WO2012077684A1 - Method for producing sugar - Google Patents

Abstract

The present invention relates to a method for producing a sugar by saccharifying a cellulose having a cellulose I type crystallinity, as represented by equation (1), of 50% or lower and/or a specific surface area of 180 m²/g or higher, by means of an enzyme formulation, and relates to a method for increasing the quantity of glucose produced, wherein the enzyme formulation contains 20% or more of endoglucanase relative to the total quantity of proteins in the enzyme component, and the cellulose is obtained by pulverizing a cellulose-containing raw material in a pulverizer. Cellulose I type crystallinity (%) = [(I_22.6 - I_18.5) / I_22.6] × 100 (1) (I_22.6 denotes the diffraction intensity of the lattice plane (002 plane) (diffraction angle (2θ) = 22.6°) and I_18.5 denotes the diffraction intensity of the amorphous portion (diffraction angle (2θ) = 18.5°) in X-ray diffraction)

Description

Method for producing sugar

The present invention relates to a method for producing sugar and a method for increasing the amount of glucose produced.

Cellulose-containing raw materials are used as industrial raw materials such as cellulose ether raw materials, cosmetics, foods, and biomass materials. In particular, in recent years, attempts have been made to produce sugar from biomass materials and to convert it into ethanol, lactic acid, etc. by fermentation or the like from efforts to address environmental problems (see Patent Document 1).
As a method for saccharifying a cellulose-containing raw material, an acid saccharification method using an acid such as sulfuric acid and an enzyme saccharification method using an enzyme such as cellulase are known, and a more environmentally friendly enzyme saccharification method is desired. Cellulases are roughly divided into three types of enzymes, endoglucanase (EG), cellobiohydrolase (CBH), and β-glucosidase (BG), which have different functions. In order to produce glucose from biomass, these three types of cellulases are used. is needed. In the commercially available cellulase preparation, cellulase derived from Trichoderma reesei is said to have good saccharification efficiency, but its protein composition ratio is about 80% CBH and about 20% EG, and the ratio of BG is low. ing. Therefore, for the purpose of improving saccharification efficiency, the importance of BG activity is such that the total enzyme amount can be reduced to about half by increasing the ratio of BG activity to cellulase preparation (Cell Crust 1.5L) derived from T. reesei. Has also been pointed out (see Non-Patent Document 1).
Furthermore, as an enzymatic saccharification method, saccharification such as a method using a specific cellulase (see Patent Document 2), a method of hydrolyzing cellulose or hemicellulose treated with hydrogen peroxide (see Patent Documents 3 and 4), etc. Efficiency improvement studies are being conducted.
However, these methods are not yet satisfactory in terms of saccharification efficiency and productivity.

JP 2006-223152 A JP 2003-135052 A JP 2007-74992 A JP 2007-74993 A

The present invention provides a method for producing a saccharide with excellent productivity and a method for increasing the amount of glucose produced, which can efficiently obtain a saccharide.

The present inventors have found that the above problem can be solved by saccharifying cellulose having a specific crystallinity and / or specific surface area using a specific enzyme compounding agent.
That is, the present invention includes the following [1] and [2].
[1] A method for producing a saccharide by saccharifying a cellulose having a cellulose I type crystallinity of 50% or less and / or a specific surface area of 180 m ² / g or more represented by the following formula (1) with an enzyme compounding agent. The enzyme compounding agent contains 20% or more of endoglucanase in the total protein content of the enzyme compounding agent, and the cellulose is obtained by pulverizing a cellulose-containing raw material with a pulverizer.
Cellulose type I crystallinity (%) = [(I _22.6 -I _18.5 ) / I _22.6 ] × 100 (1)
[I _22.6 is the diffraction intensity of the grating plane (002 plane) (diffraction angle 2θ = 22.6 °) in X-ray diffraction, and I _18.5 is the diffraction intensity of the amorphous portion (diffraction angle 2θ = 18.5 °). ]
[2] Cellulose I-type crystallinity represented by the following calculation formula (1) is 50% or less and / or cellulose having a specific surface area of 180 m ² / g or more is saccharified with an enzyme compounding agent. In this method, the enzyme compound contains endoglucanase in an amount of 20% or more of the total protein content of the enzyme compound, and the cellulose is obtained by pulverizing a cellulose-containing raw material with a pulverizer. A method for increasing the amount of glucose produced.
Cellulose type I crystallinity (%) = [(I _22.6 -I _18.5 ) / I _22.6 ] × 100 (1)
[I _22.6 is the diffraction intensity of the grating plane (002 plane) (diffraction angle 2θ = 22.6 °) in X-ray diffraction, and I _18.5 is the diffraction intensity of the amorphous portion (diffraction angle 2θ = 18.5 °). ]

According to the sugar production method of the present invention, sugar can be efficiently produced, and therefore productivity can be improved. Moreover, according to the method for increasing the production amount of glucose of the present invention, glucose can be produced efficiently, so that the production amount of glucose can be remarkably increased and productivity can be improved.

The present invention is a method for producing a saccharide in which cellulose having a cellulose I type crystallinity of 50% or less and / or a specific surface area of 180 m ² / g or more represented by the above formula (1) is saccharified with an enzyme compounding agent. The enzyme compounding agent contains endoglucanase in an amount of 20% or more in the total protein content of the enzyme compounding agent, and the cellulose is obtained by pulverizing a cellulose-containing raw material with a pulverizer. It is.
In addition, the present invention provides a glucose saccharification treatment of cellulose having a cellulose I-type crystallinity of 50% or less and / or a specific surface area of 180 m ² / g or more represented by the above formula (1) with an enzyme compounding agent. In the method for increasing the amount of production, the enzyme compound contains endoglucanase in an amount of 20% or more of the total protein content of the enzyme compound, and the cellulose is obtained by pulverizing a cellulose-containing raw material with a pulverizer. This is a method for increasing the amount of glucose produced.
Hereinafter, the present invention will be described in detail. In the present specification, cellulose I type crystallinity may be simply referred to as “crystallinity”.

〔cellulose〕
The cellulose used in the present invention has a cellulose I-type crystallinity of 50% or less and / or a specific surface area of 180 m ² / g or more.
Here, the cellulose I type crystallinity is the ratio of the amount of crystal region of cellulose to the total amount. Cellulose type I is a crystalline form of natural cellulose. The degree of crystallinity is also related to the physical and chemical properties of cellulose, and the larger the value, the higher the crystallinity of cellulose and the less non-crystalline parts, so the hardness, density, etc. increase, but elongation, flexibility, Solubility and chemical reactivity in water and solvent decrease.

The cellulose I type crystallinity in the present invention is calculated by the Segal method from the diffraction intensity value by the X-ray diffraction method, and is defined by the following calculation formula (1).
Cellulose type I crystallinity (%) = [(I _22.6 -I _18.5 ) / I _22.6 ] × 100 (1)
[I _22.6 is the diffraction intensity of the grating plane (002 plane) (diffraction angle 2θ = 22.6 °) in X-ray diffraction, and I _18.5 is the diffraction intensity of the amorphous portion (diffraction angle 2θ = 18.5 °). ]

The cellulose type I crystallinity of the cellulose used in the present invention is 50% or less. If the degree of crystallinity is 50% or less, the chemical reactivity of cellulose is improved, and a mixture of glucose or oligosaccharides such as cellobiose and cellotriose can be efficiently obtained by enzyme treatment with an enzyme compounding agent containing endoglucanase. it can. In addition, in the production of cellulose ether, when an alkali is added, alkali celluloseation easily proceeds and the reaction conversion rate of the cellulose etherification reaction can be improved.
Therefore, from the above viewpoint, the degree of crystallinity is preferably 40% or less, more preferably 30% or less, more preferably 15% or less, still more preferably 10% or less, and still more preferably no type I crystal is detected by analysis. 0%. The cellulose I type crystallinity defined by the calculation formula (1) may be a negative value in calculation, but the cellulose I type crystallinity in the case of a negative value is 0%.

The specific surface area of the cellulose used in the present invention is 180 m ² / g or more. When the specific surface area is 180 m ² / g or more, the chemical reactivity of cellulose is improved, and the saccharification treatment can be efficiently performed with an enzyme compounding agent containing endoglucanase.
Therefore, from the above viewpoint, the specific surface area is preferably 200 m ² / g or more, more preferably 250 m ² / g or more, more preferably 270 m ² / g or more, and further preferably 290 m ² / g or more. Moreover, there is no restriction | limiting in particular as an upper limit of the specific surface area of the said cellulose, However, From a viewpoint of productivity, Preferably it is 500 m < ² > / g or less. In addition, the specific surface area here is the value measured by the method as described in an Example.

Moreover, it is preferable that the molecular weight of the cellulose used by this invention is 130,000 or less. If the molecular weight is 130,000 or less, the chemical reactivity of cellulose is improved, and the saccharification treatment can be efficiently performed with an enzyme compounding agent containing endoglucanase.
Therefore, from the above viewpoint, the molecular weight is more preferably 110,000 or less, more preferably 90,000 or less, still more preferably 70,000 or less, and still more preferably 50,000 or less. Moreover, there is no restriction | limiting in particular as a lower limit of the molecular weight of the said cellulose, However, From a viewpoint of productivity, Preferably it is 1000 or more. In addition, the molecular weight here is a value measured by the method described in Examples.

The cellulose used in the present invention is not limited as long as it belongs to any one of the above-mentioned crystallinity and specific surface area, but improves the chemical reactivity of cellulose and is more efficient with an enzyme compounding agent containing endoglucanase. From the viewpoint of performing a saccharification treatment, cellulose belonging to any suitable range of the above-described crystallinity and specific surface area is preferable, and cellulose belonging to the above-described preferable range of molecular weight is more preferable.

[Cellulose-containing raw material]
The cellulose having the above specific crystallinity and / or specific surface area is obtained by pulverizing a cellulose-containing raw material with a pulverizer.
The cellulose-containing raw material preferably has a cellulose content of 20% by mass or more, more preferably 40% by mass or more, and still more preferably 60% by mass or more in the remaining components obtained by removing water from the raw material. The upper limit of the cellulose content in the cellulose-containing raw material is usually 99% by mass or less in the remaining components obtained by removing water from the cellulose-containing raw material. In the present invention, the cellulose content means the total amount of cellulose and hemicellulose.

There is no restriction | limiting in particular as a cellulose containing raw material, For example, various wood chips, pruned branch materials, thinning materials, branch wood, etc .; wood pulp manufactured from wood, cotton obtained from the fiber around cotton seeds Pulp such as linter pulp; Paper such as newspapers, cardboard, magazines, fine paper; plant stems, leaves, fruit bunches such as bagasse (sugar cane squeezed), palm empty fruit bunches (EFB), rice straw, corn stalks, etc. And the like: plant shells such as rice husk, palm husk, coconut husk etc. Among these, pulps, papers, plant stems / leaves / fruits, plant shells, and woods are preferred, pulps, papers, and plant stems / leaves / fruits are more preferred, and pulps And bagasse are more preferred.
These cellulose-containing raw materials may be powdery or sheet-like.
In the case of commercially available pulp, the cellulose content in the remaining components excluding water is generally 75 to 99% by mass, and other components include lignin and the like. Moreover, the cellulose I type crystallinity degree of a commercially available sheet-like pulp is 60% or more normally.
The water content in the cellulose-containing raw material (water content in the cellulose-containing raw material immediately before the pulverization treatment) is preferably 20% by mass or less, more preferably 15% by mass or less, and still more preferably 10% by mass or less. If the water content in the cellulose-containing raw material is 20% by mass or less, it can be easily pulverized, and the crystallinity can be easily reduced by the pulverization process described later, and the subsequent sugar production can be efficiently performed. it can.

[Crushing treatment]
In this invention, the cellulose which has the above-mentioned crystallinity degree and / or specific surface area is obtained by grind | pulverizing the above-mentioned cellulose containing raw material with a grinder. By carrying out a pulverization treatment with a pulverizer, cellulose having a specific crystallinity and / or specific surface area can be obtained efficiently.
As the pulverizer used in the pulverization treatment, a medium pulverizer is preferable from the viewpoint of increasing the saccharification efficiency and increasing the production amount of glucose. The medium pulverizer includes a container driven pulverizer and a medium stirring pulverizer.

Examples of the container-driven crusher include a rolling mill, a vibration mill, a planetary mill, and a centrifugal fluid mill. Among these, a vibration mill is preferable and a vibration mill filled with a rod is more preferable from the viewpoint of high grinding efficiency and improvement of productivity.
As vibration mills, vibration mills manufactured by Chuo Kako Co., Ltd., small vibration rod mill model 1045 manufactured by Yoshida Seisakusho, vibration cup mill P-9 model manufactured by Fritsch, Germany, and small vibration mill NB-O manufactured by Nikko Chemical Co., Ltd. Examples include molds.

As a medium agitation type pulverizer, a tower type pulverizer such as a tower mill; an agitating tank type pulverizer such as an attritor, an aquamizer, a sand grinder; a distribution tank type pulverizer such as a visco mill and a pearl mill; For example, a continuous dynamic type pulverizer. Among these, a medium agitation mill of an agitation tank type pulverizer is preferable from the viewpoint that the crushing efficiency is high and productivity can be improved. In the case of using a medium stirring pulverizer, the peripheral speed at the tip of the stirring blade is preferably 0.5 to 20 m / s, more preferably 1 to 15 m / s.
In addition, the kind of grinder can refer to "Progress of chemical engineering 30th particle control" (Chemical Engineering Society, Tokai branch edition, published on October 10, 1996, Kashiwa Shoten).
The processing method may be either a batch type or a continuous type.

Examples of media include balls, rods, and tubes. Of these, balls and rods are preferable from the viewpoint of high crushing efficiency and productivity can be improved, and rods are more preferable from the viewpoint of shortening the processing time. There is no restriction | limiting in particular as a material of a medium, For example, iron, stainless steel, an alumina, a zirconia, silicon carbide, silicon nitride, glass etc. are mentioned.

The rod used as the medium is a rod-shaped medium, and a cross section having a square shape, a polygonal shape such as a hexagon, a circular shape, an elliptical shape, or the like can be used.
The outer diameter of the rod is preferably in the range of 0.5 to 200 mm, more preferably 1 to 100 mm, and still more preferably 5 to 50 mm. The length of the rod is not particularly limited as long as it is shorter than the length of the pulverizer container. If the size of the rod is in the above range, the desired pulverizing force can be obtained, and the cellulose used in the present invention can be obtained without contamination of the cellulose-containing raw material by mixing fragments of the rod and the like.

The outer diameter of the ball used as the medium is preferably 1 to 100 mm, more preferably 3 to 50 mm, and still more preferably 6 to 30 mm. If the outer diameter of the ball is in the above range, a desired crushing force can be obtained.

The medium filling rate varies depending on the type of the pulverizer, but is preferably 10 to 97%, more preferably 15 to 95%. When the filling rate is within this range, the contact frequency between the cellulose and the medium is improved, and the grinding efficiency can be improved without hindering the movement of the medium. Here, the filling rate refers to the apparent volume of the medium relative to the volume of the pulverizer.
The processing time of the pulverizer cannot be determined unconditionally depending on the type of pulverizer, the type of medium, the size, the filling rate, etc., but from the viewpoint of reducing the crystallinity, it is preferably 0.01 to 50 hr, more preferably 0.05 to 20 hr, more preferably 0.1 to 10 hr. The treatment temperature is not particularly limited, but is preferably 5 to 250 ° C., more preferably 10 to 200 ° C. from the viewpoint of preventing deterioration due to heat.

Through the above pulverization treatment, cellulose having a cellulose I-type crystallinity of 50% or less and / or a specific surface area of 180 m ² / g or more can be efficiently obtained from the cellulose-containing raw material.
The average particle size of the obtained cellulose is preferably 25 to 150 μm, more preferably 30 to 100 μm, from the viewpoint of chemical reactivity and handleability when the cellulose is used as an industrial raw material. When the average particle size is 25 μm or more, it is possible to suppress “mamako (dama)” when cellulose is brought into contact with a liquid such as water.

In addition, when using a powdery raw material as the cellulose-containing raw material supplied to the pulverizer, from the viewpoint of efficiently dispersing the pulverized raw material in the pulverizer, those having an average particle diameter of the raw material in the range of 1 mm or less are preferable. . If this average particle size is 1 mm or less, when supplying into the pulverizer, the pulverized raw material can be efficiently dispersed in the pulverizer, and the predetermined particle size can be reached without taking a long time. Can do. On the other hand, the lower limit of the average particle diameter is preferably 0.03 mm or more from the viewpoint of productivity. From these viewpoints, the average particle diameter is more preferably 0.03 to 0.7 mm, and further preferably 0.05 to 0.5 mm. The average particle size is measured at a temperature of 25 ° C. using a laser diffraction / scattering particle size distribution measuring device, treated with ultrasonic waves for 1 minute before measuring the particle size, and using water as a dispersion solvent during the measurement. It is the value.

Moreover, when using a sheet-like raw material as a cellulose containing raw material supplied to a grinder, when putting a cellulose containing raw material into a grinder, it is preferable to coarsely grind into a chip shape beforehand. The size of the cellulose-containing raw material in the form of chips is preferably 1 to 50 mm square, more preferably 1 to 30 mm square. By roughly pulverizing the chips in the range angle, the pulverization can be efficiently and easily performed.
Examples of the method for coarsely pulverizing the cellulose-containing raw material into chips include a method using a shredder or a rotary cutter.
When using a rotary cutter, the magnitude | size of the chip-shaped cellulose containing raw material obtained can be controlled by changing the opening of a screen. The opening of the screen is preferably 1 to 50 mm, more preferably 1 to 30 mm. If the opening of the screen is 1 mm or more, the cellulose-containing raw material does not become cottony and the handleability is improved. If the opening of the screen is 50 mm or less, the load can be reduced because it has an appropriate size as a cellulose-containing raw material used in the subsequent pulverizer treatment.
Therefore, the load can be reduced.

[Alkali treatment]
In the production method of the present invention, the cellulose-containing raw material is preferably alkali-treated before the saccharification treatment described later, from the viewpoint of increasing saccharification efficiency and increasing the amount of glucose produced, and before the pulverization treatment. More preferably, an alkali treatment is performed.
The alkali treatment is preferably an immersion treatment using an alkaline solution from the viewpoint of increasing the saccharification efficiency and increasing the amount of glucose produced.

The concentration of the alkali compound in the alkaline solution in the immersion treatment is preferably 0.1 to 60% by mass, more preferably 0.1 to 50% by mass, more preferably 0.1 to 50% by mass from the viewpoint of increasing saccharification efficiency and increasing the amount of glucose produced. Preferably, the content is 0.1 to 40% by mass.
The amount of the alkaline solution used in the immersion treatment is preferably 50 to 99% by mass, more preferably 60 to 99% by mass, and still more preferably 80 to 99% by mass with respect to the dry weight of the raw material cellulose.
The treatment time for the alkali treatment is preferably 0.5 to 50 hours, more preferably 1 to 24 hours, still more preferably 1.5 to 10 hours.

Examples of the alkali compound used for the alkali treatment include alkali metal hydroxides such as sodium hydroxide, potassium hydroxide and lithium hydroxide; alkaline earth metal hydroxides such as magnesium hydroxide and calcium hydroxide; sodium oxide Alkali metal oxides such as potassium oxide; alkaline earth metal oxides such as magnesium oxide and calcium oxide; alkali metal sulfides such as sodium sulfide and potassium sulfide; alkaline earth metal sulfides such as magnesium sulfide and calcium sulfide Is mentioned.
Among these, an alkali metal hydroxide or an alkaline earth metal hydroxide is preferable, an alkali metal hydroxide is more preferable, and sodium hydroxide or potassium hydroxide is still more preferable. In addition, these alkali compounds can be used individually or in combination of 2 or more types.

After the immersion treatment, the cellulose-containing raw material may be neutralized or washed with acetic acid or the like and lyophilized before the saccharification treatment described below from the viewpoint of removing alkali compounds, improving saccharification efficiency, and improving the amount of glucose produced. preferable.

[Saccharification treatment]
In the present invention, a specific enzyme compounding agent is allowed to act on the cellulose that has been subjected to the above-mentioned pulverization treatment to obtain a sugar. Here, it is preferable to decompose to monosaccharides in consideration of the case where it is used for ethanol fermentation or lactic acid fermentation after saccharification treatment.
The enzyme compounding agent used in the present invention contains endoglucanase in an amount of 20% or more in the total protein of the enzyme compounding agent. By using such an enzyme compounding agent, the efficiency of saccharification treatment can be improved compared to conventional enzyme compounding agents, and there is no need to enhance β-glucosidase activity, so the degree of freedom in compounding is improved. it can.
The content of endoglucanase is 20% or more in the total protein of the enzyme compounding agent, preferably 25 to 100%, more preferably 33 to 90%, still more preferably 50 to 90%. When the content of endoglucanase is less than 20% of the total protein of the enzyme compounding agent, the function of endoglucanase is not sufficiently exhibited and saccharification efficiency is inferior.

[Endoglucanase]
Endoglucanase is a type of cellulase that is an enzyme that hydrolyzes the glycosidic bond of β-1,4-glucan in cellulose. The endoglucanase used in the present invention is not particularly limited, but from the viewpoint of cellulose saccharification efficiency, endoglucanase I (EGI) and endoglucanase II (EGII) derived from the genus Trichoderma are preferable. It may be expressed and used. There are no particular restrictions on the preparation method for expression in a heterologous host, but examples include the methods described in the Examples.

The endoglucanase used in the present invention may be a commercially available cellulase preparation or a product obtained by purifying a cellulase derived from animals, plants, or microorganisms. Although there is no restriction | limiting in particular about the purification method, For example, the method of an Example description is mentioned.
Examples of cellulases to be purified include cellulase preparations derived from Trichoderma reesei such as Cellcrust 1.5L (Novozymes) and Bacillus sp. KSM-N145 (FERM P-19727). ) line-derived cellulase, or Bacillus sp. (Bacillus sp.) KSM-N252 (FERM P-17474), Bacillus sp. (Bacillus sp.) KSM-N115 (FERM P-19726), Bacillus sp. (Bacillus sp.) KSM- N440 (FERM P-19728), Bacillus sp (Bacillus sp.) KSM-N659 (FERM P-19730) cellulase from each strain, such as, more Trichoderma viride (Trichoderma viride), Aspergillus Akureatasu (Aspergillus acleatus), Clostridium thermocellum (Clostridium thermocellum), Clostridium stercorarium (Clostridium stercorarium), Clostridium josui Clostridium josui) Cellulomonas Fimi (Cellulomonas fimi), Acremonium cell Lori caustics (Acremonium cellulolyticus), Irupekkusu Rakuteusu (Irpex lacteus), Aspergillus niger (Aspergillus niger), Humicola insolens (Humicola insolens) derived cellulase mixtures and Pyrococcus horikoshii (Pyrococcus horikoshii ) derived thermostable cellulase. Among these, preferably a cellulase derived from Trichoderma reesei , Trichoderma viride , or Humicola insolens , such as Cell Crust 1.5L (Novozymes), TP-60 (Meiji Seika Co., Ltd.) Company) or Ultraflo L (Novozymes).

[Other enzymes]
The enzyme compounding agent used in the present invention may contain an enzyme other than endoglucanase. However, from the viewpoint of improving the efficiency of the saccharification treatment, those containing one or more enzymes selected from the group consisting of cellobiohydrolase, hemicellulase, and β-glucosidase are preferred.
Further, in order to efficiently produce glucose, it is known that β-glucosidase that degrades cellobiose produced by the action of cellobiohydrolase needs to be added or enhanced, but it is used in the present invention. If it is an enzyme compounding agent, glucose can be efficiently produced even without β-glucosidase.
Cellobiohydrolase is a type of cellulase, an enzyme that mainly breaks down cellulose to produce the disaccharide cellobiose. Cellobiohydrolase I (CBHI) and cellobiohydrolase II (CBHII) are two types. Are known.
Cellobiohydrolase is a commercially available cellulase preparation similar to endoglucanase, or purified cellulase derived from animals, plants, or microorganisms, and the purification method is not particularly limited. For example, the method described in the Examples Can be mentioned.

Hemicellulase is an enzyme that degrades hemicellulose and includes xylanase, mannanase and the like.
The hemicellulase to be used is not particularly limited, and commercially available preparations and those derived from animals, plants and microorganisms are used. For example, a xylanase derived from Bacillus sp. KSM-N546 (FERM P-19729) is used. in addition, Aspergillus niger (Aspergillus niger), Trichoderma viride (Trichoderma viride), Humicola insolens (Humicola insolens), Bacillus alcalophilus (Bacillus alcalophilus) derived from a xylanase, further Thermomyces (Thermomyces), Ou Leo bus Shijiumu (Aureobasidium), Streptomyces (Streptomyces), Clostridium (Clostridium), Thermotoga (Thermotoga), Thermoascus (Thermoascus), Karudoseramu (Caldocellum), thermo mono Supora (Thermomonospora) genus xylanase like from like. An enzyme having hemicellulase activity contained in the cellulase mixture can also be used.

β-Glucosidase is a kind of cellulase and is an enzyme that decomposes cellobiose and finally produces glucose.
The β-glucosidase to be used is not particularly limited, and commercially available preparations, those derived from animals, plants and microorganisms are used. For example, an enzyme derived from Aspergillus niger (for example, β-glucosidase manufactured by Megazyme) and Agrobacterium (Agrobacterium), Thermotoga maritima (Thermotoga maritima), Trichoderma reesei (Trichoderma reesei), Penicillium Emerusonii (Penicillium emersonii) include enzymes such as the origin.

The reaction conditions for saccharifying cellulose with the above-mentioned specific enzyme compounding agent can be appropriately selected depending on the crystallinity of cellulose, the specific surface area, the molecular weight, and the components in the enzyme compounding agent to be used.
The pH for the saccharification treatment is preferably selected according to the type of enzyme used, preferably pH 2 to 10, more preferably pH 3 to 7, still more preferably pH 4 to 6, and still more preferably around pH 5 ( pH 4.7-5.3).
The treatment temperature for the saccharification treatment is preferably selected according to the type of enzyme used, preferably 10 to 90 ° C., more preferably 20 to 70 ° C., still more preferably 35 to 60 ° C., and still more preferably 45. ~ 55 ° C.
The treatment time for the saccharification treatment is preferably 5 to 168 hours, more preferably 24 to 120 hours, and still more preferably 48 to 96 hours.

When using an enzyme compounding agent containing 20% or more of endoglucanase in the total protein content of the enzyme compounding agent and using cellulose having a crystallinity of 50% or less derived from pulp and / or a specific surface area of 180 m ² / g or more as a substrate Add 0.5% to 20% (w / v) of the substrate suspension with the enzyme compounding agent so that the protein is 0.00017-2.5% (w / v), and the pH is 2-10. (It is preferable to select an appropriate pH depending on the type of enzyme used. When 1.5 liters of cell crust is used, it is more preferably pH 3-7, still more preferably pH 4-6, and even more preferably around pH 5 (pH 4.7-5). .3)), a reaction temperature of 10 to 90 ° C. (preferably an appropriate temperature is selected depending on the type of enzyme used. Properly it is 35 ~ 60 ° C., even more preferably be saccharification treatment under the condition of 45 ~ 55 ℃), from the viewpoint of efficiently obtaining a sugar.

In relation to the above-described embodiment, the present invention discloses the following sugar production method [1].
[1] Cellulose type I crystallinity represented by the following formula (1) is 50% or less, preferably 40% or less, more preferably 30% or less, more preferably 15% or less, still more preferably 10% or less, more preferably 0% type I crystal is not detected by the analysis, and / or a specific surface area of 180 m ² / g or more, preferably 180 m ² / g or more 500 meters ² / g or less, more preferably 200 meters ² / g or more 500 meters ² / g or less, more preferably 250 meters ² / g or more 500 meters ² / g or less, more preferably 270 meters ² / g or more 500 meters ² / g or less, more preferably cellulose enzyme formulation is less than 290 m ² / g or more 500 meters ² / g A method for producing a sugar that is saccharified with an agent,
The enzyme compounding agent contains endoglucanase in an amount of 20% or more, preferably 25 to 100%, more preferably 33 to 90%, still more preferably 50 to 90% of the total protein content of the enzyme compounding agent. Cellulose is a method for producing sugar, obtained by pulverizing a cellulose-containing raw material with a pulverizer.
Cellulose type I crystallinity (%) = [(I _22.6 -I _18.5 ) / I _22.6 ] × 100 (1)
[I _22.6 is the diffraction intensity of the grating plane (002 plane) (diffraction angle 2θ = 22.6 °) in X-ray diffraction, and I _18.5 is the diffraction intensity of the amorphous portion (diffraction angle 2θ = 18.5 °). ]

The present invention preferably further includes the following sugar production methods [2] to [12].
[2] The molecular weight of the cellulose is 130,000 or less, more preferably 1000 or more and 130,000 or less, more preferably 1000 or more and 110,000 or less, more preferably 1000 or more and 90,000 or less, still more preferably 1000 or more and 70,000 or less, and still more preferably. The method for producing a saccharide according to the above [1], wherein is from 1,000 to 50,000.
[3] The method for producing sugar according to [1] or [2] above, wherein the pulverizer is a medium pulverizer.
[4] The method for producing sugar according to any one of [1] to [3] above, wherein the cellulose-containing raw material is subjected to an alkali treatment before the saccharification treatment, more preferably an alkali treatment before the pulverization treatment.
[5] The method for producing sugar according to [4], wherein the alkali treatment is an immersion treatment using an alkaline solution.
[6] The sugar according to any one of [1] to [5], wherein the endoglucanase is at least one selected from Trichoderma-derived endoglucanase I (EGI) and endoglucanase II (EGII). Production method.
[7] The sugar composition according to any one of [1] to [6], wherein the enzyme compounding agent further contains one or more selected from the group consisting of cellobiohydrolase, hemicellulase, and β-glucosidase. Production method.
[8] The method for producing a saccharide according to any one of [1] to [7], wherein the enzyme compounding agent further contains cellobiohydrolase and / or hemicellulase as an enzyme and does not contain β-glucosidase. .
[9] The above saccharification treatment temperature is 10 to 90 ° C., more preferably 20 to 70 ° C., still more preferably 35 to 60 ° C., and still more preferably 45 to 55 ° C. ] The manufacturing method of the saccharide | sugar in any one of.
[10] The saccharification treatment according to any one of [1] to [9] above, wherein a treatment time of the saccharification treatment is 5 to 168 hours, more preferably 24 to 120 hours, and still more preferably 48 to 96 hours. Production method.
[11] The above [1] to [10], wherein the cellulose-containing raw material is at least one selected from the group consisting of pulps, papers, plant stems / leaves / fruit bunches, plant shells, and woods. ] The manufacturing method of the saccharide | sugar in any one of.
[12] In the cellulose-containing raw material, the cellulose content in the remaining components excluding water from the raw material is 20% by mass or more, more preferably 20% by mass or more and 99% by mass or less, and further preferably 40% by mass or more. The method for producing a saccharide according to any one of the above [1] to [11], which is 99% by mass or less, more preferably 60% by mass or more and 99% by mass or less.

The present invention further discloses a method for increasing the production amount of glucose described in [13] below.
[13] The cellulose I type crystallinity represented by the following calculation formula (1) is 50% or less, preferably 40% or less, more preferably 30% or less, more preferably 15% or less, still more preferably 10% or less, more preferably 0% type I crystal is not detected by the analysis, and / or a specific surface area of 180 m ² / g or more, preferably 180 m ² / g or more 500 meters ² / g or less, more preferably 200 meters ² / g or more 500 meters ² / g or less, more preferably 250 meters ² / g or more 500 meters ² / g or less, more preferably 270 meters ² / g or more 500 meters ² / g or less, more preferably cellulose enzyme formulation is less than 290 m ² / g or more 500 meters ² / g A method for increasing the amount of glucose produced by saccharification with an agent,
The enzyme compounding agent contains endoglucanase in an amount of 20% or more, preferably 25 to 100%, more preferably 33 to 90%, still more preferably 50 to 90% of the total protein content of the enzyme compounding agent. Cellulose is a method of increasing the amount of glucose produced by pulverizing a cellulose-containing raw material with a pulverizer.
Cellulose type I crystallinity (%) = [(I _22.6 -I _18.5 ) / I _22.6 ] × 100 (1)
[I _22.6 is the diffraction intensity of the grating plane (002 plane) (diffraction angle 2θ = 22.6 °) in X-ray diffraction, and I _18.5 is the diffraction intensity of the amorphous portion (diffraction angle 2θ = 18.5 °). ]

The X-ray diffraction intensity, water content, specific surface area, average molecular weight, and cellulose content of the mechanically treated cellulose-containing raw material were measured by the methods described below. Moreover, the saccharification reaction of various celluloses such as pulverized pulp or powdered pulp was performed under the conditions described below.
(1) Measurement of X-ray diffraction intensity X-ray diffraction intensity was measured using the “Rigaku RINT 2500VC X-RAY diffractometer” manufactured by Rigaku Corporation under the following conditions, and based on the above formula (1), cellulose type I Crystallinity was calculated.
The measurement conditions were X-ray source: Cu / Kα-radiation, tube voltage: 40 kv, tube current: 120 mA, measurement range: 2θ = 5 to 45 °. The measurement sample was prepared by compressing a pellet having an area of 320 mm 2 × thickness 1 mm. The X-ray scan speed was measured at 10 ° / min.
(2) Measurement of water content The water content was measured at 150 ° C. using an infrared moisture meter (“FD-610” manufactured by Kett Science Laboratory Co., Ltd.).
(3) Measurement of specific surface area The specific surface area of cellulose was measured by a water vapor adsorption method. The raw material was vacuum degassed at 80 ° C. for 8 hours, adsorption temperature: 298.15 K, saturated vapor pressure: 3.169 kpa, adsorbate: pure, adsorbate cross section: 0.125 nm ² The isotherm was measured. The specific surface area was calculated by the BET method.
(4) Measurement of average molecular weight The degree of polymerization of cellulose was measured by the copper ammonia method described in ISO-4312 method. And what multiplied the molecular weight 162 of glucose to the polymerization degree of this cellulose was made into the average molecular weight of a cellulose.
(5) Measurement of cellulose content The raw material was subjected to Soxhlet extraction with ethanol / benzene mixed solvent (1: 1) for 6 hours, and further subjected to Soxhlet extraction with ethanol for 4 hours, and the sample after extraction was vacuum-dried at 60 ° C. To 2.5 g of the obtained sample, 150 mL of water, 1.0 g of sodium chlorite and 0.2 mL of acetic acid were added and heated at 70-80 ° C. for 1 hour. Subsequently, the operation of adding sodium chlorite and acetic acid and heating was repeated, and the treatment was repeated 3 to 4 times until the sample turned white. The white residue is filtered through a glass filter (1G-3), washed with cold water and acetone, and then dried at 105 ° C. until a constant weight is obtained. The residue weight is obtained, and the cellulose content (from the cellulose-containing raw material to The cellulose content in the remaining components excluding) was calculated.
Cellulose content (mass%) = [residue weight (g) / dry weight of raw material corresponding to 2.5 g of degreased sample (g)] × 100

(6) Saccharification reaction Various cellulose substrates such as 0.05 g of powdered pulp or pulverized pulp were mixed with 1 mL of enzyme reaction solution (100 mM citrate buffer (pH 5.0), screw tube with lid (No. 5, φ27 × 55 mm, And a suitable amount of enzyme was added and reacted at 50 ° C. with shaking and stirring (150 rpm, constant temperature shaker “BR-15CF” manufactured by Taitec Co., Ltd.) for a predetermined time. The precipitate and the supernatant were separated by centrifugation (17,000 × g, 5 minutes), and the amount of reducing sugar released into the supernatant was quantified by the HPLC method shown below.
(7) Determination of sugar by HPLC method Dionex DX500 chromatography system; column: CarboPac PA1 (Dionex 4 × 250 mm), detector: ED40 pulsed amperometric detector, eluent: A solution; 100 mM sodium hydroxide Solution, solution B: 100 mM sodium hydroxide solution containing 1 M sodium acetate, solution C; ultrapure water was used. From the injection, sugars were analyzed with a linear gradient of 10% initial concentration A solution: 90% C solution, 0 to 15 minutes, A solution 95%: B solution 5%. 0.01% (w / v) glucose (made by Wako Pure Chemical Industries), xylose (made by Wako Pure Chemical Industries), xylobiose (made by Wako Pure Chemical Industries), cellobiose (made by Seikagaku Corporation) as standard Was used.
(8) Protein quantification Using a DC protein assay kit (manufactured by Bio Rad), the protein amount was calculated from a calibration curve using bovine serum albumin as a standard protein.
(9) SDS-polyacrylamide gel electrophoresis (SDS-PAGE)
SDS-PAGE is performed at 20 mA / gel using Ready Gel J-12.5% (BioRad) according to the method of Laemmli (UK Laemmli, Nature, 227, 680-685, 1970). Electrophoresis was performed for about 90 minutes. The marker was SDS-PAGE Standard Low (manufactured by Bio-Rad), and the staining after electrophoresis was Bio-Safe Coomasie (manufactured by Bio-Rad).
(10) Confirmation of purified or prepared enzyme Cellobiohydrolase I (CBHI), endoglucanase I (EGI), endoglucanase II (EGII), cellobiohydrolase II (CBHII) and heterogeneous purified from 1.5 L of cell crust Expressed EGI is the respective enzymes (Endoglucanase EG-1 (P07981), EG2: Endoglucanase EG-II (P07982), CBH1: UniProtKB / Swiss-Prot (http://au.expasy.org/sprot/). It confirmed by comparing with the molecular weight and partial amino acid sequence of Exoglucanase 1 (P62694), CBH2: Exoglucanase 2 (P07987)).

Various proteins used in Examples and Comparative Examples were obtained by purification and preparation as follows. In the following description, those manufactured by Wako Pure Chemical Industries, Ltd. were used unless otherwise specified.
(1) Purification of cellobiohydrolase I (CBHI) The following operation was performed at 10 ° C. or lower. Cell crust 1.5L (manufactured by Novozymes) was diluted 2-fold with deionized water, and then diluted to 10 mM acetate buffer (pH 5.0) using a desalting column Econo-Pac 10DG column (manufactured by Bio-Rad). Replacement was performed. 100 mL of the obtained enzyme solution was applied to an anion exchanger (a) SuperQ Toyopearl 650M (φ2.5 cm × 25 cm, manufactured by Tosoh Corporation) previously equilibrated with 10 mM acetate buffer (pH 5.0), and 250 mL of the same buffer was used. After washing the column with the solution, linear concentration gradient elution with 2000 mL of 0 to 0.3 M sodium chloride was performed.
The adsorbed fraction adsorbed on the anion exchanger (a) was concentrated to 19 mL with a UF membrane (PBCC molecular weight cut off: 5000, manufactured by Millipore). 3 mL of the concentrated adsorption fraction was subjected to gel filtration using “Sephaacryl S200HR (φ2.5 cm × 100 cm, manufactured by GE Science)”. Concerning the eluted fraction, the pass fraction that was confirmed to be almost single by SDS-PAGE was concentrated using a UF membrane, and replaced with 10 mM citrate buffer (pH 5.0) on a desalting column. Cellobiohydrolase I (CBHI) was obtained.

(2) Purification of endoglucanase I (EGI) The pass fraction that passed through the anion exchanger (a) was concentrated to 50 mL using a UF membrane, and subsequently with 10 mM acetate buffer (pH 5.0). Equilibrated cation exchanger (b) SP Toyopearl 650M (φ2.5 cm × 26 cm, manufactured by Tosoh Corporation) was used. After washing the inside of the column with 300 mL of the same buffer, linear concentration gradient elution was performed with 1500 mL of 0 to 0.3 M sodium chloride.
The pass fraction passed through the cation exchanger (b) was concentrated using a UF membrane, and then replaced with 20 mM Tris hydrochloride buffer (pH 7.8) using a desalting column. 40 mL of this pass fraction was applied to an anion exchanger (c) SuperQ Toyopearl 650M (φ2.5 cm × 25 cm) equilibrated with the same buffer, and the inside of the column was washed with 250 mL of the same buffer. A linear concentration gradient elution was performed with 2000 mL of sodium chloride.
The adsorbed fraction adsorbed on the anion exchanger (c) was pooled and concentrated to 12 mL with a UF membrane. 12 mL of the concentrated adsorption fraction was subjected to gel filtration using “Sephacryl S200HR (φ2.5 cm × 100 cm, manufactured by GE Science)”. About the eluted fraction, the fraction that was confirmed to be almost single by SDS-PAGE was concentrated using a UF membrane, and replaced with 10 mM citrate buffer (pH 5.0) on a desalting column. Endoglucanase I (EGI) was obtained.

(3) Purification of endoglucanase II (EGII) The pass fraction passed through the anion exchange column (c) was concentrated with a UF membrane, and replaced with 10 mM acetate buffer (pH 4.5) with a desalting column. did. 16 mL of this pass fraction was applied to a cation exchanger (d) SP Toyopearl 650M (φ2.5 cm × 26 cm) equilibrated with the same buffer, and the inside of the column was washed with 300 mL of the same buffer. A linear gradient elution with 1000 mL of 1M sodium chloride was performed. Concerning the eluted fraction, the pass fraction that was confirmed to be almost single by SDS-PAGE was concentrated on a UF membrane and replaced with 10 mM citrate buffer (pH 5.0) on a desalting column. Endoglucanase II (EGII) was obtained.

(4) Purification of cellobiohydrolase II (CBHII) The adsorbed fraction adsorbed on the cation exchange column (d) is concentrated on a UF membrane and 10 mM citrate buffer (pH 5.0) on a desalting column. ) To obtain cellobiohydrolase II (CBHII).

In the total protein amount of the above-mentioned Celcrust 1.5 L, CBHI was 70%, CBHII was 11%, EGI was 4%, and EGII was 5%.

(5) Preparation of heterologous expression endoglucanase I (heterologous expression EGI) The heterologous expression EGI was prepared by the following procedure.
(Synthesis of Trichoderma reesei cDNA)
Trichoderma reesei QM9414 (NBRC31329) was cultured on a PDA agar medium at 28 ° C. for 7 days to sufficiently form spores. One platinum loop of the spore was placed in a liquid medium [0.50% (w / v) KC floc (manufactured by Nippon Paper Chemical Co., Ltd.), 0.14% (w / v) ammonium sulfate, 0.03% (w / v) Urea, 0.25 (w / v) polypeptone S (Nippon Pharmaceutical Co., Ltd.), 0.20 (w / v) monopotassium phosphate, 0.03% (w / v) calcium chloride dihydrate, 0 0.03% (w / v) magnesium sulfate heptahydrate, 5.0 ppm iron sulfide heptahydrate, 1.6 ppm manganese sulfate pentapentahydrate, 1.6 ppm zinc sulfate heptahydrate, 2 0.0 ppm cobalt chloride hexahydrate)] was inoculated into an Erlenmeyer flask with a capacity of 50 mL containing 50 mL, and cultured with shaking at 28 ° C. and 160 rpm for 6 days.
After completion of the culture, total RNA was isolated from the cells obtained by centrifugation (3,000 rpm, 4 ° C., 15 minutes) using TRIzol (registered trademark) Reagent (manufactured by Invitrogen) according to the protocol. Trichoderma reesei cDNA was synthesized from the obtained total RNA using a cDNA Synthesis Kit (M-MLV Version) (TaKaRa) according to the protocol.

[Acquisition of EGI gene fragment]
Primers designed based on the endoglucanase I gene sequence of T. reesei (Taxonomy ID: 51453) published in the swissprot database using the obtained cDNA as a template [forward primer (atggcgccctcagttacactgccg), reverse primer (ttaaaggcattgcgagtagtagtcgtt)] PCR was performed.
Specifically, after mixing 0.5 μL of template cDNA, 0.5 μL of 50 μM forward primer, 0.5 μL of 50 μM reverse primer, 25 μL of PrimeSTAR (registered trademark) Max DNA Polymerase (TaKaRa), and 23.5 μL of sterile deionized water. PCR was performed using DNA Engine PTC-200 (manufactured by MJ Japan). PCR conditions were 98 ° C for 10 seconds, 55 ° C for 5 seconds, 72 ° C for 8 seconds for 30 cycles, and the amplified gene fragment was purified with High Pure PCR Product Purification kit (Roche). did.

[Linkage of EGI gene with amyB promoter and terminator]
Forward primers (SEQ ID NO: 1: gtgaattcgagctcggtaccattacgcactacccgaatcg) designed based on the amyB promoter region using the obtained EGI gene and the PCR fragments derived from the A. oryzae-derived α-amylase gene (amyB) -derived promoter and terminator region as template DNA PCR was performed using a reverse primer (SEQ ID NO: 2: tgattacgccaagcttgagttgtacctagaggagac) designed based on the amyB terminator region.
Specifically, 3.0 μL of each PCR fragment, 0.4 μL of 50 μM forward primer, 0.4 μL of 50 μM reverse primer, 25 μL of PrimeSTAR (registered trademark) Max DNA Polymerase (TaKaRa), and 15.2 μL of sterile deionized water are mixed. After that, PCR was performed with GeneAmp PCR System 9700 (manufactured by PE Applied Biosystems). PCR conditions were 98 ° C for 10 seconds, 55 ° C for 5 seconds, and 72 ° C for 20 seconds for 30 cycles, and the amplified gene fragment was purified with High Pure PCR Product Purification kit (Roche). did.

[Plasmid construction and mass preparation]
Hind III and Kpn I were added to a solution containing the pPTRI vector (TaKaRa), and a restriction enzyme reaction was performed overnight at 37 ° C. After inactivating the restriction enzyme at 70 ° C. for 15 minutes, purification was performed with a High Pure PCR Product Purification kit (Roche). The linearized pPTRI vector was mixed with 3 times the ligated EGI fragment (molar ratio) and mixed, and the In-fusion reaction (37 ° C) was performed using In-Fusion ™ Advantage PCR Cloning Kit (Clontech). For 15 minutes and at 50 ° C. for 15 minutes). 40 μL of TE buffer (pH 8.0) was added to the reaction end solution (total amount: 10 μL). The mixture was transformed by adding 50 μL of E. coli competent cell DH5α strain (manufactured by TOYOBO) to 3 μL of this mixed solution, and smeared on LB agar medium (containing 100 ppm ampicillin) supplemented with X-gal and IPTG. Culture was performed for 18 hours. White colonies were picked out of the grown colonies, and plasmid insert check was performed by colony direct PCR using Quick Taq ™ HS DyeMix (TOYOBO). A transformed colony in which a band of the target insert size was confirmed by agarose electrophoresis analysis was inoculated into an LB liquid medium containing 100 ppm ampicillin, and cultured overnight (37 ° C., 120 rpm) using a Sakaguchi flask. It was. The culture solution was centrifuged (6000 × g, 4 ° C., 15 minutes) to recover the bacterial cells, and then the plasmid was extracted and purified using QIAfilter Plasmid Midi Kit (manufactured by QIAGEN).

[Transformation of A. oryzae]
As a transformation host, an A. oryzae RIB40 strain (official name: Aspergillus oryzae (Ahlburg) Cohn var brunneus Murakami) purchased from NITE (NBRC100959) was used. This strain was cultured on a PDA agar plate medium at 25 ° C. for 7 days and then subcultured on a PDA slant medium at 25 ° C. for 7 days. The strain was refrigerated and used as a host for transformation. Using the A. oryzae RIB40 strain as a host, transformation with the constructed plasmid was carried out, and the cells were cultured at 30 ° C. for 7 days using a regeneration CD agar medium containing 0.2 ppm pyrithiamine. The transformed colonies that had grown on the CD agar medium were subcultured twice on a CD agar medium at 30 ° C. for 7 days.

[Liquid culture of A. oryzae transformed strain]
A. oryzae transformed strain was inoculated on a CD agar medium with a platinum loop and cultured at 30 ° C. for 5-7 days, and then a spore suspension was prepared. After measuring the spore concentration using a hematitometer (Thoma hemocytometer), about 5 × 10 ⁵ spores were added to 50 mL of liquid medium [5% (w / v) Polypeptone S (manufactured by Nippon Pharmaceutical), 2 0.5% (w / v) yeast extract (Difco), 0.5% (w / v) monopotassium phosphate, 0.05% (w / v) magnesium sulfate heptahydrate, 10% ( w / v) maltose) was used, and a 500 mL baffled flask was used and cultured with shaking at a culture temperature of 30 ° C. and a rotation speed of 150 rpm for about 5 days. In this manner, a culture solution for 700 mL was finally prepared.

[Purification of heterologous EGI from culture medium]
700 mL of the filtered solution (pore size 0.45 μm, manufactured by NALGENE) was concentrated to 200 mL with a flat membrane (Polyethersulfone, 76 mm, 30,000 cutoff, manufactured by Millipore), and further a centrifugal filter Amicon Ultra (30,000 cutoff, manufactured by Millipore) To 15 mL. 15 mL of this concentrated solution was replaced with 10 mM acetate buffer (pH 5.0) using a desalting column Econo-Pac 10DG column (manufactured by Bio-Rad). 5 mL of the obtained enzyme solution was subjected to an anion exchanger DEAE-650M (φ1.46 cm × 3 cm, manufactured by Tosoh Corporation) previously equilibrated with 10 mM acetate buffer (pH 5.0), and 15 mL of the same buffer solution. The column was washed with a linear gradient elution with 40 mL of 0-0.5 M sodium chloride. The pass fraction that passed through the anion exchanger was replaced with a 10 mM citrate buffer (pH 5.0) using a desalting column to obtain heterologous expression endoglucanase I (heterologous expression EGI).

Production Examples 1-6
[Shredder treatment]
Sheet wood pulp (“Boreregard,“ Blue Bear Ultra Ether ”, 800 mm × 600 mm × 1.5 mm, cellulose content 96% by mass, moisture content 7% by mass), shredder (manufactured by Meiko Shosha,“ MSX2000-IVP440F ”) )) To obtain chip-like pulp of about 10 mm × 5 mm × 1.5 mm.

[Vibration mill treatment]
100 g of the obtained chip-like pulp was put into a vibration mill (manufactured by Chuo Kako Co., Ltd., “MB-1”, container total capacity 3.5 L), and as a rod, diameter 30 mm, length 218 mm, material stainless steel, cross-sectional shape Thirteen circular rods were filled into a vibration mill (filling rate 57%) and treated for 0.5 to 8 hours under the conditions of an amplitude of 8 mm and a circular rotation of 1200 cpm to obtain pulps A to F. Table 1 shows the crystallinity, specific surface area, and molecular weight of the obtained pulp.

Comparative production example 1
Chip-like pulp obtained in the same manner as in Production Examples 1 to 6 was charged into a twin-screw extruder (“EA-20” manufactured by Suehiro EPM Co., Ltd.) at 2 kg / hr, a shear rate of 660 sec ⁻¹ , and a screw rotation speed of 300 rpm. Then, a one-pass treatment was performed while flowing cooling water from the outside. The twin-screw extruder is a fully meshing type co-rotating twin-screw extruder, and the screws arranged in two rows are combined with a screw portion having a screw diameter of 40 mm and 12 blocks alternately (90 °). The two screws have the same configuration. Table 1 shows the crystallinity, specific surface area, and molecular weight of the obtained pulp G.

Production Example 7
Powdered pulp (“W-400G” manufactured by Nippon Paper Chemical Co., Ltd., 400 mesh pass 90 or more, cellulose content 99% by mass, moisture content 1% by mass) (pulp H) is a medium agitated mill (Attritor, Mitsui Mining Co., Ltd.) Made of “MA1D-X”, total volume of container: 5.5 L), filled with attritor (diameter: 10 mm, material: zirconia, zirconia balls: 11 kg, filling rate: 59%), rotation speed: 307 rpm The pulp I was obtained by performing the treatment for 2 hours under the conditions. Table 2 shows the crystallinity, specific surface area, and molecular weight of pulp H before pulverization and pulp I after pulverization.

Examples 1-6
The pulps A to F obtained in Production Examples 1 to 6 were subjected to a saccharification reaction using an enzyme preparation composed of endoglucanase I (EGI). Specifically, 0.05 g of pulp A to F was suspended in 1 mL of an enzyme reaction solution (enzyme preparation corresponding to 100 mM citrate buffer (pH 5.0), protein 0.005% (w / v)), and 50 The enzyme reaction was performed for 5 hours, 24 hours, 48 hours, and 70 hours with shaking and stirring at ° C. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 3.

Comparative Examples 1 to 3
The pulp G obtained in Comparative Production Example 1 was subjected to a saccharification reaction with an enzyme preparation consisting of Cellcrust 1.5L (manufactured by Novozymes), cellobiohydrolase I (CBHI), and endoglucanase I (EGI). In the same manner as in Examples 1 to 6, the amount of glucose after completion of the reaction was quantified. The results are shown in Table 3.

Comparative Examples 4-15
The pulps A to F obtained in Production Example 1 were subjected to a saccharification reaction using an enzyme preparation consisting of Celclast 1.5 L (manufactured by Novozymes) and cellobiohydrolase I (CBHI). In the same manner as in ˜6, the amount of glucose after completion of the reaction was quantified. The results are shown in Table 3.

Examples 7-9
The pulp C obtained in Production Example 3 was subjected to a saccharification reaction using an enzyme preparation composed of endoglucanase I (EGI), endoglucanase II (EGII), and heterologous expression endoglucanase I (heterologous expression EGI). Specifically, 0.05 g of pulp C is suspended in 1 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), enzyme preparation equivalent to 0.005% (w / v) protein) at 50 ° C. The enzyme reaction was performed for 5 hours, 24 hours, 48 hours and 72 hours with shaking and stirring. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 4.

Comparative Examples 16-18
The saccharification of the pulp C obtained in Production Example 3 with an enzyme preparation composed of Celclast 1.5 L (manufactured by Novozymes), cellobiohydrolase I (CBHI), and cellobiohydrolase II (CBHII), respectively. The reaction was carried out in the same manner as in Examples 7 to 9, and the amount of glucose after completion of the reaction was quantified. The results are shown in Table 4.

Examples 10-15
The pulp D obtained in Production Example 4 was subjected to a saccharification reaction using an enzyme preparation combining endoglucanase I (EGI) and Cellcrust 1.5 L (manufactured by Novozymes). Specifically, 0.05 g of pulp D was added to 1 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), EGI equivalent to 0.00125 to 0.00417% (w / v) protein and 0.00083 to The suspension was suspended in a cell crust equivalent to 0.00375% (w / v) (1.5 L), and the enzyme reaction was carried out for 6 hours, 24 hours, 48 hours and 72 hours with shaking and stirring at 50 ° C. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 5.

Examples 16-21
The pulp D obtained in Production Example 4 was subjected to a saccharification reaction using an enzyme preparation combining endoglucanase I (EGI) and cellobiohydrolase I (CBHI). Specifically, 0.05 g of pulp D was added to 1 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), EGI equivalent to 0.00125 to 0.00417% (w / v) protein and 0.00083 to The enzyme reaction was carried out for 6 hours, 24 hours, 48 hours and 72 hours with shaking and stirring at 50 ° C. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 5.

Examples 22-27
The pulp D obtained in Production Example 4 was subjected to a saccharification reaction using an enzyme preparation combining heterologous expression endoglucanase I (heterologous expression EGI) and Cellcrust 1.5L (manufactured by Novozymes). Specifically, 0.05 g of pulp D was added to 1 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), 0.00125 to 0.0045% (w / v) of protein equivalent to EGI and 0. The suspension was suspended in 0005 to 0.00375% (w / v) equivalent to 1.5 L of Celcrust), and the enzyme reaction was performed for 6 hours, 24 hours, 48 hours and 72 hours with shaking and stirring at 50 ° C. . After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 5.

Examples 28-33
The pulp D obtained in Production Example 4 was subjected to a saccharification reaction using an enzyme preparation combining heterologous endoglucanase I (heterologous expression EGI) and cellobiohydrolase I (CBHI). Specifically, 0.05 g of pulp D was added to 1 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), 0.00125 to 0.0045% (w / v) of protein equivalent to EGI and 0. The suspension was suspended in CBHI (corresponding to 0005 to 0.00375% (w / v)), and the enzyme reaction was carried out at 50 ° C. with shaking and stirring for 6 hours, 24 hours, 48 hours and 72 hours. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 5.

Comparative Examples 19-20
The pulp D obtained in Production Example 4 was subjected to a saccharification reaction using an enzyme preparation composed of Cellcrust 1.5 L (manufactured by Novozymes) and cellobiohydrolase I (CBHI). Specifically, 0.05 g of pulp D was suspended in 1 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), enzyme preparation equivalent to 0.005% (w / v) protein) at 50 ° C. The enzyme reaction was performed for 6 hours, 24 hours, 48 hours, and 72 hours with shaking and stirring. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 5.

Example 34
For the pulp D obtained in Production Example 4, a saccharification reaction with an enzyme preparation comprising a combination of endoglucanase I (EGI), Cellcrust 1.5 L (manufactured by Novozymes), and xylanase M1 (XYN, produced by Megazymes) Went. Specifically, 0.05 g of pulp D was added to 1 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), EGI equivalent to 0.00113% (w / v) protein, 0.00338% (w / v) protein. ) Corresponding cell crust 1.5 L and protein 0.0005% (w / v) XYN) suspended at 50 ° C. with shaking and stirring, reaction time 6 hours, 24 hours, 48 hours and 72 hours enzyme Reaction was performed. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC.

Example 35
The pulp D obtained in Production Example 4 is subjected to a saccharification reaction with an enzyme preparation comprising a combination of endoglucanase I (EGI), cellobiohydrolase I (CBHI), and xylanase M1 (XYN, manufactured by Megazymes). It was. Specifically, 0.05 g of pulp D was added to 1 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), EGI equivalent to 0.0036% (w / v) protein, 0.0009% (w / v) protein. ) Corresponding CBHI and XYN corresponding to 0.0005% (w / v) of protein), and the enzyme reaction was performed for 6 hours, 24 hours, 48 hours and 72 hours with shaking and stirring at 50 ° C. . After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 6.

Example 36
The pulp D obtained in Production Example 4 was subjected to a saccharification reaction using an enzyme preparation consisting of a combination of endoglucanase I (EGI) and xylanase M1 (XYN, manufactured by Megazymes). Specifically, 0.05 g of pulp D was added to 1 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), EGI equivalent to 0.0045% (w / v) protein and 0.0005% (w / v) protein. ) Suspended in a corresponding amount of XYN), and subjected to an enzyme reaction for 6 hours, 24 hours, 48 hours and 72 hours with shaking and stirring at 50 ° C. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 6.

Comparative Examples 21-23
For the pulp D obtained in Production Example 4, saccharification with an enzyme preparation consisting of Cellclast 1.5 L (manufactured by Novozymes), cellobiohydrolase I (CBHI), and xylanase M1 (XYN, produced by Megazymes), respectively. Reaction was performed. Specifically, 0.05 g of pulp D was suspended in 1 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), enzyme preparation equivalent to 0.005% (w / v) protein) at 50 ° C. The enzyme reaction was performed for 6 hours, 24 hours, 48 hours, and 72 hours with shaking and stirring. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 6.

Examples 37-39
The pulp I obtained in Production Example 7 was subjected to a saccharification reaction using an enzyme preparation consisting of a combination of endoglucanase I (EGI) and cellobiohydrolase I (CBHI). Specifically, 0.15 g of pulp I was added to 3 mL of enzyme reaction solution (100 mM citrate buffer (pH 5.0), EGI corresponding to protein 0.025 to 0.075% (w / v) and protein 0.025 to 0.075% (w / v) equivalent CBHI), and the enzyme reaction was performed for 94 hours with shaking and stirring at 50 ° C. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 7.

Comparative Example 24
A saccharification reaction was performed on pulp H before pulverization using an enzyme preparation composed of 1.5 L of Celcrust (manufactured by Novozymes). Specifically, 0.15 g of pulp H was suspended in 3 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), cell crust 1.5 L equivalent to 0.1% (w / v) protein), and 50 The enzyme reaction was performed for 94 hours with stirring at ℃. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 7.

Comparative Examples 25-27
An enzyme reaction was carried out in the same manner as in Examples 37 to 39 except that the unpulverized pulp H was used in place of the pulp I, and the amount of glucose was quantified after the reaction was completed. The results are shown in Table 7.

Comparative Example 28
An enzyme reaction was carried out in the same manner as in Comparative Example 26 except that the pulp I obtained in Production Example 7 was used instead of the pulp H, and the amount of glucose was quantified after the reaction was completed. The results are shown in Table 7.

Example 40
The pulp I obtained in Production Example 7 was subjected to a saccharification reaction using an enzyme preparation consisting of a combination of endoglucanase II (EGII) and cellobiohydrolase I (CBHI). Specifically, 0.15 g of pulp I was added to 3 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), EGII equivalent to 0.0125% (w / v) protein and 0.0125% (w / v) protein. ) Suspended in a corresponding amount of CBHI), and subjected to an enzyme reaction for 6 hours, 24 hours, 48 hours and 72 hours while shaking and stirring at 50 ° C. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 8.

Comparative Example 29
The pulp I obtained in Production Example 7 was subjected to a saccharification reaction using an enzyme preparation consisting of 1.5 L of Celcrust (manufactured by Novozymes). Specifically, 0.15 g of pulp I was suspended in 3 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), cell crust 1.5 L equivalent to 0.025% (w / v) protein), and 50 The enzyme reaction was performed for 6 hours, 24 hours, 48 hours, and 72 hours with shaking and stirring at 0 ° C. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 8.

Examples 41-44
Combination of Celcrust 1.5L (manufactured by Novozymes), endoglucanase I (EGI), cellobiohydrolase I (CBHI) and xylanase M1 (XYN, manufactured by Megazymes) with respect to pulp D obtained in Production Example 4 A saccharification reaction was carried out using an enzyme preparation comprising: Specifically, 0.05 g of pulp D was added to 1 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), cell crust 1.5 L corresponding to protein 0.00338 to 0.00375% (w / v), protein EGI equivalent to 0.00113-0.0036% (w / v), CBHI equivalent to 0.0009% (w / v) protein and XYN equivalent to 0.0005% (w / v) protein) The enzyme reaction was performed for 168 hours while stirring at ℃. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of sugar released into the supernatant (total amount of glucose, cellobiose, xylose and xylobiose) was quantified by HPLC. The results are shown in Table 9.

Comparative Example 30
The pulp D obtained in Production Example 4 was subjected to a saccharification reaction using an enzyme preparation composed of 1.5 L of Celcrust (manufactured by Novozymes). Specifically, 0.05 g of pulverized pulp is suspended in 1 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), 1.5 C of cell crust equivalent to 0.005% (w / v) protein), The enzyme reaction was performed for 168 hours while stirring at 50 ° C. with shaking. After completion of the reaction, the precipitate and the supernatant were separated by centrifugation, and the amount of sugar released into the supernatant (total amount of glucose, cellobiose, xylose and xylobiose) was quantified by HPLC. The results are shown in Table 9.

Production Example 8
[Alkali treatment]
1 g of sugarcane bagasse (cellulose content: 71.3% by mass, water content: 50% by mass) was stirred in 100 ml of 5N sodium hydroxide for 3 hours. After neutralization with acetic acid, the product was washed with water three times and freeze-dried to obtain a freeze-dried product.
[Vibration mill treatment]
100 g of the obtained freeze-dried product was put into a vibration mill (Chuo Kako Co., Ltd., “MB-1”, container total capacity 3.5 L), and the rod had a diameter of 30 mm, a length of 218 mm, a stainless steel material, and a cross-sectional shape. Thirteen circular rods were filled into a vibration mill (filling rate 57%) and processed for 1 hour under the conditions of an amplitude of 8 mm and a circular rotation of 1200 cpm to obtain bagasse a. The crystallinity of the resulting bagasse a was 0%.

Example 45, Comparative Examples 31 and 32
Bagasse a obtained in Production Example 8 was subjected to saccharification treatment with an enzyme preparation consisting of endoglucanase I (EGI), Cellcrust 1.5L (manufactured by Novozymes), and cellobiohydrolase (CBHI). . Specifically, 0.5 g of bagasse a is suspended in 1 mL of an enzyme reaction solution (100 mM citrate buffer (pH 5.0), enzyme preparation equivalent to 0.005% (w / v) protein) at 50 ° C. The enzyme reaction was performed for 1 hour with shaking and stirring. After completion of the reaction, the precipitate and the supernatant were separated using a centrifuge, and the amount of glucose released into the supernatant was quantified by HPLC. The results are shown in Table 10.

As described above, it can be seen that the sugar production method of the example can produce sugar more efficiently than the method of the comparative example. In particular, it can be seen that the amount of glucose produced is significantly increased.

The sugar production method of the present invention is excellent in productivity and can efficiently obtain sugar (particularly glucose). The obtained sugar is useful for production of fermentation such as ethanol and lactic acid.

Claims (13)

1. A cellulose production method for saccharifying a cellulose having a cellulose I type crystallinity of 50% or less and / or a specific surface area of 180 m ² / g or more represented by the following formula (1) with an enzyme compounding agent,
   The enzyme compounding agent contains endoglucanase in an amount of 20% or more of the total protein content of the enzyme compounding agent, and the cellulose is a method for producing sugar obtained by pulverizing a cellulose-containing raw material with a pulverizer.
   Cellulose type I crystallinity (%) = [(I _22.6 -I _18.5 ) / I _22.6 ] × 100 (1)
   [I _22.6 is the diffraction intensity of the grating plane (002 plane) (diffraction angle 2θ = 22.6 °) in X-ray diffraction, and I _18.5 is the diffraction intensity of the amorphous portion (diffraction angle 2θ = 18.5 °). ]
2. The method for producing sugar according to claim 1, wherein the molecular weight of the cellulose is 130,000 or less.
3. The method for producing sugar according to claim 1 or 2, wherein the pulverizer is a medium pulverizer.
4. The method for producing sugar according to any one of claims 1 to 3, wherein the cellulose-containing raw material is alkali-treated before the saccharification treatment.
5. The method for producing sugar according to claim 4, wherein the alkali treatment is an immersion treatment using an alkaline solution.
6. The method for producing a sugar according to any one of claims 1 to 5, wherein the endoglucanase is at least one selected from Trichoderma-derived endoglucanase I (EGI) and endoglucanase II (EGII).
7. The method for producing a sugar according to any one of claims 1 to 6, wherein the enzyme compounding agent further contains one or more selected from the group consisting of cellobiohydrolase, hemicellulase, and β-glucosidase.
8. The method for producing a sugar according to any one of claims 1 to 7, wherein the enzyme compounding agent further contains cellobiohydrolase and / or hemicellulase as an enzyme and does not contain β-glucosidase.
9. The method for producing sugar according to any one of claims 1 to 8, wherein a treatment temperature of the saccharification treatment is 10 to 90 ° C.
10. The method for producing sugar according to any one of claims 1 to 9, wherein the saccharification treatment time is 5 to 168 hours.
11. The cellulose-containing raw material is at least one selected from the group consisting of pulps, papers, plant stems / leaves / fruit bunches, plant shells, and woods. Of sugar production.
12. The method for producing sugar according to any one of claims 1 to 11, wherein the cellulose content in the remaining components of the cellulose-containing raw material excluding water is 20% by mass or more.
13. A method of increasing the amount of glucose produced by saccharifying cellulose having an I-type crystallinity of 50% or less and / or a specific surface area of 180 m ² / g or more represented by the following formula (1) with an enzyme compounding agent. Because
    The enzyme compound contains 20% or more of endoglucanase in the total protein content of the enzyme compound, and the cellulose increases the amount of glucose produced by pulverizing the cellulose-containing raw material with a pulverizer. Method.
    Cellulose type I crystallinity (%) = [(I _22.6 -I _18.5 ) / I _22.6 ] × 100 (1)
    [I _22.6 is the diffraction intensity of the grating plane (002 plane) (diffraction angle 2θ = 22.6 °) in X-ray diffraction, and I _18.5 is the diffraction intensity of the amorphous portion (diffraction angle 2θ = 18.5 °). ]