. PCR 사이클 (cycle)의 조건은 94°C에서 1분 (변성; denaturation), 58.9°C에서 30초 (어닐링; annealing), 72°C에서 1분 (신장; elongation)이며, 이를 30회 반복하였고， 신장후 (post-elongation) 72°C에서 5분 동안 유지하였다.
발현백터인 pcDNA3.1(+)백터를 동일한 제한효소인 EcoRI 및 Xhol(invotrogen) 각각 Ιμΐ씩과 완충액 (buffer)를 흔합하여 37°C에서 2시간 이상 반웅시켰다. 상기 발현백터， 상기의 PCR로 얻어진 TM4SF4 DNA, T4 리가아제 (ligase) 및 T4 완층액 (buffer)을 흔합하여 16°C에서 2시간 이상 반응시켰다. 상기 발현백터 제작에 대한 모식도를 도 1에 나타내었디-. DH5a (iNtRON biotechnology, Sungnam, Korea) E. coli 숙주와 제작된 상기 발현백터를 흔합하여 4°C에 30분 방치한 후 42°C에서 90초 동안 열충격을 가하고， S0C배지에 접종하여 37°C 흔들배양기에서 1시간 배양 후, 항생제 마커로서 암피실린 (ampicillin)이 포함된 LB 고체배지에 도말하여 37°C 배양기에 16시간 배양하여 얻어진 콜로니에 DNA가 삽입되었음을 EcoRI 및 Xhol(invotrogen) 제한효소 처리와 시퀀싱을 통해 확인하였다. 암피실린이 첨가된 LB 액체배지 (broth)에 시뭔스가 100% 일치하는 콜로니를 하룻밤 동안 배양한 후， DNA-스핀 (spin) 플라스미드 DNA추출 키트 (Plasmid DNA Extraction kit) (iNtRON biotechnology, Sungnam , Korea)를 사용하여 플라스미드 (plasmid) DNA 추출하였다. A549, H460, A431, H23, H1299, H2009, H358및 Calu-3세포를 6웰 (well) 플레이트에 4xl05세포 /웰 (eel ls/well) 넣어주고 효과적인 형질도입을 위해 옵티— MEM(opti-MEM)으로 배지를 바꾸어준다. 상기 추출한 TM4SF4/pcDNA3.1 DNA 4yg과 리포펙타민 2000(lipofectamine 2000， invitrogen) ΙΟμΙ를 20분 동안 흔합한 후， 상기 세포에 넣어주고， 5시간 후 다시 RPMI1640으로 배지를 바꾸어 주어 일시적 형질도입을 시킨 세포들이 성장할 수 있도록 한디-. 그 후 실험은 72시간 후에 수행하였다. RT-PCR이용하여 TM4SF4 발현백터에 의해 세포에서 TM4SF4의 발현 잘 되는 것을 확인하였다.
<실시예 2>역전사중합효소발웅 (RT-PCR)및 웨스턴 블랏팅 (Western blotting)을 통한 선암 세포주인 A549 및 Calu-3에서 TM4SF4의 과발현 확인
선암 세포주를 포함한 다양한 폐암세포주에서 TM4SF4의 발현량을 조사하기 위해 역전사중합효소반웅 (RT— PCR) 및 웨스턴 블랏팅을 수행하여 각각 TM4SF4의 mRNA 및 단백질의 양을 알아보았다.
RT-PCR은 맥심 RT 프리 믹스—올리고 (dT) 15 프라이머 (Maxim™ RT Pr eM i x-01 i go ( dT ) 15Pr i mer ) (iNtRON biotechnology, Sungnam , Korea)에 전체 RNA ig을 포함하여 총량 20μ1로 반웅 흔합액을 만든 뒤 45Τ：에서 60분， 95°C에서 5분 반웅시켜 RT— PCR 산물인 cDNA를 합성하였디-. 합성된 cDNA를 주형으로 TM4SF4 프라이메정방향: 5'— CCACGAATTCATGTGCACTGGGGGC— 3(서열번호 3)'， 역방향: 5'-TCCTCGAGTTAAACGGGTCCATdTCCC-3' (서열번호 4)] 또는 β-액틴 (act in) 프라이메정방향: 5'— CATCCTCACCCTGAAGTACCC— 3' (서열번호 5)， 역방향: 5'— AGCCTGGATAGCMCGTACATG— 3' (서열번호 6)]를 각각 Ιμ ΐ, 멸균수 16μ1로 총량을 20μ1로 만들어 맥심 PCR프리믹스 (MaximTMPCRPreMix, i-Taq) ( iNtRON biotechnology , Sungnam, Korea)로 반웅시켰다. PCR은 써말 사이클러 (Thermal cycler) (APOLLO, San Diego, USA)를 사용하였으며， 94°C에서 1분 (변성), 58.9°C에서 30초 (어닐링)， 72°C에서 1분 (신장)의 조건으로 30회 반복하고, 72 °C에서 5분동안 유지시켰다 (신장 후). PCR 산물은 1% 아가로오즈 젤 (agarose gel) 상에서 EtBr(ethidi菌 bromide) 염색법을 이용한 전기영동을 통하여 나타난 변화 양상을 관찰하였다. 10% 우태아혈청 (fetal bovine serum; FBS, Hyclone) 및 항생제 (lOOU/ml penicillin 및 lOOjjg/ml streptomycin, Hyclone)를 포함한 RPMI 1640 배지를 사용하여 37t , 5% C02에서 세포를 배양하였다. lxlO7의 A549, H460, A431, H23, Calu-3, H1299ᅳ H2009및 H358세포를 수득하여 PBS로 2회 씻어준 후 단백질분해효소 억제제 칵테일 (protease inhibitor cocktail； 2mM AEBSF, ImM EDTA, 130 μ M best at in, lyM leupeptin, 14 μΜ E-64, 0.3yM aprotinin) 및 포스파타제 억제제 (phosphatase inhibitor)를 포함한 RIPA 완충액 (buffer )으로 부유한 세포를 얼음에 20분 동안 방치한 뒤， 빠르게 볼텍싱 (vortexing)하는 과정을 3회 반복하였다. 그 후ᅳ 12000rpm, 4°C에서 20분 동안 원심분리하고, 상층액을 수거한 뒤， 다시 12000rpm, 4°C에서 20분 동안 원삼분리하여 깨끗한 상층액만을 수거하였다. 로우리 방법 (Lowry method)을 이용하여 상층액에 있는 단백질을 정량한 뒤， 40yg의 세포 총 용리액 (whole cell lysate)를 7.5~12%아크릴아마이드 젤 (acrylamide gel， Bi으 rad, Japan)를 이용하여 80V에서 1시간 및 100V에서 90분 동안 전기영동을 하였다. 100% 메탄올에 10초간 미리 적신 후 증류수로 충분히 수화시킨 PVDF 멤브레인 (polyvinyl edene f loride membrane) (Bio-Rad, USA)에 세미-드라이 트랜스퍼 (semi-dry transfer) (Bio-Rad, USA)를 이용하여 20V에서 1시간 동안 상기 전기영동으로 분리한 단백질을 옮겼다. 블럭킹 (blocking) 용액 (5% BSA, 0.1% Tween-20/TBS)를 이용하여 상온에서 1시간 반웅시켜 비특이적인 결합을 배제시킨 후, 1차 항체， 항— TM4SF4 항체 (abeam, #abl02946) 및 항 -β -액틴 (act in) 항체 (Sigma-aldrich, #A3854)를 4 °C에서 하룻밤 동안 결합시켰다. 그 후， 2차 항체인 페록시다아제 (peroxidase)가 결합되어 있는 항 -IgG 항체 (Cel 1-signaling, #7076및 #7074)를 상온에서 1시간 동안 반응시켰다. ECL탐지 키트 (detect ion ki t， Amersham, UK)를 이용하여 발색양상을 확인하여 TMSF4의 발현 양상의 결과를 도 1에 나타내었다. β-액틴은 로딩대조군 (loading control)로서 같이 수행하였으며 동일한 양의 β-액틴은 동일한 단백질 양이 로딩 (loading)되었다는 것을 의미한다. 그 결과， RT-PCR 및 웨스텃블랏팅 모두에서 선암 세포주인 A549 및 Calu-3는 mRNA 및 단백질 수준에서 모두 TM4SF4의 높은 발현량을 나타낸 반면, 다른 폐암 세포주 (H46(), A431, H23, H1299, H2009및 H358)는 TM4SF4 mRNA및 TM4SF4단백질 모두 상대적으로 저발현을 나타낸다 (도 2).
<실시예 3> 폐암세포 중 대세포암종 (large cell carcinoma)세포주인 H1299 및 H460세포에서 콜로니 형성분석 (colony formation assay)을 통한 TM4SF4의 과발현에 따른 세포 성장 및 방사선 저항성의 감소 확인
실시예 2의 결과에 따르면, 같은 폐암세포주임에도 불구하고 선암 세포주와 비선암 세포주는 TM4SF4의 다른 발현양상을 나타내었다. 따라서， TM4SF4의 기능을 조사하기 위해， 폐암 세포 중 대세포암종 (large cell carcinoma)인 H1299 및 H460 세포에서 TM4SF4의 발현량이 암세포의 특징인 세포성장 및 방사선 저항성에 어떠한 연관성을 갖는지 조사하기 위해 본 실험을 수행하였디-. 보다 구체적으로, siRNA 기술을 통하여 각 세포에서 TM4SF4를 저발현 시켰을 경우 및 실시예 1을 통해 만든 발현백터인 TM4SF4/pcDNA3.1의 형질도입 (transf ect ion)을 통하여 TM4SF4를 과발현시켰을 경우에 대세포암종에서 세포성장 및 방사선 민감도가 어떻게 변하는지 콜로니 형성 분석을 통해 관찰하였으며， 콜로니의 수를 세어 대조군에 대한 퍼센트 비율로 콜로니 생존를 (¾)을 표시하였다.
<3-1> H1299 및 H460 세포에서 TM4SF4의 과발현시 세포 성장의 억제 확인 H1299및 H460세포의 2xl03개를 35-薩 i세포배양용기에 배양하고, 상기 실시예
1에서 얻은 발현백터인 ： TM4SF4/pcDNA3.1의 4yg와 함께 리포펙타민 2000을 이용하여 실시예 1에 기재된 것과 같이 일시적 형질도입을 하였다. 8일 경과한 후， 0.5%(w/v) 크리스탈 바이을렛 용액으로 살아있는 세포를 염색하고 관찰하였다. 대조군은 공백터를 이용하여 함께 실험을 수행하였다.
그 결과， 대세포암종 세포주인 H1299 및 H260 세포에서 TM4SF4이 과발현시
H1299 및 H460의 콜로니의 수는 대조군에 비하여 유의적으로 감소하였으며 (도 3)， 즉 14SF4의 과발현으로 인해 세포 성정이 억제되었디-.
<3-2>H460세포에서 T14SF4의 과발현시 세포 성장의 감소 및 방사선 민감도의 증가 확인
H460 세포에서 TM4SF4를 과발현시키기 위해 상기 실시예 3-1과 동일하게 수행하였다. 방사선 민감성을 조사하기 위하여 , TM4SF4의 과발현은 상기 실시예 3-1과 동일하게 수행하고 72시간 후에 세포를 수득하여 분석하여 방사선조사를 실시하였다. 방사선 조사는 60Co 선을 이용하여 1회 2Gy 선량을 0.2Gy/niin으로 실시하였다. 세포를 8일 동안 5% C02 ) 36°C에서 배양한 후， 0.5 % (w/v) 크리스탈 바이올렛 용액으로 살아있는 세포를 염색하고 관찰하였디-ᅳ 그 결과， 상기 실시예 3-1에서와 같이 H460 세포에서 TM4SF4의 과발현시 세포성장이 억제되는 것을 확인하였다 (도 4， 위). 또한， H460 세포에서 TM4SF4의 과발현시 2Gy 60Co 선을 조사하였을 때 대조군에 비해 콜로니의 수가 현저히 감소하는 것을 보였다 (도 4， 아래). 따라서, Η460 세포에서 TM4SF4 과발현시 세포 성장이 억제되었을 뿐만 아니라, 방사선에 대한 민감도가 증진， 즉 방사선 저항성이 감소되었다.
<3-3>Η460세포에서 TM4SF4의 저발현시 세포 성장의 증가 및 방사선 민감도의 감소 확인
TM4SF4의 저발현을 위하여 TM4SF4 유전자 발현을 억제하는 TM4SF4-siRNA 이중 올리고리보뉴클레오티드 프라이머 (duplex oligoribonucleotides primer)를 5 ' -gccucucaaugugguucccLiggaau-3 '(서열번호 7： 센스) /5'-auuccagggaaccacauugagaggc-3' (서열번호 8: 안티센스)으로 제작하여 TM4SF4 유전자의 일부 (서열번호 9)를 표적으로 하여 유전자 발현을 억제시키도록 하였다. 실시예 1에 기재된 것과 동일한 방법으로 리포펙타민™ RNAi MAX reagent (invitrogen)를 사용하여 Stealth™ RNA 표적 (target ing) TM4SF4(invitrogen)를 세포에 일시적으로ᅵ 형질도입하였다. 그리고 72시간 후에 세포를 수득하여 분석하여 방사선조사를 실시하였디-. 방사선 조사 및 그에 따른 세포 콜로니 형성 분석은 상기 실시예 3— 2에 기재된 것과 동일하게 수행되었다. 대조군은 리포펙타민 TM RNAi MAX reagent ( invitrogen)만 주입하여 수행되었다.
그 결과， 상기 H460 세포에서 TM4SF4가 저발현 되었을 경우 대조군과 비교하였을 때 배양된 콜로니의 수가 증가하였다 (도 5, 위). 또한， 방사선 2Gy 60Co 선을 조사하였을 경우 그 배양된 콜로니의 수가 증가함을 보였다 (도 5, 아래). 즉， 상기 세포에서는 TM4SF4가 저발현 되었을 때 , 세포성장이 촉진될 뿐만 아니라 방사선에 대한 저항성이 증가， 즉 방사선의 민감도가 감소되었다.
<실시예 4> 폐암세포 중 선암 세포주인 A549애서 콜로니 형성분석을 통한 TM4SF4의 저발현에 따른 세포 성장 및 방사선 저항성 증가 확인
다른 폐암세포주에 비해 TM4SF4의 발현이 낮았던 선암 세포주 A549에서는 TM4SF4의 발현에 따라 세포의 성장 및 방사선 민감도가 어떻게 변하는지 알아보기 위해 본 실험올 수행하였다. A549 세포에서 TM4SF4의 저발현을 위해 TM4SF4의 siRNA를 이용하는 방법， 세포의 성장 및 방사선 민감도를 측정하기 위한 콜로니 형성 분석 및 그 결과를 생존를 (%)로 기재하는 방법은 실시예 3— 3에서 기재된 것과 동일하게 수행되었다. 그 결과， 비소세포성 폐임 · 중 대세포암종에서 나타난 결과와 다르게 선암 세포주인 A549에서는 TM4SF4가 저발현돨 경우에 배양된 콜로니 및 방사선 조사 후 배양된 콜로니 모두 감소되었다 (도 6). 이것은 선암 세포주에서 TM4SF4를 과발현하고 있는 A549에서 그 발현을 억제시켰을 띠ᅵ， 세포의 성장이 억제될 뿐만 아니라 방사선 저항성이 감소， 즉 방사선 민감도가 증가하는 것을 나타낸다. <실시예 5> 폐암 세포 중 선암 세포주인 A549 세포에서 TM4SF4 저발현시 웨스턴 블랏팅 (Western blotting)을 통한 세포내 신호경로 활성도의 감소확인 '
TM4SF4의 저발현은 선암 세포주인 A549에서 세포의 성장을 감소시키고 방사선 민감도를 증가시킨 결과에 따라, 세포의 성장을 매개하는 세포내 신호 경로의 활성화는 TM4SF4의 발현에 의해 어떠한 영향을 받는지 알아보고자 본 실험을 수행하였다. 세포내 신호는 일련의 여러 단백질이 순차적으로 연결되어 있으며 이들의 활성화는 일반적으로 세린 (serine), 트레오닌 (threonine) 및 티로신 (tyrosine) 잔기의 인산화 (phosphorylat ion)에 의해 매개된다. 따라서 인산화의 정도는 활성화된 정도를 의미하므로 본 실험에서는 TM4SF4가 과발현될 때 및 저발현될 때 웨스턴 브랏팅을 이용하여 세포내 여러가지 신호경로를 매개하는 단백질의 인산화 정도를 측정하였디-.
실시예 3— 3에서 기술된 것과 같이 siRNA를 이용하여 TM4SF4를 저발현시킨 후 일반세포에 비해 암세포에서 과발현 또는 힝―시 발현되고 있는 몇 가지 세포내 신호전달의 활성도를 살펴보았다. DNA의 합성, 세포의 증식 (priliferation)을 초래하고 세포의 전이 (migration), 부착 (adhesion)과 같은 세포의 표현형 (phenotype)을 조절한다고 알려진 . EGFR( epidermal growth factor receptor) , 항 -세포자멸사 (anti-apoptotic) 특성을 갖으며 세포의 생존 (survival )， 증식 (proliferation), 및 이동 (migration)에 영향을 미치고， 항암 화학요법 및 방사선요법에 대한 민감성 증진을 담당한다고 알려진 IGFlRPCinsulin— like growth factor 1 receptor β) 및 이들의 세포내 신호체계를 이루는 PI3 (phosphat idyl inositol 3 kinase) 경로 (예를 들면 PTEN, Akt 포함) 뿐만 아니라 전사인자 Μ-κΒ 및 ERK의 인산화를 알아보았다. 긱- 신호경로에 대한 인산화는 실시예 2에서 기술된 것과 동일하게 웨스턴 블랏팅을 수행하여 나타내었다. TM4SF4의 과발현 또는 저발현시 , 아무 자극이 없을 때， 각 세포에서 나타나는 EGFR, IGFIRP , PI3K, Ν -κΒ 또는 ERK의 인산화의 결과를 각각의 항체 (Cell signaling, USA)를 이용하여 웨스턴 블랏팅에 의해 도 5에 나타내었디-.
그 결과， 세포의 성장 및 방사선 민감성에 중요한 신호경로를 매개하는 EGFR
IGFIRP 및 PI3K의 활성화가 TM4SF4의 저발현시 감소하는 것을 확인할 수 있었다 (도 7). 상기 결과와 일관성있게， PI3K의 탈인산화를 담당하는 PTEN은 TM4SF4의 저발현시 활성화되는 것을 확인하였다 (도 .7). 그러나 ERK의 활성화는 TM4SF4의 발현량에 크게 영향을 받지 않는 것으로 보여졌디- (도 7). 즉， TM4SF4의 저발현은 EGFR, IGF1R 및 PI3K의 인산화를 억제시킴으로써 세포의 성장 등 세포내 상기 신호 전달 경로 활성화와 관련된 세포의 이벤트 (cellular event)를 조절한다.
<실시예 6>폐암 세포주 중 선암 세포주인 A549에서 상처회복 (wound healing)를 통한 TM4SF4의 저발현에 따른 세포 이동성의 감소 확인
TM4SF4의 발현이 세포의 성장 뿐만 아니라 세포의 이동능력에는 어떠한 영향을 미치는지 알아보고자 본 실험을 수행하였다. .
실시예 3— 3에서 기재된 것과 같이 A549 세포에 siRNA를 이용하여 TM4SF4의 저발현을 유도한다. 72시간 후에 A549 세포를 35—國 배양용기 옮겨 포화도 (confluency) 90% 이상 될 때까지 배양한 후, PBS로 층분히 씻어내고 0.5%의 FBS를 포함한 RPMI 1640배지로 배양액을 바꾸어 주어 하룻밤 동안 5% C02 , 37°C에서 배양하여 기아상태 (starvation)가 되도록 하였다. 용기바닥에 200μ1 팁을 이용하여 세포를 긁은 선을 그은 후 PBS로 다시 천천히 씻어내고 다시 세포배양액을 채워서 배양하면서， 그 세포 사이의 간격을 0시간， 24시간 후, 36시간 후에 관찰하였다. 상기 세포 사이의 간격을 대조군에 대한 퍼센트 비율 (%)로 표시하였다.
그 결과, 36시간까지 이동성이 증가된 대조군에 비해 TM4SF4의 발현이 억제된 Α549 세포는 24시간까지는 대조군과 비슷한 양상을 보이는 듯 했으나， 시간이 지남에 따라 그 이동성은 현저히 줄어들었다 (도 8). 따라서， 본 결과를 통해 선암 세포주인 Α549에서 TM4SF4의 발현이 세포의 지속적인 이동에 중요한 역할을 한다.
<실시예 7> 폐암 세포 중 선암 세포주 Α549에서 TM4SF4의 저발현시 트랜스웰 (transwell)을 통한 세포 이동성 및 침윤성의 감소 확인
실시예 6에서 보여진 결과를 S대로 본 실험에서는 트랜스웰을 사용하여 TM4SF4의 발현에 따른 세포의 이동성 변화를 관찰하였다. 뿐만 아니라 본 트랜스웰을 사용하여 세포의 침윤능력에도 TM4SF4의 발현에 따른 변화가 있는지 알아보았다. 세포의 이동능력 및 침윤능력은 암세포의 전이 (metastasis)에 필요한 필수적인 세포의 특성으로 본 실험은 단순히 세포의 이동성 뿐만 아니라 TM4SF4의 발현이 암세포의 전이에 어떠한 영향을 주는지 알아보기 위한 것이다.
<7-1> A549 세포에서 TM4SF4의 저발현에 따른 세포의 이동성 감소 확인 세포 이동성을 관찰하기 위해， 실시예 3— 3에서 기재된 것과 동일한 방법으로
A549 세포에 siR A를 이용하여 TM4SF4의 저발현을 유도한다. 72시간 후에 A549 세포를 10% 우태아혈청 (fetal bovine serum; FBS, Hyclone) 및 항생제 (lOOU/ml penicillin 및 100 yg/ml streptomycin, Hyclone)를 포함한 RPMI 1640 배지에 배양하여 트랜스웰 (Cell biolabs)의 챔버 (chamber)에 2χ105/300μ 1로 넣어준다. 아래 챔버에는 우태아혈청이 포함되지 않은 PMI 1640 배지 500 y 1를 첨가하고 5¾ C02, 37°C에서 24시간 동안 배양하였다. 배양이 끝난 후 트랜스웰 아래 면으로 이동한 세포를 관찰하기 위해 CyQuant®GR 염색 시약으로 염색 후 관찰하였다. 필드 (field)에 나타난 세포의 수를 측정하여 대조군에 대한 퍼센트 비율 (%)로 표시하였다,
그 결과， 선암 세포주 A549에서 대조군과 비교하였을 때 TM4SF4의 과발현시 세포의 이동성은 약 30% 증각한 것을 알 수 있었으며 (도 9의 위), 이는 상기 실시예 6에서 관찰된 결과와 일치한다.
<7-2> A549 세포에서 14SF4의 저발현에 따른 세포의 침윤성 감소 확인 세포 침윤을 측정하기 위해, 실시예 3— 3에서 기재된 것과 동일한 방법으로
A549 세포에 siRNA를 이용하여 TM4SF4의 저발현을 유도하였다. 72시간 후에 A549 세포를 5xl05개로 준비하고 트랜스웰 윗면에 Matrigel™ 10μ 1로 코팅하여 건조시킨 후， 우태아혈청이 없는 RPMI 1640 배지로 상온에서 30분 배양시켰다. 그 후， 상기 실시예 7-1에 기재된 세포 이동성 측정 방법과 동일하게 트랜스웰을 사용하여 실험을 수행하였다. 배양이 끝난 후 침윤한 세포들을 관찰하기 위해 웰의 윗 표면 부분을 면봉으로 제거하 CyQuant®GR 염색 시약으로 염색 후 관찰하였다. 필드 (field)에 나타난 세포의 수를 측정하여 대조군에 대한 퍼센트 비율 (%)로 표시하였다.
그 결과 선암 세포주인 A549에서 TM4SF4의 저발현은 침윤성 또한 약 40¾가 증가하였다 (도 9의 아래). 따라서 TM4SF4의 발현은 선암 세포주인 A549에서 세포의 이동성 및 침윤성을 증가시키는 것을 확인할 수 있었으며， 이는 곧 암세포의 전이를 촉진하는데 중요한 역할을 한다는 것을의미한다.
<실시예 8>폐암 세포 중 선암 세포주 A549세포에서 웨스턴 블랏팅을 통한 TM4SF4의 저발현에 따른 MMKmatrix nietalloprotease) 발현의 감소 확인
본 실험에서는 암세포의 전이를 위해 필수적인 혈관생성 (angiogenesis)에
TM4SF4의 발현이 어떠한 영향을 미치는지 알아보고자 MMP의 발현량을 조사하였다. MMP는 세포외 기질 (matrix)를 분해하는 단백질 분해효소로서 혈관생성에 필수적인 요소 중 하나로 잘 알려져 있디-.
실시예 3— 3에서 기재된 것과 동일한 방법으로 A549 세포에 siRNA를 이용하여 TM4SF4의 저발현을 유도하였다. 72시간 후， 상기 실시예 2에서 기재된 것과 동일한 방법으로 아무 자극이 없는 세포의 총용리액 (whole cell lysate)을 수득하여， MMPᅳ 2， 7， 9의 발현량을 각각의 항체 (R&D system, USA)을 이용하여 웨스턴 블랏팅에 의해 확인하였다. β—액틴 (actin)은 로딩 대 군 (loading control)로써 함께 수행되었다.
그 결과， TM4SF4 발현의 억제에 의하여 세포내 丽 P-2, 7， 9의 발현량이 현저하게 감소하는 것이 나타났다 (도 10). 즉 TM4SF4는 세포내의 固 P— 2， 7, 9의 발현을 조절한다.
<실시예 9> 폐암 세포 중 선암 세포주 A549세포에서 TM4SF4의 과발현에 따른 세포 성장 및 방사선 저항성의 감소 확인
A549세포에서 TM4SF4를 과발현 하기 위해 TM4SF4/pcDNA3.1 발현백터를 이용하는 방법, 세포의 성장 및 방사선 민감도를 측정하기 위한 콜로니 형성 분석 및 그 결과를 생존률 (%)로 '기재하는 방법이 실시예 3-2에서 기재된 것과 동일한 방법으로 수행되었다.
그 결과， 대세포암종에서 나타난 결과와 반대로, 선암 세포주인 A549에서는
TM4SF4가 과발현될 경우에 배양된 콜로니 및 방사선 조사 후 배양된 콜로니 모두 그 수가 증가하였디- (도 11). 이는 실시예 4의 결과의- 일관성 있는 것으로， 선암 세포주에서 TM4SF4의 과발현이 세포의 성장 및 방사선 저항성의 증가를 초래하였다. <실시예 10> 폐암 세포 중 선암 세포주 A549세포에서 TM4SF4 과발현시 웨스턴 블랏팅 (Western blotting)을 통한 세포내 신호 경로 활성도의 증가 확인
실시예 4 및 5에서 보여진 것처럼 TM4SF4의 저발현이 세포의 성장 및 방사선 저항성을 담당하는 세포내 신호의 활성도를 억제함으로써 그 세포의 성장 및 방사선 저항성을 감소를 초래하듯이， 본 실험은 TM4SF4의 과발현이 상기 세포내 신호의 활성도 (EGFR, IGF1RP， PI3K, ΝΚ-κΒ 및 ERK)에 영향을 주는지 확인하고자 하기 위해 수행되었다.
Α549 세포에서 TM4SF4의 과발현은 상기 실시예 3-2에서 기재된 것과 같이 수행되었고， 세포내 신호경로의 활성화를 알아보기 위해 상기 실시예 5에 기재된 것과 같이 수행되었다.
그 결과,선암 세포주 Α549세포에서 TM4SF4의 과발현은 IGF1R 3， PI3K, ΝΚ-κΒ 인산화의 증가를 초래하였고， EGFR 및 ERK의 활성도에는 큰 영향을 미치지 못하였다 (도 12). 따라서， TM4SF4의 과발현이 IGFIRP , ΡΙ3Κ, ΝΚ— κΒ의 활성화를 증가시킴으로써 상기 실시예 9의 결과와 같은 세포 성징 · 및 방사선 저항성의 증가가 초래되었다. ―
<실시예 u> 폐암 세포 중 선암 세포주 A549세포에서 상처회복을 통한 TM4SF4의 과발현에 따른 세포 이동성의 증가 확인
실시예 6의 결과에서 나타난 것과 같이， A549에서 TM4SF4의 저발현은 세포의 이동성을 감소시켰다. 이 * 다시 확인하기 위해, 본 실험에서는 동일한 선암 세포주 A549에서 TM4SF4를 과발현 시켰을 때 세포의 이동성에 변화가 있는지 알아보았다.
A549 세포에 TM4SF4를 과발현시키기 위한 방법은 실시예 3-2에 기재된 것과 동일하게 수행하였디-. 그 후， 상처회복을 통한 세포의 이동성을 관찰하기 위해 상기 실시예 6에 기재된 것과 동일한 방법으로 세포의 이동성을 측정하고 그 결과를 나타내었디-.
그 결과，선암 세포주인 A549에서 TM4SF4을 과발현시켰을 때， 대조군에 비하여 상처난 세포 사이의 간격이 24시간 후 감소하였다 (도 13). 따라서, A549에서 TM4SF4의 발현이 증가되었을 때， 세포의 이동성이 증가한였다.
<실시예 12> 폐암 세포 중 선암 세포주 A549세포에서 TM4SF4의 과발현시 트랜스웰을 통한 세포 이동성 및 침윤성의 증가 확인
트랜스웰을 사용하여 A549 세포의 이동성 및 침윤성은 TM4SF4의 과발현에 의해 어떠한 영향을 받는자 확인하고자 본 실험을 수행하였다-.
<12-1> A549 세포에서 TM4SF4의 과발현에 따른 세포의 이동성 증가 확인 상기 실시예 3-2에 기재된 것과 동일한 방법으로 발현백터 TM4SF4/pcDNA3.1를 사용하여 A549 세포에서 TPSF4의 과발현을 유도하였다. 그 후， 실시예 7—1에 기재된 것과 같이 트랜스웰을사용하여 세표의 이동성을 관찰하였다.
그 결과， 선암 세포주인 A549에서 TM4SF4.가 과발현되었을 때 세포의 이동성이 대조군에 비하여 약 3( 가량 증가 되었디(도 14, 위).
<12-2> A549 세포에서 TM4SF4의 과발현에 따른 세포의 침윤성 증가 확인 상기 실시예 3-2에 기재된 것과 동일한 방법으로 발현백터 TM4SF4/pcDNA3.1를 사용하여 A549 세포에서 TM4SF4의 과발현을 유도하였다. 그 후, 실시예 7— 2에 기재된 것과 같이 트랜스웰을 사용하여 세포의 참윤성을 관찰하였다.
그 결과, 선암 세포주인 A549에서 TM4SF4가 과발현되었을 때 세포의 침윤성이 대조군에 비하여 약 40% 가량 증가되는 것을 알 수 있었디 · (도 14， 아래).
<실시예 13> 폐암 세포 중 선암 세포주 A549세포에서 웨스턴 불랏팅을 통한 M4SF4의 과발현에 따른 MMP(matrix metal loprotease) 발현의 증가 확인
실시예 6 내지 8의 결과에서 나타난 것과 같이， A549 세포에서 TM4SF4의 저발현은 應 P-2,7,9 저발현을 유도였다. ' 상기 결과를 확인하고자, 본 실험에서는 A549 세포에서 TM4SF4의 과발현이 丽 P-2,'7,9의 과발현을 유도하는지 웨스턴 - 블랏팅을 통해 알아보았다.
실시예 3ᅳ 2에서 기재된 것과 동일한 방법으로 A549 세포에 TM4SF4의 과발현을 유도하였다. 그 후， 상기; 실시예 2에서 기재된 것과 동일한 방법으로 세포 총 용리액 (whole cell lysate)을 수득하여 웨스턴 블랏팅을 실시하여 丽 P-2, 7, 9 발현량을 확인하였다.
그 결과， 선암 세포주인 A549 세포에서 TM4SF4의 과발현은 匪 P-2, 7， 9의 발현량을 증가시켰다 (도 15). <실시예 14> 폐암 세포 충 선암 세포주 A549세포에서 항— TMSF4 항체의 처리에 따른 세포 성장의 감소 확인
A549 세포의 2xl03개를 60—隱 세포배양용기에 넣어 배양하고 중화 항 -TM4SF4 항체 (neutralizing anti-TM4SF4 antibody, Abeam)를 각각 lug/ml 또는 3yg/ml의 농도로 처리하였다. 처리한 날로부터 5일 후 0.5%(w/v) 크리스탈 바이을렛 용액으로 염색하고 관찰하여 콜로니들의 숫자를 세어 대조군에 대한 퍼센트 비율 (%)로 콜로니 생존률을 표시하였다.
그 결과, siRNA를 이용하여 TM4SF4의 발현을 억제힌■ 것과 동일하게， 처리한 항체의 농도 의존적으로 관찰된 콜로니의 수가 감소하였디- (도 16). 이것은 막 단백질인 TM4SF4는 비소성세포 폐암 중 선암 세포주 (A549)의 성장에 중요한 역할을 한다는 것을 나타내며, 막 단백질을 항체로 중화시켰을 때， siRNA로 그 발현을 억제하였을 때와 동일하게 세포의 성장능력이 크게 손상되었다. '

Claims

[청구의 범위】
【청구항 1】
TM4SF4( transmembrane 4 L six family member 4)의 발현 또는 활성 억제제를 유효성분으로 함유하는 비소세포성 폐암 중 선암 예방 및 치료용 약학적 조성물.
【청구항 2]
제 1항에 있어서， TM4SF4가 서열번호 1로 기재되는 아미노산 서열을 갖는 것을 특징으로 하는 비소세포성 폐암 중 선암 예방 및 치료용 약학적 조성물.
【청구항 3】
제 1항에 있어서， TM4SF4 단백질의 발현 억제제는 TM4SF4 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드 또는 작은 간섭 RNA(small interfering NA)인 것을 특징으로 하는 비소세포성 폐암 중 선암 예방 및 치료용 약학적 조성물.
【청구항 4】
제 1항에 있어서，. TM4SF4단백질의 활성 억제제는 TM4SF4단백질에 상보적으로 결합하는 화합물， 펩티드， 펩티드 미메틱스 및 항체로 이루어진 군으로부터 선택된 어느 하나인 것을 특징으로 하는 비소세포성 폐암 중 선암 예방 및 치료용 약학적 조성물.
【청구항 5】
TM4SF4의 발현 또는 활성 억제제를 유효성분으로 함유하는 비소세포성 폐암 중 선암에 대한 항암 보조제 .
【청구항 6】
제 5항에 있어서， 상기 항암 보조제는 비소세포성 폐암 중 선암 세포에 대한 방사선 민감도를 증진시키는 것을 특징으로 하는 비소세포성 폐암 중 선암에 대한 항암 보조제 .
【청구항 7】 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 유효성분으로 함유하는 선암을 제외한 비소세포성 폐암의 예방 및 치료용 약학적 조성물.
【청구항 8】
제 7항에 있어서, TM4SF4 단백질을 암호화하는 유전자가 서열번호 2로 기재되는 유전자 서열을 갖는 것을 특징으로 하는 선암을 제외한 비소세포성 폐암 예방 및 치료용 약학적 조성물.
【청구항 9】
TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 유효성분으로 함유하는 선암을 제외한 비소세포성 폐암에 대한 항암보조제 .
【청구항 10】
제 9항에 있어서, 상기 항암 보조제는 선암을 제외한 비소세포성 폐암 세포에 대한 방사선 민감도를 증진시키는 것을 특징으로 하는 선암을 제외한 비소세포성 폐암에 대한 항암 보조제 .
【청구항 11】
TM4SF4의 발현 또는 활성 억제제를 비소세포성 폐암 중 선암 세포에 투여하는 단계를 포함하는 비소세포성 폐암 중 선암 세포의 방사선에 대한 민감도 증진 방법 .
【청구항 12】
TM4SF4 유전자를 포함하는 백터를 선암을 제외한 비소세포성 폐암 세포에 투여하는 단계를 포함하는 선암을 제외한 비소세포성 폐암 세포의 방사선에 대한 민감도 증진 방법 .
【청구항 13]
제 11항 또는 제 12항에 있어서， 상기 방사선은 감마 방사선인 것을 특징으로 하는 방사선에 대한 민감도 증진 방법 .
【청구항 14]
1) TM4SF4 단백질 발현 세포주에 피검물질을 처리하는 단계 ;
2) 상기 세포주의 TM4SF4 단백질의 발현 또는 활성 정도를 측정하는 단계 ; 및
3) 상기 TM4SF4 단백질의 발현 또는 활성 정도가 피검물질을 처리하지 않은 대조군에 비해 감소하는 피검물질을 선별하는 단계를 포함하는 비소세포성 폐암 중 선암 세포에 대한 항암제 또는 방사선 민감도 증진제 후보물질의 스크리닝 방법 .
【청구항 15】
1) TM4SF4 단백질 발현 세포주에 피검물질을 처리하는 단계 ;
2) 상기 세포주의 TM4SF4 단백질의 발현 또는 활성 정도를 측정하는 단계 ; 및
3) 상기 TM4SF4 단백질의 발현 또는 활성 정도가 피검물질을 처리하지 않은 대조군에 비해 증가하는 피검물질을 선별하는 단계를 포함하는 선암을 제외한 비소세포성 폐암 세포에 대한 항암제 또는 방사선 민감도 증진제 후보물질의 스크리닝 방법 .
【청구항 16】
제 14항 또는 제 15항에 있어서， 단계 2)의 단백질의 발현 정도는 면역침강법 (i瞧 unoprecipitation), 방사능면역분석법 (RIA)， 효소면역분석법 (ELISA)， 면역조직화학법 (immunohistochemistry), RT— PCR, 웨스턴 블랏팅 (Western blotting) 및 유세포 분석법 (FACS)으로 이루어진 군으로부터 선택된 어느 하나로 측정하는 것을 특징으로 하는 스크리닝 방법 .
【청구항 17】
제 14항 또는 제 15항에 있어서， 단계 2)의 단백질의 활성 정도는 SDS-PAGE, 면역형광법， 효소면역분석법 (ELISA), 질량분석 및 단백질 칩으로 이루어진 군으로부터 선택된 어느 하나로 측정하는 것을 특징으로 하는 스크리닝 방법.
[청구항 18】
제 14항 또는 제 15항에 있어서, 단계 3)의 방사선은 감마 방사선인 것을 특징으로 하는 스크리닝 방법 .
【청구항 19】
약학적으로 유효한 양의 TM4SF4의 발현 또는 활성 억제제를 비소세포성 폐암 중 선암에 걸린 개체에 투여하는 단계를 포함하는, 비소세포성 폐암 중 선암의 치료 방법.
【청구항 20]
약학적으로 유효한 양의 TM4SF4의 발현 또는 활성 억제제를 개체에 투여하는 단계를 포함하는， 비소세포성 폐암 중 선암의 예방 방법 .
【청구항 21】
약학적으로 유효한 양의 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 선암을 제외한 비소세포성 폐암에 걸린 개체에 투여하는 단계를 포함하는， 선암을 제외한 비:소세포성 폐암의 치료 방법.
【청구항 22】
약학적으로 유효한 양의 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터를 개체에 투여하는 단계를 포함하는， 선암을 제외한 비소세포성 폐암의 예방 방법 .
【청구항 23】
비소세포성 폐암 중 선암 예방 및 치료용 약학적 조성물로 사용하기 위한 TM4SF4의 발현 또는 활성 억제제의 용도.
【청구항 24】
비소세포성 폐암 중 선암에 대한 항암 보조제로 사용하기 위한 TM4SF4의 발현 또는 활성 억제제의 용도.
【청구항 25】
선암을 제외한 비소세포성 폐암의 예방 및 치료용 약학적 조성물로 사용하기 위한 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터의 용도.
【청구항 26]
선암을 제외한 비소세포성 폐암에 대한 항암 보조제로 사용하기 위한 TM4SF4 단백질을 암호화하는 유전자를 포함하는 발현백터의 용도ᅳ
【청구항 27]
비소세포성 폐암 중 선암 세포의 방사선에 대한 민감도 증진제로 사용하기 위한 TM4SF4의 발현 또는 활성 억제제의 용도.
【청구항.28】
선암을 제외한 비소세포성 폐암 세포의 방사선에 대한 민감도 증진제로 사용하기 위한 TM4SF4 유전자를 포함하는 백터의 용도.
PCT/KR2011/007900 2011-09-26 2011-10-21 비소세포성 폐암에서 ｔｍ４ｓｆ４의 발현 또는 활성의 조절을 통한 방사선 저항성 및 암세포의 성장, 전이, 및 침윤능력을 저하시키는 방법 WO2013047941A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2014531696A JP5887413B2 (ja) 2011-09-26 2011-10-21 非小細胞肺癌におけるｔｍ４ｓｆ４の発現または活性を調節することによって癌細胞の放射線耐性ならびに増殖、転移および浸潤を低減させる方法
US14/347,506 US9075064B2 (en) 2011-09-26 2011-10-21 Method for decreasing radioresistance and growth, metastasis and infiltration of cancer cells through regulating expression or activity of TM4SF4 in non-small cell lung cancer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2011-0096918 2011-09-26
KR1020110096918A KR101314828B1 (ko) 2011-09-26 2011-09-26 비소세포성 폐암에서 ｔｍ４ｓｆ４의 발현 또는 활성의 조절을 통한 방사선 저항성 및 암세포의 성장, 전이, 및 침윤능력을 저하시키는 방법

Publications (1)

Publication Number Publication Date
WO2013047941A1 true WO2013047941A1 (ko) 2013-04-04

Family

ID=47995948

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/007900 WO2013047941A1 (ko) 2011-09-26 2011-10-21 비소세포성 폐암에서 ｔｍ４ｓｆ４의 발현 또는 활성의 조절을 통한 방사선 저항성 및 암세포의 성장, 전이, 및 침윤능력을 저하시키는 방법

Country Status (4)

Country Link
US (1) US9075064B2 (ko)
JP (1) JP5887413B2 (ko)
KR (1) KR101314828B1 (ko)
WO (1) WO2013047941A1 (ko)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113227149B (zh) * 2019-12-06 2024-05-17 韩国原子力研究所 抗tm4sf4抗体及其用途
CN112083171B (zh) * 2020-09-07 2023-07-18 中国人民解放军总医院第八医学中心 Ku70蛋白T455位点磷酸化抑制剂及其应用
WO2022265439A1 (ko) * 2021-06-18 2022-12-22 한국원자력연구원 항-tm4sf4 인간화 항체 및 이의 용도

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008283945A (ja) * 2007-05-21 2008-11-27 Toru Tani 肝癌検出用マーカー
KR100934706B1 (ko) * 2006-12-07 2009-12-31 재단법인서울대학교산학협력재단 Ｔｍ４ｓｆ５의 기능을 저해하는 항암물질의 스크리닝 방법및 칼콘계 화합물을 함유하는 항암조성물
US20110177098A1 (en) * 2008-07-15 2011-07-21 Lori Sussel Tm4sf4 and modulators thereof and methods for their use

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020115057A1 (en) * 2000-09-18 2002-08-22 Paul Young Process for identifying anti-cancer therapeutic agents using cancer gene sets
US20040219579A1 (en) * 2003-02-19 2004-11-04 Natasha Aziz Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer
DE10316701A1 (de) * 2003-04-09 2004-11-04 Hinzmann, Bernd, Dr. Humane Nukleinsäuresequenzen aus Bronchialkarzinomen
DE102004023187A1 (de) * 2004-05-11 2005-12-01 Ganymed Pharmaceuticals Ag Identifizierung von Oberflächen-assoziierten Antigenen für die Tumordiagnose und -therapie
KR100906145B1 (ko) * 2006-05-30 2009-07-03 한국생명공학연구원 Ｔｍｐｒｓｓ4 억제제를 유효성분으로 포함하는 항암제
KR101345374B1 (ko) * 2006-12-21 2013-12-24 삼성전자주식회사 １기 폐암 환자의 병기 구분용 마커, 상기 마커에 대한프라이머를 포함하는 키트, 상기 마커 또는 상기 마커에대한 항체를 포함하는 마이크로어레이, 및 １기 폐암환자의 병기를 구분하는 방법
KR101163215B1 (ko) * 2007-05-26 2012-07-06 한국생명공학연구원 헐떡이풀 추출물 또는 이로부터 분리된 트리테르펜화합물을 유효성분으로 함유하는 암 질환의 예방 및 치료용조성물
CN101748122B (zh) * 2008-12-18 2012-07-25 中国科学院上海生命科学研究院 抑制tm4sf4表达的干扰分子及其应用

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100934706B1 (ko) * 2006-12-07 2009-12-31 재단법인서울대학교산학협력재단 Ｔｍ４ｓｆ５의 기능을 저해하는 항암물질의 스크리닝 방법및 칼콘계 화합물을 함유하는 항암조성물
JP2008283945A (ja) * 2007-05-21 2008-11-27 Toru Tani 肝癌検出用マーカー
US20110177098A1 (en) * 2008-07-15 2011-07-21 Lori Sussel Tm4sf4 and modulators thereof and methods for their use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
QIU, J. ET AL.: "Overexpression of the gene for transmembrane 4 superfamily member 4 accelerates liver damage in rats treated with CC14", J. HEPATOL., vol. 46, no. 2, February 2007 (2007-02-01), pages 266 - 275 *

Also Published As

Publication number Publication date
KR20130033075A (ko) 2013-04-03
US20140234326A1 (en) 2014-08-21
US9075064B2 (en) 2015-07-07
KR101314828B1 (ko) 2013-10-04
JP2014528944A (ja) 2014-10-30
JP5887413B2 (ja) 2016-03-16

Similar Documents

Publication Publication Date Title
KR20170096199A (ko) Kras 돌연변이와 관련된 악성 종양을 치료하기 위한 방법 및 조성물
JP7392954B2 (ja) トリプルネガティブ乳癌の治療方法
EP2621511A1 (en) Methods and pharmaceutical compositions for the treatment of bone density related diseases
CN109609644B (zh) Pax3-fkhr和acta1基因在预防、治疗横纹肌肉瘤中的用途
KR20170107958A (ko) 트랜스페린 수용체 (TfR)에 대한 RNA 압타머
JP6543612B2 (ja) 大腸癌の治療剤、及び大腸癌患者の予後の予測方法
US11920135B2 (en) Methods of treating VEGF/VEGFR resistant prostate, renal, or colorectal cancers using combination therapies
US20180148793A1 (en) Biomarkers and uses thereof for selecting pancreas cancer intervention
WO2014113406A1 (en) Compositions and methods for treating pancreatic cancer
KR101314828B1 (ko) 비소세포성 폐암에서 ｔｍ４ｓｆ４의 발현 또는 활성의 조절을 통한 방사선 저항성 및 암세포의 성장, 전이, 및 침윤능력을 저하시키는 방법
US9233144B2 (en) Tyrosine kinase receptor TYRO3 as a therapeutic target in the treatment of cancer
KR20130102990A (ko) 항암면역우회암의 표시인자 및 무력화 표적으로서의 ａｐｉ５의 용도
Zhao et al. A study of the suppressive effect on human pancreatic adenocarcinoma cell proliferation and angiogenesis by stable plasmid-based siRNA silencing of c-Src gene expression
Gjerset et al. Sensitization of tumors to chemotherapy through gene therapy
CN107715103B (zh) Clusterin在制备杀伤肿瘤干细胞的癌症治疗药物中的应用
WO2016123679A1 (en) A method of treatment
CN106554962B (zh) 过表达gpr160的癌症的预防、诊断和治疗
Zhao et al. LncRNA FOXD3-AS1/miR-128-3p axis-mediated IGF2BP3 in glioma stimulates cancer angiogenesis and progression
KR101535346B1 (ko) 암 줄기세포의 분화치료를 위한 ｃ―Ｙｅｓ의 약제학적 용도
US20110111400A1 (en) Method for enhancing chemical sensitivity or radiosensitivity of cancer cells by inhibiting expression of tspyl5
KR20200022187A (ko) Nono의 발현 또는 활성 억제제를 유효성분으로 포함하는 방사선 민감성 증진용 조성물
CN107723369B (zh) Setd1b蛋白及其编码基因在肝癌诊断治疗中的应用
US11168327B2 (en) STEAP2 inhibitors for the treatment of liver cancers
WO2023230562A2 (en) Rna compositions and therapeutic methods thereof
WO2024076781A1 (en) Polynucleotides for silencing transcript variant 1 of assembly factor for spindle microtubules and applications thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11873289

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2014531696

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14347506

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 11873289

Country of ref document: EP

Kind code of ref document: A1