WO2012130951A1 - Aptamères ayant une spécificité pour les protéines de la paroi cellulaire qui fixent l'immunoglobuline - Google Patents

Aptamères ayant une spécificité pour les protéines de la paroi cellulaire qui fixent l'immunoglobuline Download PDF

Info

Publication number
WO2012130951A1
WO2012130951A1 PCT/EP2012/055655 EP2012055655W WO2012130951A1 WO 2012130951 A1 WO2012130951 A1 WO 2012130951A1 EP 2012055655 W EP2012055655 W EP 2012055655W WO 2012130951 A1 WO2012130951 A1 WO 2012130951A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
aptamer
binding
aptamers
target
Prior art date
Application number
PCT/EP2012/055655
Other languages
German (de)
English (en)
Inventor
Regina Stoltenburg
Beate Strehlitz
Original Assignee
Helmholtz-Zentrum Für Umweltforschung Gmbh – Ufz
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Helmholtz-Zentrum Für Umweltforschung Gmbh – Ufz filed Critical Helmholtz-Zentrum Für Umweltforschung Gmbh – Ufz
Priority to EP12713665.3A priority Critical patent/EP2691527A1/fr
Priority to US14/009,088 priority patent/US9353421B2/en
Publication of WO2012130951A1 publication Critical patent/WO2012130951A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56911—Bacteria
    • G01N33/56944—Streptococcus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56911—Bacteria
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56911—Bacteria
    • G01N33/56938—Staphylococcus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers

Definitions

  • the present invention relates to an aptamer which binds to microorganisms containing protein A, G or L, protein A, G or L or protein A, G or L, in particular Staphylococcus aureus, Streptococcus or Peptostreptococcus, uses of the aptamer and methods for Detection and enrichment of protein A, G or L, protein A, G or L-containing substances or protein A, G or L-containing microorganisms in which the aptamer is used.
  • Staphylococcus aureus is a globular, Gram-positive, pathogenic bacterium. S. aureus occurs almost everywhere in nature, also on the skin and in the upper airways of 25 to 30% of all humans. Particularly dangerous are antibiotic-resistant forms and especially multi-drug resistant forms. These come in heaped
  • S. aureus diseases that are caused by S. aureus include sepsis, skin and wound infections, pneumonia, abscesses, boils, endocarditis, osteomyelitis, food poisoning from S. aureus exotoxins, and bovine mastitis.
  • S. aureus has hitherto been carried out by means of cultivation or immunological and molecular biological methods (antibody assays, PCR-based methods).
  • the methods are either time consuming or expensive. It was therefore an object of the present invention to provide specific substances which enable rapid, simple and reliable detection of S. aureus.
  • Immunoglobulin-binding cell wall proteins binding to substances containing an immunoglobulin-binding cell wall protein and to microorganisms containing an immunoglobulin-binding cell wall protein, wherein the immunoglobulin-binding cell wall protein is selected from the group consisting of or consisting of protein A, G or L.
  • the aptamer in the sense of the previous paragraph means that the aptamer can also bind to other immunoglobulin-binding cell wall proteins or to substances or microorganisms containing another immunoglobulin-binding cell wall protein than said proteins A, G or L.
  • an aptamer which binds to protein A, G or L, protein A, G or L-containing substances as well as protein A, G or L-containing microorganisms, in particular Staphylococcus aureus, Streptococcus or Peptostreptococcus.
  • the aptamer according to the invention is specific for protein A, G or L.
  • the aptamer according to the invention is a nucleic acid aptamer, in particular a
  • Single-stranded DNA ssDNA
  • RNA aptamer RNA aptamer
  • the aptamer binds to a substance containing an immunoglobulin-binding cell wall protein, or to a microorganism that binds an immunoglobulin
  • Cell wall protein contains, means in particular means that the aptamer to the cell wall protein, which is present in the substance or which part of the
  • Is microorganism binds.
  • the aptamer binds to the
  • aptamer refers in the prior art to short single-stranded nucleic acid oligomers, also referred to as oligonucleotides, capable of specifically binding to a target structure or target molecule, also referred to as a target,
  • Ring structures stacking forces through electron interaction with neighboring bases
  • electrostatic interactions e.g., van der Waals, ion, dipole forces
  • hydrogen bonds e.g., hydrogen bonds
  • nucleic acid aptamers are distinguished, for example, from DNA aptamers formed from single-stranded DNA (ssDNA) and RNA aptamers.
  • Aptamers are characterized by the formation of aptamers specific three-dimensional structure, which depends on the nucleic acid sequence. This structure enables aptamers, analogous to an antigen-antibody binding to bind target structures accurately.
  • a particular nucleic acid sequence of an aptamer may, under defined conditions, have a three-dimensional structure that is specific to a defined target structure. The three-dimensional structure of an aptamer arises, among other things, as a result of intramolecular base pairings according to Watson and Crick and Hoogsteen base pairings (quadruplex).
  • an aptamer according to the invention contains protein A, G or L, a protein A, G or L-containing substance or a protein A, G or L.
  • Microorganism binds, or is specific, means that it binds to one or more targets selected from protein A, G or L, a substance containing protein A, G or L or a microorganism containing protein A, G or L.
  • Protein A, protein G and protein L are bacterial cell wall proteins. They belong to a group of proteins that contain repeating domains that can bind immunoglobulins.
  • Protein G is a protein found in the cell wall of bacteria of the genus Streptococcus. Depending on the Streptococcus strain, it has a molecular mass of about 58 to 65 kDa and has two or three homologous binding domains with high affinity for the Fc region of immunoglobulins, in particular of the isotype IgG, at the C terminus. It also binds to albumin proteins via three homologous domains N-terminal to the IgG binding region. At the N-terminus, protein G has another binding region (region E) for human alpha-2 globulin in the native conformation, also termed s-form. Exemplary protein G representatives have the UniProt (Universal Protein Database) Nos.
  • Protein L is a protein found in the cell wall of Peptostreptococcus magnus. Similar to protein A and G, it is also capable of binding immunoglobulins, especially immunoglobulins containing the kappa-type light chains.
  • aptamers Due to their specificity for protein A, G or L, aptamers are present
  • Substances are substances which are firmly bound to protein A, G or L, for example by a covalent bond, hydrogen bonds or a complex bond
  • the aptamers according to the invention are also specific for recombinantly produced protein A, protein G or protein L, for example recombinantly produced in E. coli protein A, G, or L.
  • protein A, protein G and protein L also mutation forms of these proteins, ie altered protein A, G or L compared to the wild type, for example, caused by artificial or natural gene mutations include.
  • Aptamers according to the invention which are specific for protein A, G or L, protein A, G or L-containing substances or protein A, G or L-containing microorganisms can be obtained for example with the SELEX method (Systematic Evolution of Ligands by Exponential Enrichment) , Basic work on the SELEX process is from Tuerk and Gold, Science 249 (1990) 505-510, and Ellington and Szostak, Nature 346 (1990) 818-822. SELEX processes are further disclosed in US 5,567,588 and US 5,270,163.
  • a combinatorial random library consisting of single-stranded DNA (ssDNA) oligonucleotides is first generated.
  • the oligonucleotides have an internal variable region, for example 40-60 nucleotides, flanked at the 5 'and 3' ends of primer regions.
  • the primer regions serve as Primer binding sites for a PCR amplification.
  • Combinatorial random libraries can be obtained from commercial providers.
  • the variability of a library is for example in the range of about 10 15 different molecules.
  • Selection and amplification steps are cyclically enriched the oligonucleotides that bind best to the target.
  • Each cycle consists of the following substeps:
  • the selected and enriched oligonucleotide pool is called
  • a SELEX process for the isolation of aptamers of the invention is described in more detail in the accompanying examples.
  • An exemplary method for the discovery of aptamers according to the invention is the so-called FluMag-SELEX method in which fluorescence-labeled ssDNA molecules and magnetic beads (beads) as
  • Immobilization matrix can be used for the target. This method, which was used in the accompanying examples, is also described in: R. Stoltenburg et al. (2005) FluMag-SELEX as an advantageous method for DNA aptamer selection, Anal. Bioanal. Chem. 383, 83-91.
  • aptamers according to the invention can be prepared by conventional techniques of chemical DNA and RNA synthesis, which are known to the person skilled in the art. If the sequence of a DNA aptamer is known, then an RNA aptamer having the same sequence can be prepared by conventional synthetic methods. Furthermore, the binding properties of individual aptamers to the target can be investigated.
  • the aptamers according to the invention are synthetic oligonucleotides, which in particular were selected according to the SELEX method just described from an underlying synthetic combinatorial oligonucleotide library or are subsequently prepared by conventional synthesis methods.
  • the invention relates to an aptamer which binds to microorganisms containing protein A, G or L, protein A, G or L or protein A, G or L and which is selected from the group consisting of
  • an aptamer comprising, or consisting of, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 65, with the proviso that thymine may be replaced by uracil,
  • the functionality of the aptamers from a) -f), ie the binding to protein A, G or L-containing substances or protein A, G or L-containing microorganisms, can be estimated by a secondary structure analysis of the aptamers.
  • the functionality of other variants mentioned in this description can thus be estimated.
  • Modeling of the possible secondary structure of aptamers can be done using the "mfold" program (version 3.1 or 3.5), which is freely available on the Internet
  • Binding buffer composition 100 mM NaCl, 20 mM Tris-HCl, pH 7.6, 10 mM MgCl 2 , 5 mM KCl, 1 mM CaCl 2 .
  • the invention includes aptamers whose sequence has an identity of at least 70%, preferably at least 80%, or at least 85%, or at least 90%, or at least 93%, or at least 95%, or at least 96%, or at least 97% , and most preferably at least 98%, having any of the sequences of SEQ ID NO: 1 to SEQ ID NO: 65.
  • identity is to be understood as meaning the number of matching nucleotides (identity), expressed in percent
  • identity between two relevant nucleic acid sequences is preferably determined with the aid of computer programs.
  • identity is to be determined so that the number of nucleotides sharing the shorter sequence with the longer sequence determines the percentage of identity
  • the identity is determined using the known and publicly available computer program ClustalW2
  • the definition of identity in the ClustalW2 program and its method of discovery, which are publicly available, are expressly referred to in this invention.
  • ClustalW2 is publicly available from the European Bioinformatics Institute (EBI) of the European Molecular Biology Laboratory (EMBL) and is available on the Internet at http://www.ebi.ac.uk/Tools/msa/clustalw2/.
  • EBI European Bioinformatics Institute
  • EMBL European Molecular Biology Laboratory
  • the ClustalW2 computer program is used to determine the identity between eg the nucleotide sequence
  • DNA Weight Matrix IUB
  • CAP OPEN 10
  • CAP EXTENSION 0.20
  • CAP DISTANCES 5
  • NO END GAPS no
  • ITERATION none
  • NUMBER 1;
  • the invention also relates to any aptamer that hybridizes to the complementary strand of an aptamer according to the invention described above, provided that such an aptamer contains substance A, G or L, a protein A, G or L-containing substance or a protein A, G or L containing organism, in particular Staphylococcus aureus, Streptococcus or Peptostreptococcus binds.
  • hybridization in the context of this invention means a hybridization under conventional hybridization conditions, preferably under stringent conditions, as described, for example, in Sambrook et al., Molecular Cloning, A Laboratory Manual, 3rd Ed. (2001) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • nucleic acid molecules for example, be isolated from DNA libraries.
  • the identification and isolation of such nucleic acid molecules can thereby using the above
  • Nucleic acid molecules SEQ ID NO: 1 to SEQ ID NO: 65
  • parts of these molecules or the reverse complements of these molecules are carried out, e.g. by hybridization by standard methods (see, e.g., Sambrook et al., 2001, Molecular Cloning, A
  • Fragments used as a hybridization probe may also be synthetic fragments or oligonucleotides prepared by conventional methods
  • the invention also provides an aptamer which is derived from an aptamer having one of the sequences of SEQ ID NO: 1 to SEQ ID NO: 65 in that one of the sequences of SEQ ID NO: 1 to SEQ ID NO: 65 or multiple nucleotides substituted, deleted (deletion), inserted within the sequence (inserted) and / or am 5'-end and / or 3'-end are added, wherein such an aptamer to protein A, G or L, a protein A, G or L-containing substance or a protein A, G or L-containing organism, in particular Staphylococcus aureus, Streptococcus or Peptostreptococcus binds.
  • Such altered aptamers preferably have an identity of at least 70%, or at least 80%, or at least 85%, or at least 90%, or at least 93%, or at least 95%, or at least 96%, or at least 97%, and most preferably at least 98% with one of
  • Sequences of SEQ ID NO: 1 to SEQ ID NO: 65 The term identity has been previously defined.
  • a sequence in which one or more nucleotides are substituted is also referred to as a substitution mutant, a sequence in which one or more nucleotides are deleted, as a deletion mutant and a sequence in which one or more nucleotides are inserted, as an insertion mutant.
  • up to 60 nucleotides are substituted, deleted, and / or inserted, more preferably up to 50 nucleotides, even more preferably up to 40 nucleotides, or up to 30 nucleotides, in particular preferably up to 10 nucleotides or up to 8 nucleotides or up to 5 nucleotides, more preferably up to 3 nucleotides, and most preferably up to 2 nucleotides.
  • nucleotides When added, preferably up to 100 nucleotides are added at the 5 'and / or 3' end of the aptamer, more preferably up to 50 nucleotides, even more preferably up to 40 nucleotides, or up to 20 nucleotides, most preferably up to 10 nucleotides or up to 8 nucleotides, most preferably up to 5 nucleotides.
  • motifs ATACCAGCTTATTCAATT SEQ ID NO: 66
  • ACAATCGTAATCAGTTAG SEQ ID NO: 67
  • Substantially unchanged means that up to a maximum of 5 nucleotides, preferably a maximum of 4 nucleotides, most preferably a maximum of 3 nucleotides, are substituted, deleted and / or inserted in this motif.
  • Adjuncts may, for example, be oligonucleotides which act as spacers between the Aptamer sequence and a label or to an oligonucleotide having a sequence which is complementary to a labeled oligonucleotide, as described in WO20051 13817.
  • Fragments also referred to as parts or subsequences, have the previously
  • Fragments are obtained by cleaving at the 5 'end and / or at the 3' end of a
  • Aptamers removes one or more nucleic acids. Fragments are preferably at least 10, more preferably at least 15 and more preferably at least 20 nucleotides in length, most preferably at least 30 or at least 40 nucleotides in length. Fragments are, for example, those aptamers in which the motifs ATACCAGCTTATTCAATT (SEQ ID NO: 66) and / or
  • ACAATCGTAATCAGTTAG (SEQ ID NO: 67) are completely or partially removed.
  • derivative in the context of the present invention refers to an aptamer which has a chemical structure which does not occur in natural DNA or RNA.
  • the term derivative denotes an aptamer containing a chemical structure other than deoxyribose, ribose, phosphate, adenine (A), guanine (G), cytosine (C), thymine (T), or uracil (U).
  • An aptamer derivative may be modified at the nucleobase, at the pentose or at the phosphate backbone.
  • derivative refers to an aptamer
  • derivatives include, but are not limited to,
  • Aptamers which have at least one nucleotide an alkylation, arylation or acetylation, alkoxylation, halogenation, an amino group or another functional group.
  • modified nucleotides are 2'-fluoro ribonucleotides, 2'-NH 2 -, 2'-OCH 3 - and 2'-O-methoxyethyl ribonucleotides, which are used for RNA aptamers.
  • Labeled aptamers also referred to as labeled aptamers.
  • Labels are visual, optical, photonic, electronic, acoustic, opto-acoustic, mass, electrochemical, electro-optical, spectrometric, enzymatic, or otherwise chemically, biochemically, or physically detectable.
  • Labels can be, for example, tethered reporter, marker or adapter molecules. Examples of these are labeled aptamers whose
  • marker substances are given below in the explanation of methods according to the invention, in which labeled aptamers can be used.
  • RNA or DNA Phosphodiselenoate RNA or DNA, locked nucleic acid (LNA), peptide nucleic acid (PNA), N3'-P5 'phosphoramidate, phosphoroamidate RNA or DNA
  • RNA / DNA cyclohexene nucleic acid (CeNA), tricyclo-DNA (tcDNA) or aptamer, or have the phosphoramidate morpholine (PMO) components (see also Chan et al., Clinical and Experimental Pharmacology and Physiology (2006) 33, 533-540).
  • PMO phosphoramidate morpholine
  • aptamers Some of the modifications allow aptamers to be stabilized against nucleic acid-cleaving enzymes.
  • the stabilization does not affect the affinity of the modified RNA / DNA aptamers, but prevents the rapid decomposition of the Aptamers in an organism or biological solutions by RNases / DNases.
  • An aptamer is referred to as stabilized in the context of the invention if the half-life in biological sera is greater than one minute, preferably greater than one hour, more preferably greater than one day.
  • the aptamers can also be used
  • Reporter molecules may be modified, which can contribute to the detection of the labeled aptamers also to increase the stability.
  • the invention relates to an aptamer which binds to microorganisms containing protein A, G or L, protein A, G or L or protein A, G or L and which is selected from the group consisting of
  • an aptamer comprising, or consisting of, a nucleic acid sequence having SEQ ID NO: 62, with the proviso that thymine may be replaced by uracil
  • Nucleotides are substituted, deleted, inserted and / or attached, in particular an aptamer having a sequence according to SEQ ID NO: 1 to SEQ ID NO: 4,
  • the invention relates to an aptamer which binds to microorganisms containing protein A, G or L, protein A, G or L or protein A, G or L and which is selected from the group consisting of
  • an aptamer comprising, or consisting of, a nucleic acid sequence having SEQ ID NO: 63, with the proviso that thymine may be replaced by uracil
  • an aptamer whose nucleic acid sequence has an identity of at least 70% with the nucleic acid sequence of an aptamer from a), in particular an aptamer having a sequence according to SEQ ID NO: 5 to SEQ ID NO: 8,
  • Nucleotides are substituted, deleted, inserted and / or attached, in particular an aptamer having a sequence according to SEQ ID NO: 5 to SEQ ID NO: 8,
  • the invention relates to an aptamer which binds microorganisms containing protein A, G or L, protein A, G or L or protein A, G or L and which is selected from the group consisting of
  • an aptamer comprising, or consisting of, a nucleic acid sequence having SEQ ID NO: 64, with the proviso that thymine may be replaced by uracil
  • Nucleotides are substituted, deleted, inserted and / or attached, in particular an aptamer having a sequence according to SEQ ID NO: 9 to SEQ ID NO: 10, e) a fragment of an aptamer according to a), b), c) or d), and
  • the invention relates to an aptamer which binds microorganisms containing protein A, G or L, protein A, G or L or protein A, G or L and which is selected from the group consisting of a) an aptamer comprising, or consisting of, a nucleic acid sequence having SEQ ID NO: 65, with the proviso that thymine may be replaced by uracil, b) an aptamer whose nucleic acid sequence has an identity of at least 70% with the nucleic acid sequence of an aptamer from a), in particular an aptamer having a sequence according to SEQ ID NO: 1 1 to SEQ ID NO: 12,
  • Nucleotides are substituted, deleted, inserted and / or added, in particular an aptamer having a sequence according to SEQ ID NO: 1 1 to SEQ ID NO: 12, e) a fragment of an aptamer according to a), b), c) or d) , and
  • a specific embodiment of the invention relates to an aptamer which binds to microorganisms containing protein A, G or L, protein A, G or L-containing substances or protein A, G or L, and which is selected from the group consisting of
  • an aptamer comprising, or consisting of, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 65, wherein
  • an oligonucleotide having the sequence 5' ATACCAGCTTATTCAATT 3 '(SEQ ID NO: 66) is removed and / or
  • an oligonucleotide having the sequence 5' ACAATCGTAATCAGTTAG 3 '(SEQ ID NO: 67) is removed,
  • an aptamer whose nucleic acid sequence has an identity of at least 70% with the nucleic acid sequence of an aptamer from a), c) an aptamer which hybridizes with the complementary strand of an aptamer from a),
  • an aptamer in which one or more nucleotides are substituted, deleted, inserted and / or attached to an aptamer from a), e) a fragment of an aptamer according to a), b), c) or d), and
  • embodiments of the invention include embodiments in which an oligonucleotide with the sequence 5 'ACAATCGTAATCAGTTAG 3' (SEQ ID NO: 67) is removed at the 3 ' end of the nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 65.
  • the binding ability of the aptamers according to the invention is determined by the affinity
  • the invention relates to a medicament, in particular for
  • prophylaxis Diagnosis, prophylaxis and / or treatment of diseases attributable to Staphylococcus aureus, Streptococcus and / or Peptostreptococcus comprising one or more different aptamers of the invention as described above.
  • prophylaxis it may be meant, for example, that Staphylococcus aureus, Streptococcus or Peptostreptococcus are rendered harmless by attachment of an aptamer according to the invention and thus infection of an organism is prevented.
  • the invention also relates to the use of the aptamers according to the invention for the diagnosis, prophylaxis, treatment and / or treatment of diseases based on
  • a pharmaceutical according to the invention is any agent which can be used in the prophylaxis, diagnosis, therapy, follow-up or after-treatment of patients who at least temporarily exhibit a pathogenic modification of the overall condition or condition of individual parts of the patient's organism.
  • the medicine can be a medicine for humans as well as for animals.
  • Diseases attributable to Staphylococcus aureus and treatable with a pharmaceutical composition according to the invention are, in particular, sepsis, skin and wound infections, pneumonias, abscesses, boils, carbuncles, endocarditis, muscle diseases (pyomyositis), Osteomyelitis, food poisoning by S. aureus exotoxins, Toxic shock syndrome (TSS) sepsis and mastitis in animals.
  • TSS Toxic shock syndrome
  • the medicament according to the invention preferably contains pharmaceutically acceptable excipients and / or carriers which are known to the person skilled in the art.
  • the medicament may comprise the aptamer as a pharmaceutically acceptable salt.
  • these may be, for example, salts of inorganic acids, e.g. the phosphoric acid, or salts of organic acids.
  • the particular dose or dose range for the administration of the medicament according to the invention is large enough to achieve the desired prophylactic or therapeutic effect of binding to protein A, G or L. In general, the dose will vary with the age, constitution and gender of the patient, as well as the severity of the disease
  • the medicament may also comprise further active ingredients, such as, for example, in order to promote the medicinal effect.
  • further active ingredients such as, for example, in order to promote the medicinal effect.
  • Antibody any active ingredient that is suitable for the treatment of a patient.
  • the drug of the present invention may be administered orally, transmucosally, rectally, pulmonarily, enterally and / or parenterally.
  • Preferred is a direct injection into the body.
  • the chosen mode of administration will depend on the indication, dose to be administered, individual-specific parameters, etc. In particular, the different modes of administration will allow for site-specific therapy that minimizes side effects and reduces the drug dose.
  • Preferred injections are the intradermal, subcutaneous, intramuscular or intravenous injection.
  • the application can, for example, with the help of so-called vaccine guns that bring the DNA by means of gold balls into the skin, or by means of syringes, which bring the DNA under the skin or into the muscle to happen.
  • the aptamer is also possible to provide the aptamer as an aerosol which is inhaled by the organism, preferably a human patient.
  • pharmaceutically acceptable adjuvants such as adjuvants, may be added to the pharmaceutical compositions produced therefrom.
  • adjuvants any substance which makes possible, amplifies or modifies an effect with the DNA aptamers according to the invention is an adjuvant.
  • adjuvants are, for example
  • Aluminum compounds e.g. Aluminum hydroxide or aluminum phosphate, saponins, e.g. QS 21, muramyl dipeptide or muramyl tripeptide, proteins, e.g.
  • TNF Gamma interferon or TNF, MF 59, phosphate dibylcholine, squalene or polyols.
  • the pharmaceutical agent can be present for example as a tablet, capsule, powder, solution, dispersion or suspension.
  • the dosage forms of the pharmaceutical agent are with the usual solid or liquid carriers and / or
  • the invention relates to a method for the detection of protein A, G or L, substances containing protein A, G or L or microorganisms containing protein A, G or L, in particular Staphylococcus aureus, Streptococcus or Peptostreptococcus, in which
  • one or more different aptamers of the invention as described above are contacted with a sample containing protein A, G or L containing substance A, G or L or the microorganism, and
  • the method can be both a qualitative and a quantitative detection method.
  • the process steps a) and b) can be carried out simultaneously or substantially simultaneously, depending on the concrete process design.
  • the method is particularly suitable for use in the food, water and
  • the method is particularly suitable for the detection of Staphylococcus aureus in any media and environments, especially in water and other liquids, such as in drinking and wastewater samples.
  • the aptamer of the present invention binds to Protein A, which exists in the cell wall and is accessible to the aptamer.
  • the aptamer may also bind to other germs containing protein A, G or L, for example as a surface protein in the cell wall. If the protein A, G or L does not sit on the surface of a microorganism, it is possible to destroy the organism in order to release protein A, G or L contained therein for detection.
  • a sample in the sense of the above detection method is a material provided or sampled which is believed to contain protein A, G or L, protein A, G or L-containing substance or a microorganism containing protein A, G or L (in summary referred to as “target” or as part of this detection method as “analyte”), and that on the
  • Presence Target should be checked.
  • a sample may be a water sample, in particular a drinking water, groundwater, surface water or wastewater sample, a sample of other environmental sampled material, a clinical sample or a food sample.
  • a sample may further be any biological material isolated from individuals, for example, biological tissues and fluids, including but not limited to: Blood, skin, plasma, serum, lymph, urine, cerebrospinal fluid, tears, smears,
  • components of cell cultures are also included in samples.
  • the sampling takes place in particular so that the extracted subset corresponds to an average of the total amount.
  • the characteristics determined by examination of the sample are used to assess the amount detected by the sample, which in turn allows conclusions to be drawn about the total amount, for example the blood or the lymph in an organism.
  • the Pre-treated samples such as by mixing, addition of enzymes or markers, or purified.
  • an aptamer-target complex is formed by binding the aptamer the target.
  • the binding or binding event can be detected, for example, visually, optically, photonically, electronically, acoustically, opto-acoustically, by mass, electrochemically, electro-optically, spectrometrically, enzymatically, or otherwise chemically, biochemically or physically.
  • the aptamer is fixed on a surface, for example, and the change in layer thickness after addition of the target is determined by one of the methods mentioned, such as, for example, about a change in the optical properties of the sensor layer (e.g., refractive index).
  • Another method of label-free detection is the measurement of the mass change after binding of the aptamer to the target with a microbalance, or the measurement of a
  • the complex may be visualized by labeling, for example, in an indicator reaction following direct or indirect coupling of a complex partner with a complex
  • Labeling substance Either the used aptamer or the target can be provided with a label. Preferably, the aptamer is labeled.
  • Preferred labels are visual, optical, photonic, electronic, acoustic, opto-acoustic, mass, electrochemical, electro-optical, spectrometric, enzymatic, or otherwise physically, chemically, or biochemically detectable.
  • the label is detected by luminescence, UV / VIS spectroscopy, enzymatically, electrochemically or radioactively.
  • Luminescence refers to the emission of light.
  • photoluminescence, chemiluminescence and bioluminescence are used for detection of the label.
  • photoluminescence or fluorescence the excitation takes place by absorption of photons.
  • fluorophores include, without limitation, bisbenzimidazole, fluorescein, acridine orange, Cy5, Cy3 or propidium iodide, which can be covalently coupled to aptamers, tetramethyl-6-carboxyhodamine (TAMRA), Texas Red TR, rhodamine, Alexa fluorine dyes (inter alia, fluorescent dyes of various wavelengths from different companies).
  • TAMRA tetramethyl-6-carboxyhodamine
  • Alexa fluorine dyes inter alia, fluorescent dyes of various wavelengths from different companies.
  • the evaluation is done visually or with appropriate measuring instruments, eg in the Multilabel Counter, in the fluorescence microscope, or by flow cytometry, eg in
  • Chemiluminescence describes the emission of visible light as a result of a chemical reaction.
  • Bioluminescence refers to the emission of visible light as a result of an enzyme reaction, such as a redox reaction catalyzed by the enzyme luciferase.
  • colloidal metallic particles e.g. Gold nanoparticles, colloidal non-metallic particles, quantum dots, organic polymers, latex particles, or liposomes with signal-producing substances. Colloidal particles can be detected colorimetrically.
  • markers enzymes whose enzymatic reaction is characterized by the consumption or formation of detectable substrates or products, without limitation, optical or electrochemical detection.
  • Evidence may e.g. with enzymes as labeling substances that convert substrates into colored products, preferably peroxidase, green fluorescent protein (GFP), luciferase, [beta] -galactosidase or alkaline
  • the colorless substrate X-Gal is converted by the activity of [beta] -galactosidase to a blue product whose color is visually detected.
  • alkaline phosphatase Various proofs are possible with alkaline phosphatase (AP), as exemplified below: electrochemical detection: substrate phenylphosphate, enzymatic reaction of APP forms phenol, is electrochemically detected on phenol sensor (eg with immobilized tyrosinase)
  • substrate AMPPD (2 '-Spiroadamantan) -4- methoxy-4- (3 "-phosphoryloxy) phenyl-1, 2-dioxetane
  • APP converts 5-bromo-4-chloro-3-indolyl phosphate (BCIP or X-phosphate) and nitroblue tetrazolium salt (NBT) in color.
  • BCIP or X-phosphate 5-bromo-4-chloro-3-indolyl phosphate
  • NBT nitroblue tetrazolium salt
  • the peroxidase catalyzes, for example, the oxidation of ABTS (2,2'-azino-bis- [3-ethylbenzthiazoline-6-sulfonic acid]) in the presence of H 2 0 2 .
  • Horseradish peroxidase is preferred because of its enzyme stability and a variety of possible substrates.
  • Other enzyme markers that catalyze the generation of detectable products are chloramphenicol acetyltransferase (CAT) and glutathione S-transferase (GST).
  • the detection can also be carried out by means of radioactive isotopes with which the aptamer is labeled, preferably 3H, 14C, 32P, 33P, 35S or 125 I, particularly preferably 32P, 33P or 1251.
  • radioactive isotopes with which the aptamer is labeled, preferably 3H, 14C, 32P, 33P, 35S or 125 I, particularly preferably 32P, 33P or 1251.
  • scintillation counting the radiolabelled aptamer target Complex emitted radioactive radiation indirectly measured.
  • Scintillator substance is excited by the radioactive radiation. During the transition to the ground state, the excitation energy is released again as flashes of light, which are amplified and counted by a photomultiplier.
  • the aptamers can also be labeled with digoxigenin or biotin, which are bound, for example, by antibodies or streptavidin, which in turn can carry a label, such as an enzyme conjugate. If the antibody is coupled to an enzyme, an enzyme-linked immunosorbent assay (ELISA) can be used to demonstrate what will be explained below.
  • ELISA enzyme-linked immunosorbent assay
  • the prior covalent attachment (conjugation) of an antibody to an enzyme can be accomplished in several known ways. Detection of antibody binding may also be radioactive in an RIA (radioactive immunoassay) with radioactive isotopes, preferably 125 I, or by fluorescence in a FIA (fluoroimmunoassay) with fluorophores, preferably with fluorescein or FITC.
  • RIA radioactive immunoassay
  • FIA fluoroimmunoassay
  • the said methods preferably include washing steps to separate unbound and / or unspecifically bound aptamers and / or detection reagents.
  • the implementation of all detection methods is known to the person skilled in the art.
  • Direct detection of the label is preferred in the present method of the invention, especially direct detection by fluorescence.
  • the detection is carried out in situ.
  • This reaction requires a suitable incubation space on which the detection can be easily performed and visualized.
  • a solid support is advantageously used, which makes it possible to fix sample, aptamers and, if necessary, detection reagents of the complexes.
  • the aptamers can be applied to the solid support either before or after the sample. Methods of immobilization of the aforementioned aptamers are known to the person skilled in the art. Examples are given below. All proofs that have already been mentioned above, such as mark-free proof and evidence with the use of a marking, can be considered for the proof. In the case of a color detection, the aptamers can be marked so that a reading and evaluation can be realized directly after the incubation.
  • the aptamer according to the invention alone or a mixture of different aptamers according to the invention can be used in the methods explained above and in all other methods disclosed by this invention.
  • Aptamers according to the invention can also be used in combination with other aptamers.
  • a combination with other aptamers for other targets ie other targets than protein A, G or L, protein A, G or L-containing substances, and protein A, G or L-containing microorganisms
  • the sample or the aptamer can be immobilized on a solid phase, depending on the process design.
  • (micro) arrays of the aptamer according to the invention, or microtiter plate test systems can be used in the process.
  • the detection method described above can be carried out analogously to known immunoassays, wherein, in comparison to a known immunoassay, one or more antibodies are replaced by an aptamer according to the invention.
  • the detection method in the form of a competitive assay or a sandwich assay.
  • an aptamer of the invention specific for the target is bound to a solid phase. This is followed by the addition of the sample solution which contains the target to be measured and is simultaneously mixed with a known concentration of labeled target.
  • Sample solution in unknown concentration present unlabelled target as well as the labeled target compete for binding to the bound aptamer.
  • concentration of the target in the sample the less tagged target will be bound to the aptamer.
  • By detecting and optionally quantitating the label it is possible to detect the target in the sample and to measure its concentration.
  • an aptamer according to the invention which is specific for the target is also first bound to a solid phase. It is bound to labeled target. The measurement of the mark gives the
  • the primary antibody In a classical immunological sandwich assay, at least two antibodies are used. First, one of the two antibodies is immobilized on a solid phase. This is called the primary antibody or as a catcher. After addition of the sample, the antigen contained therein binds to the primary antibody. Subsequently, the sample solution is removed and the second antibody called secondary antibody or detector is added in dissolved form to the solid phase. The detector now also binds to the antigen bound by the primary antibody. For detection and quantification, the secondary antibody is either self-labeled or detected via a labeled reagent. In the present invention, this process is modified so that either the primary antibody or as a catcher. After addition of the sample, the antigen contained therein binds to the primary antibody. Subsequently, the sample solution is removed and the second antibody called secondary antibody or detector is added in dissolved form to the solid phase. The detector now also binds to the antigen bound by the primary antibody. For detection and quantification, the secondary antibody is either self-labeled or detected
  • Primary antibody or the secondary antibody, or both, are replaced by an inventive aptamer and that the antigen containing a target for the aptamer, so protein A, G or L, a protein A, G or L-containing substance or protein A, G or L. Microorganism, is.
  • the assay can be carried out with all known solid phases, for example microtiter plates, strips, membranes, cuvettes etc.
  • protein A, G or L Detection of protein A, G or L, protein A, G or L containing substances or microorganisms containing protein A, G or L, in particular Staphylococcus aureus, Streptococcus or Peptostreptococcus, in which
  • step a) can be carried out using all conventional techniques, which are also known from immunological assays.
  • the detection in step d) can be carried out in the case of an antibody by the known methods known from immunological direct and indirect sandwich assays. Either the antibody itself may be labeled, for example by attachment of an enzyme capable of catalyzing a color reaction for detection, or a third antibody may be added which in turn binds to the second antibody and has a label. If an aptamer is used in step c), this is preferably a labeled aptamer, which can be detected with suitable detection reactions, as previously described. Between said steps a) -d) are preferably
  • the invention relates to a method for enrichment
  • Containing a complex or complexes of the aptamer (s) and protein A, G or L, from the aptamer (s) and the protein A , G or L-containing substance or from the Aptamer (s) and the protein A, G or L-containing microorganism is formed,
  • the complex (s) and the remaining sample are separated from each other, and c) optionally protein A, G or L, the protein A, G or L-containing substance or the microorganism containing the protein A, G or L from the complex is isolated.
  • sample in the sense of this method is defined as well as a sample in the sense of the previously described detection method
  • Water sample such as a sample of drinking water, groundwater, surface water, or sewage, a sample of other environmentally extracted material, or a food sample.
  • This method is also used in particular in food, water and environmental analysis, water treatment and water treatment, especially of drinking water and wastewater, diagnostics and in hospitals and
  • a “separation" of protein A, G or L, protein A, G or L-containing substance or a protein A, G or L-containing microorganism (collectively referred to as "target") from a sample may, in the context of the analytical
  • Detection limit be complete or incomplete.
  • Staphylococcus aureus, Streptococcus, or Peptostreptococcus can be separated from environments in which it is undesirable, for example, from aqueous or other liquid samples.
  • Enrichment is achieved in step b) when the formed aptamer-target complex and the remaining sample are separated from each other Two fractions are obtained, wherein in the fraction containing the complex, the complex is enriched "Enrichment” may refer to the complex comprising aptamer and protein A, G or L, from aptamer and protein A, G or L-containing substance or from
  • Aptamer and the protein A, G or L-containing microorganism is formed, or on the protein A, G or L, the protein A, G or L-containing substance or the protein A, G or L-containing microorganism (collectively referred to as "target"
  • process step c) can be carried out, in other words an enrichment means an increase in the concentration of the aptamer-target complex or of the target itself.
  • isolation may refer to the complex formed from aptamer and protein A, G or L, from aptamer and protein A, G or L containing substance or from aptamer and protein A, G or L containing microorganism , or on the protein A, G or L, the protein A, G or L-containing substance or the microorganism itself containing the protein A, G or L itself. Therefore, the last process step is optional.
  • complex refers to the structure formed upon binding of the aptamer to its target
  • complex refers to an aptamer-target structure in which the aptamer is attached to the target.
  • aptamer-target binding occurs predominantly, but not necessarily exclusively, via the structural compatibility, so-called “stacking interactions" in aromatic compounds
  • Ring structures stacking forces through electron interaction with neighboring bases
  • electrostatic interactions e.g., van der Waals, ionic, dipole forces
  • the said process steps a), b) and c) can take place simultaneously, depending on the process design, and in particular the process steps a) and b) can take place simultaneously.
  • the formation of the aptamer-target complex can be promoted by tempering to the optimum aptamer-target binding temperature, preferably 20-25 q C, and / or stirring the sample.
  • aptamer-target complexes are separated from the remaining sample solution. Suitable methods are known to those skilled in the art, e.g. Dialysis,
  • the aptamer-target complex is separated in optional step c).
  • physicochemical effects such as a variation of salt concentration or pH or heat denaturation conceivable.
  • further purification of the target is possible, whereby the aptamer can be degraded beforehand, e.g. by acid (thermal) hydrolysis or DNases. If the aptamer is immobilized, the target can be eluted, e.g. from a column, which is then regenerated and reused.
  • the aptamers can also be immobilized on a solid phase, more specifically on the surface of a solid phase, preferably via a spacer molecule, which can be, for example, a linker nucleic acid.
  • a spacer molecule which can be, for example, a linker nucleic acid.
  • suitable methods of immobilization are known in the art, both with a covalent coupling and a non-covalent coupling by means of suitable affinity pairs, such as Biotin / streptavidin may be associated.
  • the solid phase may be, for example, plates, strips, membranes, films, gels, beads, micro- and nanoparticles.
  • Exemplary carrier materials are inorganic and organic polymers, ceramics, glasses, metals, in particular noble metals. These include plastics, for example based on polystyrene.
  • biopolymers preferably cellulose, dextran, agar, agarose and Sephadex, which may be functionalized, in particular as nitrocellulose or cyanogen bromide Sephadex, can be used as polymers in the process according to the invention.
  • Aptamers can be bound to magnetic beads whose surface contains, for example, tosyl or epoxy groups, amino or carboxyl groups or streptavidin
  • the separation, enrichment, and / or isolation method just described is an affinity chromatography method in which an aptamer according to the invention is immobilized on a solid phase, preferably on beads or beads
  • the corresponding targets can be enriched starting from low concentrations.
  • the invention also relates to the use of the previously described aptamer for detecting, enriching, separating and / or isolating protein A, G or L, protein A, G or L-containing substances or protein A, G or L-containing
  • Microorganisms in particular Staphylococcus aureus, Streptococcus or
  • the aptamer can be used in the previously explained methods.
  • the term enrichment includes the purification of the target.
  • the invention also relates to methods for quantifying the binding of an immunoglobulin to protein A, G or L, which method a) protein A, G or L or a microorganism containing a protein A, G or L is provided,
  • the mentioned immunoglobulin binds to the same epitope of the protein A, G or L as the aptamer according to the invention.
  • epitopes then means that they are the same epitopes which occur multiple times because several protein A, G or L molecules are used in the process and / or because protein A, G or L has several epitopes of the same type
  • Step c) of the method binds the aptamer to protein A, G or L molecules to which no immunoglobulin has bound
  • the amount of bound protein A, G or L is determined in step d), for example by fluorescence labeling over the intensity Binding can be determined for an array of protein A, G or L by the recognizable location of the label.
  • the aptamer and the immunoglobulin bind to different epitopes. However, due to steric hindrance, the aptamer in step c) no longer binds to protein A, G, or L molecules to which immunoglobulin has already bound. In step c) of the method, the aptamer binds to protein A, G or L molecules to which no immunoglobulin has bound.
  • the invention also relates to the use of the previously described aptamer for quantifying the binding of
  • Immunoglobulins on protein A, G or L are particularly suitable as an assay for medical diagnostics.
  • protein A, G or L or the microorganism containing the protein A, G or L can take place in various ways.
  • protein A, G or L or the protein A, G or L containing microorganism in a be provided liquid phase in a defined amount. It is also possible to immobilize the aptamer in a defined amount on a solid phase or to immobilize protein A, G or L or the microorganism in a defined amount on a solid phase.
  • the solid phase may be, for example, plates such as microtiter plates, strips, membranes, films, gels, beads, micro- and nanoparticles.
  • step b) an immunoglobulin is added which binds to protein A, G or L or to protein A, G or L present in the cell wall of the microorganism.
  • the antibody is usually suspended in a liquid phase.
  • step b) If protein A, G or L or the microorganism are bound to a solid phase, after step b), preferably unbound antibody is removed by washing, for example with a suitable washing buffer. There are after the step b), and optionally a washing step, antibody-coated protein A, G or L molecules / microorganisms and not occupied with antibody protein A, G or L molecules / microorganisms, here referred to as "mixture" Step, the mixture is brought into contact with inventive aptamer, the aptamer binds to unassociated protein A, G or L.
  • step c) preferably unbound aptamer is removed by washing, for example with a suitable washing buffer.
  • Has bound microorganism A bond between the aptamer and protein A, G or L or the microorganism can be detected as previously explained in the detection method according to the invention.
  • a labeled aptamer is used.
  • Another use of the aptamer according to the invention relates to the use of blocking or quantifying free binding sites on protein A, G or L.
  • protein A, G or L modified surfaces e.g. Beads or microtiter plates.
  • the aptamers can be used for Blocking of the immobilized protein A, G or L - binding sites are used. This presupposes that the aptamer and the other protein A, G or L binding substance have the same binding site in the protein A, G or L or influence each other in their binding ability.
  • the aptamers may be used to quantify the binding sites left after immobilization, or in other words, to control the
  • the invention also relates to an aptamer probe for the detection of protein A, G or L, protein A, G or L containing substances or protein A, G or L-containing microorganisms, in particular Staphylococcus aureus, Streptococcus or Peptostreptococcus, wherein the probe Aptamer according to the invention and a labeling agent (label).
  • the label may be attached to the aptamer in a variety of ways, for example, but not limited to, covalent binding, complexation, DNA / RNA hybridization.
  • a labeling agent can be bound to an aptamer of the invention as in
  • WO20051 13817 describe.
  • WO20051 13817 describes an aptamer with an attached oligonucleotide tail and a linker oligonucleotide carrying a label, wherein the sequence of the linker oligonucleotide is complementary to the sequence of the oligonucleotide tail of the aptamer such that the linker oligonucleotide is attached to the oligonucleotide tail of the oligonucleotide tail Aptamers hybridizes and the aptamer is labeled.
  • Another possibility is the binding of biotin to the aptamer and the binding of label to streptavidin. A biotin-streptavidin bond binds the label to the aptamer.
  • labeling agents are basically usable, which can be bound to DNA or RNA. Concrete examples of labeling substances have been given above in the explanation of methods according to the invention in which labeled
  • the label is a dye.
  • the marking agent is a substance that imparts an image through the labeled aptamer in an imaging procedure.
  • the image may be generated by radiation that produces an image directly visible to the human eye, or by radiation that is not directly visible, for example
  • Labeling agents may be, for example, luminescence, phosphorescence, fluorescence, radioactive, or UV / VIS labeling substances.
  • the probe according to the invention can be used in particular for the detection, enrichment, separation and / or isolation methods described in this description, in particular in assays for detecting microorganisms containing protein A, G or L or protein A, G or L, such as Staphylococcus aureus , Streptococcus or
  • Assays may e.g. direct and indirect sandwich assays.
  • the invention relates to a biosensor comprising a
  • Such a biosensor according to the present invention preferably comprises the following elements:
  • a transducer that converts the binding event between aptamer and target into an electrically quantifiable signal.
  • Signal processing device an output electronics, a display device, a data processing device, a data storage and interfaces to other devices be present.
  • the biological receptor of the aptamer biosensor preferably has the aptamer according to the invention in immobilized form or consists only of the aptamer in immobilized form.
  • the function of the receptor is the recognition of the analyte based on a biochemical mechanism, here the binding of the
  • Aptamers according to the invention to its target protein A, G or L, protein A, G or L-containing substance, protein A, G or L-containing microorganism. From a sample that comes into contact with the biosensor, such as a complex one Mixture containing target, the target can be identified and quantified via the specific binding of the aptamer.
  • the specificity of the biosensor is dictated by the receptor, while the
  • Sensitivity of the sensor is mainly influenced by the transducer used.
  • the aptamer-target binding taking place at the receptor is converted by the transducer into an electronically usable signal.
  • the transducer converts the signal from the selective recognition reaction of the receptor (binding target to aptamer), which is proportional to the concentration of the target in the sample, into an electrically quantifiable measurement signal. Signaling occurs due to the molecular interaction between the target and the aptamer.
  • biosensor preferably qualitative, quantitative and / or semi-quantitative analytical information can be obtained. It is particularly suitable for use in food, water and environmental analysis, water treatment and water treatment, in particular of drinking water and wastewater, in diagnostics and for use in hospitals and
  • the coupling between receptor and transducer is preferably carried out by the
  • Immobilization of the aptamer on the transducer surface for example via a streptavidin-biotin bond, wherein preferably the aptamer is linked to biotin and the surface of the transducer has immobilized streptavidin.
  • the binding of the target to the aptamer according to the invention can be measured, for example, via optical, microgravimetric, thermal or acoustic transducers, preferably via optical or microgravimetric transducers.
  • optical transducers can be based on principles of photometry, whereby, for example, color or luminescence intensity changes are detected.
  • Optical methods include the measurement of fluorescence, phosphorescence, bioluminescence and chemiluminescence, infrared transitions and light scattering.
  • the optical methods also include the measurement of layer thickness changes when target is bound to aptamer.
  • the layer thickness change may e.g. by means of
  • Microgravimetric transducers include QCM sensors (Quartz Crystal
  • Microbalance that detect mass change when targeting aptamer.
  • Quartz crystal which is highly sensitive to mass changes that occur when target binds to aptamer.
  • the quartz crystal used is placed in an oscillating electric field and the resonant frequency of the crystal is measured.
  • a mass change on the surface of the quartz crystal e.g. by reacting the analyte with the receptor previously immobilized on the crystal surface causes a change in the resonance frequency, which can be quantified.
  • Electrochemical transducers may be e.g. measure the change in the concentration of redox-active markers on the electrode surface, or the change in the concentration of redox-active substrates or products, e.g. be consumed or formed in the enzymatic reaction of an enzyme marker.
  • Thermal transducers measure the heat of the aptamer-target binding reaction.
  • the invention relates to a solid phase, also referred to as a solid support, in particular for use in the detection, enrichment, separation and / or isolation of protein A, G or L, protein A, G or L-containing
  • Solid phases are conceivable in all possible geometric forms.
  • solid supports are plates, strips, membranes, microtiter plates, films, gels, microparticles, nanoparticles or beads.
  • Particularly suitable materials from which a solid phase can be made are inorganic polymers, organic polymers, glasses, organic and inorganic crystals, ceramics, metals, especially precious metals, and semiconductors.
  • a particularly suitable organic polymer is a polymer based on polystyrene.
  • biopolymers preferably cellulose, dextran, agar, agarose and Sephadex, which may be functionalized, in particular as nitrocellulose or cyanogen bromide Sephadex, can be used as polymers.
  • Aptamers may be attached to magnetic beads, e.g.
  • Carry carboxy-terminated or epoxy-activated side chains Furthermore, coupling of magnetic beads to the ribose or deoxyribose of the aptamers, e.g. via a hydrazone bond, possible.
  • the examples of polymers are not limiting and other molecules are conceivable.
  • the immobilized aptamer solid support is a stationary phase for affinity chromatography, which support is preferably in the form of spheres or otherwise shaped particles.
  • the solid phase is a test strip containing one or more different aptamers of the invention.
  • the test strip is particularly useful for qualitative, semi-quantitative and quantitative assays that use visual detection techniques, especially for lateral flow assays.
  • a lateral flow assay works as follows: A liquid sample suspected of containing a target for the aptamer of the invention is applied to the strip at one location, or the strip is wetted with the sample at one site. This site is the so called trial order zone of the strip.
  • the strip contains a matrix material through which the liquid test medium and the target suspended or dissolved therein can flow by capillary action from a sample application zone into a detection zone, where a detectable signal or the absence of such a signal indicates the presence of the target.
  • the strip which can be used for lateral flow assays contains one or more aptamers according to the invention, for example in the sample application zone or at least still locally in front of the detection zone.
  • target When target is present in the test sample, it forms a complex with the aptamer present in the strip, which flows to and is detected in the detection zone.
  • the target within the strip flows to the aptamer, forming with it a complex which subsequently flows to the detection zone.
  • the binding reaction may also take place directly on the site of application, e.g. the test strip contains the aptamer and the aptamer-target binding is visualized directly with a corresponding marker.
  • a labeled aptamer is used, wherein any label already described above can be used.
  • a label is used, which leads to a visually detectable signal in the detection zone of the test strip. Basically, the presence or absence of target in the sample can be detected by detection or lack of detection of a labeled aptamer in the sample
  • Detection zone can be determined.
  • an enzyme-labeled aptamer is used.
  • Target present in the sample forms a complex with the enzyme-labeled aptamer, which flows along the strip to a detection zone containing a substrate for the enzyme label which is capable of producing a colored reaction in the presence of the enzyme label.
  • the strip preferably contains a further zone in which target is immobilized, so that labeled aptamer arising due to the
  • Absence of sufficient target in the sample is not combined with the target, detected, and thereby prevented from reaching the detection zone.
  • test strip functions according to the principle of an immunological lateral flow assay, for example one
  • Pregnancy test strip wherein a labeled immunoglobulin used there is replaced by an inventive, preferably labeled, aptamer.
  • a special variant works according to the following principle: A test strip is wetted with the sample and the target present in the sample binds to a dye-labeled aptamer. The target aptamer-dye complex migrates to the detection zone where a second antibody is fixed which also binds to the target. The immobilized antibody binds the migrating target aptamer-dye complex in the
  • the test strip can be produced from any material that can be wetted with a sample and into which an aptamer according to the invention can be introduced. Particularly preferred are materials through which a sample and a target contained therein can flow by capillary action. Examples are nitrocellulose, nitrocellulose blends with polyester or cellulose, uncoated paper, porous paper, viscose filament, glass fiber, acrylonitrile copolymer or nylon, as well as all other materials common in lateral flow assays.
  • test strip can already be used as such to detect the presence of target in a sample.
  • the strip may be dipped in a sample, for example, in a lateral flow assay, with only one end, which then serves as a trial application zone.
  • the invention also provides a lateral flow assay device comprising the above-described test strip.
  • the device may have, for example, a housing in which the test strip is embedded and which has a preferably closable opening to the sample application zone of the test strip, as well as recesses for monitoring a detection zone and possibly a control zone.
  • a housing in which the test strip is embedded and which has a preferably closable opening to the sample application zone of the test strip, as well as recesses for monitoring a detection zone and possibly a control zone.
  • recesses for monitoring a detection zone and possibly a control zone.
  • the solid support and the aptamer form a microarray, or a so-called "DNA or RNA chip," which may be single-channel or multi-channel Measuring points one or more aptamers and reference materials for basic signal compensation or functional testing can be arranged. In a multi-channel chip, this arrangement takes place in the individual channels. This is the parallel
  • Immobilization of aptamer to solid phase can be accomplished in a variety of ways and in any manner known to those skilled in the art for immobilizing DNA or RNA on solids. Known options have already been mentioned earlier in this description.
  • the immobilization of aptamers on nanoparticles is e.g. described in WO2005 / 13817.
  • a solid phase of paper or porous material may be wetted with the liquid phase aptamer and the volatiles then volatilized leaving the aptamer in the paper or porous material.
  • the present invention also relates to a kit comprising an aptamer according to the invention.
  • the kit preferably comprises an aptamer according to the invention, in particular a labeled aptamer according to the invention or an aptamer probe according to the invention, and further components for the reaction intended by the kit or the procedure to be carried out, for example components for an intended
  • Detection enrichment, separation and / or isolation procedures are buffer solutions, substrates for a color reaction, dyes or enzymatic substrates.
  • the aptamer and / or other components may be immobilized on a solid phase. Exemplary forms and materials for solid phases have been mentioned elsewhere in this specification.
  • the solid phase can be provided for example in the form of a (micro) array or a microtiter plate.
  • the solid phase may in the specific case comprise an immobilized capture substance for protein A, G or L, protein A, G or L-containing substance or a protein A, G or L-containing microorganism, in particular an immobilized antibody capable of binding protein A, G or L, a protein A, G or L-containing substance or a protein A, G or L-containing microorganism is used.
  • an immobilized capture substance for protein A, G or L, protein A, G or L-containing substance or a protein A, G or L-containing microorganism in particular an immobilized antibody capable of binding protein A, G or L, a protein A, G or L-containing substance or a protein A, G or L-containing microorganism is used.
  • Catcher substance is preferably arranged in the form of a (micro) array, in a microtiter plate or in chips.
  • the kit is preferably for carrying out a detection, enrichment, separation and / or isolation method according to the invention for protein A, G or L, protein A, G or L-containing substance or a microorganism containing protein A, G or L, or for carrying out in other assays with the aid of an aptamer according to the invention.
  • a detection, enrichment, separation and / or isolation method according to the invention for protein A, G or L, protein A, G or L-containing substance or a microorganism containing protein A, G or L, or for carrying out in other assays with the aid of an aptamer according to the invention.
  • the aptamer can be provided in a variety of forms, for example freeze-dried or in a liquid medium.
  • the invention also relates to a measuring device for detecting protein A, G or L, substances containing protein A, G or L or protein A, G or L.
  • the meter includes one or more of the aptamers described above, an apta probe as previously described, or one
  • the measuring device may include, inter alia, a sampling device, a signal processing device, a
  • Data processing device a data storage device and interfaces for connection to external devices or storage media.
  • the meter is a portable meter that can be used on-site, such as a pocket-sized lightweight meter.
  • the sampling device of the measuring device can be constructed in various ways.
  • the sampling device is a capillary or a porous strip in which liquids can be absorbed.
  • Such Sampling device is usually immersed in a liquid sample for sampling.
  • Capillary force transports the sample to the desired location in the meter where the aptamer is located and where the detection reaction can take place.
  • the sample is transported to a biosensor having the aptamer, which in turn generates a measurement signal.
  • the sampling device has a hose or a tube and a pump.
  • the pump draws in a liquid sample and transports the sample to the desired location in the instrument where the aptamer is located and where the detection reaction can take place.
  • the sample is transported to a biosensor identifying the aptamer, which in turn generates a measurement signal.
  • the invention also relates in one aspect to the use of a previously described probe, a previously described solid phase, a previously described biosensor, a previously described test strip, a previously described lateral flow assay device, a previously described kit, or a previously described measuring device for Detection of protein A, G or L, substances containing protein A, G or L or microorganisms containing protein A, G or L, or for enrichment,
  • Dynabeads® M-280 streptavidin (Invitrogen, UK) was used according to manufacturer's instructions. 1 ⁇ 10 9 Magnetic Beads first 3 were ⁇ each 500 ⁇ PBS, pH 7.4 and then incubated with shaking at 51 C ⁇ g biotinylated protein A for 1 h at 21 ° C (virgin, biotinylated protein A from Staphylococcus aureus (Sigma, P21 65), dissolved in 0.1 M sodium phosphate buffer pH7.4 to a stock solution of 2 mg / ml).
  • DNA aptamers for protein A was carried out using the FluMag SELEX process. Biotinylated protein A was immobilized on streptavidin-functionalized magnetic beads and used in this form as a target for aptamer selection.
  • a fluorescein label the DNA from the second SELEX round allowed au ßerdem their quantification in the different steps of the SELEX process by means of measurement of fluorescence (Wallac Victor 2 V Multilabel Counter; PerkinElmer, Germany; measurement conditions: Excitation 485 nm / Emission 535 nm, time 1 s, CW -lamp energy 22500, measuring volume ⁇ ⁇ / well, measurement in black 96 well microtiter plates (NUNC; Germany)).
  • the starting point of the selection process was a randomized DNA oligonucleotide library prepared by chemical synthesis (Microsynth AG, CH):
  • N 40 represents the variable nucleotide region (random sequence).
  • oligonucleotides of this library have specific sequences at the 5 'and 3' end, which serve as primer binding sites for the amplification of the oligonucleotides by means of PCR.
  • aptamer selection For aptamer selection, consecutive SELEX rounds were performed consisting of several steps: the selection steps - (i) binding of the DNA oligonucleotide library ( ⁇ 2.5nmol ssDNA) or the oligonucleotide pool selected in the previous round to the target-modified ones Magnetic beads (incubation for 30 min at 21 ° C.
  • binding buffer [100 mM NaCl, 20 mM Tris-HCl, pH 7.6, 10 mM MgCl 2 , 5 mM KCl, 1 mM CaCl 2 ], binding volume 250 ⁇ M
  • separation of the unbound oligonucleotides by several washing steps of the binding complexes (iii) elution of the bound oligonucleotides by heat (2x incubation of the binding complexes in 250 ⁇ binding buffer for 10min at 95 ° C with shaking); the amplification step - (iv) Amplification of the eluted oligonucleotides by PCR and purification - (v) separation of the double-stranded PCR products and recovery of the relevant DNA single strands (sense strands) by means of denaturing PAGE and subsequent gel elution.
  • the new oligonucleotide pool generated this way at the end of a SELEX round was used for a re-binding reaction with the target-modified magnetic beads in the next SELEX round.
  • a fresh aliquot of ⁇ 10 8 target-modified magnetic beads was used.
  • rounds 3 and 7 - 1 1 an additional negative selection step was added. This means that the oligonucleotides were first incubated with streptavidin-functionalized magnetic beads (without a target) in order to remove all oligonucleotides which bind non-specifically to the immobilization matrix.
  • the oligonucleotides remaining in the supernatant were then ligated with the target-modified magnetic beads (see selection step - (i)).
  • the SELEX process in FIG. Round after the amplification step in this case with unmodified primers, terminated.
  • FIG. 1 shows the course of the SELEX process for the selection of protein A-binding aptamers. Shown is the amount of oligonucleotides binding to the target-modified magnetic beads in each SELEX round. In rounds 3 and 7-1 1 (marked in FIG. 1 with * symbol) was additionally carried out a negative selection step. The amount of oligonucleotides that bind to the immobilization matrix of the target is also shown (0-0.07 pmol), but was often at the detection limit of the fluorescence measurement.
  • the selected oligonucleotides (aptamer pool) were amplified with unmodified primers, in order subsequently to clone the resulting PCR products directly into the vector pCR2.1 -TOPO and into E. coli TOP10 cells (TOPO TA cloning kit; UK). Positive clones were identified by colony PCR. Using the QIAprep 96 Turbo Miniprep Kit (Qiagen, Germany), the plasmid DNA of some of the clones was prepared and added for sequencing the aptamer insert (Microsynth AG, CH).
  • the primer sequence (sense) at the 5 'end is ATACCAGCTTATTCAATT (SEQ ID NO: 66) and the primer binding region for the antisense primer at the 3' end is ACAATCGTAATCAGTTAG (SEQ ID NO: 67). They are each shown in bold type.
  • the sequences having SEQ ID NOs: 66 and 67 are part of the aptamers, subject to truncated sequences as defined in the foregoing general description.
  • the column “Number” indicates the number of clones with identical aptamer sequence If several clones with identical sequence were found, the aptamer designation is marked in bold (see, for example, PA # 2/8).
  • Some aptamers can be grouped into groups based on their sequences. Different nucleotides within a group compared to the representative of a group are underlined. The sequences combined in a group are identical except for point mutations and deletions or derive from the substitute. The aptamer number of the proxy of a group is underlined (see, e.g., Aptamer No. PA # 2/8 for Group 1).
  • the aptamers can be divided into groups based on their sequences. Within a group deviating nucleotides are marked with underlining.
  • the sequence of SEQ ID NO: 62 summarizes the Group 1 sequences and shows variable nucleotides underlined.
  • SEQ ID NO: 63 summarizes the Group 2 sequences and shows variable nucleotides underlined.
  • SEQ ID NO: 64 summarizes the Group 3 sequences and shows variable nucleotides underlined.
  • SEQ ID NO: 65 summarizes the group 4 sequences and shows variable nucleotides underlined.
  • Xi is either A or L, where L is not a nucleotide (deletion).
  • Table 2 shows an overview of the nucleotide symbols which represent one or more of the nucleotides A, G, C or T.
  • PA # 2/8 ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG 1 4
  • PA # 2 /16 ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCGTTCGTTCTCGTGGCTACAATCGTAATCAGTTAG 3 1
  • PA # 4/34 ATACCAGCTTATTCAATTCCCCAACGAGTCGATATGTAGCCCACACTCTGATTCGTCCACAATCGTAATCAGTTAG 5 3
  • ATACCAGCTTATTCAATTVCMC AAC GAGT C GAT AT GT AGC C C AC AYT CTGATTCGTC CACAATCGTAATCAGTTAG 63
  • PA # 6/54 ATACCAGCTTATTCAATTACC GATCACTAGCCGACTAATTGGT TT CCGATCGCAGTT CACAATCGTAATCAGTTAG 10 1
  • PA # 14/82 ATACCAGCTTATTCAATTC C AC AAC C GAACT CGTAAGAC GTATGTAGCCGC C AAC T GTACAATCGTAATCAGTTAG 1 1 2
  • PA # 2/3 ATACCAGCTTATTCAATTC GACAAGTGGGCATTAC GATT CT AGCC CT GATT AT GTTCCACAATCGTAATCAGTTAG 1 5 3
  • PA # 2/14 ATACCAGCTTATTCAATTAC GAC C GT AGAC G AC T AC AC GAT GTTGCGCATTTC T GTACAATCGTAATCAGTTAG 1 7 2
  • PA # 4/31 ATACCAGCTTATTCAATTC GATGACGACTGT AGCC GCAATACGCCCCTGTTACGTTGTACAATCGTAATCAGTTAG 1 8 2
  • PA # 2/4 ATACCAGCTTATTCAATTGGAGTCCGACTAAATGATCTTTGAGAGTGTCTCACAGTCCACAATCGTAATCAGTTAG 21
  • PA # 2 ATACCAGCTTATTCAATTGCAATGGACCCCAAAGTTGGATTGTAGCCGCTGCTGTTCGACAATCGTAATCAGTTAG 25
  • PA # 4/29 ATACCAGCTTATTCAATTGGAGCCGCAAATATCGTGATGAATGTGTGAGCCGATCTACACAATCGTAATCAGTTAG 29
  • PA # 4/30 ATACCAGCTTATTCAATTACCCCGATGTAGCCGACGTGCACTTGTTATGATTAGGACCACAATCGTAATCAGTTAG 30
  • PA # 4/39 ATACCAGCTTATTCAATTGCAGCCGACTAACCTGATGAGTGTGGTCAGTTTACGCTTGACAATCGTAATCAGTTAG 32
  • PA # 4 ATACCAGCTTATTCAATTGGAGACGACGCGGCTGATTATGTTAGTCTGTAACGCCACCACAATCGTAATCAGTTAG 33
  • PA # 6/46 ATACCAGCTTATTCAATTACGAACATGGAGCCGCACTGATTACTGGTCCACCGCGTACACAATCGTAATCAGTTAG 34
  • PA # 10/68 ATACCAGCTTATTCAATTACGATGTAGCCGTTCCCTTTACGATGTGCACCGACTAACCACAATCGTAATCAGTTAG 43
  • PA # 1 0/80 ATACCAGCTTATTCAATTGTAGACGACGAACTGTTATGACATTTTTTCTTGTCCTCACACAATCGTAATCAGTTAG 50
  • PA # 1 4/84 ATACCAGCTTATTCAATTCCAATGATCGATTGTTGCCCTGATTGATGGTTGTTGTCGTACAATCGTAATCAGTTAG 51
  • PA # 1 4/85 ATACCAGCTTATTCAATTGGACGCCGACTAACTTAAGCGATTTGGCCCACTCATCTCGACAATCGTAATCAGTTAG 52
  • PA # 1 4/86 ATACCAGCTTATTCAATTGGAGACGCTAACATGATGCTACGAAGGTGTGAATCGGTGCACAATCGTAATCAGTTAG 53
  • PA # 1 4/89 ATACCAGCTTATTCAATTGGGCACCACGGGAGTCGGCCACATTTGGAGTTGTTTTTGCACAATCGTAATCAGTTAG 54
  • PA # 1 4/91 ATACCAGCTTATTCAATTCGAGTGTGGCCGCCAACTGAGCTTGTTAGTGTCCTCTTGTACAATCGTAATCAGTTAG 55
  • PA # 1 4/93 ATACCAGCTTATTCAATTGTAGACGACGACTGTACGTTGACCTGCTAACCACTTCTGGACAATCGTAATCAGTT 56
  • PA # 1 4/94 ATACCAGCTTATTCAATTGCACCAGTGGAAAGATTGTAGCCGTTCCTCCTGATTATGCACAATCGTAATCAGTTAG 57
  • PA # 1 4/95 ATACCAGCTTATTCAATTGCACGGTGGGAGATTGTAGCCCCTCTTTTTTTTTTTTGCCTGTACAATCGTAATCAGTTAG 58
  • PA # 1 4/97 ATACCAGCTTATTCAATTGTAGACGACCACCTGATTAACTTTGGCCGGGCCCTTTTGTACAATCGTAATCAGTTAG 59
  • PA # 1 4/99 ATACCAGCTTATTCAATTACGATCCTTGTAGCCCAGCGCACTGATCACGCTTGTGACCACAATCGTAATCAGTTAG 60
  • PA # 1 4/100 ATACCAGCTTATTCAATTGTAGACGACGCAATATAATGATTAGTTGGCACGACCCTGCACAATCGTAATCAGTTAG 61
  • Comparative sequence analyzes were performed using ClustalW2, a Multiple Sequence Alignment Tool (http://www.ebi.ac.uk/Tools/msa/clustalw2/).
  • FIG. 1 A possible secondary structure of aptamer PA # 2/8 (SEQ ID NO: 1) is shown in FIG.
  • Aptamer clones with different sequence are examined for their individual binding ability to the selection target (biotinylated protein A immobilized on streptavidin-functionalized magnetic beads).
  • the binding attempts are carried out according to the SELEX conditions. For each experiment come 2,5- ⁇ 3 10 7 Target-modified magnetic beads and ⁇ 55pmol fluorescein-labeled aptamer ssDNA in binding buffer (1 00mm NaCl, 20 mM Tris-HCl, pH 7.6, 1 0mm MgCl 2, 5 mM KCl, 1 mM CaCl 2 ) and in a binding volume of 250 ⁇ used.
  • the target-modified magnetic beads are washed several times in binding buffer prior to use and the aptamer ssDNA is thermally equilibrated by incubation at 90 ° C for 8 min, on ice for 10 min and at RT for ⁇ 5 min. Subsequently, the prepared aptamer ssDNA and the washed target-modified magnetic beads are combined for binding for 30 min at 21 ° C with shaking. The unbound ssDNA is removed and the binding complexes are washed several times in binding buffer. Thereafter, the elution of the target-bound ssDNA is carried out by heat by incubation of the binding complexes in binding buffer at 95 ° C for 10 min with shaking. This elution procedure is performed twice in total. Due to the fluorescein labeling of the aptamer ssDNA and a calibration curve, the amount of eluted ssDNA can be quantified. This corresponds to the amount of target-bound aptamer in the binding experiment.
  • EXAMPLE 5 Construction of a biosensor and detection of protein A
  • the Biacore® system is a commercially available biosensor system that provides label-free detection of biomolecular interactions in real time and utilizes the physical principle of surface plasmon resonance (SPR) spectroscopy, as shown in FIG.
  • the biosensor chip of the Biacore system consists of a glass chip 1, which is coated with a thin gold film 2 and represents the sensor surface. A special functionalization of this sensor surface, for example with carboxymethyldextran (CM), allows the covalent immobilization of the biological receptor molecules.
  • CM carboxymethyldextran
  • the biotin-streptavidin coupling system is preferably used to immobilize the biotinylated aptamers on the streptavidin-coated sensor surface of the biosensor chip.
  • the subsequent interaction between target and aptamer takes place in a flow cell 3, wherein the sample solution 4 with target 5 is passed over the sensor surface by means of an integrated, continuous flow system.
  • the optical detection unit of the Biacore system consists of a light source 6 (light emitting diodes), a prism 7 and a detector 8 (diode array detector).
  • Monochromatic polarized light L is irradiated under the conditions of total reflection from a high refractive index medium (sensor chip with gold film) into a low refractive index medium (sensor layer, buffer solution). At a certain angle of incidence, a weakening of the reflected light R occurs. This angle, the resonance angle, reacts very sensitively to changes in the refractive index of the sensor layer.
  • the binding of the target 5 to the immobilized aptamer 9 on the sensor surface results in a mass increase in the sensor layer, which leads to a change in the refractive index of this layer and thus to a shift of the resonance angle.
  • These changes are output as a measurable signal, expressed in units of resonance (RU), and are proportional to the amount of bound target 5 on the sensor surface.
  • RU units of resonance
  • the changes in resonance angle are recorded continuously and plotted against time as a sensorgram, which is shown schematically in FIG. In section II of the signal curve, a shift of the resonance angle is recognizable by the binding of target to the immobilized aptamer.
  • the displacement of the resonance angle is also shown in FIG. 3, by means of a reflected light beam denoted by "I" and by "II".
  • the aptamer-target complex can be redissolved under suitable buffer conditions so that the sensor surface is regenerated and available for re-binding with target molecules.
  • An aptamer according to the invention is immobilized on the surface of the biosensor described above.
  • a solution of protein A is passed over the sensor surface, with protein A binding to the aptamer.
  • the attachment of protein A is called
  • the truncated variants of the aptamer PA # 2/8 shown in Table 3 were prepared.
  • the aptamer PA # 2/8 [S19-76] (SEQ ID NO: 69) lacks the 5 'primer region and PA # 2/8 [S1 -58] (SEQ ID NO: 70) lacks the 3' primer region ,
  • the PA # 2 / 8KR40 (SEQ ID NO: 71) is the core region, without the 5 'primer region and without the 3' primer region.
  • the binding experiments were carried out according to the SELEX conditions.
  • target-modified magnetic beads 2.5-3 ⁇ 1 0 7 target-modified magnetic beads and ⁇ 55 pmol fluorescein-labeled aptamer ssDNA in binding buffer (100 mM NaCl, 20 mM Tris-HCl, pH 7.6, 10 mM MgCl 2 , 5 mM KCl, 1 mM CaCl 2 ) are used.
  • Target-modified magnetic beads were prepared in advance of the binding experiments using Dynabeads® M-280 streptavidin (Invitrogen, UK) to immobilize native, biotinylated protein A of Staphylococcus aureus (P21 65, Sigma-Aldrich, Germany).
  • the target-modified magnetic beads Prior to each binding reaction, the target-modified magnetic beads were washed several times in binding buffer and the aptamer ssDNA thermally equilibrated by incubation at 90 ° C for 8 min, on ice for 10 min and then transferred to RT for ⁇ 5 min.
  • the prepared aptamer ssDNA and the washed target-modified magnetic beads were then combined for binding and incubated for 30 min at 21 ° C with shaking.
  • the unbound ssDNA was removed and the binding complexes washed several times in binding buffer. Thereafter, the elution of the target-bound ssDNA was carried out by heat by incubation of the binding complexes in binding buffer at 95 ° C for 10 min with shaking.
  • FIG. 5 shows the results of the bead-based binding experiments with the aptamer PA # 2/8 and its truncated variants in comparison to the unselected SELEX library as a negative control.
  • the original aptamer PA # 2/8 has a very good binding ability to protein A-modified magnetic beads. After removal of the 3 'primer region (variant PA # 2/8 [S1 -58]) this binding ability is retained and could even be improved.
  • the Biacore X100 system is a commercially available biosensor system (GE Healthcare, Sweden) that enables label-free detection of biomolecular interactions in real-time using the physical principle of surface plasmon resonance (SPR) spectroscopy.
  • SPR surface plasmon resonance
  • the Biotin CAPture Kit with the sensor chip CAP was used, which enables the production of a streptavidin-coated sensor surface.
  • the biotin-streptavidin coupling system can be used to immobilize biotinylated aptamers on the sensor surface.
  • the target solution is passed through the sensor surface through an integrated, continuous flow system.
  • the target solution consisting of recombinant protein A (P7837, Sigma-Aldrich, Germany) or native protein A (P3838, Sigma-Aldrich, Germany) in binding buffer (100 mM NaCl, 20 mM Tris-HCl, pH 7.6, 10 mM MgCl 2 , 5 mM KCl, 1 mM CaCl 2 ) with 0.005% SP20 was passed over the prepared sensor surfaces at a flow rate of ⁇ ⁇ / min. The interaction between aptamer and target took place during a binding phase of 300s, followed by a dissociation phase of 300s. The running buffer used was binding buffer with 0.005% SP20.
  • the sensorgrams (FIGS.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Virology (AREA)
  • Food Science & Technology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un aptamère qui se fixe sur des substances contenant les protéines A, G ou L ainsi que sur des micro-organismes contenant les protéines A, G ou L, notamment sur Staphylococcus aureus, Streptococcus ou Peptostreptococcus, des procédés de détection et de concentration de substances contenant les protéines A, G ou L ou de micro-organismes contenant les protéines A, G ou L, lesquels impliquent une mise en œuvre dudit aptamère ainsi qu'un kit, un biocapteur, un dispositif de dosage à flux latéral et un appareil de mesure lesquels contiennent un tel aptamère et peuvent être mis en œuvre dans lesdits procédés.
PCT/EP2012/055655 2011-03-31 2012-03-29 Aptamères ayant une spécificité pour les protéines de la paroi cellulaire qui fixent l'immunoglobuline WO2012130951A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP12713665.3A EP2691527A1 (fr) 2011-03-31 2012-03-29 Aptamères ayant une spécificité pour les protéines de la paroi cellulaire qui fixent l'immunoglobuline
US14/009,088 US9353421B2 (en) 2011-03-31 2012-03-29 Aptamers that are specific for immunoglobulin-binding cell wall proteins

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE201110006610 DE102011006610B3 (de) 2011-03-31 2011-03-31 Aptamere, die spezifisch sind für Immunoglobulin bindende Zellwandproteine
DE102011006610.1 2011-03-31

Publications (1)

Publication Number Publication Date
WO2012130951A1 true WO2012130951A1 (fr) 2012-10-04

Family

ID=45952501

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2012/055655 WO2012130951A1 (fr) 2011-03-31 2012-03-29 Aptamères ayant une spécificité pour les protéines de la paroi cellulaire qui fixent l'immunoglobuline

Country Status (3)

Country Link
EP (1) EP2691527A1 (fr)
DE (1) DE102011006610B3 (fr)
WO (1) WO2012130951A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103048369A (zh) * 2013-01-18 2013-04-17 江南大学 一种基于还原氧化石墨烯-纳米金复合材料的金黄色葡萄球菌无标记电化学适配体传感器
WO2019215112A1 (fr) 2018-05-09 2019-11-14 Lifetaq-Analytics Gmbh Analyse cellulaire in situ dans un système de culture cellulaire
CN111004805A (zh) * 2019-12-30 2020-04-14 广西医科大学 T细胞免疫检查点pd-l1的适配体筛选、鉴定方法及抗肿瘤应用
WO2021096759A1 (fr) * 2019-11-13 2021-05-20 Crosslife Technologies Inc. Aptamères de mutéine de type gyri modifiés, et procédés associés

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5270163A (en) 1990-06-11 1993-12-14 University Research Corporation Methods for identifying nucleic acid ligands
US5567588A (en) 1990-06-11 1996-10-22 University Research Corporation Systematic evolution of ligands by exponential enrichment: Solution SELEX
WO2005013817A1 (fr) 2003-08-07 2005-02-17 Charité-Universitäts- Medezin Berlin Systeme ecg et procede de mesure a grande surface de signaux ecg
WO2005113817A2 (fr) 2004-05-03 2005-12-01 Nanosphere, Inc. Conjugues nanoparticules-aptameres, et leur procede d'utilisation pour detecter un analyte cible
KR20090032285A (ko) * 2007-09-27 2009-04-01 고려대학교 산학협력단 레티놀 결합 단백질(ｒｂｐ4)에 특이적으로 결합하는ｄｎａ 앱타머 및 그 제조방법
US20090203028A1 (en) * 2006-07-21 2009-08-13 Hitachi Chemical Research Center, Inc. Novel aptamers that bind to listeria surface proteins
KR20100060213A (ko) * 2008-11-27 2010-06-07 고려대학교 산학협력단 비스파틴에 특이적으로 결합하는 ｄｎａ 앱타머 및 그 제조방법
JP2010158238A (ja) * 2008-12-09 2010-07-22 Tokyo Univ Of Agriculture & Technology Ｃ反応性タンパク質結合性アプタマー及びその用途
KR20100083970A (ko) * 2009-01-15 2010-07-23 고려대학교 산학협력단 디클로페낙에 특이적으로 결합하는 ｄｎａ 앱타머 및 그 제조방법
KR20100130092A (ko) * 2009-06-02 2010-12-10 고려대학교 산학협력단 키랄 구조의 이부프로펜에 입체선택적으로 결합하는 ｄｎａ 앱타머 및 그 제조방법

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5270163A (en) 1990-06-11 1993-12-14 University Research Corporation Methods for identifying nucleic acid ligands
US5567588A (en) 1990-06-11 1996-10-22 University Research Corporation Systematic evolution of ligands by exponential enrichment: Solution SELEX
WO2005013817A1 (fr) 2003-08-07 2005-02-17 Charité-Universitäts- Medezin Berlin Systeme ecg et procede de mesure a grande surface de signaux ecg
WO2005113817A2 (fr) 2004-05-03 2005-12-01 Nanosphere, Inc. Conjugues nanoparticules-aptameres, et leur procede d'utilisation pour detecter un analyte cible
US20090203028A1 (en) * 2006-07-21 2009-08-13 Hitachi Chemical Research Center, Inc. Novel aptamers that bind to listeria surface proteins
KR20090032285A (ko) * 2007-09-27 2009-04-01 고려대학교 산학협력단 레티놀 결합 단백질(ｒｂｐ4)에 특이적으로 결합하는ｄｎａ 앱타머 및 그 제조방법
KR20100060213A (ko) * 2008-11-27 2010-06-07 고려대학교 산학협력단 비스파틴에 특이적으로 결합하는 ｄｎａ 앱타머 및 그 제조방법
JP2010158238A (ja) * 2008-12-09 2010-07-22 Tokyo Univ Of Agriculture & Technology Ｃ反応性タンパク質結合性アプタマー及びその用途
KR20100083970A (ko) * 2009-01-15 2010-07-23 고려대학교 산학협력단 디클로페낙에 특이적으로 결합하는 ｄｎａ 앱타머 및 그 제조방법
KR20100130092A (ko) * 2009-06-02 2010-12-10 고려대학교 산학협력단 키랄 구조의 이부프로펜에 입체선택적으로 결합하는 ｄｎａ 앱타머 및 그 제조방법

Non-Patent Citations (22)

* Cited by examiner, † Cited by third party
Title
CAMILLE L. A. HAMULA ET AL: "Selection of Aptamers against Live Bacterial Cells", ANALYTICAL CHEMISTRY, vol. 80, no. 20, 15 October 2008 (2008-10-15), pages 7812 - 7819, XP055030661, ISSN: 0003-2700, DOI: 10.1021/ac801272s *
CHAN ET AL., CLINICAL AND EXPERIMENTAL PHARMACOLOGY AND PHYSIOLOGY, vol. 33, 2006, pages 533 - 540
CHO, E. J.; LEE, J.-W.; ELLINGTON, A. D., APPLICATIONS OF APTAMERS AS SENSORS, ANNUAL REVIEW OF ANALYTICAL CHEMISTRY, vol. 2, 2009, pages 241 - 264
CIESIOLKA ET AL.: "Affinity Selection-Amplification from Randomized Ribooligonucleotide Pools", METHODS IN ENZYMOLOGY, vol. 267, 1996, pages 315 - 35
CONRAD ET AL.: "In Vitro Selection of Nucleic Acid Aptamers That Bind Proteins", METHODS IN ENZYMOLOGY, vol. 267, 1996, pages 336 - 83
ELLINGTON; SZOSTAK, NATURE, vol. 346, 1990, pages 818 - 822
FITZWATER ET AL.: "A SELEX Primer", METHODS IN ENZYMOLOGY, vol. 267, 1996, pages 275 - 301, XP002112701, DOI: doi:10.1016/S0076-6879(96)67019-0
FOWLER CASEY C ET AL: "Aptamers and Their Potential as Recognition Elements for the Detection of Bacteria", PRINCIPLES OF BACTERIAL DETECTION: BIOSENSORS, RECOGNITION RECEPTORS AND MICROSYSTEMS, SPRINGER, 1 January 2008 (2008-01-01), pages 689 - 714, XP008152999, ISBN: 978-0-387-75112-2 *
GNANAM A J ET AL: "Development of aptamers specific for potential diagnostic targets in Burkholderia pseudomallei", TRANSACTIONS OF THE ROYAL SOCIETY OF TROPICAL MEDICINE AND HYGIENE, ELSEVIER, GB, vol. 102, 1 December 2008 (2008-12-01), pages S55 - S57, XP025846792, ISSN: 0035-9203, [retrieved on 20081201], DOI: 10.1016/S0035-9203(08)70015-4 *
J. G. BRUNO ET AL: "In Vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes", FOLIA MICROBIOLOGICA, vol. 53, no. 4, 1 July 2008 (2008-07-01), pages 295 - 302, XP055030719, ISSN: 0015-5632, DOI: 10.1007/s12223-008-0046-6 *
J. P. BANNANTINE ET AL: "Development and Characterization of Monoclonal Antibodies and Aptamers against Major Antigens of Mycobacterium avium subsp. paratuberculosis", CLINICAL AND VACCINE IMMUNOLOGY, vol. 14, no. 5, 1 May 2007 (2007-05-01), pages 518 - 526, XP055030720, ISSN: 1556-6811, DOI: 10.1128/CVI.00022-07 *
JEEVALATHA VIVEKANANDA ET AL: "Anti-Francisella tularensis DNA aptamers detect tularemia antigen from different subspecies by Aptamer-Linked Immobilized Sorbent Assay", LABORATORY INVESTIGATION, vol. 86, no. 6, 1 June 2006 (2006-06-01), pages 610 - 618, XP055030675, ISSN: 0023-6837, DOI: 10.1038/labinvest.3700417 *
JOSHI R ET AL: "Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars", MOLECULAR AND CELLULAR PROBES, ACADEMIC PRESS, LONDON, GB, vol. 23, no. 1, 1 February 2009 (2009-02-01), pages 20 - 28, XP025910706, ISSN: 0890-8508, [retrieved on 20081118], DOI: 10.1016/J.MCP.2008.10.006 *
MOK, W; LI, Y.: "Recent Progress in Nucleic Acid Aptamer-Based Biosensors and Bioassays", SENSORS, vol. 8, 2008, pages 7050 - 7084
Q. PAN ET AL: "Aptamers That Preferentially Bind Type IVB Pili and Inhibit Human Monocytic-Cell Invasion by Salmonella enterica Serovar Typhi", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 49, no. 10, 1 October 2005 (2005-10-01), pages 4052 - 4060, XP055030688, ISSN: 0066-4804, DOI: 10.1128/AAC.49.10.4052-4060.2005 *
R. STOLTENBURG ET AL.: "FluMag-SELEX as an advantageous method for DNA aptamer selection", ANAL. BIOANAL. CHEM., vol. 383, 2005, pages 83 - 91, XP019327576, DOI: doi:10.1007/s00216-005-3388-9
SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
SONG, S.; WANG, L.; LI, J.; FAN, C.; ZHAO, J.: "Aptamer-based biosensors", TRAC TRENDS IN ANALYTICAL CHEMISTRY, vol. 27, 2008, pages 108 - 117, XP022520321, DOI: doi:10.1016/j.trac.2007.12.004
TUERK; GOLD, SCIENCE, vol. 249, 1990, pages 505 - 510
W. G. PURSCHKE: "A DNA Spiegelmer to staphylococcal enterotoxin B", NUCLEIC ACIDS RESEARCH, vol. 31, no. 12, 15 June 2003 (2003-06-15), pages 3027 - 3032, XP055030769, DOI: 10.1093/nar/gkg413 *
X. CAO ET AL: "Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus", NUCLEIC ACIDS RESEARCH, vol. 37, no. 14, 4 June 2009 (2009-06-04), pages 4621 - 4628, XP055030768, ISSN: 0305-1048, DOI: 10.1093/nar/gkp489 *
ZUKER M., NUCLEIC ACID RESEARCH, vol. 31, 2003, pages 3406 - 3415

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103048369A (zh) * 2013-01-18 2013-04-17 江南大学 一种基于还原氧化石墨烯-纳米金复合材料的金黄色葡萄球菌无标记电化学适配体传感器
WO2019215112A1 (fr) 2018-05-09 2019-11-14 Lifetaq-Analytics Gmbh Analyse cellulaire in situ dans un système de culture cellulaire
US11279971B2 (en) 2018-05-09 2022-03-22 Lifetaq-Analytics Gmbh In situ cell analysis in cell culture system
WO2021096759A1 (fr) * 2019-11-13 2021-05-20 Crosslife Technologies Inc. Aptamères de mutéine de type gyri modifiés, et procédés associés
CN111004805A (zh) * 2019-12-30 2020-04-14 广西医科大学 T细胞免疫检查点pd-l1的适配体筛选、鉴定方法及抗肿瘤应用

Also Published As

Publication number Publication date
DE102011006610B3 (de) 2012-06-21
EP2691527A1 (fr) 2014-02-05

Similar Documents

Publication Publication Date Title
Yoo et al. Detection and beyond: Challenges and advances in aptamer-based biosensors
Li et al. Nucleic acid tests for clinical translation
Mok et al. Recent progress in nucleic acid aptamer-based biosensors and bioassays
Musumeci et al. Fluorescence sensing using DNA aptamers in cancer research and clinical diagnostics
Strehlitz et al. Aptamers for pharmaceuticals and their application in environmental analytics
Ramezani et al. A selective and sensitive fluorescent aptasensor for detection of kanamycin based on catalytic recycling activity of exonuclease III and gold nanoparticles
Song et al. Aptamer-based biosensors
Tang et al. Colorimetric and ultrasensitive bioassay based on a dual-amplification system using aptamer and DNAzyme
Wang et al. Recent advances in fluorescent nucleic acid probes for living cell studies
US10975370B2 (en) Methods for screening nucleic acid aptamers
Hanif et al. Aptamer based nanobiosensors: Promising healthcare devices
Suo et al. A versatile turn-on fluorometric biosensing profile based on split aptamers-involved assembly of nanocluster beacon sandwich
Bognár et al. Aptamers against immunoglobulins: Design, selection and bioanalytical applications
DE102011006610B3 (de) Aptamere, die spezifisch sind für Immunoglobulin bindende Zellwandproteine
KR20150139582A (ko) 나노파티클-지원 신호 증폭을 이용한 rna 마이크로칩 검출
Wu et al. Low-noise solid-state nanopore enhancing direct label-free analysis for small dimensional assemblies induced by specific molecular binding
JP2021535409A (ja) 核酸に基づく検出方法
Liao et al. Aptamer-based sensitive detection of target molecules via RT-PCR signal amplification
EP3676615A1 (fr) Dosage à écoulement latéral pour détecter la présence d'une cellule de mammifère ou d'une bactérie spécifique dans un échantillon biologique
EP2691523B1 (fr) Aptamères spécifiques d'aminoglycosides
Pereira et al. Enlarging the toolbox against antimicrobial resistance: aptamers and CRISPR-Cas
EP2774988B1 (fr) Aptamères spécifiques au fluorchinolone
Du et al. Fluorescent platforms for RNA chemical biology research
Dai et al. Dynamic control of peptide strand displacement reaction using functional biomolecular domain for biosensing
DE102010038842A1 (de) Tau-Protein spezifische Aptamere, deren Verwendung sowie Kit umfassend solche Aptamere

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12713665

Country of ref document: EP

Kind code of ref document: A1

REEP Request for entry into the european phase

Ref document number: 2012713665

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14009088

Country of ref document: US