WO2012170704A2 - Methods and compositions of predicting activity of retinoid x receptor modulator - Google Patents
Methods and compositions of predicting activity of retinoid x receptor modulator Download PDFInfo
- Publication number
- WO2012170704A2 WO2012170704A2 PCT/US2012/041379 US2012041379W WO2012170704A2 WO 2012170704 A2 WO2012170704 A2 WO 2012170704A2 US 2012041379 W US2012041379 W US 2012041379W WO 2012170704 A2 WO2012170704 A2 WO 2012170704A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- treatment
- snps
- group
- rsl
- biomarkers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70567—Nuclear receptors, e.g. retinoic acid receptor [RAR], RXR, nuclear orphan receptors
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16C—COMPUTATIONAL CHEMISTRY; CHEMOINFORMATICS; COMPUTATIONAL MATERIALS SCIENCE
- G16C20/00—Chemoinformatics, i.e. ICT specially adapted for the handling of physicochemical or structural data of chemical particles, elements, compounds or mixtures
- G16C20/30—Prediction of properties of chemical compounds, compositions or mixtures
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16H—HEALTHCARE INFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR THE HANDLING OR PROCESSING OF MEDICAL OR HEALTHCARE DATA
- G16H50/00—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics
- G16H50/20—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B30/00—Methods of screening libraries
- C40B30/04—Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- the present invention relates to the field of pharmacogenomics, which applies one or more genomic biomarkers and the related diagnostic methods, devices, reagents, systems, and kits, for predicting varied individual responses such as, for example, efficacy or adverse effect, to therapeutic agents.
- RXR retinoid X receptor
- PPAR peroxisome proliferator- activated receptors
- LXR Liver X receptors
- FXR farnesoid X receptor
- Bexarotene (also called Targretin, LGD1069) is a selective modulator of retinoid X receptors (RXRs) approved for treating refractory advanced- stage cutaneous T-cell lymphoma (1, 2).
- RXRs retinoid X receptors
- a number of preclinical studies and phase I and II clinical trials have shown that bexarotene also exhibits promising antitumor or tumor prevention activity for breast cancer, renal cell carcinoma and lung cancer (3-8). Consequently, two large phase III trials (SPIRIT I and SPIRIT II) were conducted to evaluate the efficacy and safety of standard chemotherapy agents with or without bexarotene as a first-line therapy in treating advanced non small cell lung cancer.
- the present invention provides a panel of isolated biomarkers comprising two, three, four or more single nucleotide polymorphisms (SNPs) selected from the group consisting of rs7434820, rs4572960, rsl0058324, rsl051853, rs6997581, rs2631686, rsl795505, rsl 184776, rs7334509, rs6491738, rs7333033, rs7338381, rs3916931 and rs 1506011, or complimentary sequences thereof, and/or in linkage disequilibrium therewith.
- SNPs single nucleotide polymorphisms
- the panel may comprise all the SNPs, or complimentary sequences thereof, and/or in linkage disequilibrium therewith.
- the SNPs may comprise the nucleotide sequences set forth in SEQ ID NOs: l-14, respectively, or complimentary sequences thereof, and/or in linkage disequilibrium therewith.
- a panel of biomarkers e.g., SNPs, associated and/or linked with two, three, four or more SNPs selected from the group consisting of rs7434820, rs4572960, rsl0058324, rsl051853, rs6997581, rs2631686, rsl795505, rsl 184776, rs7334509, rs6491738, rs7333033, rs7338381, rs3916931 and rsl 506011, or in linkage disequilibrium therewith.
- SNPs e.g., SNPs
- a microarray for the assessment of the panel of isolated biomarkers disclosed herein which comprises a combination of molecules on a substrate, wherein said molecules are used for assaying the SNPs.
- the molecules may be oligonucleotides or polypeptides.
- the oligonucleotides may comprise the nucleotide sequences set forth in SEQ ID NOs: l-14, or complimentary sequences thereof.
- a reagent for the assessment of the panel of isolated biomarkers disclosed herein which may comprise one or more molecules for assaying the SNPs.
- the molecules may be oligonucleotides or polypeptides.
- the oligonucleotides may comprise the nucleotide sequences set forth in SEQ ID NOs: l-14, or complimentary sequences thereof.
- the SNPs may be assayed by sequencing, capillary electrophoresis, mass spectrometry, single-strand conformation polymorphism (SSCP), electrochemical analysis, denaturing HPLC and gel electrophoresis, restriction fragment length polymorphism, hybridization analysis, single-base extension, and/or microarray.
- sequencing capillary electrophoresis
- mass spectrometry single-strand conformation polymorphism (SSCP)
- SSCP single-strand conformation polymorphism
- electrochemical analysis denaturing HPLC and gel electrophoresis
- restriction fragment length polymorphism hybridization analysis
- single-base extension single-base extension
- microarray microarray
- kits for the assessment of a panel of isolated biomarkers which comprises the reagent disclosed herein, wherein the biomarkers may comprise one or more SNPs selected from the group consisting of rs7434820, rs4572960, rsl0058324, rsl051853, rs6997581, rs2631686, rsl795505, rsl 184776, rs7334509, rs6491738, rs7333033, rs7338381, rs3916931, rsl506011, or in linkage disequilibrium therewith.
- the kit may further comprise instructions for using the biomarker to conduct a companion diagnostic test.
- a companion diagnostic test for a treatment using a panel of isolated biomarkers comprising one, two, three, four or more SNPs selected from the group consisting of rs7434820, rs4572960, rsl0058324, rsl051853, rs6997581, rs2631686, rsl795505, rsl 184776, rs7334509, rs6491738, rs7333033, rs7338381, rs3916931 and rsl 506011, or in linkage disequilibrium therewith.
- the panel may comprise all the SNPs, or complimentary sequences thereof.
- the companion diagnostic test may comprise: a) obtaining a biological sample from a subject that is undergoing a treatment or is considered for a treatment; b) isolating genomic DNA from said biological sample; c) assaying the panel of biomarkers; d) generating an output with a computer algorithm based on the assay results of said panel of biomarkers; and/or e) determining the likely responsiveness of said subject to said treatment.
- the SNPs may be assayed by sequencing, capillary
- electrophoresis mass spectrometry, single-strand conformation polymorphism (SSCP), electrochemical analysis, denaturing HPLC and gel electrophoresis, restriction fragment length polymorphism, hybridization analysis, single-base extension, and/or microarray.
- SSCP single-strand conformation polymorphism
- electrochemical analysis denaturing HPLC and gel electrophoresis
- restriction fragment length polymorphism hybridization analysis, single-base extension, and/or microarray.
- the treatment may comprise a therapeutic regimen using a modulator of a retinoid X receptor (RXR), a retinoid acid receptor (RAR), a peroxisome proliferator-activated receptor (PPAR), a Liver X receptor (LXR), or a farnesoid X receptor (FXR), wherein the RXR modulator may be bexarotene.
- RXR retinoid X receptor
- RAR retinoid acid receptor
- PPAR peroxisome proliferator-activated receptor
- LXR Liver X receptor
- FXR farnesoid X receptor
- the disease may be selected from the group consisting of small cell lung cancer, prostate cancer, breast cancer, cutaneous T-cell lymphoma, cancer prevention, metabolic syndrome, dermatologic disease, neurodegenerative disease and disorder .
- the method may be used for selecting a patient who is most likely to benefit from the treatment or who is most likely to experience an adverse effect from the treatment.
- the new biomarker may be a DNA, a RNA, a polypeptide, a siRNA or another form of biomarker.
- the drug target may be identified based on a biological pathway related to a biomarker, wherein the biological pathway may be selected from the group consisting of reabsorption of bile acids, inward rectifier potassium channels, regulation of the actin cytoskeleton, nuclear localization, integrin receptors, sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1, and polycomb group ring finger 5.
- the biological pathway may be selected from the group consisting of reabsorption of bile acids, inward rectifier potassium channels, regulation of the actin cytoskeleton, nuclear localization, integrin receptors, sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1, and polycomb group ring finger 5.
- Figure 1 Sub-population analysis and study design.
- A Survival analysis of patients exhibiting different triglyceride levels following bexarotene treatment.
- Stage I discovery phase 150 samples (74 cases and 76 controls) were genotyped using the Affymetrix GeneChip 500K Mapping Array Set (Nsp array + Sty array) containing 500,000 SNPs following the Affymetrix standard protocol. 255 SNPs were then selected for stage II study.
- 400 samples were individually genotyped using the 255 Sequenom iPLEX SNP assays, including 147 samples (minus one case and two controls) used in the Stage I for the Verification group and 253 new samples for the Replication group.
- 129 samples were included from the patients with middle level of triglyceride percentile (HTG Mid).
- FIG. 1 Regional plot of the associated region at SLC10A2. The significant association at a locus near SLC10A2 was identified using Sequenom iPLEX. The graph is generated from hapmap, and the ruler at the top represents the physical position on Chrl3. There are four SNPs (marked by four purple circles) from this region showing significant association with bexarotene-induced hypertriglyceridemia, and they are in strong LD block which is displayed in red triangles or blocks. The LD plot was generated using hapmap website's default settings, the dark red represents d-prime from CEU larger than 1. [0014] Figure 3. Associated and functional analysis of LCP1. A. Physical location of rs7334509 on Chrl3 and its associated genes. The number along the ruler at the top indicates the physical position on Chrl3, and SNPs in this region are shown in two-letter code
- LCP1 expression data was obtained from the microarray experiment using four groups of samples: i) MDA parental cells; ii) MDA derived cells resistant to paclitaxel (MDA-PR); iii) MDA-PR cells treated with 30 nM paclitaxel (3 days on, 7 days off) for 3 months; iv) MDA-PR cells treated with 30 nM paclitaxel/1 ⁇ bexarotene (3 days both, 7 days only bexarotene) for 3 months. Each group had four replicates and different groups are shown in a different shade of blue color. The LCP1 expression signal of each sample is labeled at the end of the bar graph.
- Figure 4 The method of determining whether a human subject should receive therapy using predicting genomic biomarkers.
- the present invention describes genomic biomarkers that have been discovered to correlate with different responses (efficacy, adverse effect, and other end points) among patients receiving treatment regime including bexarotene, in treating diseases such as, non small cell lung cancer.
- the newly discovered biomarkers can be used in companion diagnostic tests which can help to predict drug responses and apply drugs only to those who will be benefited, or exclude those who might have adverse effects, by the treatment.
- the present invention comprises a method of predicting responders to therapeutic regime which includes RXR modulator, such as bexarotene by using score generated by genotyping the genetic biomarkers and processing the results via computer algorithm.
- biomarker refers generally to a molecule, including a gene, protein, carbohydrate structure, or glycolipid, the expression of which in or on a mammalian tissue or cell or secreted can be detected by known methods (or methods disclosed herein) and is predictive or can be used to predict (or aid prediction) for a mammalian cell's or tissue's sensitivity to, and in some embodiments, to predict (or aid prediction) an individual's responsiveness to treatment regimens.
- a "pharmacogenomic biomarker” is an objective biomarker which correlates with a specific clinical drug response or susceptibility in a subject (see, e.g., McLeod et al., Eur. J. Cancer (1999) 35: 1650-1652). It may be a biochemical biomarker, or a clinical sign or symptom.
- the presence or quantity of the pharmacogenomic marker is related to the predicted response of the subject to a specific drug or class of drugs prior to administration of the drug. By assessing the presence or quantity of one or more pharmacogenomic markers in a subject, a drug therapy which is most appropriate for the subject, or which is predicted to have a greater degree of success, may be selected.
- a drug or course of treatment may be selected that is optimized for the treatment of the specific tumor likely to be present in the subject.
- the presence or absence of a specific sequence mutation or polymorphism may correlate with drug response.
- the use of pharmacogenomic biomarkers therefore permits the application of the most appropriate treatment for each subject without having to administer the therapy.
- polymorphic locus refers to a region in a nucleic acid at which two or more alternative nucleotide sequences are observed in a significant number of nucleic acid samples from a population of individuals.
- a polymorphic locus may be a nucleotide sequence of two or more nucleotides, an inserted nucleotide or nucleotide sequence, a deleted nucleotide or nucleotide sequence, or a microsatellite, for example.
- a polymorphic locus that is two or more nucleotides in length may be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more, 20 or more, 30 or more, 50 or more, 75 or more, 100 or more, 500 or more, or about 1000 nucleotides in length, where all or some of the nucleotide sequences differ within the region.
- a polymorphic locus is often one nucleotide in length, which is referred to herein as a "single nucleotide polymorphism" or a "SNP.”
- the high-density genotyping may be conducted by using SNPs. In some embodiments, about 1,000-5,000,000 or more SNPs, may be used. In some embodiments, the high-density genotyping may be array-based. In some embodiments, the high-density genotyping may be conducted by using sequencing, such as high-throughput sequencing.
- each nucleotide sequence is referred to as a "polymorphic variant" or "nucleic acid variant.”
- polymorphic variants represented in a minority of samples from a population is sometimes referred to as a "minor allele” and the polymorphic variant that is more prevalently represented is sometimes referred to as a "major allele.”
- minor allele the polymorphic variant represented in a minority of samples from a population
- major allele the polymorphic variant that is more prevalently represented
- Individuals who are homozygous with respect to one allele are sometimes predisposed to a different phenotype as
- allelotyped and/or genotyped samples from individuals having different values in a relevant phenotype often are allelotyped and/or genotyped.
- allelotyped and/or genotyped refers to a process for determining the allele frequency for a polymorphic variant in pooled DNA samples from cases and controls. By pooling DNA from each group, an allele frequency for each locus in each group is calculated. These allele frequencies are then compared to one another.
- a genotype or polymorphic variant may be expressed in terms of a "haplotype," which as used herein refers to a set of DNA variations, or polymorphisms, that tend to be inherited together.
- a haplotype can refer to a combination of alleles or to a set of SNPs found on the same chromosome.
- two SNPs may exist within a gene where each SNP position includes a cytosine variation and an adenine variation.
- Certain individuals in a population may carry one allele (heterozygous) or two alleles (homozygous) having the gene with a cytosine at each SNP position.
- the individuals can be characterized as having a cytosine/cytosine haplotype with respect to the two SNPs in the gene.
- sample refers to a composition that is obtained or derived from a subject of interest that contains a cellular and/or other molecular entity that is to be characterized and/or identified, for example based on physical, biochemical, chemical and/or physiological characteristics.
- the phrase "clinical sample” or “disease sample” and variations thereof refer to any sample obtained from a subject of interest that would be expected or is known to contain the cellular and/or molecular entity that is to be characterized.
- tissue or cell sample refers to a collection of similar cells obtained from a tissue of a subject or patient.
- the source of the tissue or cell sample may be solid tissue as from a fresh, frozen and/or preserved organ or tissue sample or biopsy or aspirate; blood or any blood constituents; bodily fluids such as cerebral spinal fluid, amniotic fluid, peritoneal fluid, or interstitial fluid; cells from any time in gestation or development of the subject.
- the tissue sample may also be primary or cultured cells or cell lines.
- the tissue or cell sample is obtained from a disease tissue/organ.
- the tissue sample may contain compounds which are not naturally intermixed with the tissue in nature such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or the like.
- Plasma refers to the intravascular fluid part of extracellular fluid (all body fluid outside of cells). It is mostly water and contains dissolved proteins, glucose, clotting factors, mineral ions, hormones and carbon dioxide (plasma being the main medium for excretory product transportation). Blood plasma is prepared by spinning a tube of fresh blood containing an anti-coagulant in a centrifuge until the blood cells fall to the bottom of the tube. The blood plasma is then poured or drawn off. "Blood serum” is blood plasma without fibrinogen or the other clotting factors (i.e., whole blood minus both the cells and the clotting factors).
- Polynucleotide or “nucleic acid,” as used interchangeably herein, refer to polymers of nucleotides of any length, and include DNA and RNA.
- the nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase.
- a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs. If present, modification to the nucleotide structure may be imparted before or after assembly of the polymer.
- the sequence of nucleotides may be interrupted by non-nucleotide components.
- a polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
- Other types of modifications include, for example, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, cabamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, ply-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g
- any of the hydroxyl groups ordinarily present in the sugars may be replaced, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to prepare additional linkages to additional nucleotides, or may be conjugated to solid supports.
- the 5' and 3' terminal OH can be phosphorylated or substituted with amines or organic capping groups moieties of from 1 to 20 carbon atoms.
- Other hydroxyls may also be derivatized to standard protecting groups.
- Polynucleotides can also contain analogous forms of ribose or deoxyribose sugars that are generally known in the art, including, for example, 2'-0-methyl-2'-0- allyl, 2'-fluoro- or 2'-azido-ribose, carbocyclic sugar analogs, a-anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs and abasic nucleoside analogs such as methyl riboside.
- One or more phosphodiester linkages may be replaced by alternative linking groups.
- linking groups include, but are not limited to, embodiments wherein phosphate is replaced by P(0)S("thioate”), P(S)S ("dithioate"), "(O)NR 2 ("amidate”), P(0)R, P(0)OR', CO or CH 2 ("formacetal"), in which each R or R' is independently H or substituted or unsubstituted alkyl (1-20 C) optionally containing an ether (—0—) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl. Not all linkages in a polynucleotide need be identical. The preceding description applies to all polynucleotides referred to herein, including RNA and DNA.
- Oligonucleotide generally refers to short, generally single stranded, generally synthetic polynucleotides that are generally, but not necessarily, less than about 200 nucleotides in length.
- oligonucleotide and “polynucleotide” are not mutually exclusive. The description above for polynucleotides is equally and fully applicable to oligonucleotides.
- Amplification generally refers to the process of producing multiple copies of a desired sequence.
- Multiple copies means at least 2 copies.
- a “copy” does not necessarily mean perfect sequence complementarity or identity to the template sequence.
- copies can include nucleotide analogs such as deoxyinosine, intentional sequence alterations (such as sequence alterations introduced through a primer comprising a sequence that is hybridizable, but not complementary, to the template), and/or sequence errors that occur during amplification.
- array refers to an ordered arrangement of hybridizable array elements, such as polynucleotide probes (e.g., oligonucleotides), beads, or binding reagents (e.g., antibodies), on a substrate.
- the substrate can be a solid substrate, such as a glass or silica slide, a fiber optic binder, or a semi-solid substrate, such as nitrocellulose membrane.
- the nucleotide sequences can be DNA, RNA, or any permutations thereof.
- phenotype refers to a trait which can be compared between individuals, such as presence or absence of a condition, a visually observable difference in appearance between individuals, metabolic variations, physiological variations, variations in the function of biological molecules, and the like.
- a phenotype can be qualitative or quantitative.
- An example of a phenotype is responsiveness to a treatment, such as a drug.
- Responsiveness can be assessed using any endpoint indicating a benefit to the patient, including, without limitation, (1) inhibition, to some extent, of disease progression, including slowing down and complete arrest; (2) reduction in the number of disease episodes and/or symptoms; (3) reduction in lesional size; (4) inhibition (i.e., reduction, slowing down or complete stopping) of disease cell infiltration into adjacent peripheral organs and/or tissues; (5) inhibition (i.e., reduction, slowing down or complete stopping) of disease spread; (6) relief, to some extent, of one or more symptoms associated with the disorder; (7) increase in the length of disease-free presentation following treatment; (8) decreased mortality at a given point of time following treatment; and/or (9) lack of adverse effects following treatment. Responsiveness can also be assessed using any endpoint indicating side effect and/or toxicity to the patient.
- Treating” or “treatment” or “alleviation” refers to therapeutic treatment wherein the object is to slow down (lessen) if not cure the targeted pathologic condition or disorder or prevent recurrence of the condition.
- a subject is successfully “treated” if, after receiving a therapeutic amount of a therapeutic agent, the subject shows observable and/or measurable reduction in or absence of one or more signs and symptoms of the particular disease.
- treatment with a therapeutic agent is effective to result in the patients being disease-free 3 months after treatment, preferably 6 months, more preferably one year, even more preferably 2 or more years post treatment.
- prediction or “prognosis” is used herein to refer to the likelihood that a patient will respond either favorably or unfavorably to a drug or set of drugs.
- the prediction relates to the extent of those responses. In one embodiment, the prediction relates to whether and/or the probability that a patient will survive or improve following treatment, for example treatment with a particular therapeutic agent, and for a certain period of time without disease recurrence.
- the predictive methods of the invention can be used clinically to make treatment decisions by choosing the most appropriate treatment modalities for any particular patient.
- the predictive methods of the present invention are valuable tools in predicting if a patient is likely to respond favorably to a treatment regimen, such as a given therapeutic regimen, including for example, administration of a given therapeutic agent or combination, surgical intervention, steroid treatment, etc.
- output refers to a value or score generated from a computer algorithm. The output may be generated based on assay results using the biomarkers disclosed herein as inputs to the computer algorithm.
- An "output" can be either quantitative or qualitative, and can be used for determining the likely responsiveness of a subject to a treatment in a companion diagnostic test.
- the present invention describes novel genomic biomarkers that correlate with the activity of RXR modulator, such as bexarotene. These biomarkers can be used to identify the patients who are most likely to benefit or experience adverse effect from bexarotene treatment.
- an isolated SNP-containing nucleic acid molecule comprises one or more SNP positions disclosed by the present invention with flanking nucleotide sequences on either side of the SNP positions.
- a flanking sequence can include nucleotide residues that are naturally associated with the SNP site and/or heterologous nucleotide sequences.
- the flanking sequence is up to about 500, 300, 100, 60, 50, 30, 25, 20, 15, 10, 8, or 4 nucleotides (or any other length in-between) on either side of a SNP position, or as long as the full-length gene or entire protein-coding sequence (or any portion thereof such as an exon).
- biomarkers of the invention are those provided in Table 2 and Table 3 and others in linkage disequilibrium with them: rs7434820 (SEQ ID NO: l)
- CTCTCC A A A AT A ACTCTTC ATGC AC A [ A/C/T] TTTAGCTT ACCTCTG A A A A ACT AC A rsl0058324 (SEQ ID NO:3)
- ATCCATCTCCTTCCATCCTCAGACAT[C/T]GGCACTCGTGGTTCTTGGGCCTTCA rs7333033 (SEQ ID NO: 11)
- the invention includes individual biomarker and biomarker sets, which comprise more than one biomarker provided in Table 2 and Table 3.
- the biomarkers having predicting value for bexarotene treatment are not limited to the ones listed in Table 2 and Table 3.
- the invention also includes other biomarkers, e.g., SNPs, which have high correlation with the biomarkers listed in Table 2, and they could also be used to predict bexarotene responses by patients.
- those SNPs are in linkage disequilibrium with the SNPs provided in Table 2.
- Additional predicting SNPs might reside on genes related to the genes that SNPs listed in Table 2 are associated with. SNPs that are in linkage disequilibrium may be found in various public databases, e.g., HapMap.
- linkage disequilibrium refers to the co-inheritance of alleles (e.g., alternative nucleotides) at two or more different SNP sites at frequencies greater than would be expected from the separate frequencies of occurrence of each allele in a given population.
- the expected frequency of co-occurrence of two alleles that are inherited independently is the frequency of the first allele multiplied by the frequency of the second allele. Alleles that co-occur at expected frequencies are said to be in "linkage equilibrium”.
- LD refers to any non-random genetic association between allele(s) at two or more different SNP sites, which is generally due to the physical proximity of the two loci along a chromosome. See e.g., U.S. 2008/0299125.
- LD can occur when two or more SNPs sites are in close physical proximity to each other on a given chromosome and therefore alleles at these SNP sites will tend to remain unseparated for multiple generations with the consequence that a particular nucleotide (allele) at one SNP site will show a non-random association with a particular nucleotide (allele) at a different SNP site located nearby. Hence, genotyping one of the SNP sites will give almost the same information as genotyping the other SNP site that is in LD. See e.g., U.S. 2008/0299125.
- a particular SNP site is found to be useful for diagnosing, then the skilled artisan would recognize that other SNP sites which are in LD with this SNP site would also be useful for diagnosing the condition.
- Various degrees of LD can be encountered between two or more SNPs with the result being that some SNPs are more closely associated (i.e., in stronger LD) than others.
- the physical distance over which LD extends along a chromosome differs between different regions of the genome, and therefore the degree of physical separation between two or more SNP sites necessary for LD to occur can differ between different regions of the genome. See e.g., U.S. 2008/0299125.
- Information generated from genomic biomarkers described herein can be used to determine appropriate dosage and/or treatment regimens for an individual with non small cell lung cancer. This knowledge, when applied to dosing or drug selection, can avoid adverse reactions or therapeutic failure and thus enhance therapeutic efficiency when administering a therapeutic composition, such as bexarotene.
- biomarkers disclosed herein and their associated SNPs or genes could also be used to predict patient' s responses to treatment of other diseases or conditions besides non small cell lung cancer.
- diseases include, but are not limited to, prostate cancer, breast cancer, cutaneous T-cell lymphoma, cancer prevention, metabolic syndrome, dermatologic disease, neurodegenerative diseases and disorders such as Alzheimer's disease, which was shown to respond to bexarotene in a mouse model (30).
- PPARy and/or RXR related diseases and disorders can include, but are not limited to, neurodegenerative diseases and disorders, diseases and disorder resulting from trauma and injury, and/or an inflammatory component as well as dermatological diseases and disorders with or without an inflammatory component.
- Neurodegenerative disorders include, but are not limited to, Alzheimer's, Parkinson's, Huntington's Disease, as well as neural diseases and conditions with an inflammatory
- central nervous system injuries including, but not limited to, central nervous system injuries, stroke, ischemic damage to the nervous system, neural trauma (e.g., percussive brain damage, spinal cord injury, and traumatic damage to the nervous system), multiple sclerosis and other immune-mediated neuropathies (e.g., Guillain-Barre syndrome and its variants, acute motor axonal neuropathy, acute inflammatory demyelinating polyneuropathy, and Fisher Syndrome), ⁇ AIDs dementia complex, and bacterial, parasitic, fungal, and viral meningitis and encephalitis.
- neural trauma e.g., percussive brain damage, spinal cord injury, and traumatic damage to the nervous system
- multiple sclerosis and other immune-mediated neuropathies e.g., Guillain-Barre syndrome and its variants, acute motor axonal neuropathy, acute inflammatory demyelinating polyneuropathy, and Fisher Syndrome
- ⁇ AIDs dementia complex bacterial, parasitic, fungal, and viral meningit
- biomarkers disclosed herein and their associated SNPs or genes could also be used to predict patient's responses to treatment of cystic fibrosis (CF) and CF- related disease(s) and disorder(s) (e.g., variant cystic fibrosis and non- CF bronchiectasis inflammatory responses), and inflammatory responses associate with associated with cystic fibrosis-related disease(s) or disorder(s).
- CF cystic fibrosis
- CF- related disease(s) and disorder(s) e.g., variant cystic fibrosis and non- CF bronchiectasis inflammatory responses
- inflammatory responses associate with associated with cystic fibrosis-related disease(s) or disorder(s).
- the biomarkers disclosed herein and their associated SNPs or genes could also be used to predict patient's responses to treatment of dermatological diseases and/or disorders where lipid PPARy -regulated gene expression is decreased (e.g., LPP).
- the treatments of the present invention can include the use of RXR agonist alone or in combination with a PPARy agonist (and optionally a LXR agonist) to suppress, inhibit, or mitigate a diverse range of PPARy and/or RXR related diseases as described above and/or inflammatory responses associated with the PPARy and/or RXR related diseases.
- Pharmacogenomics involves tailoring a treatment for a subject according to the subject's genotype as a particular treatment regimen may exert a differential effect depending upon the subject's genotype.
- a clinician or physician may target pertinent information and preventative or therapeutic treatments to a subject who would be benefited by the information or treatment and avoid directing such information and treatments to a subject who would not be benefited (e.g., the treatment has no therapeutic effect and/or the subject experiences adverse side effects).
- Information generated from pharmacogenomic biomarkers using a method described herein can be used to determine appropriate dosage and treatment regimens for an individual. This knowledge, when applied to dosing or drug selection, can avoid adverse reactions or therapeutic failure and thus enhance therapeutic efficiency when administering a therapeutic composition.
- the pharmacogenomic biomarker may be used to develop a companion diagnostic test.
- a companion diagnostic test using the biomarkers disclosed herein may consider applying knowledge obtained in biomarkers using a method described herein, when determining whether to administer a pharmaceutical composition to a subject.
- a physician or clinician may consider applying such knowledge when determining the dosage, e.g., amount per treatment or frequency of treatments, of a treatment, administered to a patient.
- the invention provides methods for assessing or aiding assessment of responsiveness of a subject to treatment.
- the invention also provides methods for predicting responsiveness or monitoring treatment/responsiveness to a treatment in a subject.
- the invention provides methods for selecting a subject for treatment and treating the subject.
- the methods comprise assessing one or more pharmacogenomic biomarkers in a sample obtained from the subject; and predicting, assessing, or aiding assessment of responsiveness of the subject to a treatment based on the genotype of said one or more pharmacogenomic biomarkers.
- the responsiveness is predicted or assessed by classifying the subject using an algorithm such as SVM, logistic regression, or K-nearest neighbors analysis.
- a particular treatment regimen can exert a differential effect depending upon the subject's genotype.
- a candidate therapeutic exhibits a significant interaction with a major allele and a comparatively weak interaction with a minor allele (e.g., an order of magnitude or greater difference in the interaction)
- such a therapeutic typically would not be administered to a subject genotyped as being homozygous for the minor allele, and sometimes not administered to a subject genotyped as being heterozygous for the minor allele.
- a candidate therapeutic is not significantly toxic when administered to subjects who are homozygous for a major allele but is comparatively toxic when administered to subjects heterozygous or homozygous for a minor allele
- the candidate therapeutic is not typically administered to subjects who are genotyped as being heterozygous or homozygous with respect to the minor allele.
- the methods described herein are applicable to pharmacogenomic methods for preventing, alleviating or treating conditions such as metabolic disorders, cardiovascular diseases, cancers, etc.
- a nucleic acid sample from an individual may be subjected to a prognostic test described herein.
- information for preventing or treating type II diabetes and/or one or more type II diabetes treatment regimens then may be prescribed to that subject.
- a treatment regimen is specifically prescribed and/or administered to individuals who will most benefit from it based upon their likelihood of responding to a treatment regimen assessed by the methods described herein.
- identifying a subject with a high likelihood of responding to a treatment regimen and then prescribing such treatment regimen to individuals identified as having a high likelihood of responding.
- certain embodiments are directed to a method for treating a subject, which comprises: detecting the presence or absence of a pharmacogenomic biomarker associated with responsiveness to a treatment regimen in a nucleotide sequence set forth herein in a nucleic acid sample from a subject, and prescribing or administering the treatment regimen to a subject from whom the sample originated where the presence of a pharmacogenomic biomarker associated with responsiveness to the treatment regimen is detected in the nucleotide sequence.
- the treatment sometimes is preventative (e.g., is prescribed or administered to reduce the probability that a disease condition arises or progresses), sometimes is therapeutic, and sometimes delays, alleviates or halts the progression of a disease condition. Any known preventative or therapeutic treatment for alleviating or preventing the occurrence of a disorder may be prescribed and/or administered.
- Pharmacogenomics methods also may be used to analyze and predict a response to a drug. For example, if pharmacogenomics analysis indicates a likelihood that an individual will respond positively to a treatment with a particular drug, the drug may be administered to the individual. Conversely, if the analysis indicates that an individual is likely to respond negatively to treatment with a particular drug, an alternative course of treatment may be prescribed.
- the response to a therapeutic treatment can be predicted in a background study in which subjects in any of the following populations are genotyped: a population that responds favorably to a treatment regimen, a population that does not respond significantly to a treatment regimen, and a population that responds adversely to a treatment regiment (e.g., exhibits one or more side effects).
- populations are provided as examples and other populations and subpopulations may be analyzed. Based upon the results of these analyses, a subject is genotyped to predict whether he or she will respond favorably to a treatment regimen, not respond significantly to a treatment regimen, or respond adversely to a treatment regimen.
- the comparisons and/or calculations for predicting, assessing or aiding assessment can be carried out in any convenient manner appropriate to the type of measured value and/or reference value for the pharmacogenomic biomarkers at issue.
- the process of comparing or calculating may be manual or it may be automatic (such as by a machine including computer- based machine). As will be apparent to those of skill in the art, replicate genotyping may be taken for the pharmacogenomic biomarkers.
- the pharmacogenomic biomarkers can be used to stratify or select a subject population for a clinical trial.
- the pharmacogenomic biomarkers can, in some embodiments, be used to stratify individuals that may exhibit a toxic response to a treatment from those that will not.
- the pharmacogenomic biomarkers can be used to separate those that will be non-responders from those who will be responders.
- the pharmacogenomic biomarkers described herein can be used in
- another embodiment is a method of selecting an individual for inclusion in a clinical trial of a treatment or drug comprising the steps of: (a) obtaining a nucleic acid sample from an individual; (b) determining the identity of a polymorphic variation which is associated with a positive response to the treatment or the drug, or at least one polymorphic variation which is associated with a negative response to the treatment or the drug in the nucleic acid sample, and (c) including the individual in the clinical trial if the nucleic acid sample contains said polymorphic variation associated with a positive response to the treatment or the drug or if the nucleic acid sample lacks said polymorphic variation associated with a negative response to the treatment or the drug.
- step (c) optionally comprises administering the drug or the treatment to the individual if the nucleic acid sample contains the polymorphic variation associated with a positive response to the treatment or the drug and the nucleic acid sample lacks said biallelic marker associated with a negative response to the treatment or the drug.
- the proximal polymorphic variant identified sometimes is a publicly disclosed polymorphic variant, which for example, sometimes is published in a publicly available database.
- the polymorphic variant identified is not publicly disclosed and is discovered using a known method, including, but not limited to, sequencing a region surrounding the identified pharmacogenomic biomarker in a group of nucleic samples. Thus, multiple polymorphic variants proximal to a biomarker are identified using this method.
- the proximal polymorphic variant often is identified in a region surrounding the biomarker.
- this surrounding region is about 50 kb flanking the biomarker (e.g., about 50 kb 5' of the first polymorphic variant and about 50 kb 3' of the first polymorphic variant), and the region sometimes is composed of shorter flanking sequences, such as flanking sequences of about 40 kb, about 30 kb, about 25 kb, about 20 kb, about 15 kb, about 10 kb, about 7 kb, about 5 kb, or about 2 kb 5' and 3' of the biomarker.
- the region is composed of longer flanking sequences, such as flanking sequences of about 55 kb, about 60 kb, about 65 kb, about 70 kb, about 75 kb, about 80 kb, about 85 kb, about 90 kb, about 95 kb, or about 100 kb 5' and 3' of the biomarker.
- polymorphic variants are identified iteratively. For example, a first proximal polymorphic variant is identified using the methods described above and then another polymorphic variant proximal to the first proximal polymorphic variant is identified (e.g., publicly disclosed or discovered) and the presence or absence of an association of one or more other polymorphic variants proximal to the first proximal polymorphic variant is determined.
- a first proximal polymorphic variant is identified using the methods described above and then another polymorphic variant proximal to the first proximal polymorphic variant is identified (e.g., publicly disclosed or discovered) and the presence or absence of an association of one or more other polymorphic variants proximal to the first proximal polymorphic variant is determined.
- the methods described herein are useful for identifying or discovering additional polymorphic variants that may be used to further characterize a gene, region or loci associated with a condition, a disease, or a disorder.
- allelotyping or genotyping data from the additional polymorphic variants may be used to identify a functional mutation or a region of linkage disequilibrium.
- polymorphic variants identified or discovered within a region comprising the biomarker are genotyped, and it can be determined whether those polymorphic variants are in linkage disequilibrium with the biomarker. The size of the region in linkage disequilibrium with the biomarker also can be assessed using these genotyping methods.
- methods for determining whether a polymorphic variant is in linkage disequilibrium with a biomarker and such information can be used in prognosis/diagnosis methods described herein.
- genes may be identified that are in proximity to the biomarkers, and their functions analyzed. Genes with functions that are directly or indirectly related to the relevant phenotype, or other genes in the same cellular pathway, may be targets for further analysis with the relevant phenotype, and new biomarkers may be identified.
- biomarkers and their associated SNPs or genes could gain insight of the underlying biological pathways or mechanisms underlying the studied phenotypes, such as efficacy, adverse effect, or other endpoints.
- SLC10A2 is an attractive candidate that might be involved in rexinoid-induced hypertriglyceridemia.
- SLC10A2 is a gene responsible for reabsorption of bile acids from the small intestine.
- Bile acids are known to affect serum triglyceride levels (15-18), and as the major component for bile acid uptake, the activity of SLC10A2 is closely related to triglyceride levels (19, 20). Moreover, SLC10A2 is known to be regulated by RXR at the transcriptional level, probably through forming a heterodimer with PPAR , a nuclear receptor known to participate in lipid metabolism (21, 22). Thus the discoveries made in this invention might facilitate developing assays based on SLC10A2 or other genes involved in related pathways, which could lead to design a new generation of RXR agonist with reduced or minimal adverse affect like hypertriglyceridemia.
- LCP1 Another associated locus identified in this invention, rs7334509, is located near LCP1, which is also called L-Plastin.
- Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. These proteins share the unique property of cross-linking actin filaments into tight bundles, and they are primarily involved in regulation of the actin cytoskeleton. L-Plastin is predominantly expressed in hematopoietic cells, but has also been shown to be expressed in most human cancer cells and might be involved in DNA repair, tumor cell migration and invasion (23, 24).
- kits, chips, devices, or assays for use in accordance with the present invention.
- Such an assay, chip, device, or a kit may comprise a plurality of primers or probes to detect genetic signature of SNPs such the ones listed in Table 2 and Table 3.
- Such methods can include instruments and instructions that a subject can use to obtain a sample, e.g., of buccal cells or blood, without the aid of a health care provider.
- the invention also contemplates the development of computer algorithm which will convert the test results generated from the measurement of the genomic biomarkers into an output, e.g. , a score, (See e.g. , Figure 4), which will be used to determine in whether an individual should receive the therapeutic invention, such as bexarotene treatment.
- a score See e.g. , Figure 4
- Diagnostic kits based on the biomarkers described above might be developed, and they can be used to predict individual's response to the corresponding drug.
- Such test kits can include devices and instructions that a subject can use to obtain a sample, e.g., of buccal cells or blood, without the aid of a health care provider.
- kits or articles of manufacture are also provided by the invention.
- Such kits may comprise at least one reagent specific for genotyping a biomarker described herein, and may further include instructions for carrying out a method described herein.
- the invention provides compositions and kits comprising primers and primer pairs, which allow the specific amplification of the polynucleotides of the invention or of any specific parts thereof, and probes that selectively or specifically hybridize to nucleic acid molecules of the invention or to any part thereof.
- Probes may be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
- a detectable marker such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
- Such probes and primers can be used to detect the presence of polynucleotides in a sample and as a means for detecting cell expressing proteins encoded by the polynucleotides.
- the kit may comprise reagents for detecting presence of polypeptides.
- reagents may be antibodies or other binding molecules that specifically bind to a polypeptide.
- such antibodies or binding molecules may be capable of distinguishing a structural variation to the polypeptide as a result of polymorphism, and thus may be used for genotyping.
- the antibodies or binding molecules may be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
- a detectable marker such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
- Other reagents for performing binding assays, such as ELISA, may be included in the kit.
- kits comprise reagents for genotyping at least two, at least three, at least five, at least ten, or more biomarkers.
- the kits may further comprise a surface or substrate (such as a microarray) for capture probes for detecting of amplified nucleic acids.
- kits may further comprise a carrier means being compartmentalized to receive in close confinement one or more container means such as vials, tubes, and the like, each of the container means comprising one of the separate elements to be used in the method.
- container means such as vials, tubes, and the like
- each of the container means comprising one of the separate elements to be used in the method.
- one of the container means may comprise a probe that is or can be detectably labeled.
- probe may be a polynucleotide specific for a biomarker.
- the kit may also have containers containing nucleotide(s) for amplification of the target nucleic acid sequence and/or a container comprising a reporter-means, such as a biotin-binding protein, such as avidin or streptavidin, bound to a reporter molecule, such as an enzymatic, florescent, or radioisotope label.
- a reporter-means such as a biotin-binding protein, such as avidin or streptavidin
- the kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
- a label may be present on the container to indicate that the composition is used for a specific therapy or non-therapeutic application, and may also indicate directions for either in vivo or in vitro use, such as those described above.
- the kit can further comprise a set of instructions and materials for preparing a tissue or cell sample and preparing nucleic acids (such as genomic DNA) from the sample.
- nucleic acids such as genomic DNA
- the invention provides a variety of compositions suitable for use in performing methods of the invention, which may be used in kits.
- the invention provides surfaces, such as arrays that can be used in such methods.
- an array of the invention comprises individual or collections of nucleic acid molecules useful for detecting pharmacogenomic biomarkers of the invention.
- an array of the invention may comprises a series of discretely placed individual nucleic acid oligonucleotides or sets of nucleic acid oligonucleotide combinations that are hybridizable to a sample comprising target nucleic acids, whereby such hybridization is indicative of genotypes of the pharmacogenomic biomarkers of the invention.
- nucleic acids attaching nucleic acids to a solid substrate such as a glass slide.
- One method is to incorporate modified bases or analogs that contain a moiety that is capable of attachment to a solid substrate, such as an amine group, a derivative of an amine group or another group with a positive charge, into nucleic acid molecules that are synthesized.
- the synthesized product is then contacted with a solid substrate, such as a glass slide, which is coated with an aldehyde or another reactive group which will form a covalent link with the reactive group that is on the amplified product and become covalently attached to the glass slide.
- Other methods such as those using amino propryl silica surface chemistry are also known in the art, as disclosed at world wide web at cmt.corning.com and cmgm.stanford.edu/pbrownl.
- Attachment of groups to oligonucleotides which could be later converted to reactive groups is also possible using methods known in the art. Any attachment to nucleotides of oligonucleotides will become part of oligonucleotide, which could then be attached to the solid surface of the microarray. Amplified nucleic acids can be further modified, such as through cleavage into fragments or by attachment of detectable labels, prior to or following attachment to the solid substrate, as required and/or permitted by the techniques used.
- Example 1 The following example is offered to illustrate but not to limit the invention. Example 1
- DNA preparation DNA was extracted from plasma samples with the QIAGEN QIAamp MinElute Virus Spin Kit (Valencia, CA, USA). DNA samples were amplified using the Amersham Bioscience GenomiPhi DNA Amplification Kit (Piscataway, NJ, USA).
- Stage I 150 samples were genotyped using the Affymetrix GeneChip 500K Mapping Array Set containing 500,000 SNPs following Affymetrix standard protocol (Santa Clara, CA, USA). From the genome-wide scan results, 255 SNPs were selected for Stage II study using Sequenom iPLEXTM assays (Sequenom, San Diego, CA, USA). These assays were used to genotype 400 DNA samples from the SPIRIT trials. Among them, 147 samples out of the 150 samples used in Stage I were selected as the verification group, and the other 253 samples were used as the replication group ( Figure IB).
- the human breast cancer cell line MDA-MB-231 was obtained from the American Type Culture Collection (Manassas, VA, USA), and MDA-MB -231 cells were routinely cultured in RPMI-1640 supplemented with 10% fetal bovine serum and 2 mM glutamine in 5% C02. Bexarotene was synthesized at Ligand Pharmaceuticals Inc. (San Diego, CA, USA), and paclitaxel was purchased from Sigma Chemicals (St. Louis, MO, USA). The protocol for establishment of paclitaxel-resistant MDA-MB-231 cells and resensitization to paclitaxel by bexarotene treatment was described previously (5).
- MDA-MB-231 cells were exposed to regimens on a 10-day cycle: a 3-day treatment with 30 nM paclitaxel followed by a 7-day exposure to control medium.
- Paclitaxel-resistant MDA-MB-231 cells (MDA-PR) were established within 8 cycles of such treatment (3 days on and 7 days off; total of 80 days).
- MDA-PR cells were then treated with the combination of 30 nM paclitaxel (3 days on and 7 days off) in the absence or presence of 1 ⁇ Targretin (10 days on) in a new 10-day cycle for 3 months.
- MDA-PR cells thus treated became re-sensitized to paclitaxel. Meanwhile, the regimen including paclitaxel alone had no effect on the growth of MDA-PR cells.
- RNA microarray RNA was extracted from parent and paclitaxel-resistant MDA- MB-231 breast cancer cells treated with vehicle control, paclitaxel alone or with bexarotene as described in previous section (Paclitaxel resistant MDA-MB-231 cells and resensitization with bexarotene treatment). All RNA samples had satisfactory 28S/18S ratio when analyzed with 2100 Bioanalyzer (Agilent, Palo Alto, CA, USA). A single probe was prepared for each RNA sample and hybridized to a single array using the standard protocol and reagents supplied by Affymetrix, and the probe was then hybridized to Affymetrix HG-U133A array (22,283 probe sets).
- Plasma samples from 403 patients who participated in the SPIRIT I and II trials were available for our study, and they were divided into high, middle and low groups based on their percentile of maximum triglyceride level exhibited during bexarotene treatment (Table 1). This grouping strategy mimicked the grouping method illustrated in the survival analysis reported earlier (9, 10) and shown in Figure 1A, in which distinct survival results were observed when patients were divided into three groups based on their absolute triglyceride levels reached following bexarotene treatment.
- Stage I 74 samples were randomly selected from the high HTG (case) and 76 samples were selected from the low HTG (control) subgroups, and they were genotyped with Affymetrix 500K SNP array ( Figure IB). From the initial genome-wide scan, 255 SNPs were selected for the Stage II genotyping study using all except 3 available clinical samples with Sequenom iPLEX assays. Among the 400 samples, 147 samples (73 cases + 74 controls) were selected as the verification group, and the other 253 samples (76 cases + 48 controls + 129 HTG Mid) were termed the replication group ( Figure IB). To perform association analysis, p-values were first calculated based on the allelic frequency differences between cases and controls (Table 2).
- Genotypic tests were also performed using triglyceride percentile as the quantitative trait in the three groups (Table 3). For this analysis, individuals with the middle level of triglyceride percentile were included in the replication group. Significant associations were declared for SNPs with p-values ⁇ 0.05. By combining these two approaches and criteria for significance, 14 SNPs showing significant associations with triglyceride level were found (Table 2, 3).
- hypertriglyceridemia (Table 2, 3) are located on 9 loci.
- Four significantly associated SNPs are located within the same linkage disequilibrium (LD) block on chromosome 13 ( Figure 2). This region lies approximately 200 kb upstream of SLC10A2, a gene responsible for reabsorption of bile acids from the small intestine.
- the second region with multiple SNPs showing a strong association is located on chromosome 12, where rsl795505 and rsl 184776 are only about 5000 nucleotides apart.
- Both SNPs lie in the intron region of Lin-7 homolog A (Lin7A), but this region is in an LD block containing the 2nd and 3rd exons of the Lin7A gene.
- rs7334509 lies between LCPl and carboxypeptidase B2 (CBP2), and resides in an LD block containing the 3' half of the LCPl (Figure 3A).
- CBP2 carboxypeptidase B2
- Bexarotene has been shown to resensitize breast cancer cells which had become chemo resistant after prolonged treatment with chemotherapy agents, such as paclitaxel (5).
- chemotherapy agents such as paclitaxel
- Figure 3B Examination of gene expression data from the microarray study with MDA-PR cells resistant to paclitaxel revealed that LCPl, which lies close to rs7334509, was up-regulated by co-treatment with bexarotene (Figure 3B).
- PELO encodes a protein which contains a conserved nuclear localization signal
- ITGA1 encodes the alpha 1 subunit of integrin receptors. No known gene was found to reside in the vicinity of rsl506011.
- rs7434820 FLJ46481
- rsl051853 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1
- rs2631686 polycomb group ring finger 5 (PCGF5) exhibit modest association with hypertriglyceridemia.
- RXR is able to form heterodimers with a number of nuclear receptors, such as retinoid acid receptors, PPAR, LXR, and FXR, and is a pleiotropic regulator involved in many biological pathways.
- nuclear receptors such as retinoid acid receptors, PPAR, LXR, and FXR
- RXR-specific agonists such as bexarotene
- SLC10A2 is an attractive candidate that might be involved in rexinoid-induced hypertriglyceridemia.
- SLC10A2 is a gene responsible for reabsorption of bile acids from the small intestine. Bile acids are known to affect serum triglyceride levels (15-18), and as the major component for bile acid uptake, the activity of SLC10A2 is closely related to triglyceride levels (19, 20).
- SLC10A2 is known to be regulated by RXR at the transcriptional level, probably through forming a heterodimer with PPAR , a nuclear receptor known to participate in lipid metabolism (21, 22). Down-stream conversion of triglycerides into fatty acids also generates signaling molecules that activate a number of nuclear receptors, many of which form heterodimer partners with the RXR receptors, potentially triggering other cellular mechanisms controlling cancer cell growth.
- LCP1 L-Plastin
- Plastins are a family of actin- binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. These proteins share the unique property of cross-linking actin filaments into tight bundles, and they are primarily involved in regulation of the actin cytoskeleton.
- L-Plastin is predominantly expressed in hematopoietic cells, but has also been shown to be expressed in most human cancer cells and might be involved in DNA repair, tumor cell migration and invasion (23, 24).
- expression of LCP1 in the paclitaxel-resistant MDA-PR cell line was significantly up-regulated by a combination of bexarotene and paclitaxel treatment. This result implies that LCP1 might be involved in the antitumor action exerted by bexarotene.
- Recent studies have found both actin and tubulin to be involved in tumor cell-resistance to chemotherapy (25-27).
- the LCP1 polymorphism identified in this study may causally or functionally influence individual responses to bexarotene as an antitumor agent.
- genotype call rates in our study are lower than the typical call rates for other genotyping studies where DNA was extracted from optimal DNA sources such as whole blood.
- Detailed analysis of the genotyping raw data generated from iPLEX assays showed that many of the no calls were due to very low or no signal from either allele, but reliable genotype calls still could be made when signals are substantially higher than background noise (data not shown).
- Studies from Lu et al. and Park et al. on whole genome amplification samples also showed that high concordance genotype calls could be obtained from samples with low overall call rates (28, 29).
- Plasma samples were not collected from patients in the chemotherapy-only control groups.
- the correlation between survival and triglyceride level induced by bexarotene was observed in two very large, randomized, independent phase III trials (9, 10) which evaluated different chemo therapy agents with or without bexarotene across nearly 250 clinical sites worldwide.
- the patient populations were very uniform due to the strict inclusion criteria, and all patients had advanced stage Illb or stage IV NSCLC qualifying for first-line treatment.
- ⁇ NA No mean available because there is only one sample in this genotype.
- the p-values which are lower than 0.05 are highlighted in bold, and the associated SNPs that met this threshold in all three tests are indicated with an asterisk.
- the two alleles are represented by A and B, thus homozygous are AA and BB, and heterozygous are represented by AB.
- Average of triglyceride levels in patients carrying the indicated genotype are listed under "Mean TRIG" column.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Medical Informatics (AREA)
- Diabetes (AREA)
- Hospice & Palliative Care (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Oncology (AREA)
- General Engineering & Computer Science (AREA)
- Cell Biology (AREA)
- Databases & Information Systems (AREA)
- Data Mining & Analysis (AREA)
- Epidemiology (AREA)
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020147000545A KR20140039278A (ko) | 2011-06-08 | 2012-06-07 | 레티노이드 x 수용체 모듈레이터 활성 예측 방법 및 조성물 |
| AU2012267877A AU2012267877B2 (en) | 2011-06-08 | 2012-06-07 | Methods and compositions of predicting activity of retinoid X receptor modulator |
| BR112013031221A BR112013031221A2 (pt) | 2011-06-08 | 2012-06-07 | métodos e composições para prever a atividade do modulador de receptor retinóide x |
| EP12797326.1A EP2718486A4 (en) | 2011-06-08 | 2012-06-07 | METHODS AND COMPOSITIONS FOR PREDICTING THE ACTIVITY OF A RETINOID RECEPTOR X MODULATOR |
| RU2013158861/10A RU2013158861A (ru) | 2011-06-08 | 2012-06-07 | Способы и композиции для предсказания активности модулятора ретиноидного х-рецептора |
| MX2013014437A MX2013014437A (es) | 2011-06-08 | 2012-06-07 | Metodos y composiciones para predecir la actividad del modulador de receptor x de retinoide. |
| US14/124,668 US10202652B2 (en) | 2011-06-08 | 2012-06-07 | Methods and compositions of predicting activity of retinoid X receptor modulator |
| CA2838207A CA2838207A1 (en) | 2011-06-08 | 2012-06-07 | Methods and compositions of predicting activity of retinoid x receptor modulator |
| SG2013087861A SG195191A1 (en) | 2011-06-08 | 2012-06-07 | Methods and compositions of predicting activity of retinoid x receptor modulator |
| CN201280027212.8A CN103649386B (zh) | 2011-06-08 | 2012-06-07 | 预测类视黄醇x受体调节剂活性的方法和组合物 |
| JP2014514846A JP2014524735A (ja) | 2011-06-08 | 2012-06-07 | レチノイドxレセプターの調節因子の活性を予測する方法および組成物 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161494773P | 2011-06-08 | 2011-06-08 | |
| US61/494,773 | 2011-06-08 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012170704A2 true WO2012170704A2 (en) | 2012-12-13 |
| WO2012170704A3 WO2012170704A3 (en) | 2013-01-31 |
Family
ID=47296742
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/041379 Ceased WO2012170704A2 (en) | 2011-06-08 | 2012-06-07 | Methods and compositions of predicting activity of retinoid x receptor modulator |
Country Status (12)
| Country | Link |
|---|---|
| US (1) | US10202652B2 (https=) |
| EP (1) | EP2718486A4 (https=) |
| JP (1) | JP2014524735A (https=) |
| KR (1) | KR20140039278A (https=) |
| CN (1) | CN103649386B (https=) |
| AU (1) | AU2012267877B2 (https=) |
| BR (1) | BR112013031221A2 (https=) |
| CA (1) | CA2838207A1 (https=) |
| MX (1) | MX2013014437A (https=) |
| RU (1) | RU2013158861A (https=) |
| SG (1) | SG195191A1 (https=) |
| WO (1) | WO2012170704A2 (https=) |
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015073896A3 (en) * | 2013-11-15 | 2015-07-16 | Psma Development Company, Llc | Biomarkers for psma targeted therapy for prostate cancer |
| WO2016073855A1 (en) * | 2014-11-07 | 2016-05-12 | Ngm Biopharmaceuticals, Inc. | Methods for treatment of bile acid-related disorders and prediction of clinical sensitivity to treatment of bile acid-related disorders |
| US9670260B2 (en) | 2011-07-01 | 2017-06-06 | Ngm Biopharmaceuticals, Inc. | Compositions comprising fusion variants of FGF19 polypeptides |
| US9878009B2 (en) | 2012-12-27 | 2018-01-30 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having error of bile acid synthesis |
| US9925242B2 (en) | 2012-12-27 | 2018-03-27 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for treatment of nonalcoholic steatohepatitis |
| US9963494B2 (en) | 2012-11-28 | 2018-05-08 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for reducing glucose levels in a subject |
| CN108504733A (zh) * | 2017-11-29 | 2018-09-07 | 中山拓普基因科技有限公司 | 肿瘤个体化化疗用药指导基因snp位点检测组合物 |
| US10093735B2 (en) | 2014-01-24 | 2018-10-09 | Ngm Biopharmaceuticals, Inc. | Beta-klotho binding proteins |
| US10369199B2 (en) | 2013-10-28 | 2019-08-06 | Ngm Biopharmaceuticals, Inc. | Methods of using variants of FGF19 polypeptides for the treatment of cancer |
| US10398758B2 (en) | 2014-05-28 | 2019-09-03 | Ngm Biopharmaceuticals, Inc. | Compositions comprising variants of FGF19 polypeptides and uses thereof for the treatment of hyperglycemic conditions |
| US10456449B2 (en) | 2014-06-16 | 2019-10-29 | Ngm Biopharmaceuticals, Inc. | Methods and uses for modulating bile acid homeostasis and treatment of bile acid disorders and diseases |
| US10517929B2 (en) | 2014-10-23 | 2019-12-31 | Ngm Biopharmaceuticals, Inc. | Pharmaceutical compositions comprising FGF19 variants |
| US10744185B2 (en) | 2015-11-09 | 2020-08-18 | Ngm Biopharmaceuticals, Inc. | Methods of using variants of FGF19 polypeptides for the treatment of pruritus |
| US10800843B2 (en) | 2015-07-29 | 2020-10-13 | Ngm Biopharmaceuticals, Inc. | Beta klotho-binding proteins |
| US11066454B2 (en) | 2012-11-28 | 2021-07-20 | Ngm Biopharmaceuticals, Inc. | Compositions comprising variants and fusions of FGF19 polypeptides |
| US11089959B2 (en) * | 2013-03-15 | 2021-08-17 | I2Dx, Inc. | Electronic delivery of information in personalized medicine |
| US11370841B2 (en) | 2016-08-26 | 2022-06-28 | Ngm Biopharmaceuticals, Inc. | Methods of treating fibroblast growth factor 19-mediated cancers and tumors |
| US11419497B2 (en) * | 2013-03-15 | 2022-08-23 | I2Dx, Inc. | Electronic delivery of information in personalized medicine |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104131102B (zh) * | 2014-08-07 | 2016-06-15 | 马飞 | 一种判断nsclc患者对吉非替尼治疗反应性的试剂盒 |
| JOP20190025A1 (ar) * | 2016-09-01 | 2019-02-19 | Denovo Biopharma Llc | طرق وتركيبة لتوقع نشاط إنزاستورين |
| WO2019044852A1 (ja) * | 2017-08-31 | 2019-03-07 | 株式会社資生堂 | レチノイドの副作用に対する感受性の決定方法 |
| KR102169699B1 (ko) * | 2019-12-27 | 2020-10-23 | 주식회사 클리노믹스 | 유전자 검사를 위한 맞춤형 유전자칩 및 이의 제작 방법 |
| CA3174572A1 (en) | 2020-03-06 | 2021-09-10 | Denovo Biopharma Llc | Compositions and methods for assessing the efficacy of inhibitors of neurotransmitter transporters |
| KR20250118433A (ko) * | 2024-01-30 | 2025-08-06 | 서울대학교산학협력단 | 알츠하이머병 발병 위험도 예측을 위한 레이 복잡도 복사 점수 저하와 관련이 있는 단일염기다형성 마커 및 이의 용도 |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007038670A2 (en) | 2005-09-30 | 2007-04-05 | Perlegen Sciences, Inc. | Methods and compositions for screening and treatment of disorders of blood glucose regulation |
| CN101316583A (zh) * | 2005-09-30 | 2008-12-03 | 生命医药公司 | 用特异性rxr激动剂治疗癌症 |
| US20080299125A1 (en) | 2006-06-05 | 2008-12-04 | Perlegen Sciences, Inc. | Genetic basis of treatment response in depression patients |
| WO2009134774A1 (en) | 2008-04-28 | 2009-11-05 | Expression Analysis | Methods and systems for simultaneous allelic contrast and copy number association in genome-wide association studies |
| WO2011006157A2 (en) | 2009-07-10 | 2011-01-13 | Case Western Reserve University | Rxr agonist compounds and methods |
| EP2494077A4 (en) * | 2009-10-27 | 2013-08-21 | Caris Mpi Inc | MOLECULAR PROFILING FOR PERSONALIZED MEDICINE |
| US7790396B1 (en) | 2009-12-23 | 2010-09-07 | Suregene, Llc | Methods and compositions for the treatment of psychotic disorders through the identification of the SULT4A1-1 haplotype |
-
2012
- 2012-06-07 CA CA2838207A patent/CA2838207A1/en not_active Abandoned
- 2012-06-07 BR BR112013031221A patent/BR112013031221A2/pt not_active IP Right Cessation
- 2012-06-07 SG SG2013087861A patent/SG195191A1/en unknown
- 2012-06-07 MX MX2013014437A patent/MX2013014437A/es not_active Application Discontinuation
- 2012-06-07 US US14/124,668 patent/US10202652B2/en active Active
- 2012-06-07 RU RU2013158861/10A patent/RU2013158861A/ru not_active Application Discontinuation
- 2012-06-07 JP JP2014514846A patent/JP2014524735A/ja active Pending
- 2012-06-07 CN CN201280027212.8A patent/CN103649386B/zh not_active Expired - Fee Related
- 2012-06-07 WO PCT/US2012/041379 patent/WO2012170704A2/en not_active Ceased
- 2012-06-07 AU AU2012267877A patent/AU2012267877B2/en not_active Ceased
- 2012-06-07 KR KR1020147000545A patent/KR20140039278A/ko not_active Withdrawn
- 2012-06-07 EP EP12797326.1A patent/EP2718486A4/en not_active Ceased
Non-Patent Citations (1)
| Title |
|---|
| See references of EP2718486A4 * |
Cited By (37)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9670260B2 (en) | 2011-07-01 | 2017-06-06 | Ngm Biopharmaceuticals, Inc. | Compositions comprising fusion variants of FGF19 polypeptides |
| US9751924B2 (en) | 2011-07-01 | 2017-09-05 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising fusion variants of FGF19 polypeptides for reducing glucose levels in a subject |
| US11065302B2 (en) | 2011-07-01 | 2021-07-20 | Ngm Biopharmaceuticals, Inc. | Compositions comprising fusion variants of FGF19 polypeptides |
| US10413590B2 (en) | 2011-07-01 | 2019-09-17 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants of FGF19 polypeptides for reducing body mass in a subject |
| US9963494B2 (en) | 2012-11-28 | 2018-05-08 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for reducing glucose levels in a subject |
| US11066454B2 (en) | 2012-11-28 | 2021-07-20 | Ngm Biopharmaceuticals, Inc. | Compositions comprising variants and fusions of FGF19 polypeptides |
| US10758590B2 (en) | 2012-11-28 | 2020-09-01 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF 19 polypeptides for treating diabetes |
| US11103554B2 (en) | 2012-12-27 | 2021-08-31 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants of FGF19 polypeptides for reducing bile acid synthesis in a subject having cirrhosis |
| US9889177B2 (en) | 2012-12-27 | 2018-02-13 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having primary sclerosing cholangitis |
| US9925242B2 (en) | 2012-12-27 | 2018-03-27 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for treatment of nonalcoholic steatohepatitis |
| US9889178B2 (en) | 2012-12-27 | 2018-02-13 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having nonalcoholic steatohepatitis |
| US9974833B2 (en) | 2012-12-27 | 2018-05-22 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having pregnancy intrahepatic cholestasis |
| US9878009B2 (en) | 2012-12-27 | 2018-01-30 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having error of bile acid synthesis |
| US9878008B2 (en) | 2012-12-27 | 2018-01-30 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having bile acid diarrhea or bile acid malabsorption |
| US11564972B2 (en) | 2012-12-27 | 2023-01-31 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants of FGF19 polypeptides for treating primary biliary cirrhosis in a subject |
| US9895416B2 (en) | 2012-12-27 | 2018-02-20 | Ngm Biopharmaceuticals, Inc. | Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having cholestasis |
| US11419497B2 (en) * | 2013-03-15 | 2022-08-23 | I2Dx, Inc. | Electronic delivery of information in personalized medicine |
| US12312639B2 (en) | 2013-03-15 | 2025-05-27 | I2Dx, Inc. | Alzheimer's disease personalized medicine |
| US11089959B2 (en) * | 2013-03-15 | 2021-08-17 | I2Dx, Inc. | Electronic delivery of information in personalized medicine |
| US10369199B2 (en) | 2013-10-28 | 2019-08-06 | Ngm Biopharmaceuticals, Inc. | Methods of using variants of FGF19 polypeptides for the treatment of cancer |
| WO2015073896A3 (en) * | 2013-11-15 | 2015-07-16 | Psma Development Company, Llc | Biomarkers for psma targeted therapy for prostate cancer |
| US11596676B2 (en) | 2014-01-24 | 2023-03-07 | Ngm Biopharmaceuticals, Inc. | Methods of treating nonalcoholic steatohepatitis comprising administering an anti-human beta klotho antibody or binding fragment thereof |
| US10744191B2 (en) | 2014-01-24 | 2020-08-18 | Ngm Biopharmaceuticals, Inc. | Beta klotho-binding proteins and methods of use thereof |
| US10093735B2 (en) | 2014-01-24 | 2018-10-09 | Ngm Biopharmaceuticals, Inc. | Beta-klotho binding proteins |
| US12378312B2 (en) | 2014-01-24 | 2025-08-05 | Ngm Biopharmaceuticals, Inc. | Polynucleotides encoding human beta klotho antibodies or binding fragments thereof and methods of use thereof |
| US10398758B2 (en) | 2014-05-28 | 2019-09-03 | Ngm Biopharmaceuticals, Inc. | Compositions comprising variants of FGF19 polypeptides and uses thereof for the treatment of hyperglycemic conditions |
| US11241481B2 (en) | 2014-06-16 | 2022-02-08 | Ngm Biopharmaceuticals, Inc. | Methods and uses for modulating bile acid homeostasis and treatment of bile acid disorders and diseases |
| US10456449B2 (en) | 2014-06-16 | 2019-10-29 | Ngm Biopharmaceuticals, Inc. | Methods and uses for modulating bile acid homeostasis and treatment of bile acid disorders and diseases |
| US10517929B2 (en) | 2014-10-23 | 2019-12-31 | Ngm Biopharmaceuticals, Inc. | Pharmaceutical compositions comprising FGF19 variants |
| WO2016073855A1 (en) * | 2014-11-07 | 2016-05-12 | Ngm Biopharmaceuticals, Inc. | Methods for treatment of bile acid-related disorders and prediction of clinical sensitivity to treatment of bile acid-related disorders |
| US11141460B2 (en) | 2014-11-07 | 2021-10-12 | Ngm Biopharmaceuticals, Inc. | Methods for treatment of bile acid-related disorders and prediction of clinical sensitivity to treatment of bile acid-related disorders |
| US10434144B2 (en) | 2014-11-07 | 2019-10-08 | Ngm Biopharmaceuticals, Inc. | Methods for treatment of bile acid-related disorders and prediction of clinical sensitivity to treatment of bile acid-related disorders |
| US10800843B2 (en) | 2015-07-29 | 2020-10-13 | Ngm Biopharmaceuticals, Inc. | Beta klotho-binding proteins |
| US11667708B2 (en) | 2015-07-29 | 2023-06-06 | Ngm Biopharmaceuticals, Inc. | Anti-human beta klotho antibody or binding fragment thereof and methods of their use |
| US10744185B2 (en) | 2015-11-09 | 2020-08-18 | Ngm Biopharmaceuticals, Inc. | Methods of using variants of FGF19 polypeptides for the treatment of pruritus |
| US11370841B2 (en) | 2016-08-26 | 2022-06-28 | Ngm Biopharmaceuticals, Inc. | Methods of treating fibroblast growth factor 19-mediated cancers and tumors |
| CN108504733A (zh) * | 2017-11-29 | 2018-09-07 | 中山拓普基因科技有限公司 | 肿瘤个体化化疗用药指导基因snp位点检测组合物 |
Also Published As
| Publication number | Publication date |
|---|---|
| RU2013158861A (ru) | 2015-07-20 |
| MX2013014437A (es) | 2015-03-20 |
| KR20140039278A (ko) | 2014-04-01 |
| SG195191A1 (en) | 2013-12-30 |
| EP2718486A2 (en) | 2014-04-16 |
| CN103649386A (zh) | 2014-03-19 |
| US10202652B2 (en) | 2019-02-12 |
| AU2012267877A1 (en) | 2014-01-23 |
| EP2718486A4 (en) | 2014-12-31 |
| US20150368720A1 (en) | 2015-12-24 |
| AU2012267877B2 (en) | 2015-12-24 |
| CA2838207A1 (en) | 2012-12-13 |
| CN103649386B (zh) | 2015-12-23 |
| JP2014524735A (ja) | 2014-09-25 |
| WO2012170704A3 (en) | 2013-01-31 |
| BR112013031221A2 (pt) | 2017-01-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2012267877B2 (en) | Methods and compositions of predicting activity of retinoid X receptor modulator | |
| US20210108266A1 (en) | Method for discovering pharmacogenomic biomarkers | |
| US20160222468A1 (en) | Diagnosis, prognosis and treatment of glioblastoma multiforme | |
| EP3507384B1 (en) | Methods and composition for the prediction of the activity of enzastaurin | |
| KR20230005816A (ko) | 신경전달물질 수송체 억제제의 효능을 평가하기 위한 조성물 및 방법 | |
| US20120190656A1 (en) | Methods for selecting therapies to improve hdl cholesterol and triglyceride levels | |
| WO2015168252A1 (en) | Mitochondrial dna copy number as a predictor of frailty, cardiovascular disease, diabetes, and all-cause mortality | |
| KR20170049768A (ko) | 피부 색상 및 흑화 민감도 진단용 단일염기다형성 마커 및 이의 용도 | |
| KR102134176B1 (ko) | Arid3a의 다형성을 이용한 비소세포폐암의 예후 진단 방법 | |
| KR20170114702A (ko) | 폐암 환자의 생존 예측용 slc5a10 다형성 마커 및 이를 이용한 폐암 생존 예후의 예측 방법 | |
| HK1196399B (en) | Method for discovering pharmacogenomic biomarkers | |
| HK1196399A (en) | Method for discovering pharmacogenomic biomarkers | |
| HK40011257A (en) | Methods and composition for the prediction of the activity of enzastaurin | |
| HK40011257B (en) | Methods and composition for the prediction of the activity of enzastaurin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12797326 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase in: |
Ref document number: 2838207 Country of ref document: CA |
|
| ENP | Entry into the national phase in: |
Ref document number: 2014514846 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2013/014437 Country of ref document: MX |
|
| NENP | Non-entry into the national phase in: |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2012797326 Country of ref document: EP |
|
| ENP | Entry into the national phase in: |
Ref document number: 20147000545 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase in: |
Ref document number: 2013158861 Country of ref document: RU Kind code of ref document: A |
|
| ENP | Entry into the national phase in: |
Ref document number: 2012267877 Country of ref document: AU Date of ref document: 20120607 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14124668 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112013031221 Country of ref document: BR |
|
| ENP | Entry into the national phase in: |
Ref document number: 112013031221 Country of ref document: BR Kind code of ref document: A2 Effective date: 20131204 |