WO2012157742A1 - VECTEUR RÉTROVIRAL POUR L'EXPRESSION D'ARNsi - Google Patents

VECTEUR RÉTROVIRAL POUR L'EXPRESSION D'ARNsi Download PDF

Info

Publication number
WO2012157742A1
WO2012157742A1 PCT/JP2012/062771 JP2012062771W WO2012157742A1 WO 2012157742 A1 WO2012157742 A1 WO 2012157742A1 JP 2012062771 W JP2012062771 W JP 2012062771W WO 2012157742 A1 WO2012157742 A1 WO 2012157742A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
gene
cell
tcr
cells
Prior art date
Application number
PCT/JP2012/062771
Other languages
English (en)
Japanese (ja)
Inventor
幸子 岡本
峰野　純一
Original Assignee
タカラバイオ株式会社
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by タカラバイオ株式会社 filed Critical タカラバイオ株式会社
Priority to JP2013515216A priority Critical patent/JP5969468B2/ja
Publication of WO2012157742A1 publication Critical patent/WO2012157742A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/50—Biochemical production, i.e. in a transformed host cell
    • C12N2330/51—Specially adapted vectors

Definitions

  • the present invention relates to a retroviral vector that generates siRNA that induces RNA interference in a mammalian cell and expresses a desired gene, a method for producing a transgenic cell using the vector, and a transgenic cell.
  • RNA interference is a double-stranded RNA (hereinafter referred to as “dsRNA”) consisting of a sense RNA consisting of a sequence homologous to the mRNA of the target gene and an antisense RNA consisting of a complementary sequence thereto. Is a phenomenon that can induce the destruction of mRNA of a target gene and suppress the expression of the target gene.
  • RNA interference has attracted attention as a simple method for inhibiting gene function or as a method applicable to gene therapy.
  • RNA interference is a phenomenon that was initially discovered in nematodes (see Non-Patent Document 1), but is now observed in various organisms such as plants, protozoa, insects, and mammals. Suppression of gene expression by RNA interference is called gene knockdown.
  • siRNA short interfering RNA
  • RISC RNA induced silencing complex
  • siRNA was generated from single-stranded short hairpin (hereinafter referred to as “sh”) RNA forming a stem-loop structure, and was reported to be effective in inducing RNA interference (non-patented). Reference 3). Based on this result, shRNA-expressing vectors are now an important tool for analysis and use of RNA interference.
  • An object of the present invention is to provide a retroviral vector for introducing and expressing a foreign gene into a cell and further transcribe RNA that induces RNA interference in the cell to suppress the expression of a specific endogenous gene. There is to do.
  • the present inventors have found a retrovirus vector that can achieve both the expression of the introduced gene and the suppression of the expression of the endogenous gene by RNA interference, and completed the present invention.
  • a method for producing a transgenic cell comprising a step of introducing the retroviral vector according to any one of [1] to [6] into a cell, [8] The method for producing a transgenic cell according to [7], wherein the cells are T cells or a cell population containing T cells, [9] A gene-transferred cell into which the retroviral vector according to any one of [1] to [6] is introduced, [10] The transgenic cell according to [9], wherein the cell is T cell or a cell population containing T cell.
  • a retroviral vector having an ability to efficiently express a desired gene and efficiently suppress the expression of a specific gene, a method for producing a gene-transferred cell using the vector, and a cell into which the vector has been introduced Is provided.
  • These retroviral vectors, gene-transfected cell production methods and gene-introduced cells are extremely useful for protein production, disease treatment by cell therapy, and research and testing therefor.
  • LTR Long Terminal Repeat
  • U3 includes a transcriptional enhancer sequence and a promoter sequence.
  • the “packaging signal sequence” is also referred to as “psi sequence” or “ ⁇ sequence”, and is necessary for encapsidation of retroviral RNA strands and packaging into virus particles in the formation of virus particles.
  • SD main splice donor
  • the “splice acceptor (SA) sequence” refers to a splice site that is a boundary site between an intron and an exon in an RNA processing reaction in which an intron existing in RNA is removed and exons before and after it are recombined. Means a splice site present on the 3 ′ end side of the intron.
  • SA sequence a “splice donor (SD) sequence” means a splice site present at the 5 ′ end of an intron.
  • GU consensus sequence exists at the 5 'end of the intron of the RNA precursor present in the nucleus, and the 5' end side of the GU sequence is the SD sequence.
  • the feature of the consensus sequence of SA and SD sequences of introns contained in eukaryotic mRNA precursors is called GU-AG rule.
  • An SA sequence or SD sequence having a mutation introduced into the consensus sequence is also included in the SA sequence or SD sequence of the present specification as long as it functions in the RNA processing reaction.
  • gene of interest is artificially inserted into a cell (for example, the cell's nuclear genome or cytoplasm) either temporarily or permanently (by artificial manipulation). It refers to an exogenous gene that is desired to be performed. Such genes include genes that are completely or partially derived from the introduced cell, and also include genes having any mutation. Further, it may be the same gene as the endogenous gene that the cell naturally has.
  • naturally means a natural state in which no artificial manipulation is applied.
  • wild type refers to the gene or gene product isolated from a naturally occurring source that is most frequently observed in a population. This may be naturally occurring or produced as a recombinant.
  • mutant refers to a gene or gene product that has altered sequence and / or functional properties when compared to a wild-type gene or gene product. Mutant genes are produced by naturally occurring mutations or by artificially modifying genes to mutate sequences.
  • T cell is also called a T lymphocyte, and means a cell derived from the thymus among lymphocytes involved in an immune response.
  • T cells include helper T cells, suppressor T cells, regulatory T cells, CTL, naive T cells, memory T cells, ⁇ T cells that express ⁇ and ⁇ chain TCRs, and ⁇ and ⁇ chain TCRs. ⁇ T cells are included.
  • cell populations containing T cells include blood (peripheral blood, umbilical cord blood, etc.), bone marrow fluid, peripheral blood mononuclear cells (PBMC), blood cell lineage collected, isolated, purified and derived from these Examples of the cell population include cells, hematopoietic stem cells, and cord blood mononuclear cells.
  • PBMC peripheral blood mononuclear cells
  • various cell populations derived from blood cells containing T cells can be used in the present invention. These cells may be activated in vivo (in vivo) or ex vivo (ex vivo) by cytokines such as anti-CD3 antibodies and IL-2. These cells can be used either those collected from a living body or obtained through in vitro culture, for example, those obtained by directly or cryopreserving the T cell population obtained by the method of the present invention. .
  • suppression of expression refers to inhibiting the production of a final polypeptide by preventing transcription and / or translation from a gene encoding the polypeptide, ie, the polypeptide as a product. Means that the amount decreases. Therefore, even when the transcription reaction from the gene encoding the polypeptide is not suppressed, if the transcription product (mRNA) is rapidly degraded and the production of the protein is suppressed, it is included in the “expression suppression”.
  • the state in which the expression is suppressed is a state in which the expression level is 20% or more, 40% or more, 60% or more, 80% or more, or 100%, that is, completely suppressed as compared with the case where the expression is not suppressed.
  • Retroviral vector of the present invention comprises, in order from the 5 ′ end, (A) a 5 ′ LTR sequence derived from a retrovirus, (B) SD sequence, (C) a retrovirus-derived packaging signal sequence ( ⁇ ), (D) a siRNA generating sequence in which RNA is transcribed, which forms at least one stem-loop structure and induces RNA interference in mammalian cells; (E) SA sequence, (F) the sequence of the desired gene; (G) a 3 ′ LTR sequence derived from a retrovirus, It is a nucleic acid construct containing the nucleic acid of each sequence.
  • the present invention makes it possible to suppress the expression of a specific gene in the cell and to express the introduced desired gene by introducing one vector into the cell.
  • the vector of the present invention has high siRNA production efficiency and / or desired gene expression efficiency. Therefore, it can be used for the purpose of substituting with another gene for newly introducing the function of the gene expressed in the cell, such as suppressing the expression of the mutant gene and expressing the wild type gene.
  • the retrovirus is a single-stranded RNA virus, and the 5 ′ LTR sequence, SD sequence, packaging signal sequence, gag gene, pol gene, SA sequence, env gene, A 3 ′ LTR sequence is present.
  • a plurality of accessory genes are included in addition to these elements.
  • a 5 'LTR sequence, a packaging signal sequence, and a 3' LTR sequence are essential for the retroviral vector.
  • Other gene products such as gag, pol, env and the like can be supplied from packaging cells carrying these genes.
  • the desired gene is placed 3 'to the packaging signal sequence of the retroviral vector, or 3' to the packaging signal sequence and SA sequence if it has an SA sequence.
  • the (a) 5 ′ LTR sequence, (g) 3 ′ LTR sequence and (c) packaging signal sequence contained in the vector of the present invention are retrovirus-derived sequences that can introduce genes into mammalian cells. Any array can be used. Retroviruses include subclasses of oncoretrovirus and lentivirus, and sequences from any class of virus can be used in the present invention. These sequences may be sequences derived from the same virus, but they can be combined with sequences from different viruses as long as virus particles can be formed and integrated into the introduced cell genome by combination with appropriate packaging cells. May be used.
  • LTR sequences and packaging signal sequences used in the present invention include Moloney murine leukemia virus (MMLV), mouse embryonic stem cell virus (MESV), mouse stem cell virus (MSCV), myeloproliferative sarcoma belonging to oncoretrovirus. Sequences derived from viruses (MPSV) and splenic focal forming viruses (SFFV) can be used.
  • Oncoretrovirus-derived viral vectors are capable of high-efficiency gene transfer, but the cells must be actively dividing when the vector is introduced. These oncoretroviral vectors have been described in a number of literature [eg, US Pat. No. 5,219,740, US Pat. No. 6,207,453, US Pat. No.
  • LTR sequence and packaging signal sequence used in the present invention examples include human immunodeficiency virus (HIV-1, HIV-2), simian immunodeficiency virus (SIV), feline immunodeficiency virus ( Sequences from FIV), equine infectious anemia virus (EIAV), goat arthritis encephalitis virus (CAEV) can be used.
  • a lentiviral vector can introduce a gene into the genome in the nucleus regardless of the mitosis of the cell into which the gene is introduced. Lentiviral vectors have also been described in a number of literature [eg, Journal of Virology, Vol. 72, 8463-8471 (1998)].
  • Other groups of retroviruses such as the spumavirus (eg, foamy virus) can also efficiently transduce non-dividing cells.
  • an LTR sequence having a mutated sequence can also be used.
  • the LTR is functionally divided into three regions U3, R and U5 from the 5 'end.
  • the U3 region has enhancer / promoter activity, and the RNA genome II of the host cell transcribes the viral genome from the R region of the 5 'LTR sequence to the R region of the 3' LTR sequence.
  • An LTR sequence in which the U3 region of the 3 'LTR sequence and / or the 5' LTR sequence is replaced with an enhancer / promoter derived from other than the virus from which the LTR sequence is derived can also be used in the present invention.
  • virus-derived enhancers / promoters such as human cytomegalovirus (HCMV) immediate early, Moloney murine sarcoma virus (MMSV), rous sarcoma virus (RSV), spleen focus-forming virus (SFFV), ⁇ -actin, globin, elastase, albumin Mammal-derived enhancers / promoters of ⁇ -fetoprotein and insulin genes can be used.
  • HCMV human cytomegalovirus
  • MMSV Moloney murine sarcoma virus
  • RSV rous sarcoma virus
  • SFFV spleen focus-forming virus
  • ⁇ -actin globin
  • elastase albumin Mammal-derived enhancers / promoters of ⁇ -fetoprotein and insulin genes
  • the (b) SD sequence and (e) SA sequence contained in the vector of the present invention can be the SD sequence and SA sequence naturally present in the virus from which the LTR sequence or packaging signal sequence to be used is derived.
  • foreign SD sequences and SA sequences that is, viruses different from the viruses from which the LTR sequences or packaging signal sequences used are derived (ie, heterologous viruses), SD sequences and SAs derived from introns of mammalian genes.
  • Arrays can be used.
  • 16S RNA of simian virus (SV) 40, immediate early RNA of HCMV, SD sequence and SA sequence derived from human hEF1 ⁇ gene can be used [American Academy of Sciences, Vol. 95, No. 1, 219-223. Page (1998)].
  • a mutation is introduced into the consensus sequence, and an SD sequence or SA sequence can also be used in the vector of the present invention.
  • the siRNA generating sequence (d) contained in the vector of the present invention is a sequence that forms at least one stem-loop structure and transcribes RNA that can induce RNA interference in mammalian cells.
  • the purpose of RNA interference in the present invention is to selectively suppress the expression of a specific endogenous gene that is naturally expressed by a cell into which a vector is introduced.
  • RNA interference is induced by siRNA in which an RNA molecule homologous to a base sequence of mRNA transcribed from a gene whose expression is desired to be suppressed (hereinafter referred to as a target gene) and an RNA molecule complementary thereto are annealed. .
  • siRNA generating sequence used in the present invention, a sequence (sense sequence) homologous to a base sequence of a region of mRNA transcribed from a target gene and a complementary sequence (antisense sequence) are arranged in series. Is arranged.
  • a single RNA strand transcribed from the siRNA generation sequence forms a double-stranded structure by annealing the sense and antisense sequences within the molecule, and the formed double-stranded RNA portion is used as a stem region.
  • a stem-loop structure is formed in which the loop region is an arbitrary sequence arranged between the antisense sequence and the antisense sequence.
  • siRNA is generated from the stem region by the action of RNase III (Dicer).
  • the chain length of the portion corresponding to the stem region in the siRNA generating sequence is, for example, 13 to 29 bases, preferably 15 to 25 bases, more preferably 19 to 25 bases from the viewpoint of suppression of interferon response in mammalian cells.
  • the loop region may be an arbitrary sequence, and a sequence having a chain length of 1 to 30 bases is exemplified, but a sequence of 1 to 25 bases, more preferably 5 to 22 bases is used.
  • siRNA generated in the cell according to the present invention is composed of RNA having a sequence complementary to RNA having a sequence homologous to a specific base sequence of mRNA transcribed from the target gene. It is not necessary to be completely homologous or complementary to the specific base sequence. As long as the function of suppressing the expression of the target gene is exerted, a siRNA generation sequence consisting of substantially homologous RNA and RNA having a substantially complementary sequence may be used.
  • the siRNA generating sequence used in the present invention transcribes a plurality of siRNAs corresponding to the base sequences of different regions of one target gene in addition to one that transcribes one type of siRNA targeting one type of gene.
  • a plurality of siRNAs corresponding to a plurality of target genes may be transcribed.
  • the number of siRNAs generated from the siRNA generating sequence used in the present invention is 1 to 10, 1 to 6, 1 to 4, a plurality, or several.
  • the desired gene sequence (f) contained in the vector of the present invention is a gene sequence to be expressed in the cell into which the vector is introduced.
  • the gene sequence includes, for example, a sequence encoding a protein and a sequence encoding an RNA that functions in a cell, such as tRNA or miRNA.
  • the vector of the present invention is produced as a vector in which a sequence (multicloning site) in which a plurality of restriction enzyme recognition sequences for linking the sequence (f) are arranged is arranged in the vector instead of the sequence (f), and then multicloning is performed.
  • the sequence (f) may be inserted using the site.
  • a vector having a multiple cloning site instead of the sequence (f) is also included in the vector of the present invention.
  • the siRNA generated from the sequence (d) of the vector of the present invention may suppress gene expression from the sequence targeting the gene sequence of the sequence (f).
  • a mutation can be introduced into a desired gene sequence, and the sequence can be modified so as not to be affected by siRNA.
  • substitution of other amino acids within the range that does not impair the function of the polypeptide encoded by the desired gene in the amino acid sequence encoded by the RNA that the siRNA acts on For example, the amino acid sequence may be changed by substitution with a similar amino acid.
  • Similar amino acids mean amino acids that are similar in physicochemical properties, such as aromatic amino acids (Phe, Trp, Tyr), aliphatic amino acids (Ala, Leu, Ile, Val), polar amino acids (Gln, Asn) , Basic amino acids (Lys, Arg, His), acidic amino acids (Glu, Asp), amino acids having hydroxyl groups (Ser, Thr), amino acids with small side chains (Gly, Ala, Ser, Thr, Met), etc. Amino acids classified as: It is expected that such substitutions with similar amino acids will not change the phenotype of the polypeptide (ie, are conservative amino acid substitutions).
  • a gene into which a silent mutation or a conservative amino acid substitution mutation has been introduced as described above may be referred to as a “codon conversion type” gene.
  • the present invention is not particularly limited. However, by selecting a codon that is frequently used in the host to be used or a sequence that increases translation efficiency, and converting the base sequence, Improvement of gene expression efficiency is expected.
  • the desired gene of the vector of the present invention is a sequence encoding an oligomeric protein.
  • Oligomeric proteins include structural proteins, enzymes, transcription factors, receptors, and antibodies.
  • the oligomeric protein may be a cell surface protein (membrane protein), and a sequence encoding an antigen recognition receptor exemplified in the examples, for example, a T cell receptor (T cell receptor: TCR) is desired. It is suitable as a gene.
  • TCRs There are two types of TCRs: heterodimers consisting of ⁇ and ⁇ chains (heterodimers) and heterodimers consisting of ⁇ and ⁇ chains.
  • Each chain of TCR consists of a variable (V) region, a binding (J) region, and a constant (C) region.
  • V variable
  • J binding
  • C constant
  • the diversity of the TCR V region is caused by the combination of the gene segments encoding the V region and rearrangement of the rearranged binding site by DNA rearrangement, and the insertion of an N sequence into the binding site.
  • Hypervariable regions (CDRs) with particularly high amino acid sequence variations are observed in the V regions of the ⁇ and ⁇ chains.
  • a desired gene can be a sequence obtained by polycistronicly linking genes encoding two polypeptides constituting a TCR heterodimer.
  • the two genes can be connected to each other via a sequence selected from a sequence encoding a self-cleaving peptide and an IRES (internal ribosomal entry site) sequence.
  • the order of the two genes may be either, for example, a polycistronic sequence from the 5 'end to the order of TCR ⁇ chain-TCR ⁇ chain or TCR ⁇ chain-TCR ⁇ chain.
  • the self-cleaving peptide can be obtained from a viral 2A peptide or a 2A-like peptide having a function equivalent to that of the virus.
  • 2A peptide F2A derived from foot-and-mouth disease virus (FMDV)
  • 2A peptide E2A derived from equine rhinitis A virus (ERAV)
  • E2A equine rhinitis A virus
  • P2A derived from Porcine teschovirus
  • TaV Thosea asigna virus
  • T2A having the amino acid sequence shown in SEQ ID NO: 7 can be used.
  • 2A peptides are reviewed in Expert Opinion On Biological Therapy, Volume 5, pages 627-638 (2005).
  • the IRES sequence refers to an element that promotes the direct entry of a ribosome into the initiation codon of a cistron (protein coding region), eg, AUG, thereby initiating cap-independent translation of the gene [Trens in Bio Chemical Science (Trends Biochem Sci), Vol. 15, No. 12, pp. 477-83 (1990)]. Multiple polypeptides are translated from a single mRNA having multiple cistrons linked by an IRES sequence.
  • exogenous TCR when an exogenous TCR that recognizes a desired antigen is introduced into a T cell, the endogenous TCR that is naturally expressed by the T cell competes with the exogenous TCR, and the expression of the exogenous TCR may decrease. There is. In addition, side effects such as graft-versus-host disease (GVHD) may occur due to TCR mispaired between endogenous TCR and exogenous TCR. Therefore, it is important to suppress the expression of endogenous TCR.
  • the V region of the endogenous TCR differs depending on the individual TCR, whereas the C region is a sequence common to the individual TCRs and is encoded by the gene of the same base sequence. Therefore, the siRNA generated by the sequence (d) is targeted. It is suitable for the arrangement. Furthermore, in order to prevent the expression of the exogenous TCR gene introduced by the siRNA, the silent mutation can be introduced into the base sequence encoding the C region in the gene. Thus, exogenous TCR can be expressed efficiently.
  • the base sequence AGTAAGGATTCTGATGGTAT (SEQ ID NO: 19) of the endogenous TCR ⁇ chain in the C region of the gene encoding TCR is not particularly limited. What is necessary is just to carry out codon conversion to AGCAAGGACAGCGACGTGTAC (sequence number 20).
  • the amino acid sequences encoded by the two base sequences are common to SKDSDVY (SEQ ID NO: 21), but the ⁇ chain of the endogenous TCR is selected by siRNA generated by transcription of the artificial gene described in SEQ ID NO: 10. Is suppressed. Codon conversion is illustrated in Table 1 described in the Examples.
  • Method for producing gene-introduced cell of the present invention comprises a step of introducing the retroviral vector of the present invention described in (1) above into a cell. This process is performed outside the body.
  • mammals such as cells derived from humans or cells derived from non-human mammals such as monkeys, mice, rats, pigs, cows, and dogs can be used.
  • non-human mammals such as monkeys, mice, rats, pigs, cows, and dogs
  • Arbitrary cells can be used.
  • peripheral blood mononuclear cells collected, isolated, purified and derived from blood (peripheral blood, umbilical cord blood, etc.), body fluids such as bone marrow, tissues or organs, blood cells, hematopoietic stem cells, umbilical cord blood
  • body fluids such as bone marrow, tissues or organs
  • blood cells hematopoietic stem cells
  • umbilical cord blood Use nuclear cells, fibroblasts, preadipocytes, hepatocytes, blood cells, skin keratinocytes, mesenchymal stem cells, hematopoietic stem cells, adipose stem cells, various cancer cell lines, periodontal ligament fibroblasts or neural stem cells be able to.
  • the cells may be either collected from a living body or established as a cell line. When it is desired to transplant the produced gene-transduced cell or a cell differentiated from the cell into a living body, it is preferable to produce the transgenic cell from a cell collected from the living body itself
  • the step of introducing the vector of the present invention into a cell comprises selecting an appropriate packaging cell based on the LTR sequence and the packaging signal sequence possessed by the vector, and using this, a retrovirus.
  • Particles can be prepared and carried out.
  • PG13 ATCC CRL-10686
  • PA317 ATCC CRL-9078
  • GP + E-86 and GP + envAm-12 US Pat. No. 5,278,056
  • Psi-Crip [American Academy of Sciences, Vol. 85, No. 6460-6464 (1988)] is exemplified.
  • Retroviral particles can also be produced using 293 cells or 293T cells with high transfection efficiency.
  • Retrovirus vectors produced based on many types of retroviruses and packaging cells that can be used for packaging the vectors are widely available from various companies. From these retroviral vectors, DNA fragments having the sequences (a) to (g) of the vector of the present invention can be prepared. These packaging cells can also be used in the method of the present invention.
  • a retrovirus produced by pseudotype packaging having an envelope derived from a virus different from that of the genome of the retrovirus vector can also be used.
  • pseudotyped retroviruses having proteins that can function as envelopes or envelopes derived from MMLV, gibbon leukemia virus (GaLV), vesicular stomatitis virus (VSV), or feline endogenous virus (feline endogenous virus) can be used.
  • retroviral vector particles having a sugar chain-modified protein on its surface can be prepared.
  • a functional substance that improves the introduction efficiency can also be used (for example, International Publication No. 95/26200, International Publication No. 00/01836).
  • substances that improve the introduction efficiency include substances having an activity of binding to a viral vector, such as fibronectin or fibronectin fragments.
  • a fibronectin fragment having a heparin binding site for example, a fragment commercially available as RetroNectin (registered trademark, CH-296, manufactured by Takara Bio Inc.) can be used.
  • RetroNectin registered trademark, CH-296, manufactured by Takara Bio Inc.
  • polybrene, fibroblast growth factor, type V collagen, polylysine, or DEAE-dextran which is a synthetic polycation having an effect of improving the infection efficiency of retrovirus cells, can be used.
  • the functional substance is immobilized on a suitable solid phase, for example, a container (plate, petri dish, flask, bag, etc.) used for cell culture or a carrier (microbeads, etc.).
  • a suitable solid phase for example, a container (plate, petri dish, flask, bag, etc.) used for cell culture or a carrier (microbeads, etc.).
  • a container plate, petri dish, flask, bag, etc.
  • a carrier microbeads, etc.
  • the gene-transferred cell of the present invention is a cell into which the retroviral vector of (1) has been introduced by the production method of (2).
  • the gene-transferred cell of the present invention expresses a desired exogenous gene, and the expression of a specific endogenous gene is suppressed.
  • An embodiment of the present invention includes a gene-transferred cell into which an exogenous TCR that recognizes a specific antigen is introduced.
  • the disease to which a T cell into which an exogenous TCR is introduced is administered is not particularly limited as long as it is a disease sensitive to the T cell.
  • cancer leukemia, solid tumor, etc.
  • hepatitis Infectious diseases caused by viruses such as influenza and HIV, bacteria, and fungi, such as tuberculosis, MRSA, VRE, and deep mycosis are exemplified.
  • the cell of the present invention can also be used for donor lymphocyte infusion for the purpose of bone marrow transplantation, prevention of infection after irradiation, and remission of relapsed leukemia.
  • Example 1 Production of Codon-Converted Human T Cell Receptor ⁇ and ⁇ Genes According to the method described in International Publication No. 2008/153029 pamphlet (incorporated herein by reference), codon-converted human An anti-MAGE-A4 TCR ⁇ chain gene was prepared by converting a part of the wild type gene. A nucleic acid fragment containing this gene was cloned into the restriction enzyme KpnI-XhoI site of pPCR-Script (Stratagene). Similarly, a codon-converted human anti-MAGE-A4 TCR ⁇ chain gene was prepared by converting a part of the wild-type gene. A nucleic acid fragment containing this gene was cloned into the restriction enzyme KpnI-XhoI site of pPCR-Script.
  • Example 2 Preparation of Codon-transformed TCR Expression Retroviral Vector First, PCR was performed with 3MSCV5 primer described in SEQ ID NO: 1 and 3MSCV3 primer described in SEQ ID NO: 2 using pMSCVneo (Clontech) as a template to amplify the MSCV3 ′ LTR site Cleaved with restriction enzymes XhoI and EcoRI, and cloned into the XhoI-EcoRI site of the pMT vector [pMT vector described in Gene Ther, Vol. 11, pp. 94-99 (2004)] pMS-MC was prepared.
  • pMSCVneo Clontech
  • pMS3-MC consists of 5 ′ LTR derived from MMLV, SD sequence derived from MMLV, ⁇ derived from MMLV, SA sequence derived from the human EF1 ⁇ gene into which mutation has been introduced, and U3 region is derived from MSCV. Contains 3 'LTR from MMLV. As shown in FIG. 1, a DNA fragment to be inserted into pMS3-MC was prepared.
  • a DNA encoding a codon-converted human anti-MAGE-A4 TCR ⁇ chain (indicated as TCR ⁇ in FIG. 1) was subjected to PCR using the MAGE-AF primer described in SEQ ID NO: 3 and the MAGE-AR primer described in SEQ ID NO: 4. Amplified.
  • a DNA encoding a codon-converted human anti-MAGE-A4 TCR ⁇ chain (denoted as TCR ⁇ in FIG. 1) using the MAGE-BF primer described in SEQ ID NO: 5 and the MAGE-BR primer described in SEQ ID NO: 6 Amplified by PCR.
  • the recombinant plasmid prepared in Example 1 was used as a template.
  • T2A in FIG. 1 an artificially synthesized gene containing the T2A peptide sequence shown in SEQ ID NO: 7 (indicated as T2A in FIG. 1) as a template, the T2A-F primer described in SEQ ID NO: 8 and the T2A-R primer described in SEQ ID NO: 9 were used. Amplified by PCR. These amplified products were cloned into pMS3-MC vector digested with NotI-XhoI using In-Fusion Advantage PCR Cloning Kit (Clontech) to prepare pMS3-MAGE-A4-b2Aa vector.
  • Example 3 Preparation of Codon-transformed TCR and siRNA Expression Retroviral Vector
  • siRNA generating sequence in FIG. 2 An artificial gene shown in SEQ ID NO: 10 (referred to as siRNA generating sequence in FIG. 2) was synthesized. This artificial gene transcribes single-stranded RNAs that form four types of stem-loop structures, and generates a total of four types of siRNAs for wild-type TCR ⁇ and wild-type TCR ⁇ .
  • PCR was performed using the loop-Mlu-F primer shown in SEQ ID NO: 11 and the loop-Mlu-R primer shown in SEQ ID NO: 12 to obtain an amplified DNA fragment.
  • FIG. 10 An artificial gene shown in SEQ ID NO: 10 (referred to as siRNA generating sequence in FIG. 2) was synthesized. This artificial gene transcribes single-stranded RNAs that form four types of stem-loop structures, and generates a total of four types of siRNAs for wild-type TCR ⁇ and wild-type TCR ⁇ .
  • this DNA fragment was cloned into the MluI digest of the pMS3-MAGE-A4-b2Aa vector using In-Fusion Advantage PCR Cloning Kit (Clontech) and pMu1-MAGE-A4- A b2Aa vector was prepared.
  • Example 4 Preparation of Retrovirus Solution Escherichia coli JM109 was transformed with plasmid vectors pMS3-MAGE-A4-b2Aa and pMu1-MAGE-A4-b2Aa to obtain transformants. Plasmid DNAs retained by these transformants were purified using QIAGEN Plasmid Midi Kit (manufactured by Qiagen) and subjected to the following operations as transfection DNA. The prepared pMS3-MAGE-A4-b2Aa and pMu1-MAGE-A4-b2Aa plasmids were transfected into 293T cells, respectively.
  • Retrovirus Packaging Kit Eco manufactured by Takara Bio Inc.
  • Supernatant fluids containing various ecotropic viruses were obtained from the transduced cells obtained, and filtered through a 0.45 ⁇ m filter (Milex HV, manufactured by Millipore). Using this supernatant, ecotropic virus was infected to PG13 cells (ATCC CRL-10686) cells by a method using polybrene.
  • the culture supernatant of the obtained cells was collected, filtered through a 0.45 ⁇ m filter, and codon-transformed TCR expression retrovirus solution (MS3-MAGE-A4-b2Aa) and codon-transformed TCR-siRNA co-expression retrovirus solution ( Mu1-MAGE-A4-b2Aa).
  • Example 5 Infection of covirus-converted TCR and codon-converted TCR-siRNA co-expressing retroviral vector into human PBMC 1
  • a TCR-siRNA co-expression retrovirus solution (Mu1-MAGE-A4-b2Aa) was infected twice by a standard method using RetroNectin (registered trademark, manufactured by Takara Bio Inc.), and codon-transformed TCR-introduced PBMC and Codon-transformed TCR introduction-siRNA co-expression PBMCs were prepared.
  • Qiagen QIAGEN RNeasy Mini Kit
  • cDNA synthesis was performed using PrimeScript RT reagent Kit (Perfect Real Time) (manufactured by Takara Bio Inc.).
  • real-time PCR using SYBR Premix Ex Taq II (manufactured by Takara Bio Inc.), wild type TCR ⁇ amplification primers of SEQ ID NOS: 13 and 14, and wild type TCR ⁇ amplification primers of SEQ ID NOs: 15 and 16 using this cDNA as a template.
  • the wild-type TCR ⁇ and wild-type TCR ⁇ gene expression levels were measured and their relative values were calculated.
  • the total RNA amount was corrected based on the GAPDH gene expression level measured by the same real-time PCR using the GAPDH gene amplification primers of SEQ ID NOs: 17 and 18.
  • PBMC into which no vector was introduced was prepared, the gene expression level was measured in the same manner as described above, and the relative value of expression in each experimental group relative to the relative value of wild type TCR ⁇ and wild type TCR ⁇ gene expression in the cell.
  • the inhibitory effect of the wild type TCR gene was evaluated by calculating the ratio.
  • the results are shown in FIG. In the figure, the vertical axis indicates the relative value when the negative control in which no vector was introduced is defined as 100 with respect to the gene expression level.
  • the horizontal axis shows the introduced retrovirus. As shown in FIG.
  • Example 6 Infection of codon-transformed TCR and codon-transformed TCR-siRNA co-expressing retroviral vector into human PBMC 2
  • codon-converted TCR-introduced PBMC and codon-converted TCR-introduced siRNA co-expressing PBMC were prepared.
  • Three days after the second virus infection the cells were collected and stained with HLA-A2402 MAGE-A4 tetramer-PE (MBL) and FITC-labeled anti-Human CD8 antibody (Becton Dickinson). Using a flow cytometer, the proportion of cells that were CD8 positive and tetramer positive and the average fluorescence intensity of PE were measured for the stained cells.
  • FIG. 4 shows the MAGE-A4 tetramer positive cell ratio
  • FIG. 5 shows the average fluorescence intensity of phycoerythrin (PE) derived from MAGE-A4 tetramer positive cells.
  • the horizontal axis indicates the introduced retrovirus and the dilution rate
  • the vertical axis indicates the MAGE-A4 tetramer positive cell rate (FIG. 4) and the average fluorescence intensity of PE derived from MAGE-A4 tetramer positive cells (FIG. 5).
  • the average fluorescence intensity in FIG. 5 reflects the expression level of anti-MAGE-A4 TCR in MAGE-A4 tetramer positive cells. As shown in FIGS.
  • the codon-converted TCR-introduced siRNA co-expressing PBMC (Mu1-MAGE-A4-b2Aa) was introduced by suppressing the expression of wild-type TCR ⁇ and ⁇ .
  • the expression rate and expression intensity of the ⁇ / ⁇ complex protein of type TCR were enhanced.
  • the horizontal axis represents the virus copy number
  • the vertical axis represents the MAGE-A4 tetramer positive cell ratio (FIG. 6) and the average fluorescence intensity of the MAGE-A4 tetramer positive cells (FIG. 7).
  • PBMC (Mu1-MAGE-A4-b2Aa) was introduced with codon-transformed TCR introduction due to suppression of wild-type TCR ⁇ and ⁇ expression.
  • PBMC MS3-MAGE-A4-b2Aa
  • a higher MAGE-A4 tetramer positive cell rate was obtained with a lower virus copy number, and the average intensity of fluorescence derived from the tetramer positive cells was also higher. That is, enhancement of the expression rate and expression intensity of the codon-transformed TCR ⁇ / ⁇ composite protein was observed in the cells into which the siRNA expression unit was introduced.
  • Example 7 Production of Codon-Converted Human T Cell Receptor ⁇ and ⁇ Genes An J et al., International Journal of Hematology (Int. J. Hematol.), Vol. 93, pp. 176-185 (2011) (by reference) And a nucleic acid fragment containing a TCR ⁇ chain gene or TCR ⁇ chain gene recognizing a peptide of tumor antigen WT1 235-243, respectively.
  • Two mutations shown in Table 1 were introduced into the C region of the gene encoding the TCR ⁇ chain and TCR ⁇ chain, respectively, with the nucleotide sequence of the wild-type TCR as a codon-converted TCR by a mutagenesis primer and PCR. Although the amino acid sequences encoded by the wild type and codon-converted base sequences are common, a mutation is introduced into the base sequence of the codon-converted TCR. The expression of codon-converted TCR is not suppressed by siRNA.
  • Example 8 Preparation of codon-converted TCR-expressing retrovirus vector Amplified product amplified by PCR using the codon-converted human anti-WT1 TCR ⁇ chain gene and TCR ⁇ chain gene nucleic acid fragment prepared in Example 7 as a template, Example 2 The artificial gene amplification product encoding the T2A peptide sequence described in 1 was cloned into the pMS3-MC vector of Example 2 digested with ApaI-XhoI using In-Fusion Advantage PCR Cloning Kit (Clontech). The pMS3-WT1-a2Ab vector (vector A) was prepared.
  • Example 9 Production of Codon-transformed TCR and siRNA Expression Retroviral Vectors As shown in FIG. 8, amplification products of artificial genes that generate the four types of siRNAs synthesized in Example 3 were used as pMS3-WT1-a2Ab vectors (vectors). It inserted in each part of A).
  • pMS3-WT1-a2Ab-loop-siTCR (vector B) inserted between the TCR gene and 3′LTR
  • Example 10 Comparison of codon-transformed TCR-siRNA co-expressing retroviral vectors
  • a retroviral solution was prepared from each vector prepared in Examples 8 and 9 in the same manner as in Example 4.
  • Each vector was introduced into human PBMC in the same manner as in Example 6, and the cells were collected 3 days after the second virus infection.
  • the virus copy number was measured. The results are shown in FIG. 9 and FIG. In the figure, the horizontal axis represents the virus copy number, and the vertical axis represents the WT1 tetramer positive cell ratio (FIG.
  • FIG. 10 the average fluorescence intensity of the WT1 tetramer positive cells.
  • cells introduced with vector D have higher WT1 tetramer positive cell ratio and average fluorescence intensity at lower virus copy numbers than cells introduced with vectors A to C.
  • the expression rate and expression intensity of the introduced codon-converted anti-TCR ⁇ / ⁇ complex protein were enhanced.
  • Example 11 Preparation of Codon-transformed TCR Expression Retroviral Vector
  • a DNA fragment to be inserted into pMS3-MC prepared in Example 2 was prepared.
  • a DNA encoding a codon-converted human anti-MAGE-A4 TCR ⁇ chain (indicated as TCR ⁇ in FIG. 11) was subjected to PCR using the MAGE-AF2 primer described in SEQ ID NO: 31 and the MAGE-AR2 primer described in SEQ ID NO: 32 Amplified.
  • a DNA encoding a codon-converted human anti-MAGE-A4 TCR ⁇ chain indicated as TCR ⁇ in FIG.
  • Example 12 Preparation of Codon-transformed TCR and siRNA Expression Retroviral Vector To the pMS3-MAGE-A4-a2Ab vector of Example 11 in which the DNA fragment containing the siRNA generating sequence was digested with MluI in the same manner as in Example 3. Cloning produced the pMu1-MAGE-A4-a2Ab vector (FIG. 12).
  • Example 13 Preparation of codon-converted TCR-expressing retroviral vector Amplified product amplified by PCR using nucleic acid fragments containing the codon-converted human anti-WT1 TCR ⁇ -chain gene and TCR ⁇ -chain gene prepared in Example 7 as a template, Example 2 The artificial gene amplification product encoding the T2A peptide sequence described in 1 was cloned into the pMS3-MC vector of Example 2 digested with ApaI-XhoI to prepare a pMS3-WT1-b2Aa vector (vector E) (FIG. 13).
  • Example 14 Preparation of Codon-transformed TCR and siRNA Expression Retroviral Vector
  • the amplification product of the artificial gene that generates the four types of siRNA synthesized in Example 3 was used as the pMS3-WT1-b2Aa vector (vector E) of Example 13. It was inserted between the SD sequence and the SA sequence to prepare pMu1-WT1-b2Aa (vector F) (FIG. 13).
  • Example 15 Comparison of codon-transformed TCR-expressing retrovirus vector and codon-transformed TCR-siRNA co-expressing retrovirus vector
  • the vectors prepared in Examples 2, 3, 11, and 12 (pMS3-MAGE-A4-b2Aa, pMu1- A retrovirus solution was prepared in the same manner as in Example 4 using MAGE-A4-b2Aa, pMS3-MAGE-A4-a2Ab, and pMu1-MAGE-A4-a2Ab).
  • Each vector was introduced into human PBMC in the same manner as in Example 6, and the cells were collected 3 days after the second virus infection.
  • FIG. 14 shows the results of pMS3-MAGE-A4-b2Aa and pMS3-MAGE-A4-a2Ab.
  • FIG. 15 shows the results of pMu1-MAGE-A4-b2Aa and pMu1-MAGE-A4-a2Ab.
  • the horizontal axis represents the virus copy number
  • the vertical axis represents the MAGE-A4 tetramer positive cell ratio (FIG. 14 left, FIG.
  • the cells into which the MS3-MAGE-A4-b2Aa vector was introduced were higher in MAGE with a lower virus copy number than the cells into which the MS3-MAGE-A4-a2Ab vector was introduced.
  • -A4 tetramer positive cell ratio and average fluorescence intensity were obtained, and cells introduced with the Mu1-MAGE-A4-b2Aa vector had a lower virus compared to cells introduced with the Mu1-MAGE-A4-a2Ab vector.
  • a higher MAGE-A4 tetramer positive cell ratio and average fluorescence intensity were obtained at the copy number, and the expression rate and expression intensity of the introduced codon-converted anti-TCR ⁇ / ⁇ complex protein were enhanced.
  • FIG. 16 shows the results of pMS3-WT1-a2Ab and pMS3-WT1-b2Aa.
  • FIG. 17 shows the results of pMu1-WT1-a2Ab and pMu1-WT1-b2Aa.
  • the horizontal axis represents the virus copy number
  • the vertical axis represents the WT1 tetramer positive cell rate (FIG. 16 left, FIG. 17 left) and the average fluorescence intensity of the WT1 tetramer positive cells (FIG. 16 right, FIG. 17 right). .
  • cells introduced with the MS3-WT1-b2Aa vector showed higher WT1 tetramer positive at a lower virus copy number than cells transfected with the MS3-MAGE-A4-a2Ab vector.
  • Cell ratio and average fluorescence intensity are obtained, and cells transfected with the Mu1-WT1-b2Aa vector are more positive for WT1 tetramer at a lower virus copy number than cells transfected with the Mu1-WT1-a2Ab vector.
  • the cell ratio and average fluorescence intensity were obtained, and the expression rate and expression intensity of the introduced codon-converted anti-TCR ⁇ / ⁇ composite protein were enhanced.
  • the present invention relates to a retroviral vector having the ability to efficiently express a desired gene and efficiently suppress the expression of a specific gene, a method for producing a gene-transferred cell using the vector, and a cell into which the vector has been introduced It is.
  • retroviral vectors, gene-transfected cell production methods and gene-introduced cells are extremely useful for protein production, disease treatment by cell therapy, and research and testing therefor.
  • SEQ ID NO: 1 3MSCV5 primer SEQ ID NO: 2: 3MSCV3 primer SEQ ID NO: 3: MAGE-AF primer SEQ ID NO: 4: MAGE-AR primer SEQ ID NO: 5: MAGE-BF primer SEQ ID NO: 6: MAGE-BR primer SEQ ID NO: 7: T2A peptide coding sequence SEQ ID NO: 8: T2A-F primer SEQ ID NO: 9: T2A-R primer SEQ ID NO: 10: siRNA generating sequence for wild type TCR genes SEQ ID NO: 11: loop-Mlu-F primer SEQ ID NO: 12: Loop-Mlu-R primer SEQ ID NO: 13: wild type TCR alpha chain amplification primer F SEQ ID NO: 14: wild type TCR alpha chain amplification primer R SEQ ID NO: 15: wild type TCR beta chain amplification primer F SEQ ID NO: 16: wild type TCR beta chain amplification primer R SEQ ID NO: 17: GAPDH amplification primer F SEQ ID NO

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'objet de la présente invention est un vecteur rétroviral qui, pour introduire dans une cellule et exprimer un gène exogène, supprime en outre l'expression d'un gène endogène spécifique par une transcription d'ARN qui induit une interférence d'ARN dans la cellule. Dans cet ordre, à partir de l'extrémité 5', le vecteur rétroviral selon l'invention contient les acides nucléiques de chacun des éléments suivants : (a) une séquence 5'LTR (Longue répétition terminale) dérivée d'un rétrovirus, (b) une séquence donneur d'épissure (SD), (c) une séquence signal d'encapsulation (ψ) dérivée d'un rétrovirus, (d) une séquence génératrice d'ARNsi qui forme au moins une structure tige-boucle et dans laquelle l'ARN transcrit induit une interférence d'ARN dans des cellules de mammifères, (e) une séquence accepteur d'épissure (SA), (f) la séquence du gène souhaité, et (g) une séquence 3'LTR dérivée d'un rétrovirus.
PCT/JP2012/062771 2011-05-19 2012-05-18 VECTEUR RÉTROVIRAL POUR L'EXPRESSION D'ARNsi WO2012157742A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2013515216A JP5969468B2 (ja) 2011-05-19 2012-05-18 ｓｉＲＮＡ発現レトロウイルスベクター

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2011-112027 2011-05-19
JP2011112027 2011-05-19

Publications (1)

Publication Number Publication Date
WO2012157742A1 true WO2012157742A1 (fr) 2012-11-22

Family

ID=47177056

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2012/062771 WO2012157742A1 (fr) 2011-05-19 2012-05-18 VECTEUR RÉTROVIRAL POUR L'EXPRESSION D'ARNsi

Country Status (2)

Country Link
JP (1) JP5969468B2 (fr)
WO (1) WO2012157742A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021070956A1 (fr) 2019-10-11 2021-04-15 タカラバイオ株式会社 VECTEUR D'EXPRESSION D'ARNsi

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004508047A (ja) * 2000-09-08 2004-03-18 バイロメッド・リミテッド スプライシングアクセプターを含む遺伝子組換え細胞性非翻訳配列を有する高効率レトロウイルスベクター

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004508047A (ja) * 2000-09-08 2004-03-18 バイロメッド・リミテッド スプライシングアクセプターを含む遺伝子組換え細胞性非翻訳配列を有する高効率レトロウイルスベクター

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KITAMURA, TOSHIO ET AL.: "Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics.", EXP. HEMATOL., vol. 31, 2003, pages 1007 - 1014 *
MILLER, A. DUSTY ET AL.: "Improved retroviral vectors for gene transfer and expression.", BIOTECHNIQUES, vol. 7, no. 9, 1989, pages 980 - 982, 984, 986, 989, 990 *
OKAMOTO, SACHIKO ET AL.: "Improved expression and reactivity of transduced tumor-specific TCRs in human lymphocytes by specific silencing of endogenous TCR.", CANCER RES., vol. 69, no. 23, 2009, pages 9003 - 9011 *
YANG, S. ET AL.: "Development of optimal bicistronic lentiviral vectors facilitates high-level TCR gene expression and robust tumor cell recognition.", GENE THER., vol. 15, 2008, pages 1411 - 1423 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021070956A1 (fr) 2019-10-11 2021-04-15 タカラバイオ株式会社 VECTEUR D'EXPRESSION D'ARNsi

Also Published As

Publication number Publication date
JP5969468B2 (ja) 2016-08-17
JPWO2012157742A1 (ja) 2014-07-31

Similar Documents

Publication Publication Date Title
Prel et al. Highly efficient in vitro and in vivo delivery of functional RNAs using new versatile MS2-chimeric retrovirus-like particles
Zhang et al. Lentiviral vectors for sustained transgene expression in human bone marrow–derived stromal cells
Banerjea et al. Inhibition of HIV-1 by lentiviral vector-transduced siRNAs in T lymphocytes differentiated in SCID-hu mice and CD34+ progenitor cell-derived macrophages
KR101363928B1 (ko) 특이적 유전자 발현 방법
Hamaguchi et al. Lentivirus vector gene expression during ES cell-derived hematopoietic development in vitro
Sparacio et al. Generation of a flexible cell line with regulatable, high-level expression of HIV Gag/Pol particles capable of packaging HIV-derived vectors
JP5484897B2 (ja) 遺伝子治療のためのベクター
US20030039636A1 (en) Novel self-inactivating (SIN) lentiviral vectors
AU2014314079B2 (en) RNA based method to obtain stably integrated retroviral vectors
RU2426788C1 (ru) Генетические конструкции для антивич-терапии
Douglas et al. Efficient human immunodeficiency virus-based vector transduction of unstimulated human mobilized peripheral blood CD34+ cells in the SCID-hu Thy/Liv model of human T cell lymphopoiesis
WO2021070956A1 (fr) VECTEUR D'EXPRESSION D'ARNsi
Ghani et al. Generation of high-titer self-inactivated γ-retroviral vector producer cells
JP5969468B2 (ja) ｓｉＲＮＡ発現レトロウイルスベクター
Mühlebach et al. Transduction efficiency of MLV but not of HIV-1 vectors is pseudotype dependent on human primary T lymphocytes
Swainson et al. Lentiviral transduction of immune cells
WO2015053398A1 (fr) Vecteur rétroviral de titre élevé
CA2650270C (fr) Cellules de conditionnement de retrovirus a fort titre
RU2533817C1 (ru) Усовершенствование генетических конструкций для повышения эффективности антивич терапии
WO2012157743A1 (fr) Vecteur rétroviral portant une sd-sa exogène
WO2023038055A1 (fr) Acide nucléique pour la production de vecteurs rétroviraux
Braun et al. Inhibition of simian/human immunodeficiency virus replication in CD4+ T cells derived from lentiviral-transduced CD34+ hematopoietic cells
US11965173B2 (en) Plasmid system
WO2023083760A1 (fr) Glycoprotéines d'enveloppe de rétrovirus du koala et leurs utilisations
WO2014092090A1 (fr) Cellules produisant un vecteur viral et procédé de production de vecteur

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12786047

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2013515216

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12786047

Country of ref document: EP

Kind code of ref document: A1