WO2012090223A1 - Dendrimères poly(étherimine) et leurs utilisations - Google Patents

Dendrimères poly(étherimine) et leurs utilisations Download PDF

Info

Publication number
WO2012090223A1
WO2012090223A1 PCT/IN2011/000898 IN2011000898W WO2012090223A1 WO 2012090223 A1 WO2012090223 A1 WO 2012090223A1 IN 2011000898 W IN2011000898 W IN 2011000898W WO 2012090223 A1 WO2012090223 A1 WO 2012090223A1
Authority
WO
WIPO (PCT)
Prior art keywords
petim
composition
poly
dendrimers
gene
Prior art date
Application number
PCT/IN2011/000898
Other languages
English (en)
Inventor
Narayanaswamy Jayaraman
Padinjaremattathil Ullas THANKAPPAN
Narayan Shampur MADHUSUDANA
Anita DESAI
Govindasamy Jayamurugan
Rajesh YAMAJALA BHASKARA RAMA DURGA
Original Assignee
Indian Institute Of Science
National Institute Of Mental Health & Neurosciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Indian Institute Of Science, National Institute Of Mental Health & Neurosciences filed Critical Indian Institute Of Science
Publication of WO2012090223A1 publication Critical patent/WO2012090223A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08G—MACROMOLECULAR COMPOUNDS OBTAINED OTHERWISE THAN BY REACTIONS ONLY INVOLVING UNSATURATED CARBON-TO-CARBON BONDS
    • C08G73/00—Macromolecular compounds obtained by reactions forming a linkage containing nitrogen with or without oxygen or carbon in the main chain of the macromolecule, not provided for in groups C08G12/00 - C08G71/00
    • C08G73/02—Polyamines
    • C08G73/024—Polyamines containing oxygen in the form of ether bonds in the main chain
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08G—MACROMOLECULAR COMPOUNDS OBTAINED OTHERWISE THAN BY REACTIONS ONLY INVOLVING UNSATURATED CARBON-TO-CARBON BONDS
    • C08G83/00—Macromolecular compounds not provided for in groups C08G2/00 - C08G81/00
    • C08G83/002—Dendritic macromolecules
    • C08G83/003—Dendrimers

Definitions

  • the present invention relates to the field of poly(ether imine) (PETIM) dendrimers, methods of producing the dendrimers and their use as transfecting agents for therapeutic agent delivery in particular, for nucleic acid delivery.
  • PETIM poly(ether imine)
  • the process of gene therapy aims at generation of an optimal therapeutic outcome, either by production or inhibition of specific intracellular proteins, mediated by exogenously delivered DNA (Anderson, W. F. (1998) Human gene therapy. Nature 392, 25-30).
  • Critical to the success of gene therapy is the requirement of a safe and efficient gene delivery system (Verma, I. M., and Somia, M. (1997) Gene therapy- promises, problems and prospects. Nature 389, 239-242).
  • Viral and non-viral vectors are the general approaches to address gene delivery requirements. Whereas viral vectors are prominent, including in clinical gene therapies (Thomas, C. E., Ehrhardt, A., and Kay, M. A. (2003) Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet.
  • Non-viral vectors are considered attractive due to advantages associated with molecular level modifications suitable to optimize vector properties (Mintzer, A. M., and Simanek, E. E. (2009) Nonviral vectors for gene delivery. Chem. Rev. 109, 259-302; Fernandez, C. A., and Rice, K. G. (2009) Engineered nanoscaled polyplex gene delivery systems. Mol. Pharm. 6, 1277-1289; Bhattacharya, S., and Bajaj, A. (2009) Advances in gene delivery through molecular design of cationic lipids. Chem. Commun.
  • Non-viral vectors based on cationic lipids, chitosan, poly-lactide-co-glycolide, gelatin, polyethylene imine and polymethyl methacrylate were studied extensively (Remy, J. S., Abdallah, B., Zanta, M. A., Boussif, O., Behr, J.-P., and Demeneix, B. (1998) Gene transfer with lipospermines and polyethylenimines. Adv. Drug Deliv. Rev.
  • PRR pattern recognition receptors
  • TLR toll-like receptors
  • NOD-like receptors NOD-like receptors
  • RIG-like receptors recognize pathogenic agents or their ligands, and activate intracellular signaling events, resulting in initiation of adaptive immune responses.
  • the intermediary molecules involved in PRR-mediated signaling is a safer strategy than using TLR ligands which may evoke adverse effects following systemic administration (Wales, J., Andreakos, E., Feldmann, M., Foxwell, B. (2007) Targeting intracellular mediators of pattern-recognition receptor signaling to adjuvant vaccination. Biochem, Soc. Trans. 35, 1501-3).
  • Nanoparticulate formulations for gene delivery offer the advantages of specific cellular or subcellular targeting, improved bioavailability and facile synthesis (Bharali, D. J., Pradhan, V., Elkin, G., Qi, W., Hutson, A., Mousa, S. A. et al. (2008) Novel nanoparticles for the delivery of recombinant hepatitis B vaccine. Nanomedicine 4, 31 1- 7).
  • nanoparticulate formulations can increase the expression of co- stimulatory molecules (including CD40, CD80 and CD86 on dendritic cells), and soluble factors (TNF-a, IL-6, RANTES, MIP-la and IL-2) and MHC I, II and Toll-Like Receptors (Klippstein, R., Pozo, D. Nanotechnology-based manipulation of dendritic cells for enhanced immunotherapy strategies (2010) Nanomedicine: Nanotechnology, Biology and Medicine 6, 523-9).
  • co- stimulatory molecules including CD40, CD80 and CD86 on dendritic cells
  • soluble factors including CD40, CD80 and CD86 on dendritic cells
  • MHC I, II and Toll-Like Receptors Klippstein, R., Pozo, D. Nanotechnology-based manipulation of dendritic cells for enhanced immunotherapy strategies (2010) Nanomedicine: Nanotechnology, Biology and Medicine 6, 523-9).
  • Figure 1 shows (a) structure of fourth generation PETIM dendrimer, as an example of generic PETIM dendrimer series; (b) preparation of fourth generation PETIM dendrimer from a third generation PETIM dendrimer; (c) a cartoon representation of the electrostatic interaction of cationic PETIM dendrimer with anionic nucleotide
  • Figure 2 shows
  • Lane 1 pEGFP-Cl(5 ⁇ g); lane 2: pEGFP-Cl complexed with PETIM at the end of 30 min.; lane 3: pEGFP-Cl treated with DNase I (1U) for 30 min.; lanes 4 to 6: intact DNA released from the complexes by SDS disruption, after treatment with DNase I for 30, 60, and 120 min., respectively.
  • Figure 3 shows electron micrographs of:
  • PETIM-pEGFP-Cl complexes localized near the outer nuclear membrane and also within the nucleus (8 h post-transfection).
  • Figure 4 shows quantitative analysis of transfection efficiency of Turbofect (TF), a cationic lipid and PETIM-based transfection of pEGFP plasmid in BHK-21 cells. Mock represents un-transfected cells. Numerical ratios indicate the charge ratios of PETIM- pEGFPCl dendriplexes studied. Experiments were performed in 24 well-plates, in triplicate and data presented with standard error of mean ( ⁇ S.E.M.).
  • Figure 5 shows transmission electron micrographs of dendriplex distribution within C2C12 cell (A & B) and P388D1 cells (C and D). Images showing (A, C) Mock- transfected (control) cells. (B,D) Cells Transfected with PETIM-pEGFP-C 1 complex (10:1 w/w ratio), 4 hours post-transfection. Arrows indicate dendriplexes seen within endosomes.
  • Table 1 provides list of primers used in this application.
  • Table 2 provides Fold changes in mRNA levels (calculated as 2 "AACt ) of TLR7 and associated genes induced by PETIM dendrimer, pEGFP-Cl and PETIM-pEGFP-Cl dendriplex.
  • the subject matter of the present invention primarily concerns composition and methods of delivering foreign genetic material into cells. It is particularly useful for enhancement of the efficiency of genetic material with reduced toxicities.
  • the object of the present invention is to deliver genetic material into cells, the inventors contemplate that any molecule of suitable size and configuration can be delivered into cells using the present invention.
  • other material for example protein and/or drugs can be delivered to targeted cells using the delivery system, techniques, and the composition disclosed in the present invention.
  • the gene delivery system or nucleic acid delivery system disclosed in the present invention can be used to deliver genes in-vitro or in-vivo to cells.
  • the gene or nucleic acid delivery complex of the present invention comprises two parts, the genetic material; and a delivery vehicle/sy stem/vector.
  • the genetic material or the nucleic acid either DNA or RNA is carried by the delivery complex.
  • One or more genes can be encoded on a strand of plasmid DNA, on double stranded DNA or RNA.
  • the genetic material must express on or more immunogenic protein such as different viral antigens and/or VLPs. Transduced cells will subsequently express enough of the immunogenic protein.
  • the present invention provides an entirely new class of dendrimer delivery systems.
  • the present invention provides poly(ether imine) (PETIM) dendrimer delivery system having the structure as set forth in Formula I.
  • the dendrimer delivery system as disclosed in the present invention is capable of delivering negatively charged molecule such as nucleic acid molecule.
  • the invention further provides a process of preparation of the dendrimer and process of delivering a nucleic acid molecule with poly(ether imine) (PETIM) dendrimer delivery system.
  • the PETIM dendrimers of the present invention are able to condense the DNA effectively, protect it from endosomal damage, and deliver to cell nucleus for effective gene expression.
  • the Dendrimers as disclosed in the present invention are suitable agents for gene delivery roles.
  • PETIM dendrimers Poly(ether imine) (PETIM) dendrimers, with primary amine peripheral groups, exhibit significantly reduced toxicities over a broad concentration range.
  • PETIM dendrimers are hither-to un-known novel gene delivery vectors, combining structural features of poly(ethylene imine) polymers and dendrimers, yet relatively non-toxic and structurally precise.
  • Non-viral vector based gene delivery approach is attractive due to advantages associated with molecular level modifications suitable to optimize vector properties.
  • PETIM poly(ether imine)
  • PETIM dendrimer constituted with tertiary amine branch points, ⁇ -propyl ether linkers and primary amines at their peripheries, exhibits significantly reduced toxicities, over a broad concentration range.
  • the dendrimer complexes pDNA effectively, protects DNA from endosomal damages and delivers to cell nucleus.
  • a oly (ether imine) (PETIM) dendrimers having the structure as set forth in Formula I.
  • Xi, X 2 H, branched alkyl, aryl synthetic polymer, peptide, sugar, poly(ethylene glycol), poly(ethylene imine), protein, polysaccharide and combinations thereof with linkage amine, imine, amide, imide, ester, urethane, urea, azide, or hydrazo
  • a polymer system to deliver at least one negatively charged target molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and at least one negatively charged molecule.
  • PETIM poly(ether imine)
  • Another embodiment of the present invention provides a polymer system deliver at least one negatively charged target molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and at least one negatively charged molecule, wherein structure of the (PETIM) dendrimers is as set forth in Formula I.
  • PETIM poly(ether imine)
  • Xi, X 2 H, branched alkyl, aryl synthetic polymer, peptide, sugar, poly(ethylene glycol), poly(ethylene imine), protein, polysaccharide and combinations thereof with linkage amine, imine, amide, imide, ester, urethane, urea, azide, or hydrazo
  • Another embodiment of the present invention provides a polymer system deliver at least one negatively charged target molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and at lest one negatively charged molecule, wherein the negatively charged molecule is selected from a group consisting of nucleic acid, oligomers of DNA and RNA, polynucleotides, DNAzymes, single and double stranded DNA, single and double stranded RNA, antisense RNA and DNA, hammerhead RNA, short interfering RNA, micro RNA, ribozymes, pharmaceutically active compound, a peptide, protein, a therapeutic molecule or combinations thereof.
  • PETIM poly(ether imine)
  • Another embodiment of the present invention provides a deliver at least one negatively charged target molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and at lest one negatively charged molecule, wherein molecular weight of the PETIM is in the range of about 500 to 75,000 Dalton.
  • PETIM poly(ether imine)
  • nucleic acid sequence or polynucleotide is selected from a group consisting of green fluorescent protein gene, GUS-gene, luciferase gene, ⁇ -galactosidase gene, hygromycin resistance gene, neomycin resistance gene, and chloramphenicol acetyl transferase gene, genes encoding low density lipoprotein receptors and coagulation factors, gene suppressers of tumors, genes encoding major histocompatibility proteins, antioncogenes, pi 6, p53, genes encoding thymidine kinase, genes encoding IL2, genes encoding IL 4, genes encoding TNF, genes encoding an viral antigen, genes encoding lectin, genes encoding a mannose receptor, genes encoding asialoadhesin, and a genes encoding a retroviral transactiviating factor (TA)
  • GUS-gene luciferase gene
  • Yet another embodiment of the present invention provides the polymer system for nucleic acid delivery as disclosed in the present invention, wherein said nucleic acid or polynucleotide is operatively linked to a promoter.
  • the polymer system for DNA delivery as disclosed in the present invention wherein the DNA is plasmid DNA.
  • compositions for delivering a therapeutic molecule into cells comprising a polymer system to deliver at least one negatively charged target molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and at lest one negatively charged molecule.
  • PETIM poly(ether imine)
  • compositions for delivering a therapeutic molecule into cells comprising a polymer system to deliver at least one negatively charged target molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further iunctionalizations, and at least one negatively charged molecule, wherein the composition further comprises a targeting moiety which is recognizable by a cell membrane receptor.
  • PETIM poly(ether imine)
  • compositions comprising the polymer system for nucleic acid delivery as disclosed in the present invention, wherein the composition upon administration initiates transcriptional activation of Toll- Like Receptor 7, proinflammatory and type I interferon genes in C2C12 (murine myoblast) and P388D1 (murine macrophage) cell lines.
  • Still another embodiment of the present invention provides a composition comprising the polymer system for Plasmid DNA such as, pEGFP-Cl delivery as disclosed in the present invention produce significant increases in the mRNA levels of genes, such as, TLR7 gene, proinflammatory genes NF- ⁇ and TNFa and type I interferon genes (IFNa and IFNp).
  • Plasmid DNA such as, pEGFP-Cl delivery as disclosed in the present invention produce significant increases in the mRNA levels of genes, such as, TLR7 gene, proinflammatory genes NF- ⁇ and TNFa and type I interferon genes (IFNa and IFNp).
  • composition comprising the polymer system for nucleic acid delivery as disclosed in the present invention can be used as potential vaccine adjuvants against, for example, HIV, Neisseria meningitidis group B etc infectious diseases.
  • composition comprising the polymer system for nucleic acid delivery as disclosed in the present invention, wherein the nucleic acid is HIV, or Neisseria meningitidis group B.
  • composition as disclosed in the present invention wherein the targeting moiety is selected from a group consisting of carbohydrates, peptides, chemotactic factors, hormones, natural metabolites, biotin, tetrahydrofolate, folic acid, lactobionic acid, , phosphorylated and sulfated oligosaccharides, transferrin and asialoglycoprotein.
  • composition as disclosed in the present invention is a pharmaceutical composition, a gene therapy composition, or a vaccine.
  • composition as disclosed in the present invention is in the form of nanoparticle or a microsphere.
  • Another embodiment of the present invention provides use of the polymer system as of present invnetion for the preparation of composition useful for gene therapy.
  • Another embodiment of the present invention provides a method of delivering a nucleic acid sequence of interest into a selected cell, wherein the method comprising mixing an effective amount of a polynucleotide comprising the nucleic acid sequence of interest operatively linked to a promoter with an effective amount of poly(ether imine) (PETIM) dendrimers of present invention to result in a complex; and contacting the cell with the complex under conditions suitable to deliver the complex and maintain the viability of the cell.
  • PETIM poly(ether imine)
  • Further embodiment of the present invention provides a method of transfecting cells, wherein the method comprising contacting said cells with the composition as disclosed in the present invention under conditions wherein said composition enters said cells, and the nucleic acid of said composition is released.
  • Still another embodiment of the present invention provides a poly (ether imine) (PETIM) dendrimers with primary amine peripheral groups having the structure as set forth in Formula I
  • a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter.
  • PETIM poly(ether imine)
  • nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein molecular weight of the PETIM is in the range of about 500 to 75,000 Dalton.
  • PETIM poly(ether imine)
  • nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein structure of the (PETIM) dendrimers is as set forth in Formula I.
  • PETIM poly(ether imine)
  • ⁇ , X 2 H, branched alkyl, aryl synthetic polymer, peptide, sugar, poly(ethylene glycol), poly(ethylene imine), protein, polysaccharide and combinations thereof with linkage amine, imine, amide, imide, ester, urethane, urea, azide, or hydrazo
  • Still further embodiment of the present invention provides a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the nucleic acid sequence of interest is DNA or RNA sequence.
  • PETIM poly(ether imine)
  • Still further embodiment of the present invention provides a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the nucleic acid sequence of interest is DNA or RNA sequence, wherein the RNA sequence is selected from the group consisting of an antisense RNA, miRNA, siRNA and a ribozyme.
  • PETIM poly(ether imine)
  • a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the nucleic acid sequence of interest is selected from a group consisting of green fluorescent protein gene, GUS-gene, luciferase gene, ⁇ - galactosidase gene, hygromycin resistance gene, neomycin resistance gene, and chloramphenicol acetyl transferase gene, genes encoding low density lipoprotein receptors and coagulation factors, gene suppressers of tumors, genes encoding major histocompatibility proteins, antioncogenes, pi 6, p53, genes encoding thymidine kinase, genes encoding IL2, genes encoding IL
  • a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the polynucleotide is a plasmid.
  • PETIM poly(ether imine)
  • compositions for delivering nucleic acid into cells comprising a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter.
  • PETIM poly(ether imine)
  • compositions for delivering nucleic acid into cells comprising a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the composition further comprises a targeting moiety which is recognizable by a cell membrane receptor.
  • PETIM poly(ether imine)
  • compositions for delivering nucleic acid into cells comprising a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the composition further comprises a targeting moiety which is recognizable by a cell membrane receptor, wherein the targeting moiety is selected from a group consisting of lactose, galactose, mannose, fructose, glucose, ribose, arabinose, xylose, rhamnose, peptides, chemotactic factors, hormones, natural metabolites, biotin, tetrahydrofolate, folic acid, lactobionic acid, asialo-oligosides, oligomannosides, phosphorylated
  • PETIM Poly(ether imine) dendrimers comprising primary amine peripheral groups, wherein the formula of said dendrimer is as set forth in Formula I,
  • PETIM Poly(ether imine) dendrimers having the formula as set of Formula I or having the structure as set forth in Structure I as disclosed in the present invnetion, wherein molecular weight of said poly(ether imine) (PETIM) dendrimers is in the range of about 500 to 75,000 Dalton.
  • Yet another preferred embodiment of the present invention provides a polymer system to deliver at least one negatively charged molecule into cells, wherein the system comprising a poly(ether imine) (PETIM) dendrimers having the formula as set forth in Formula I as disclosed in the present invention, and at least one negatively charged molecule with, wherein said primary amine peripheral groups are with or without further functionalizations.
  • PETIM poly(ether imine)
  • Still another embodiment of the present invention provides a polymer system comprising a poly(ether imine) (PETIM) dendrimers having the formula as set forth in Formula I as disclosed in the present invention, wherein said negatively charged molecule is selected from a group consisting of nucleic acid, oligomers of DNA and PvNA, DNA, polynucleotides, DNAzymes, single and double stranded DNA, single and double stranded RNA, antisense PvNA and DNA, hammerhead RNA, short interfering RNA, micro RNA, ribozymes and combinations thereof.
  • compositions for delivering a negatively charged therapeutic molecule into cells comprising comprising a poly(ether imine) (PETIM) dendrimers having the formula as set forth in Formula I as disclosed in the present invention.
  • PETIM poly(ether imine)
  • compositions for delivering a negatively charged therapeutic molecule into cells comprising comprising a poly(ether imine) (PETIM) dendrimers having the formula as set forth in Formula I as disclosed in the present invention, wherein said negatively charged molecule is selected from a group consisting of nucleic acid, oligomers of DNA and RNA, DNA, polynucleotides, DNAzymes, single and double stranded DNA, single and double stranded RNA, antisense RNA and DNA, hammerhead RNA, short interfering RNA, micro RNA, ribozymes and combinations thereof.
  • PETIM poly(ether imine)
  • the present invention further provides a drug delivery composition comprising an effective amount of poly (ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and an effective amount of a negatively charged molecule.
  • a drug delivery composition comprising an effective amount of poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and an effective amount of a negatively charged molecule, wherein structure of the (PETIM) dendrimers is as set forth in Formula I.
  • Xi, X 2 H, branched alkyl, aryl synthetic polymer, peptide, sugar, poly(ethylene glycol), poly(ethylene imine), protein, polysaccharide and combinations thereof with linkage amine, imine, amide, imide, ester, urethane, urea, azide, or hydrazo
  • the present invention further provides a delivery composition comprising an effective amount of poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and an effective amount of a negatively charged molecule, wherein the negatively charged molecule is a peptide, protein, or a therapeutic molecule.
  • PETIM poly(ether imine)
  • Another embodiment of the present invention provides a delivery composition comprising an effective amount of poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and an effective amount of a negatively charged molecule, wherein the negatively charged molecule is a therapeutic molecule selected from a group consisting of nucleic acid, oligomers of DNA and RNA, polynucleotides, DNAzymes, single and double stranded DNA, single and double stranded RNA, antisense RNA and DNA, hammerhead RNA, short interfering RNA, micro RNA, ribozymes, pharmaceutically active compound, or combinations thereof.
  • PETIM poly(ether imine)
  • the present invention further provides a drug delivery composition
  • a drug delivery composition comprising an effective amount of poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further iunctionalizations, and an effective amount of a negatively charged molecule, wherein the negatively charged molecule is a peptide, protein, or a therapeutic molecule, wherein the composition is in the form of nanoparticle or a microsphere.
  • PETIM poly(ether imine)
  • a pharmaceutical composition comprising the a delivery composition comprising an effective amount of poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further iunctionalizations, and an effective amount of a negatively charged molecule, wherein the negatively charged molecule is a peptide, protein, or a therapeutic molecule.
  • PETIM poly(ether imine)
  • Another embodiment of the present invention provides use of a nucleic acid delivery system for preparation of a composition useful for gene therapy, wherein the composition comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter.
  • PETIM poly(ether imine)
  • Another embodiment of the present invention provides a method of delivering a nucleic acid sequence of interest into a selected cell, wherein the method comprising mixing an effective amount of a polynucleotide comprising the nucleic acid sequence of interest operatively linked to a promoter with an effective amount of poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, having structure as set forth in Formula I to result in a complex; and contacting the selected cell with the complex under conditions suitable to deliver the complex and maintain the viability of the cell.
  • PETIM poly(ether imine)
  • Xi, ⁇ H branched alkyl, aryl synthetic polymer, peptide, sugar, poly(ethylene glycol), poly(ethylene imine), protein, polysaccharide and combinations thereof with linkage amine, imine, amide, imide, ester, urethane, urea, azide, or hydrazo
  • a method of transfecting cells comprising contacting said cells with a composition comprising a nucleic acid delivery system comprising the poly(ether imine) (PETIM) dendrimers with primary amine peripheral groups, with and without further functionalizations, and ii) a polynucleotide, wherein said polynucleotide comprises a nucleic acid sequence of interest operatively linked to a promoter, wherein the composition further comprises a targeting moiety which is recognizable by a cell membrane receptor under conditions, wherein said composition enters said cells, and the nucleic acid of said composition is released.
  • PETIM poly(ether imine)
  • compositions comprising the polymer system comprising the poly(ether imine) (PETIM) dendrimers having formula as set for the in Formula I and the siRNA or miRNA molecule to suppress or minimize the expression of a target gene, wherein the composition upon administration substantially reduces expression of the said gene.
  • PETIM poly(ether imine)
  • PETIM dendrimer generation four presenting 32 amine peripheral functionalities ( Figure 1) was chosen.
  • Synthesis of the dendrimer involved two alternate Michael addition reactions and two alternate functional group reductions, performed by a divergent growth methodology and amine functionalities were obtained upon reduction of nitrile groups present at the peripheries of dendrimer (Krishna, T. R., and Jayaraman, N. (2003) Synthesis of poly(propyl ether imine) dendrimers and evolution of their cytotoxic properties. J. Org. Chem. 68, 9694-9704; Jayamurugan, G., and Jayaraman, N. (2006) Synthesis of large generation poly(propyl ether imine) (PETIM) dendrimers.
  • Cytotoxicity of PETIM dendrimer was evaluated first in BHK-21 cell line by an MTT assay. A concentration-dependent cytotoxicity was observed, with cell viability reducing to ⁇ 50%, when dendrimer concentration was ⁇ 1 mg mL "1 ( Figure 2a). Surprisingly, about 90% cell viability observed at 100 ⁇ g/ml of dendrimer concentration. Further it was observed that more than 70% viability was observe at 500 ⁇ g/ml of dendrimer concentration.
  • PETIM dendrimer employed in this study exhibits significantly reduced toxicities over a broad concentration range in the cationic form.
  • the presence of ether moieties within the dendritic structure appear to compensate higher toxicities seen generally for polyamines.
  • Gene transfection studies, involving few cell lines in combination with a reporter plasmid, showed a robust expression of the encoded protein.
  • PETIM dendrimers are hither-to un-known novel gene delivery vectors, combining the features of poly(ethylene imine) polymers and dendrimers, yet relatively non-toxic and structurally precise.
  • the PETIM dendrimers were found to efficiently complex the pEGFP-C 1 plasmid at a w/w ratio of 10:1, as evidenced by gel retardation assay.
  • the cellular uptake of PETIM- pEGFP-Cl complexes in C2C12 and P388D1 cell lines was studied by transmission electron microscopy on the pellets obtained from transfected cells. The complexes were observed to be localized predominantly in the endosomes in both the cell lines, when examined 4 hours post-exposure.
  • Hydrophilic poly(DL-lactide-co-glycolide) microspheres for the delivery of DNA to human-derived macrophages and dendritic cells (2001) J. Control. Release 76, 149-68; Burgdorf, S., Kurts, C. Endocytosis mechanisms and the cell biology of antigen presentation (2008) Curr. Opin. Immunol. 20, 89-95.
  • NF- ⁇ gene Exposure to the dendrimer or dendriplexes was also found to activate the NF- ⁇ gene in both C2C12 and P388D1 cell lines.
  • the NF- ⁇ gene when activated, triggers the expression of a number of proinflammatory, cytokine, and chemokine genes, and may have a significant effect on the ensuing adaptive immune responses, by influencing the polarization of T-cell responses into Thl or Th2 type.
  • Toll-like receptor ligands modulate dendritic cells to augment cytomegalovirus- and HIV- 1 -specific T-cell responses (2003) J. Immunol. 171, 4320-8. Engagement of TLR7 in early endosomes results in production of type I intererons, whereas interaction in the late endosomes produces NF-KB-related cytokines, such as TNFa and IL-6 (Kagan, J. C, Su, T., Horng, T., Chow, A., Akira, S., Medzhitov, R. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta (2008) Nat. Immunol. 9, 361-8).
  • TLR agonists find clinical utility, as exemplified by imiquimod, which is licensed for the treatment of cutaneous warts and superficial basal cell carcinomas. Studies have also indicated the potential utility of TLR7 ligands as vaccine adjuvants, in improving the magnitude and quality of experimental vaccines against HIV, Neisseria meningitidis group B etc. in animal models (for example, Wille-Reece, V., Flynn, B. J., Lore, K., Koup, R. A., Kedl, R. M., Mattappallil, J. J. et al.
  • HIV Gag protein conjugated to a Toll-Like Receptor 7/8 agonist improves the magnitudeand quality of Thl and CD8+ T- cell responses in non-human primates (2005) Proc. Natl. Acad. Sci. USA 102, 15190-4. Findings of the present application suggest that amine-terminated PETIM dendrimers are less-toxic and efficient inducer of TLR7 activation and type I interferons. Applications in the field of vaccination against infectious diseases and immunotherapy are options in further developments involving these new types of macromolecular entities.
  • Plasmid The plasmid DNA encoding green fluorescent protein (pEGFP-Cl) was obtained from Clontech. The plasmid was propagated in competent E. coli DH5a cells and amplified using standard protocols. The plasmid was purified using a modified alkaline lysis method and PEG-MgCl 2 purification.
  • MTT (3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2-yl-tetrazolium bromide)
  • DMSO dimethyl sulfoxide
  • EDTA ethylenediamine tetra-acetic acid
  • Deoxyribonuclease I enzyme and TurboFect in-vitro transfection reagent were obtained from Fermentas. All chemicals used in the study were of ACS/Molecular Biology grade.
  • HEK293 cell line was a gift from Dr. Anjali Karande, Indian Institute of Science, Bangalore.
  • the cell lines were maintained in Minimum Essential Medium (Sigma) supplemented with 10% Fetal Bovine Serum (Biological Industries, Israel) and ampicillin (lOOU/mL) and streptomycin (100 ⁇ g/mL) at 37°C, under C0 2 (5%).
  • Plasticware for cell culture were obtained from CellStar, Greiner.
  • PETIM dendrimers were prepared according to the protocol described in: Synthesis of large generation poly(ether imine) (PETIM) dendrimers (2006) Jayamurugan, G.; Jayaraman, N. Tetrahedron 62, 9582-9588. Preparation and structure of the fourth generation PETIM dendrimer is depicted in Figure l(a, b). The structure of the PETIM dendrimers is as provided in structure I as follows.
  • G4(C0 2 'Bu) 32 The G3-nitrile (G3(CN)i 6 ) (Krishna, T. R., and Jayaraman, N. (2003) Synthesis of poly(propyl ether imine) dendrimers and evolution of their cytotoxic properties. J. Org. Chem. 68, 9694-9704; Jayamurugan, G., and Jayaraman, N. (2006) Synthesis of large generation poly(propyl ether imine) (PETIM) dendrimers. Tetrahedron 62, 9582-9588) (1.5g) was transferred to a hydrogenation reactor vessel and mixed with Raney cobalt (4g) in water (1.2L).
  • G4(NH 2 )3 2 G4(CN) 32 (1 g) was transferred to a hydrogenation reactor vessel, mixed with Raney Co (7g) in water (1.2L) and hydrogenated (H 2 , 46 atm) at 70°C for 6 h. The reaction mixture was cooled, filtered through a celite pad and filtrate concentrated in vacuo to afford G4(NH 2 ) 32 , as a colorless gum (lg, 98 %).
  • pEGFPCl -PETIM complexes were prepared at various charge (N/P) ratios by co- incubating defined amounts of PETIM dendrimer and 1 ⁇ g of pEGFP-Cl in Phosphate Buffered Saline (PBS) (pH 7.4), in a total volume of 50 ⁇ ,.
  • PBS Phosphate Buffered Saline
  • the complexes were incubated at room temperature for 30 min.; mixed with gel loading buffer and loaded onto wells of a 0.8% agarose gel and electrophoresed for 45 min. at 100V in IX Tris- Acetate-EDTA buffer. The presence or absence of DNA bands were visualized and documented with the help of a Gel Documentation System (G-Box, Syngene).
  • G-Box Gel Documentation System
  • TEM Transmission electron microscopy
  • Deoxyribonuclease-mediated degradation of PETIM-DNA complex was studied by a DNase I protection assay.
  • pEGFPCl -PETIM complex was prepared in PBS (pH 7.4), at a charge ratio of 10: 1 and complexation verified by agarose gel electrophoresis.
  • the complex was then incubated with deoxyribonuclease I enzyme (1U) under appropriate buffer conditions. At 30, 60, or 120 min. of incubation, the enzyme action was stopped by addition of EDTA (25 raM) solution and the complexes disrupted by 5% SDS and centrifuged. The supernatants were subjected to agarose gel electrophoresis. The presence or absence of DNA bands was verified and documented.
  • PETIM-DNA complexes were studied by TEM on negatively stained thin sections, prepared from transiently transfected BHK-21 cells.
  • BHK-21 cells (lxlO 5 cells/well) were seeded in a 6-well plate with complete growth medium and incubated for 24 h at 37°C, under 5% C0 2 .
  • pEGFPCl -PETIM complexes were prepared at a ratio of 10: 1 (w/w), in a total volume of 100 ⁇ , of growth medium without serum.
  • Three wells were identified as the test group and were transfected with the dendrimer-DNA complexes and the remaining wells were mock- transfected with 100 ⁇ , of growth medium.
  • the growth medium in the wells Prior to transfection, the growth medium in the wells were replenished with medium without serum. The dendriplexes were added to the cells, rocked gently and the plate incubated at 37°C, under 5% C0 2 . After 4 h, the transfection mix was removed and complete growth medium replenished. At the end of 8 h, the cells in each well were gently scraped, using a sterile cell scraper, into 1 mL of growth medium. The scrapings from the test wells and the mock-transfected wells were pooled separately and centrifuged at 6000 rpm for 5 min. to obtain the cell pellets. The cell pellets were fixed in 4% glutaraldehyde solution and embedded into paraffin blocks. Thin sections of the blocks were cut using an ultramicrotome, appropriately stained and subjected to transmission electron microscopy.
  • a commercial in vitro transfection reagent TurboFect was used, as per manufacturer's guidelines, as a positive control for transfection.
  • Cells mock-transfected with growth medium served as negative controls.
  • the plates were re-incubated at 37°C for 48 h, at the end of which the growth medium was aspirated off from the wells and the cells gently rinsed in PBS, pH 7.4.
  • the cells were fixed in 4% paraformaldehyde for 30 min. at room temperature, rinsed with PBS and the plates examined under an inverted fluorescent microscope (Nikon Eclipse TS120). The images were documented.
  • Un-transfected cells were used as negative controls, and cells transfected with a pEGFP complexed to TurboFect, were used as positive controls.
  • the cells were incubated in serum-free medium for 4 h at 37°C in a 5% C0 2 incubator. Thereafter, the growth medium containing the complexes was aspirated off and complete growth medium was replenished. After 48 h of incubation, the cells from each well were trypsinized separately and pelleted by centrifugation at 6000 rpm for 5 min. The pellets were re-suspended in PBS and subjected to flow cytometric measurement on a FACSCalibur flow cytometer (Becton Dickinson).
  • Fluorescence emission for EGFP was recorded per 10,000 cells in each sample, using FL1 channel and 530/30 band pass filter. Non-viable cells were gated out and % of EGFP positive cells was measured. The experiment was done in triplicate, and the data were analyzed using CellQuest Pro software.
  • PETIM-pEGFP-Cl dendriplex was prepared at a weight/weight ratio of 10: 1 by coincubation of 10 ⁇ g of pEGFP-Cl and 100 ⁇ g of PETIM dendrimer in a total volume of 100 ⁇ , of serum-free medium, at 37°C for 30 minutes. Complexation was verified by agarose gel electrophoresis.
  • C2C 12 and P388D 1 cell lines C2C12 and P388D1 cells were grown to confluency in 25 cm 2 non- vented tissue culture flasks. The cells were trypsinized (or resuspended without trypsinization in the case of P388D1) and resuspended in growth medium, and about 1 x 10 5 cells were seeded alongwith 2 mL of complete growth medium per well in 6-well tissue culture plates. The plates were incubated till a confluency of 70-80% was reached. Prior to transfection, the growth medium in the wells were replaced with medium containing 1% FBS.
  • the experiment was set up in parallel in two sets of 6-well plates. At the end of 24 hours, the cells from one plate were gently scraped using a sterile cell scraper into 1 mL of growth medium. The scrapings were pooled separately and centrifuged at 6000 rpm for 5 min. to obtain the cell pellets, which were processed for Transmission Electron Microscopy. Total cellular RNA was extracted from the wells in the second plate, and processed for RT-PCR.
  • the cell pellets were fixed in 0.5mL of 3% glutaraldehyde solution at 4°C for 24 hours, and later washed in several changes of 0.1 M phosphate buffer.
  • the pellets were post- fixed in 1% osmium tetroxide for 1 hour at 4°C, washed with 0.1 M phosphate buffer and subjected to sequential dehydration with glass-distilled absolute ethanol (70% ethanol for 1 hour, 80% ethanol for 1 hour, 90% ethanol for 1 hour, followed by two changes in absolute ethanol for 30 min. each).
  • the pellets were treated with 0.5 mL of propylene oxide (clearing agent), in two changes lasting 15 minutes each.
  • the specimens were incubated overnight in a mixture of propylene oxide:araldite (1 : 1 proportion) on a rotator, at room temperature, followed by two changes in pure embedding medium, over a period of 6 hours, on the rotator, and finally embedded in flat embedding moulds or beam capsules.
  • Polymerization of embedding medium was carried out by incubation in an oven at 60°C for 48 hours. After complete polymerization, the blocks were trimmed using a razor blade and thin sections cut using an ultramicrotome (Leica). For checking the quality, the sections were collected using a glass rod, and transferred onto a clean glass slide, and placed on a slide warmer at 80°C for drying.
  • the slides were stained with 1% toluidine blue for 1 minute, washed in running water, dried and observed under a light microscope.
  • the ultrathin sections, -400-500 A thick, were collected on copper grids, and stained using uranyl acetate and lead citrate. After drying, the grids were scanned under Tecnai G Transmission Electron Microscope and representative areas were photographed using MegaView III CCD Camera.
  • Murine TLR7 NMJ33211.3; Murine NF-KB:EF043800.1 ; Murine TNFa: NM_013693.2; Murine IFNa: NM_010504.2; Murine IFNp: NM_010510.1 ; and Murine GAPDH: NM_008084
  • Total cellular RNA was extracted from each well of the 6-well plate using TRI reagent. Briefly, the cells from each well were lysed in 1 mL of TRI reagent, followed by phase separation using chloroform and RNA precipitation by addition of chilled isopropyl alcohol to the aqueous phase. After a brief wash in 70% ethanol, the pellets were air- dried and re-suspended in nuclease-free water.
  • Reverse transcription reactions were set up with about 1 ⁇ g of RNA using random primers, in a total volume of 50 ⁇ ,, using High Capacity cDNA synthesis kit (ABI) as per manufacturer instructions.
  • the reaction was carried out in a thermal cycler (Veriti 96-well thermal cycler, Applied Biosystems) with cycling conditions as follows: 25°C for 10 minutes, followed by 42°C for 45 minutes.
  • the cDNA thus produced was subjected to Real-time PCR using the primers listed in Table 1 (SEQ ID NO: 1 to SEQ ID NO: 12).
  • the real time PCR was performed using SYBR Green PCR Master Mix (ABI) in an ABI PRISM ® 7700 Sequence Detection System.
  • Each reaction was set up in a total volume of 25 ⁇ , with cycling conditions as follows: 50°C for 2 minutes, 95 °C for 10 minutes, followed by 42 cycles of sequential incubation at 95 °C for 15 minutes and 57°C for 1 minute, followed by analysis of dissociation curves to verify the specificity of the amplicons.
  • the mRNA expression in each sample was determined after normalization with the housekeeping gene GAPDH as internal control.
  • the threshold cycle (Ct) of GAPDH was subtracted from gene-specific Ct values to obtain ACt values.
  • ACt for experimental groups were subtracted from ACt of control group (normal, untreated cells) to obtain AACt.
  • the fold change of each gene mRNA was expressed as 2 "AACt .
  • Each measurement was performed in duplicate, and the experiment repeated thrice. The results are provided in Table 2.
  • mGAPDH-F SEQ ID NO: 11 AACTTTGGCATTGTGGAAGG
  • mGAPDH-R SEQ ID NO: 12 GGATGCAGGGATGATGTTCT
  • Table 2 Changes in mRNA levels (calculated as 2 " ) of TLR7 and associated genes induced by PETIM dendrimer, pEGFP-Cl and PETIM-pEGFP-Cl dendriplex

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nanotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Polymers & Plastics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Medical Informatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Microbiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des systèmes d'apport de gènes à base de dendrimères poly(éhterimine) (PETIM) non viraux. Le dendrimère PETIM constitué de points de ramification d'amine tertiaire, de lieurs n-propyle éther et d'amines primaires, avec ou sans autres fonctionnalisations, au niveau e leurs périphéries, présente des toxicités considérablement réduites sur une large plage de concentration. Ledit dendrimère complexe efficacement l'ADNp, protège l'ADN d'éventuels dommages endosomaux et le véhicule jusqu'au noyau cellulaire
PCT/IN2011/000898 2010-12-29 2011-12-28 Dendrimères poly(étherimine) et leurs utilisations WO2012090223A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IN4010/CHE/2010 2010-12-29
IN4010CH2010 2010-12-29

Publications (1)

Publication Number Publication Date
WO2012090223A1 true WO2012090223A1 (fr) 2012-07-05

Family

ID=46382389

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IN2011/000898 WO2012090223A1 (fr) 2010-12-29 2011-12-28 Dendrimères poly(étherimine) et leurs utilisations

Country Status (1)

Country Link
WO (1) WO2012090223A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11229609B2 (en) 2018-09-04 2022-01-25 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
US11247968B2 (en) 2015-09-14 2022-02-15 The Board Of Regents Of The University Of Texas System Lipocationic dendrimers and uses thereof
US11766408B2 (en) 2018-09-04 2023-09-26 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
CN117210454A (zh) * 2023-11-09 2023-12-12 北京纳捷诊断试剂有限公司 一种全血样本中核酸提取的裂解液及其应用
US11999683B2 (en) 2023-06-15 2024-06-04 The Board Of Regents Of The University Of Texas System Lipocationic dendrimers and uses thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003033027A2 (fr) * 2001-10-19 2003-04-24 University Of Strathclyde Dendrimeres utilises pour une administration ciblee
US20050027064A1 (en) * 2003-07-09 2005-02-03 Wisconsin Alumni Research Foundation Charge-dynamic polymers and delivery of anionic compounds
US20100297104A1 (en) * 2007-07-04 2010-11-25 Indian Institute Of Science Dendritic macromolecule and a process thereof
WO2012025744A1 (fr) * 2010-08-24 2012-03-01 Imperial Innovations Limited Glycodendrimères de polypropylétherimine

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003033027A2 (fr) * 2001-10-19 2003-04-24 University Of Strathclyde Dendrimeres utilises pour une administration ciblee
US20050027064A1 (en) * 2003-07-09 2005-02-03 Wisconsin Alumni Research Foundation Charge-dynamic polymers and delivery of anionic compounds
US20100297104A1 (en) * 2007-07-04 2010-11-25 Indian Institute Of Science Dendritic macromolecule and a process thereof
WO2012025744A1 (fr) * 2010-08-24 2012-03-01 Imperial Innovations Limited Glycodendrimères de polypropylétherimine

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JAYAMURUGAN, G. ET AL.: "Synthesis of large generation poly(propyl ether imine) (PETIM) dendrimers", TETRAHEDRON, vol. 62, 2006, pages 9582 - 9588, XP025002722, DOI: doi:10.1016/j.tet.2006.07.094 *
SUN, X. ET AL.: "Cationic Polymer Optimization for Efficient Gene Delivery", MINI- REVIEWS IN MEDICINAL CHEMISTRY, vol. 10, 2010, pages 108 - 125 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11247968B2 (en) 2015-09-14 2022-02-15 The Board Of Regents Of The University Of Texas System Lipocationic dendrimers and uses thereof
US11858884B2 (en) 2015-09-14 2024-01-02 The Board Of Regents Of The University Of Texas System Compositions and methods for modulating gene or gene product in cells
US11229609B2 (en) 2018-09-04 2022-01-25 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
US11304911B2 (en) 2018-09-04 2022-04-19 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
US11510880B2 (en) 2018-09-04 2022-11-29 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
US11590085B2 (en) 2018-09-04 2023-02-28 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
US11648210B2 (en) 2018-09-04 2023-05-16 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
US11648209B2 (en) 2018-09-04 2023-05-16 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
US11766408B2 (en) 2018-09-04 2023-09-26 The Board Of Regents Of The University Of Texas System Compositions and methods for organ specific delivery of nucleic acids
US11999683B2 (en) 2023-06-15 2024-06-04 The Board Of Regents Of The University Of Texas System Lipocationic dendrimers and uses thereof
CN117210454A (zh) * 2023-11-09 2023-12-12 北京纳捷诊断试剂有限公司 一种全血样本中核酸提取的裂解液及其应用
CN117210454B (zh) * 2023-11-09 2024-01-30 北京纳捷诊断试剂有限公司 一种全血样本中核酸提取的裂解液及其应用

Similar Documents

Publication Publication Date Title
Jayakumar et al. Chitosan conjugated DNA nanoparticles in gene therapy
Sun et al. Self-assembled biodegradable micellar nanoparticles of amphiphilic and cationic block copolymer for siRNA delivery
US8678686B2 (en) Multi-chain lipophilic polyamines
KR102285326B1 (ko) Rna를 세포에 도입하기 위한 조성물
Kim et al. Synthesis and characterization of mannosylated pegylated polyethylenimine as a carrier for siRNA
CN107001627B (zh) 用于将核酸引入细胞的组合物
JP5645186B2 (ja) 電荷変換型三元系ポリプレックス
Felber et al. siRNA nanocarriers based on methacrylic acid copolymers
US8658150B2 (en) Polymer derived from linear polyethylenimine for gene transfer
Wu et al. Glucose-containing diblock polycations exhibit molecular weight, charge, and cell-type dependence for pDNA delivery
KR101590652B1 (ko) 합성 중합체를 사용하여 유전자 사일런싱에 활성이 있는 핵산을 전달하기 위한 수단
Ma et al. PAMAM–Triamcinolone acetonide conjugate as a nucleus-targeting gene carrier for enhanced transfer activity
Smith Dendrimers and the double helix-From DNA binding towards gene therapy
US20130102730A1 (en) Polyamine-containing polymers and methods of synthesis and use
WO2012090223A1 (fr) Dendrimères poly(étherimine) et leurs utilisations
Zheng et al. A novel gemini-like cationic lipid for the efficient delivery of siRNA
Shuai et al. mRNA delivery via non-viral carriers for biomedical applications
JP5661626B2 (ja) アニオン性ポリマー、該アニオン性ポリマーを用いたポリイオンコンプレックスおよび三元系ポリマー複合体、ならびに薬学組成物
Bansal et al. Galactomannan-PEI based non-viral vectors for targeted delivery of plasmid to macrophages and hepatocytes
JP4772686B2 (ja) 分解性の架橋を有するカチオン性ポリマー
Hu et al. Study on galactose–poly (ethylene glycol)–poly (L-lysine) as novel gene vector for targeting hepatocytes in vitro
Opanasopit et al. Nucleic acid delivery with chitosan hydroxybenzotriazole
EP4127026A1 (fr) Copolymère linéaire pour la transfection de gènes
JP2024509906A (ja) Ｃｏｖｉｄ‐１９を含む呼吸器系ウイルス感染症、ウイルス感染を原因とする肺線維症、又は呼吸器疾患の予防又は治療のために超音波ネブライザを使用して二本鎖オリゴヌクレオチド構造物を投与するための組成物
Jiang Application of polymers in nucleic acid delivery

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11853128

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11853128

Country of ref document: EP

Kind code of ref document: A1